WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

Pages:     | 1 |   ...   | 2 | 3 || 5 | 6 |   ...   | 101 |

Можно с уверенностью отметить, что лучшими условиями местопроизрастания растений в большинстве случаев отличаются затененные склоны, чем освещенные, нижние участки карьерных откосов.

Особенно трудно приживается растительность на крутых участках склонов с выступающей наружу материнской породой.

В основном лучшими условиями местопроизрастания отмечены склоны восточной и северной экспозиций, где показатели растений на 5,5…162,2 % выше, чем на западной и южной экспозициях. А западный склон является более лучшим для роста растений в сравнении с южным.

Наиболее богатый породный состав отмечается в лесостепной зоне, на северных и восточных экспозициях, в нижних частях откоса, где больше тени и влаги. По мере удаления на равнинную территорию, в степную зону или в горы состав насаждений становится беднее.

Значительные площади в Кабардино-Балкарии вследствие открытой добычи полезных ископаемых представляют собой результат разрушения почвенно-растительного покрова и перемещения почвогрунтов, нуждаются в биологической рекультивации. Одной из актуальнейших проблем является разработка эффективных способов борьбы с техногенной эрозией, которая имеет место в наших условиях. Особое значение Каразинские естественнонаучные студии Каразінські природознавчі студії Karazin natural science studios приобретает санитарно-профилактическая рекультивация, т.е. озеленение и закрепление растительностью всех свободных от горных работ участков техногенного ландшафта.

Перспективными для закрепления склонов горных отвалов признаны породы, обладающие корнеотпрысковой способностью. В заселении антропогенных беспокровных субстратов отмечается участие таких пород. В наших условиях это, прежде всего: облепиха крушиновая, ивы (козья и остролистная), тополя (бальзамический и белый), шиповник, алыча и другие.

Таблица 1 - Экологические требования древесно-кустарниковых пород Ф а к т и ч е с к и е у с л о в и я Гранул. состав Кислотность № Виды п/п оценка 1 Абрикос обыкн. + 0 0 + 0 + + - 0 +4;04;-2 Акация белая + 0 - + + 0 + - 0 +4;03;-3 Алыча + + - + 0 0 + - 0 +4;03;-4 Береза повислая - + + + - + + - + +6;-5 Вяз шершавый + + - + + 0 0 0 + +5;03;-6 Вяз приземистый + + + + + + + 0 + +8;7 Гледичия трехкол. + + 0 + + + + - 0 +6;02;-8 Граб кавказский 0 + - 0 + 0 + 0 + +4;04;-9 Груша кавказская 0 + 0 + + 0 0 0 0 +3;10 Ежевика + + + + + 0 + + + +8;11 Ива козья + + - + + + 0 0 + +6;02;-12 Ива остролистная + + + + + + 0 0 + +7;13 Ива трехтычинков. 0 - 0 + + + - + + +5;02;-14 Клен ясенелистный + + + + + + + - + +8;-15 Лещина обыкн. - + 0 + + - - 0 + +4;02;-16 Мирикария лисохв. + + - + + + 0 - 0 +5;02;-17 Мушмула германск. - 0 - 0 - - 0 + 0 +1;04-18 Облепиха крушин. + + 0 + + + 0 0 + +6;19 Ольха черная 0 + 0 + + 0 - 0 + +4;04-20 Осина - + 0 + 0 0 0 0 + +3;05;-21 Свидина + + + + 0 0 0 0 + +5;22 Тополь бальзамич. + + - + 0 + + - + +6;01;-23 Тополь белый 0 + - + 0 0 0 0 + +3;05;-24 Тополь пирамид. + + - + 0 0 0 - + +4;03;-25 Шелковица черная 0 0 - + + - 0 0 0 +2;05;-26 Шиповник + + + + + + + 0 + +8;27 Ясень обыкн. 0 0 - + 0 - - 0 0 +1;05;-Условные обозначения:

+ - оптимальное; 0 – среднее; - - негативное В условиях техногенных земель лучшие показатели количества корневых отпрысков имеет облепиха крушиновая, ива козья, тополь бальзамический и шиповник. Высокие лесомелиоративные свойства Крупнозем Мелкозем Кис.

Нтр.

Щел.

Малопло-дородные почвы Засухоустойчив.

Теневы-нослив.

Морозоустойчив.

Каразинские естественнонаучные студии Каразінські природознавчі студії Karazin natural science studios облепихи – способность давать корневые отпрыски, поселяться на свежих песчаных и каменистых почвах, какими располагают вышеназванные участки, благополучно переносить частичное оголение корневой системы, наличие азотфиксирующих клубеньков – позволяют использовать ее при рекультивации земель, вышедших из промышленного использования. Такие насаждения могут быть дополнительным источником сбора ценных плодов.

Корневая система шиповника состоит из корней и корневищ (подземный побег). Разрастаясь в стороны корневище дает корнеотпрысковые побеги и кусты, взаимосвязанные между собой, впоследствии образуя куртины разной величины. Придаточные корни возникают по всей подземной длине корневищ, что дает положительный эффект в закреплении склонов отвалов и карьеров. Характерной особенностью шиповника является наличие большого количества молодых побегов, что обеспечивает самоомолаживание куртин.

Лесоразведение на отвалах и других нарушенных землях имеет ряд особенностей, в связи с многообразием и специфичностью экологических условий. Влияние неблагоприятных свойств субстратов, микроклимата, эрозионных процессов и других факторов на состояние и рост растений на промышленных землях проявляется в большей степени, чем на обычных лесокультурных и агролесомелиоративных объектах.

Создание защитных лесных насаждений на отвалах и эффективность их выращивания в значительной степени зависят от ассортимента древесных пород и кустарников, рекомендуемых для конкретных субстратов, условий произрастания и хозяйственного назначения лесных культур. Исследования по изучению состояния и роста растений достоверно подтверждают перспективность отдельных пород для биологической рекультивации отвалов. От правильного выбора деревьев и кустарников при защитном лесоразведении на отвалах во многом зависит их устойчивость и мелиоративная роль. При этом основное внимание должно быть обращено на низкую требовательность к почвенному плодородию, засухоустойчивость растений и относительно высокую их продуктивность.

БИОРАЗНООБРАЗИЕ ДРОЖЖЕЙ, ВЫДЕЛЕННЫХ ПРИ СПОНТАННОЙ ФЕРМЕНТАЦИИ СУСЛА ВИНОГРАДА, ФРУКТОВ И ЯГОД, ИХ ИДЕНТИФИКАЦИЯ Байрактар В.Н1., Ткаченко Ф.П. Одесский национальный университет им. И.И.Мечникова, кафедра генетики и молекуляной биологии E-mail: vogadro2007@rambler.ru Одесский национальный университет им. И.И.Мечникова, кафедра ботаники E-mail: tvf@ukr.net В природе существует большое количество диких культур дрожжей, которые могут принимать участие в брожении сахаросодержащего сусла. Чистая культура дрожжей, обуславливающая управляемость этим биотехнологическим процессом наиболее предпочтительна [1, 3]. Применение чистых культур дрожжей, обладающих такими свойствами как спиртоустойчивых, кислотовыносливых, сульфитостойких культур и не продуцирующих сероводород, обеспечивает возможность брожения даже в необычных, экстремальных условиях [5,6].

Для получения высококачественного конечного продукта огромное значение имеет степень бродильной активности используемых штаммов дрожжей [2,3,4]. Результат применения чистой культуры дрожжей в производстве во многом зависит от качества приготовленных дрожжевых разводок, количества дрожжевых клеток в бродильной смеси и строгого соблюдения условий анаэробного брожения [3].

Целью нашей работы было выделение и идентификация на основе молекулярных методов исследования микокомплекса дрожжей из разных сахаросодержащих субстратах – из сусел винограда, фруктов и ягод.

Для этого использовали полимеразно-цепную реакцию и универсальные дрожжевые праймеры с последующей амплификацией локусов. Для локусов ITS 1-5.8.S-ITS2 это выполнено с использованием двух праймеров: 5`-TCCGTAGGTGAACCTGCGG-3` или 5`-TCCTCCGCTTATTGATATGC-3`, а для локуса D1-D2 – одного 5`-GCATATCAATAAGCGGAGGAAAAG-3`. Эти олигонуклеотиды соответствовали сиквенсу, описанному ранее [6, 7]. Необходимые для исследований праймеры были синтезированы в лаборатории фармакогеномики научно-исследовательского института химической биологии и фундаментальной медицины (г. Новосибирск, Россия).

Используя молекулярно-генетический метод исследования, установлено, что в сусле винограда соКаразинские естественнонаучные студии Каразінські природознавчі студії Karazin natural science studios рта Совиньон ферментацию осуществляли дрожжи Saccharomyces cerevisiae, зарегестрированные под порядковым номером USRCB Y-3367; сорта Алиготе – Candida tropicalis, номер USRCB Y-3362; сорта Бако – Dekkera bruxellensis, номер USRCB Y- 3341. Из сусла фруктов выделены следующие виды дрожжей: из алычи – Pichia guilliermondii,коллекционный номер USRCB Y-3360; из вишни – Metschnikowia aff. fructicola, номер USRCB; Y-3356; из сливы типа «мирабель» – Pichia kudriavzevii, номер USRCB Y-3347. В сусле ягод идентифицированы: из крыжовника – Candida albicans, коллекционный номер USRCB Y-3354; из красной смородины – Candida albicans, номер USRCB Y-3346, из клубники – Pichia barkeri, номер USRCB Y-3345 и из сливы - Pichia kudriavzevii, регистрационный номер USRCB Y-3347.

Рассмотрим пример прямого секвенирования полученных фрагментов ДНК дрожжей вида Saccharomyces cerevisiae, выделенных при спонтанном брожении сусла винограда сорта Совиньон.

GGCGNGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTA GGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGT Saccharomyces cerevisiae strain D53 26S ribosomal RNA gene, partial sequence Query 1 GGCGNGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTA |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15 GGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTA Query 61 ATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 75 ATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCAT Query 121 AGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 135 AGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGT Query 181 CGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 195 CGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTG Query 241 GCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 255 GCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAG Query 301 AGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 315 AGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTG Query 361 TGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 375 TGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTG Query 421 GTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGT ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 435 GTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGT Идентификацию дрожжевых культур осуществляли путем амплификации ITC1-5.8S – ITS2b и D1D2 26S фрагментов геномного локуса, кодирующего соответствующие участки рибосомальной РНК, с Каразинские естественнонаучные студии Каразінські природознавчі студії Karazin natural science studios последующим прямым секвенированием полученных фрагментов ДНК. На примере, выше приведенного сиквенса, наглядно показано насколько точно возможно определение вида дрожжевой культуры, благодаря исследованию специфических локусов.

Литература 1. Байрактар В.Н. Симбиотическое взаимодействие дрожжей вида Saccharomyces cerevisiae и лактобактерий Lactobacillus выделенных после спонтанной ферментации виноградного сусла.// Виноград.

Киев.- 2010. -№5. вып. 28. – C.54-58.

2. Байрактар В.М. Селективний добiр перспективных дрiжджових культур Saccharomyces cerevisiae для бiотехнологiчних цiлей. //Наукові доповіді національного університету біоресурсів і природокористування України. Київ. - 2010. -№ 3. вып. 19. – C.16. - Режим доступа к журналу.: http://.nd.nubip.edu.ua/20103/10bvnpbp.pdf 3. Бурьян Н.И. Mикробиология виноделия / Н.И. Бурьян., Л.В. Тюрина// - Москва:1979. – 255c.

4. Бурьян Н.И. Mикробиология виноделия. Симферополь. Таврида, 2002. - 433с.

5. Кишковская С.А. Селекция дрожжей для шампанского производства./ С.А. Кишковская., Н.И.

Бурьян., Т.П. Чичинадзе.// Mагарач. Виноградарство и виноделие. Ялта.- 2009. №3. С.18-20.

6. Kurtzman C.P., Robnett C.J. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5- end of the large subunit (26S) ribosomal DNA gene. Journal Clinical Microbiology, 1997; No 5. vol. 3 : 1216-1223.

7. White T.J., Bruns T., Bruns, Lee S., Taylor J. PCR Protocols. A guide to methods and applications, 1990;

315-352.

РЕВИЗИЯ ПЕРЕчНЯ ОХРАНЯЕМЫХ РАСТЕНИЙ Г. СЕВАСТОПОЛЯ Бондарева Л.В.

Институт биологии южных морей им. А.О. Ковалевского НАН Украины, г. Севастополь Важным достижением в практике природоохранного дела Севастопольского региона является официальное принятие в 2003 г. “Перечня редких и находящихся под угрозой исчезновения видов растений, не занесенных в Красную Книгу Украины, которые подлежат особой охране в границах территориально-административного образования г. Севастополя” (далее – Региональный перечень). Он разработан по заказу Госуправления охраны окружающей природной среды в г. Севастополе по материалам флористического обследования региона проведенного в 2000-2001 гг. специалистами Никитского ботанического сада – Национального научного центра. Документ состоит из 3 приложений: положения о Региональном перечне и списков видов, охраняемых на местном уровне (65 видов высших сосудистых растений из 25 семейств) и занесенных в Красную книгу Украины (87 из 24 семейств).

Положением Регионального перечня предусмотрена периодическая работа по его пересмотру и корректированию. Так, с принятием новой редакции Красной книги Украины (2009 г.) [8] и продолжением инвентаризации флоры региона необходимо провести ревизию списка краснокнижных видов. Во-первых, в него должны быть включены виды регионального уровня охраны, получившие более высокий - государственный статус: Calystegia soldanella, Centaurea comperiana, C. caprina, Crambe pinnatifida, C. pontica, Crithmum maritimum, Euphorbia paralias, Parapholis incurva, Trachomitum sarmatiense (номенклатура приведена по [9]). Кроме того, в этот список следует расширить за счет новых видов, отмеченных во флоре региона (Adiantum capillus-veneris, Carex depauperata, C. liparocarpos, Centaurea steveniana, Ornithogalum refractum, Raphanus maritimus, Rumia crithmifolia, Sorbus torminalis, Stipa poёtica, Stipa heterophylla, S.

oreades var. glabrinoda).

Pages:     | 1 |   ...   | 2 | 3 || 5 | 6 |   ...   | 101 |



© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.