Добро пожаловать!
Pages:     | 1 ||

Сравнительный анализ распределения частот геРис. 1. Активность АПФ в сыворотке крови больных ГлПС нотипов полиморфного локуса A1166C гена AGTRв зависимости от тяжести заболевания (% к контролю); * – не выявил статистически значимые различия между статистическая значимость различий с контролем группами больных с различной степенью тяжести Таблица Активность АПФ в сыворотке крови больных ГЛПС различной степени тяжести на фоне базисной лекарственной терапии (мкмоль/лмин) Форма заболевания Период заболевания тяжелая тяжелая среднетяжелая без осложнений с осложнениями лихорадочный 12,4 [8,8; 18,2] 9,7 [1,1; 14,1] 49,0 [42,4; 50,3] р>0,07 р>0,06; р1>0,9 р<0,002; р2<0,006; р3<0,олиго- 36,2 [28,2;54,7] 28,2 [21,2; 47,7] 50,8 [45,9; 63,5] анурический р<0,006 р<0,019; р1>0,38 р<0,003; р2<0,03; р3<0,полиурический 55,0 [35,3; 71,5] 60,9 [50,6; 77,6] 59,2 [45,9; 70,6] р<0,0006 р<0,0002; р1>0,2 р<0,0001; р2>0,4; р3>0,восстановленного диуреза 38,0 [34,4; 45,9] 56,5 [44,1; 59,0] 49,4 [42,4; 58,3] р<0,0001 р<0,0004; р1<0,02 р<0,0001; р2<0,03; р3>0,контроль 18,05 [15,0; 21,5] Примечание: р – значимость различий с группой контроля; р1 – значимость различий между среднетяжелой формой и тяжелой формой без осложнений; р2 –значимость различий между среднетяжелой формой и тяжелой формой с осложнениями; р3 – значимость различий между тяжелой формой без осложнений и тяжелой формой с осложнениями.

Таблица Тип полиморфизма, последовательность праймеров и номенклатура аллелей анализируемых полиморфных локусов ген [oMiM], полиморфизм праймеры локализация (аллели) (фермент рестрикции) agtR1 А1166С 5' gcaccatgttttgaggttga 3' [106165] *А1166 - 225 п.о. 5' tgtggctttgctttgtcttg 3' 3q21-q25 *c1166 - (110 п.о.+115 п.о.) (bstdei ) Таблица Распределение частот генотипов и аллелей полиморфного локуса A1166С генома AGTRу больных ГЛПС различной степени тяжести заболевания генотипы аллели форма заболевания *a/*a *a/*С *С/*С *a *С n 84 65 6 233 среднетяжелая pi±Sp, ci% 54,19±4,00 41,94±3,96 3,87±1,55 75,16±2,45 24,84±2,тяжелая без n 54 30 6 138 осложнений pi±Sp, ci% 60,00±5,16 33,33±4,97 6,67±2,63 76,67±3,15 23,33±3,тяжелая с n 32 12 3 76 осложнениями pi±Sp, ci% 68,09±6,80 25,53±6,36 6,38±3,57 80,85±4,06 19,15±4,Примечание: n – абсолютное число генотипов (аллелей); pi – частота; Sp – ошибка pi.;2 – хи квадрат; p – уровень значимости; df – число степеней свободы.

Саратовский научно-медицинский журнал. 2010. том 6. № 1.

BIOCHeMIStRY ГлПС (p>0,05). Выявлено равнозначное распределение частот генотипа *C1166/*C1166 в группах больных со средней и тяжелой формой ukgc (54% и 60% соответственно). Гетерозиготный генотип *A1166/*Cвстречался почти на 10% больше у больных с средней тяжестью (42%) по сравнению с тяжелой формой ГлПС (33%). у больных более тяжелой формой ГлПС отмечено почти в 2 раза увеличение частоты генотипа *C1166/*C1166 (6,7%) по сравнению со средней степенью тяжести заболевания (3,9%) (рис. 2).

Обсуждение. Основная часть АПФ синтезируется в эндотелии сосудов и в норме. Около 90% фермента фиксирована на эндотелиальной мембране и только около 10% его активности приходится на плазму крови. Основным эффектором АПФ является Рис. 2. Распределение частот генотипов и аллелей полиАт ii, действие которого реализуется через специфиморфного локуса a1166С генома agtR1 у больных ГлПС в ческие ангиотензиновые рецепторы. Наибольшее зависимости от тяжести заболевания (%) значение имеет рецептор Ат ii 1 типа, через стимуляцию которого реализуется большинство как физи- различия между группами больных с различной стеологических, так и патофизиологических эффектов пенью тяжести ГлПС.

данного пептида: вазоконстрикция, увеличение ми- 3. Повышение активности АПФ при ГлПС, осонутного объема сердца, стимуляция секреции аль- бенно выраженное при тяжелой форме, не носит достерона и подавление вазопрессина, повышение адаптивный характер из-за дефектов в рецепции Ат уровня ингибитора тканевого активатора плазмино- ii при ГлПС и является адекватным метаболическим гена, стимуляция выработки цитокинов с инициацией ответом организма в ответ на внедрение эндотелиовоспалительного процесса в сосудистой стенке, сти- тропного вируса.

муляция генерации активных форм кислорода и др.

Библиографический список [11, 12]. При ГлПС, вызываемом эндотелиотропным 1. behavioural and structural factors in health: an empirical вирусом, имеет место как гиперактивация эндотелия, analysis / k. Stronks, h. Van de Mheen, loomon et al. // Sociology так и его повреждение [13, 14], что ведет, с одной стоof health and illness. – 1996. – № 18. – p. 653-674.

роны, к усиленной экспрессии ее клетками АПФ, а с 2. assiciation between angiotensin ii type 1 receptors gene другой – к протеолитическому отщеплению молекул and human essential hypertension / h. fan, S. li, w. gu et al. // фермента от поврежденных эндотелиоцитов и, как chung hua i hsueh i chuanhsuen tsa chi. – 1998. – Vol. 1015.

– № 2. – p. 101-103.

следствие, – к повышению пула плазменного АПФ.

3. association between renin-angiotensin system gene Нельзя исключить также усиленную экспрессию АПФ polymorphism and essential hypertension: a community-based по принципу обратной связи вследствие отсутствия study / x. Jiang, h. Sheng, J. li et al. // J hum hypertens. – его прессорного эффекта в результате нарушения 2009. – № 3. – p. 176-181.

4. angiotensin ii type 1 receptor gene polymorphism рецепции продукта катализируемой им реакции – Ат predicts development of hypertension and metabolic syndrome ii. Нами выявлены значительные сдвиги в активности / p. palatini, g. ceolotto, f. dorigatti et al. // am J hypertens. – данного фермента зависимости от тяжести ГлПС и 2009. – № 2. – p. 208-214.

наличия осложнений: среднетяжелая форма харак5. Synergistic effects on angiotensin-converting enzyme and теризуется наименее выраженной по сравнению с angiotensin ii receptor gene polymorphism on risk of myocardial infarction / a. bonnardeaux, l. tiret, o. poirier et al. // lancet. – остальными формами болезни активностью фер1994. – Vol. 344. – № 3. – p. 910-913.

мента и отсутствием его «скачков» в динамике, при 6. Synergistic effects of angiotensin converting enzyme and тяжелой форме заболевания без осложнений имеет angiotensin ii type 1 receptor gene polymorphisms on ischemic events место выраженный подъем активности к периоду / p.p. van geel, y.M. pinto, a.h. zwinderman et al. // xx congress of развития полиурии, а при наличии осложнений гипе- the european society of cardiology. – abstract. – p. 386.

7. Полиморфизм генов ренин-ангиотензиновой системы рактивность АПФ наблюдается на всем протяжении и дисфункция эндотелия у мужчин, перенесших инфаркт мизаболевания со с статистически значимыми межгрупокарда в молодом возрасте / О.А. беркович, е.А. баженова, повыми различиями. Однако изучение полиморфизН.В. Вахрамеева и др. // Артериальная гипертензия. – 2008.

ма гена рецептора Ат ii 1 типа показало, что аллели – т. 14. – № 3. – c. 239-244.

8. Mutations in genes in the renin-angiotensin system are *a1166 и *c1166, а также генотипы *a1166/*a1166, associated with autosomal recessive renal tubular dysgenesis / *a1166/*С1166 и *c1166/*c1166 не ассоциированы o. gribouval, M. gonzales, neuhaus et al. // nature genet. – с со степенью тяжести течения ГлПС, что позволяет 2005. – № 37. – p. 964-968.

сделать вывод о том, что высокая активность АПФ 9. Сиротин, б.З. Геморрагическая лихорадка с почечным при ГлПС, которая тем выраженнее, чем тяжелее те- синдромом. Монография / б.З. Сиротин. – хабаровск. – 1994.

– 300 с.

чение болезни, не обусловлена нарушенной рецеп10. Маниатис, т. Методы генетической инженерии. Молецией Ат ii из-за отсутствия васкулярного эффекта и кулярное клонирование / т. Маниатис, э. Фрич, дж. Сембрук.

может быть расценена как вполне адекватная реак– М.: Мир, 1984. – 352 с.

ция макроорганизма в ответ на метаболические из- 11. дроздова, Г.А. Клеточные механизмы артериальной гипертензии / Г.А. дроздова // Патологическая физиология. – менения, первоначально обусловленные действием 2000. – № 2. – c. 26-31.

хантавируса – возбудителя ГлПС.

12. galle, J. angiotensin ii and oxidized ldl: an unholy Заключение.

alliance creating oxidative stress / J. galle, k. heermeier // 1. у больных ГлПС выявлено статистически знаnephrol dial transplant. – 1999. – № 14. – p. 2585-2589.

чимое повышение в крови активности АПФ, завися- 13. Камилов, Ф.х. Состояние целостности эндотелия сосудов при ГлПС / Ф.х. Камилов, А.А. байгильдина // Морфощее от периода и степени тяжести заболевания.

логия. – 2008. – № 4. – c. 72.

2. Сравнительный анализ распределения частот 14. Камилов, Ф.х. экспрессия VcaM-1 как отражение акгенотипов полиморфного локуса A1166C гена ангиотивации эндотелия при ГлПС / Ф.х. Камилов, А.А. байгильдитензина ii AGTR1 не выявил статистически значимые на // Морфология. – 2008. – № 2. – c. 57.

Saratov Journal of Medical Scientific Research. 2010. Vol. 6. № 1.

Pages:     | 1 ||

© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.