WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

Авторефераты по темам  >>  Разные специальности - [часть 1]  [часть 2]

ВЛИЯНИЕ ГОМОЦИСТЕИНА НА ПРОДУКЦИЮ АКТИВНЫХ ФОРМ КИСЛОРОДА НЕЙТРОФИЛАМИ КРЫС

Автореферат кандидатской диссертации

 

МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ

имени М.В. ЛОМОНОСОВА

Биологический факультет

На правах рукописи

БРЮШКОВА ЕКАТЕРИНА АЛЕКСАНДРОВНА

ВЛИЯНИЕ ГОМОЦИСТЕИНА НА ПРОДУКЦИЮ АКТИВНЫХ ФОРМ КИСЛОРОДА НЕЙТРОФИЛАМИ КРЫС

03.01.04 - биохимия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Москва - 2012


Диссертационная работа выполнена на кафедре биохимии биологического факультета Московского государственного университета имени М.В. Ломоносова

Научный руководитель:                                               доктор биологических наук, профессор

Болдырев Александр Александрович

Официальные оппоненты:                                         доктор биологических наук, профессор

Муронец Владимир Израилевич

кандидат биологических наук, профессор Пантелеев Михаил Александрович

Ведущая организация:                                         Учреждение Российской Академии Наук

Институт Биофизики Клетки РАН

Защита диссертации состоится 19 марта 2012 г. в 15 часов 30 мин на заседании диссертационного совета Д 501.001.71 при Московском государственном университете имени М.В. Ломоносова по адресу: 119991, Москва, ГСП-1, Ленинские горы, Московский государственный университет имени М.В. Ломоносова, Биологический факультет, Большая биологическая аудитория (ББА).

С диссертацией можно ознакомиться в библиотеке биологического факультета Московского государственного университета имени М.В. Ломоносова.

Автореферат разослан    «___ »    февраля 2012 года

Ученый секретарь диссертационного совета,

кандидат биологических наук                                                                 Медведева М.В.


ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Гомоцистеин (ГЦ) является природным метаболитом, связывающим обмен метионина и глутатиона. В норме его стационарный уровень в крови не превышает 15-20 мкМ [Seshadri et al, 2002], но в условиях нарушения метаболизма ГЦ наблюдается гипергомоцистеинемия, характеризующаяся повышением его уровня в крови до 100-500 мкМ и выше. При этом увеличение концентрации ГЦ в плазме крови может быть как причиной, так и следствием патологических состояний. Повышение стационарного уровня ГЦ в организме коррелирует с разнообразными сердечнососудистыми и нейродегенеративными заболеваниями [Boushey et al, 1995]. ГЦ является фактором риска инфарктов и инсультов [Mangoni and Jackson, 2002], а также усиливает развитие атеросклероза [McCully et al, 1975; Tehlivets, 2011].

Токсическую роль ГЦ в повреждении клеток нервной системы связывают с его взаимодействием с глутаматными рецепторами и явлением экзайтотоксичности, которое характеризуется повышением концентрации ионов Са в цитоплазме, активацией Са -зависимых ферментативных каскадов и росту свободных радикалов в нейронах [Dingledine et al, 1999].

Данные о влиянии ГЦ на иммунокомпетентные клетки немногочисленны и фрагментарны. Известно, что ГЦ усиливает адгезию лейкоцитов к сосудистой стенке [Guo and Dudman, 2001], вызывает активацию, дифференциацию и апоптоз Т-лимфоцитов [Dawson et al, 2004], усиливает продукцию активных форм кислорода (АФК) в тромбоцитах [Signorello et al, 2002], стимулирует сборку и активацию NADPH-оксидазы в нейтрофилах и моноцитах [Alvarez-Maqueda et al. 2004; Siow et al, 2006]. Эти факты свидетельствуют о том, что ГЦ направленно стимулирует цитотоксичность данных клеток, но механизм описанных явлений до конца не установлен.

Уровень активных форм кислорода и хлора в клетках крови является важной характеристикой их метаболического состояния. Его изменение служит сигнальным механизмом для запуска различных клеточных процессов, таких как дифференцировка, пролиферация, апоптоз. С другой стороны, при нарушениях работы организма несбалансированная продукция АФК становится очень опасной, причем ведущая роль в подобных патологических состояниях принадлежит нейтрофилам - единственным клеткам организма, продуцирующим в межклеточное пространство значимое количество активных форм кислорода и хлора.

В связи с вышесказанным, изучение влияния ГЦ на продукцию активных форм кислорода нейтрофилами и исследование возможных механизмов действия ГЦ является

3


актуальной проблемой, имеющей как теоретическое, так и практическое значение для современной биохимии.

Целью данной работы явилась оценка влияния гомоцистеина на генерацию активных форм кислорода и хлора в интактных и активированных invivoнейтрофилах.

Задачи исследования:

  1. Исследовать продукцию активных форм кислорода и хлора в суспензии интактных и активированных invivoнейтрофилов крысы в присутствии гомоцистеина методом люминол-зависимой хемилюминесценции.
  2. Исследовать возможные механизмы действия гомоцистеина на нейтрофилы, находящиеся в разных функциональных состояниях.
  3. Изучить возможность нерецепторного влияния ГЦ на уровень активных форм кислорода и хлора, продуцируемых нейтрофилами.
  4. Выявить возможные рецепторы, участвующие в реализации эффектов ГЦ, на мембране нейтрофилов.
  5. Установить возможность экспрессии denovoканальной NR1-субъединицы NMDA-рецептора в нейтрофилах после их активации.

Научная новизна и практическая значимость работы. В настоящей работе охарактеризовано влияние гомоцистеина - соединения, которое образуется в ходе взаимопревращения метионина и цистеина, на нейтрофилы крыс, находящиеся в разных функциональных состояниях. Обнаружено, что интактные и активированные invivoнейтрофилы различным образом реагируют на повышенные концентраций гомоцистеина.

Показано, что для интактных клеток ГЦ выступает в роли умеренного супрессора уровня АФК. Установлено, что в пределах физиологических концентраций ГЦ ингибирует миелопероксидазу, специфический фермент азурофильных гранул нейтрофилов. Обнаружена способность ГЦ напрямую реагировать с продуктом миелопероксидазной реакции гипохлоритом, приводящая к образованию хлораминового производного гомоцистеина.

В работе впервые установлена способность нейтрофилов экспрессировать NMDA-рецепторы в результате их активации invivo. При помощи иммунофлуоресцентного окрашивания показано связывание антител с внеклеточным доменом NR2B субъединицы NMDA-рецепторного комплекса на мембране активированных invivoнейтрофилов. С помощью иммунопреципитации выявлены белки, соответствующие NR1 и NR2B субъединицам NMDA-рецептора.   Показано участие NMDA-рецепторов  в  реализации

4


эффекта ГЦ, приводящего к увеличению продукции АФК нейтрофилами, выделенными из очага острого воспаления.

Полученные результаты расширяют представления как об экспрессии NMDA-рецепторов в клетках иммунной системы, так и о механизмах взаимодействия гомоцистеина с нейтрофилами в зависимости от их иммунного статуса, что существенно для понимания молекулярных механизмов токсичности гомоцистеина.

Апробация работы. Результаты работы докладывались на научных семинарах кафедры биохимии Биологического факультета МГУ имени М.В. Ломоносова, на Международной конференции студентов и аспирантов по фундаментальным наукам «Ломоносов» (Россия, Москва, 2008); Ehrlich II World Conference on Magic Bullets (Germany, Nurnberg, 2008); 7th Int. Conference on Homocysteine Metabolism (Czech Republic Prague, 2009); 12th Int. Congress on Molecular Mechanisms of Neurological and Psychiatric Disorders (Slovakia, Martin, 2009); the 6th European Meeting for Vascular Biology and Medicine (Poland, Krakow, 2011). Апробация работы прошла на кафедре биохимии МГУ имени М.В. Ломоносова (26 сентября 2011 г.).

Публикации. По теме диссертации опубликовано 9 печатных работ, включая 2 статьи в журналах, входящих в список ВАК РФ, 1 статья в зарубежной монографии и 6 тезисов научных докладов.

Структура и объем диссертации. Диссертация состоит из Введения, Обзора литературы, разделов «Материалы и методы исследования», «Результаты и их обсуждение», «Выводы» и «Список литературы». Работа изложена на 120 страницах печатного текста, содержит 38 рисунков и 10 таблиц. Список литературы включает 218 отечественных и зарубежных источников.

В работе используются следующие сокращения:

АФК - активные формы кислорода, ГЦ - гомоцистеин, МПО - миелопероксидаза, Р-МЭ

  1. бета-меркаптоэтанол, ПЦР - полимеразная цепная реакция, РТ-ПЦР - полимеразная цепная реакция в реальном времени, ФМА - форболмиристатацетат, FITC -флуоресцеин изотиоционат, GAPDH - глицеральдегид-3-фосфат-дегидрогеназа, МК-801
  2. транс-8-метил-10,11-дигидро-5н-бензо[а^]циклопентен-5,10-имин малеат, NMDA - N-метил-Б-аспартат, TBS - трис-фосфатный буфер, ZM 241385 - (4-(2-[7-амино-2-(2-фурил) [1,2,4]-триазоло[2,3-а][1,3,5]триазин- 5-ил амино]этил) фенол).

5


СОДЕРЖАНИЕ РАБОТЫ

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Объектом исследования явились нейтрофилы крыс, находящиеся в двух различных функциональных состояниях - в виде интактных клеток и активированных клеток, полученных из очага острого воспаления.

Выделение интактных нейтрофилов проводили из гепаринизированной крови крыс линии Wistar. Животных перед опытом усыпляли раствором хлоралгидрата, взятым из расчета 400-600 мг вещества на 1 кг веса животного, и отбирали кровь из яремных вен с помощью шприца, содержащего раствор гепарина (50 ед/мл крови). Для получения нейтрофилов кровь наслаивали на селективную среду MonoPoly («ICN Biomedicals», США), центрифугировали при 300 g, после чего собирали кольцо нейтрофилов, локализованное на границе двух сред. Собранные после выделения клетки дважды отмывали и полученный осадок ресуспендировали в среде Хенкса («ПанЭко», Россия). В случае необходимости от эритроцитов избавлялись путем ресуспендирования пробы в 0,83% NH4CI в течение 8 мин с последующим отмыванием. Подсчет клеток проводили в камере Горяева.

Выделение активированных invivoнейтрофилов производили после создания у животного локального очага воспаления. Воспалительный процесс осуществляли путем внутрибрюшинной инъекции крысе 2,25 мг неопсонизированного зимозана по методике Сафроновой В.Г. [Сафронова и соавт. 2001], модифицированной нами для крыс путем пропорционального увеличения объема и концентрации используемых растворов.

Через 5 ч после инъекции делали смыв клеток из брюшной полости средой Хенкса. Полученную суспензию центрифугировали для осаждения нейтрофилов, затем осадок ресуспендировали в среде Хенкса. Подсчет клеток также проводили в камере Горяева.

Выделение гранулярных клеток мозжечка крыс. Для получения гранулярных клеток мозжечка использовали 10-дневных крыс линии Wistar. Животных декапитировали, вскрывали черепную коробку и извлекали мозжечок, который помещали в стоящую во льду чашку Петри, промывали холодным раствором Тироде (148 мМ NaCl, 5 мМ КС1, 2 мМ СаС12, 1 мМ MgCl2, 10 мМ глюкозы, 10 мМ HEPES, рН 7,4) измельчали и добавляли 2 мг/мл (400 ед. активности) раствор коллагеназы («Wako», Япония), приготовленный на растворе Тироде, для разрушения межнейронных контактов. Инкубацию с коллагеназой проводили в течение 30 мин при 37°С. После инкубации образцы трижды промывали раствором Тироде, аккуратно суспендировали при помощи

6


пастеровской пипетки и фильтровали через тефлоновый фильтр (диаметр пор 60 мкм) для удаления остатков тканей. Подсчет клеток проводили в камере Горяева.

Хемилюминесцентный анализ. Функциональную активность нейтрофилов оценивали по продукции АФК в присутствии хемилюминесцентного зонда люминола, окисление которого до аминофталевой кислоты сопровождается хемилюминесценцией, измеряемой при 425 нм. Клетки инкубировали 30 мин в присутствии лигандов при 37°С и постоянном перемешивании, затем к образцам добавляли люминол (1 мкМ) и регистрировали сигнал на хемилюминометре Smartlum5773 («ИнтерОптика», Россия). Генерацию АФК у интактных нейтрофилов стимулировали добавлением в пробу 1 мг опсонизированного зимозана (30 мг/мл), у активированных invivoклеток регистрировали собственный уровень хемилюминесценции. В качестве контроля регистрировали хемилюминесценцию клеток, инкубированных в тех же условиях без добавления лигандов.

Влияние гомоцистеина на коммерческий препарат миелопероксидазы (МПО) исследовали двумя способами: хемилюминометрическим и спектрофотометрическим. Первый метод основан на способности фермента катализировать реакцию образования гипохлорита в присутствии перекиси водорода и анионов хлора. Генерацию СЮ" регистрировали на хемилюминометре Smartlum5773 («ИнтерОптика», Россия). В пробу, содержащую 0,1 мМ люминол, 50 мкМ НгСЬ (8г4о1мМ = 39,4) и среду Хенкса, добавляли ГЦ в диапазоне концентраций от 1 до 10 мкМ. Реакцию начинали внесением в пробу 0,05 ед. активности миелопероксидазы («Sigma», США).

Второй метод основан на способности МПО окислять специфический субстрат о-дианизидин. Измерения проводили в среде, содержащей 10 мМ калий-фосфатный буфер (рН 7,0), 50 мкМ Н2О2, 0,33 мМ одианизидина и ГЦ в диапазоне концентраций от 10 до 500 мкМ. Реакцию начинали добавлением 0,05 ед. активности МПО. За ходом реакции следили по возрастанию оптической плотности при X= 460 нм, измерения проводили на спектрофотометре Hitachi20-200 (Япония).

Принципиальное отличие между данными способами заключается в том, что хемилюминометрический метод позволяет оценить влияние ГЦ на общее количество СЮ" в пробе, тогда как спектрофотометрический метод дает возможность исследовать влияние ГЦ на ферментативную активность, исключая возможность связывания гомоцистеина с гипохлоритом.

Прямое взаимодействие гомоцистеина с гипохлоритом оценивали по спектрам поглощения  этих   веществ   и   их   смеси   в  ультрафиолетовой   области   (220-300   нм).

7


Появление продукта взаимодействия ГЦ с гипохлоритом (хлораминового производного гомоцистеина) определяли по появлению пика поглощения при 252 нм.

Проточная цитометрия. Измерения проводили на приборе FACStar(«Becton Dikinson», США), оснащенном аргоновым лазером с длиной волны возбуждения 485 нм. В каждой пробе анализировали 10 000 событий. Данные обрабатывали в программе «WinMDI 2.9».

Для идентификации некроза клетки окрашивали иодидом пропидия (PI, Хех 485 нм, Хеш 610 нм), в конечной концентрации 10 мкМ.

Для оценки интернализации рецепторов на плазматической мембране нейтрофилов использовали метод иммунофлуоресцентного окрашивания антителами к метаботропным глутаматным рецепторам I и III класса, а также к NMDA-рецепторам. Перечень используемых антител приводится в Таблице 1.

Суспензию, содержащую 10 клеток, инкубировали 30 мин при комнатной температуре в присутствии первичных антител. После этого клетки отмывали в растворе Хенкса и окрашивали вторичными антителами, меченными флуоресцентными красителями. Инкубацию проводили в течение 40 мин в темноте, после чего клетки повторно отмывали в тех же условиях. Чтобы исключить неспецифическую флуоресценцию вторичных антител, в качестве отрицательного контроля анализировали пробы, окрашенные только вторичными антителами. В качестве положительного контроля использовали суспензию гранулярных клеток мозжечка крысы

Таблица 1. Основные характеристики антител, использованных для иммунофлуоресцентного окрашивания нейтрофилов

Название

Изотип

Производитель

Титр*

Первичные антитела

Rabbit anti-rat mGluRl

IgG

ab51314, Abeam Inc., USA

1:250

Rabbit anti-rat mGluR4

IgG

abl5305, Abeam Inc., USA

1:200

Rabbit anti-rat mGluR5

IgG

ab27190, Abeam Inc., USA

1:100

Rabbit anti-rat mGluR6+7

IgG

abl5307, Abeam Inc., USA

1:200

Mouse anti-rat ( антитела к гранулоцитам)

IgM

ab33760, Abeam Inc., USA

1:10

Mouse anti-rat NMDA NR2B

IgGl

ab 28373, Abeam Inc., USA

1:1000

8


Вторичные антитела

Goat anti-rabbit, FITC-меченные

IgG

ab 7050, Abeam Inc., USA

1:200

Goat anti-mouse, FITC-меченные

IgG

F 0257, Sigma-Aldrich, USA

1:200

Goat anti-mouse, РЕ-меченные

IgG

ab5932, Abeam Inc., USA

1:200

* - титр антител подбирали экспериментально

Идентификация  белковых  субъединиц  NMDA-рецепторного  комплекса.  Для

того чтобы детектировать NMDA-рецепторы (как связанные с мембраной, так и находящиеся во внутриклеточных компартментах), клетки подвергали лизису с последующей иммунопреципитацией с первичными антителами к NR1 субъединице NMDA-рецептора, иммобилизованными на протеин А-сефарозе. Иммобилизацию антител проводили согласно методике, описанной в протоколе производителя.

Нейтрофилы ресуспендировали в течение 5 мин в лизирующем буфере (20 мМ Tris-НС1, рН 7,5, 150 мМ NaCl, 1 мМ Na2EDTA, 1 мМ EGTA, 1% Тритон, 2,5 мМ пирофосфат натрия, 1 мМ Р-глицерофосфат, 1 мМ Na3VC>4, 1 мкг/мл леупептин) в присутствии 1 мМ PMSF и 4% раствора ингибиторов протеаз («Sigma-Aldrich», США) при 4°С. Затем образцы подвергали воздействию ультразвука, центрифугировали (10 мин, 13000 g) и проводили реакцию иммунопреципитации с полученным супернатантом в течение 5 ч при при 4°С и постоянном перемешивании.

Полученный комплекс промывали, ресуспендировали в буфере нанесения (200 мМ Трис-НС1, 4% DS-Na, 20% глицерол, 0,02% бромфеноловый синий, 4% Р-МЭ, рН 6,8) и нагревали до 90°С 5 мин, после чего очищали от протеин А-сефарозы при использовании микроцентрифужных пробирок с белковыми фильтрами (Costar Spin-X (диаметр пор 0,45 мкм), «Cole-Parmer», Канада).

Супернатант, содержащий исследуемый белок, подвергали электрофорезу в денатурирующих условиях по методу Лэммли с использованием 4,5% концентрирующего и 10% разделяющего полиакриламидных гелей. После окончания электрофореза белки переносили на нитроцеллюлозную мембрану с помощью Вестерн блоттинга, контролируя процесс переноса белков с помощью предокрашенных маркеров («Fermentas», Канада). Нитроцеллюлозные мембраны блокировали от неспецифического связывания с антителами 10% раствором сухого молока и инкубировали с первичными антителами к NR1 или NR2B субъединицам NMDA-рецептора («Abeam Inc.», США) в течение 1 ч. Затем мембраны отмывали буфером TBS/T (TBS + 0,1% Твин-20) от несвязавшихся

9


антител и окрашивали вторичными антителами, конъюгированными с пероксидазой хрена («Sigma-Aldrich», США) в тех же условиях. После окончания инкубации мембраны несколько раз промывали TBS/T и проводили идентификацию NR1 (NR2B) субъединицы методом усиленной хемилюминесценции (ECL). В темной комнате при свете красного фонаря на поверхность мембраны наносили состав, содержащий субстрат для пероксидазной реакции («Thermo Scientific», США), накрывали рентгеновской пленкой («Sigma-Aldrich», США) и помещали в кассету для авторадиографии на 10 мин. После этого пленку помещали в раствор проявителя до появления четких полос, промывали водой и обрабатывали фиксирующим раствором.

Дизайн праймеров и зондов для полимеразной цепной реакции (ПЦР) проводили на основании последовательностей, имеющихся в публичных базах данных (GeneBank) с использованием программы «Oligo Master». Специфичность выбираемых праймеров и зондов дополнительно проверяли при помощи программы Blast (сервер NCBI). Оценку температуры отжига проводили с использованием программы «Perl-Primer».

Реакцию обратной транскрипции проводили с использованием комплементарного поли(А) участку на 3'-конце мРНК праимера (TGCCCAATGATACAATGAGAC(T)i4), содержащего случайную адапторную последовательность. Это позволяет создать библиотеку кДНК с высокой степенью представленности фракции матричных РНК, 3' конец которых оказывается полиаденилированным. Для ПЦР в качестве обратного праимера использовали эту же адапторную последовательность (без поли(Т)). Использование адапторного праимера позволяет гарантировать получение продукта ПЦР с кДНК, а не с геномной ДНК.

Выделение РНК и обратная транскрипция. Для получения тотальной РНК суспензию нейтрофилов, содержащую 5 х 10 клеток, лизировали в растворе TRIzol («Invitrogen», США) в течение 5 мин, а затем проводили фенол-хлороформную экстракцию нуклеиновых кислот. Для удаления примесей ДНК использовали кит, содержащий ДНКазу I («Promega», США), все необходимые реакции проводили по указанной в протоколе производителя методике в присутствии 20 ед. активности ингибитора РНКаз RiboLock («Fermentas», США).

Для разрушения вторичной структуры РНК и эффективного отжига праймеров полученный образец тотальной РНК (10 мкл, 1 мкг/мкл) инкубировали 5 мин при 65°С в присутствии 25 пкмоль полиТ-праймера с адапторной последовательностью. Затем образец охлаждали и добавляли к 10 мкл реакционной смеси для обратной транскрипции (реактивы «Синтол», Россия), содержащей 10 ед. активности RiboLock, 200 ед. активности

10


фермента M-MLV-ревертазы, 1 мМ смеси дезоксинуклеозидтрифосфатов и реакционный буфер для M-MLV-ревертазы (50 мМ Трис-HCl рН 8,3, 50 мМ КС1, 4 мМ MgCl2, 10 мМ DDT). В качестве отрицательного контроля (ОТ) использовали образцы, содержащие вместо M-MLV-ревертазы (обратной транскриптазы) соответствующее количество воды. Реакцию обратной транскрипции проводили в амплификаторе «Терцик» (ДНК-Технология, Россия) при 42°С в течение 60 мин, после чего смесь инкубировали 10 мин при 70°С для остановки реакции.

Проведение полимеразной цепной реакции в реальном времени (РТ-ПЦР).

Для проведения РТ-ПЦР использовали набор реактивов фирмы «Синтол» (Россия). Реакционная смесь объемом 20 мкл, содержала 3 мкл матрицы (кДНК, пробы «РТ-ОТ+»), 1 ед. активности Taq-полимеразы, 0,5 мкМ прямого и обратного праймеров, 0,2 мМ дезоксинуклеозид-трифосфатов, 0,5 мкМ флуоресцентный зонд (R6G, Хмакс флуоресценции 550 нм), 3 мМ MgCb, и 2 мкл 10х ПЦР-буфера. В качестве праймеров использовали праймер к консервативной последовательности гена NR1-субъединицы NMDA-рецептора и праймер, содержащий адапторную последовательность, а также стандартную пару праймеров («Синтол», Россия) к гену глицеральдегид-3-фосфат-дегидрогеназы (GAPDH) в качестве положительного контроля (пробы «РТ+»). Амплификацию проб проводили в амплификаторе MJMini(«BioRad», Германия). Отрицательным контролем служили пробы, в которые в качестве матрицы вносили продукт обратной транскрипции ОТ образцов (пробы «РТ-ОТ ») и пробы, содержащие вместо матрицы соответствующий объем воды (пробы «РТ~»).

РТ-ПЦР проводили в следующем режиме: исходная денатурация матрицы - 3 мин при 94°С; денатурация - 94°С, 30 сек; отжиг праймеров - 55°С, 30 сек; элонгация - 72°С, 60 сек. Реакцию проводили в течение 36 циклов. За ходом реакции следили с помощью программы «Opticon Monitor» (MJ MiniOpticon Software).

Статистическая обработка результатов. Измерения проводили не менее чем в 3 параллельных пробах для каждого опыта. Между собой сопоставляли результаты, полученные не менее чем для 3 различных животных. Итоговые результаты количественных измерений представлены в виде «среднее значение ± средняя ошибка». Статистическую обработку данных внутри одного эксперимента проводили с использованием критерия значимости Y > 0,1, а при обработке серии экспериментов использовали t критерий Стьюдента для независимых выборок. Достоверными считали различия при которых Р < 0,05.

11


РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

1. Исследование действия гомоцистеина на генерацию активных форм кислорода интактными и активированными in vivo нейтрофилами

Известно, что гомоцистеин оказывает влияние не только на нейроны, но и на клетки крови. В частности, для лейкоцитов показано усиление экспрессии CDllb/CD18, CD14 и L-селектина под влиянием ГЦ, приводящее к повреждению стенок сосудов в результате избыточной адгезии лейкоцитов [Guo and Dudman, 2002]. ГЦ вызывает также активацию и дифференциацию Т-лимфоцитов и их апоптоз [Dawson et al, 2004], препятствует высвобождению NO тромбоцитами [Mutus et al, 2001], усиливает продукцию АФК и высвобождение арахидоновой кислоты в тромбоцитах [Signorello et al, 2002]. Поскольку генерация АФК является важнейшей функцией нейтрофилов, в первую очередь мы проанализировали влияние ГЦ на этот процесс. На Рис. 1 представлены типичные кривые хемилюминесценции для интактных и активированных invivoнейтрофилов.

На Рис. 4 видно, что в смеси, содержащей одновременно ГЦ и гипохлорит, наблюдается исчезновение пика 290 нм, характерного для гипохлорита. При этом появляется пик поглощения при 252 нм, что соответствует продукту взаимодействия ГЦ с гипохлоритом (хлорамину гомоцистеина). Таким образом, показано, что ГЦ не только ингибирует миелопероксидазу, но и выступает в качестве ловушки для основного продукта ее реакции, гипохлорита.

3. Исследование возможности рецепторного воздействия ГЦ на нейтрофилы

Противоположно направленный эффект ГЦ на нейтрофилы, выделенные из очага острого воспаления, указывает на существенные различия в функциональном состоянии интактных и активированных invivoклеток. С одной стороны, известно, что находящийся в кровяном русле ГЦ инициирует сборку белкового комплекса NADPH-оксидазы нейтрофилов и моноцитов [Alvarez-Maqueda et al, 2004; Siow et al, 2006], то есть должен вызывать активацию этого фермента и клеточного ответа в целом. С другой стороны,

15


активация иммунокомпетентных клеток в условиях invivoможет запускать экспрессию ряда белков и рецепторов.

Мы предположили, что интактные клетки могут отличаться от активированных invivoналичием или отсутствием на мембране одного или нескольких типов рецепторов. Хорошо известно, что в нейронах эффект ГЦ реализуется через глутаматные рецепторы [Lipton et al, 1997; Zieminska et al, 2003; Болдырев, 2009; Ganapathy et al, 2011], наличие которых в последнее время показано также для клеток иммунной системы [Boldyrev et al, 2004; Miglio et al, 2005; Mashkina et al, 2010].

Опираясь на все эти данные, мы предположили, что в наших условиях нейтрофилы могут экспрессировать NMDA-рецепторы после активации invivo. Хорошо известно, что сегментоядерные клетки обладают в высокой степени конденсированным хроматином и низким уровнем синтеза белка. Поэтому принципиально важным было продемонстрировать наличие в нейтрофилах мРНК как минимум для одной из субъединиц NMDA-рецептора. При помощи РТ-ПЦР мы исследовали активированные invivoнейтрофилы на наличие мРНК для NR1 субъединицы NMDA-рецептора, но на первом этапе наших исследований мы не обнаружили экспрессии целевой мРНК ни в интактных, ни в активированных invivoнейтрофилах. Учитывая то факт, что мРНК деградирует в среднем в течение 60 мин после синтеза, мы предположили, что экспрессия мРНК для NMDA-рецепторов может происходить в ответ на внешний стимул. Чтобы проверить наше предположение, мы дополнительно стимулировали нейтрофилы, выделенные из очага острого воспаления, инкубацией с зимозаном А и ФМА в течение 45 мин в присутствии 500 мкМ NMDA. По итогам проведенных исследований мы установили, что дополнительная активация зимозаном А нейтрофилов, выделенных из очага острого воспаления, в присутствии 500 мкМ NMDA вызывает экспрессию мРНК для NR1 (Рис. 5).


Рис. 5. Экспрессия мРНК для NR1 субъединицы NMDA-рецептора, стимулированная invitro. 1. GAPDH, (РТ-);

  1. NR1, (PT-);
  2. GAPDH, (PT+);
  3. NR1, (PT-OT-);
  4. NR1, (PT-OT+),

Ct   (threshold   cycle)   пороговый цикл реакции.


16


На Рис. 5 видно, что в исследуемых образцах с 18 цикла наблюдается значительное увеличение флуоресценции по сравнению с отрицательным контролем, причем уровень флуоресценции NR1-зонда (кривая 5) сопоставим с уровнем флуоресценции в положительном контроле (кривая 3). Мы видим так же, что после 34 цикла наблюдается небольшая флуоресценция «РТ-ОТ-» образца (кривая 4), что объясняется незначительным содержанием геномной ДНК в анализируемых пробах. Полученные данные подтверждают точку зрения, что экспрессия NMDA-рецепторов в нейтрофилах является индуцибельной.

Идентификация субъединиц NMDA-рецептора в активированных in vivo

нейтрофилах

Считается доказанным, что для формирования функционального NMDA-рецептора в нервной системе млекопитающих необходима комбинация NR1 и NR2 субъединиц, делающая возможным одновременное связывание глицина и глутамата [Laube et al, 1993; Kuryatov et al, 1994; Grimwood et al, 1995]. Поэтому в качестве дополнительного доказательства экспрессии NMDA-рецепторов в нейтрофилах после их активации, мы провели идентификацию NR1 и NR2B субъединиц NMDA-рецептора в интактных и активированных invivoнейтрофилах с помощью Вестерн блоттинга. На Рис. 6 представлены результаты взаимодействия клеточного лизата со специфическими антителами на NR1 (А) и NR2B (Б) субъединицы NMDA-рецептора с последующей идентификацией белка.

Рис. 6. Идентификация NMDA-рецепторов в интактных и активированных invivoнейтрофилах крыс.

з

  1. -    контроль    на    неспецифическое    связывание протеин А-сефарозы с белками лизата;
  2. -    результат    иммунопреципитации    интактных клеток   с   антителами   на   NR1   (А)   и   NR2B   (Б)

250

4    субъединицы NMDA-рецептора;

150

3   -    результат    иммунопреципитации    активиро

ванных invivoклеток с антителами на NR1 (А) и

NR2B (Б) субъединицы NMDA-рецептора.

М   - фракция микросом, положительный контроль.

После окрашивания образцов клеточного лизата антителами на соответствующие субъединицы NMDA-рецептора в активированных invivoклетках выявляются два белка (их позиции на Рис. 6 отмечены овалами). Молекулярная масса белка, детектируемого на пленке А, лежит в районе 100 - 110 кДа, что соответствует известной из литературы молекулярной массе NR1 субъединицы NMDA-рецептора, которая находится в диапазоне

17


от 131 кДа (гликозилированная форма) до 102 кДа в случае отсутствия гликозилирования [Reyes-Montan et al, 2006]. Аналогично, полоса детектируемая на пленке Б в районе 180 -200 кДа, соответствует по молекулярной массе тирозин-фосфорилированной NR2B субъединице NMDA-рецептора [Lau, Huganir, 1995]. Появление ряда дополнительных полос (150-180) кДа мы объясняем частичным протеолизом образцов во время иммунопреципитации, поскольку с положительным контролем (препарат микросом мозжечка) произошли аналогичные изменения.

На Рис. 6 также видно, что в интактных нейтрофилах не выявляются белки, соответствующие исследуемым субъединицам NMDA-рецептора. Таким образом, мы заключаем, что активация нейтрофилов invivoсопряжена с экспрессией в них NMDA-рецепторов, причем эти рецепторы содержат как NR1, так и NR2B субъединицы NMDA-рецепторного комплекса, что необходимо для его полноценного функционирования.

Известно, что в нейронах, экспрессирующих NMDA-рецепторы, идет конститутивный синтез NR1 субъединиц, которые при отсутствии необходимого количества NR2 субъединиц долгое время могут удерживаться в эндоплазматическом ретикулуме [Prybylowski, Wenthold, 2004]. Поэтому мы дополнительно определяли экспрессию белка NR2B субъединицы на клеточной поверхности нейтрофилов с помощью окрашивания клеток антителами, специфичными к внеклеточному участку этого белка (Рис. 7).

В


контроль NMDANR2B

контроль KMDANE2B

м 1

м:

10'                 10'                 10"                 10'

FTTC


Рис. 7. Иммунофлуоресцентное окрашивание интактных (А) и активированных invivo(Б) нейтрофилов FITC-мечеными антителами к NR2B субъединице NMDA-рецептора. В -положительный контроль - окрашивание нейронов FITC-мечеными антителами к NMDA рецепторам.

На Рис. 7 видно, что после окрашивания активированных invivoнейтрофилов специфическими антителами к внеклеточному домену NR2B субъединицы NMDA-рецептора   происходит   смещение   пика   на   гистограмме   в   область   более   высокой

18


флуоресценции FITC по сравнению с контролем (Рис. 7 Б). Аналогичный результат наблюдается при окрашивании суспензии гранулярных клеток мозжечка (Рис. 7 В, положительный контроль), тогда как флуоресценция в образцах интактных нейтрофилов соизмерима с контрольной величиной (Рис. 7 А). Это свидетельствует о том, что в результате активации нейтрофилов invivoв них происходит не только экспрессия белков NMDA-рецептора, но и интернализация их на плазматической мембране клеток.

После того, как было показано наличие на мембране активированных invivoнейтрофилов функционально активных NMDA-рецепторов, осталось выяснить, могут ли данные рецепторы в нейтрофилах быть мишенью для действия ГЦ. Чтобы проверить эту гипотезу, мы использовали неконкурентный антагонист данных рецепторов МК-801 (дизоцилпин). Клетки инкубировали с 500 мкМ ГЦ в течение 30 мин при 37°С отдельно и в присутствии 5 мкМ МК-801, а затем измеряли уровень АФК хемилюминометрическим методом. Полученные результаты представлены на Рис. 8.

Рис. 8. Влияние ГЦ на интенсивность хемилюминесценции интактных (А) и активированных invivo(Б) нейтрофилов, в присутствии антагониста NMDA-рецепторов. Интактные клетки перед измерением активировали опсонизированым зимозаном, у активированных invivoклеток регистрировали собственную хемилюминесценцию. Знак «*» соответствует статистически значимым отличиям от контрольного значения (Р < 0,05).

На Рис. 8 видно, что в случае активированных invivoнейтрофилов действие ГЦ частично предотвращается в присутствии МК-801, в то время как в пробах, инкубированных только с МК-801, уровень АФК не отличается от контрольного. Интересно, что преинкубация интактных нейтрофилов с МК-801 не предотвращала подавляющего эффекта ГЦ. Таким образом, можно сделать вывод о том, что индуцируемое ГЦ усиление генерации АФК нейтрофилами, выделенными из очага острого воспаления, действительно осуществляется при участии NMDA-рецепторов.

19


4. Исследование других возможных путей реализации эффекта гомоцистеина

Из литературы также известно, что действие гомоцистеина на лимфоциты может осуществляться не только через ионотропные, но и через метаботропные глутаматные рецепторы [Владыченская и соавт., 2006; Zieminska et al, 2003], экспрессия которых происходит после активации данных клеток [Mashkina et al, 2007]. Исходя из полученных результатов, согласно которым эффект ГЦ предотвращался преинкубацией с МК-801 не полностью, мы предположили, что активация нейтрофилов invivoтакже может сопровождаться экспрессией одного или нескольких классов метаботропных глутаматных рецепторов.

Чтобы проверить данную гипотезу, мы провели иммунофлуоресцентное окрашивание нейтрофилов, находящихся в различных функциональных состояниях (перечень использованных антител приведен в Таблице 1). Полученные данные представлены на Рис. 9.


На Рис. 10 видно, что стимулирующий эффект ГЦ частично предотвращается ингибированием аденозиновых рецепторов второго типа. На основании полученных данных можно предположить участие аденозиновых рецепторов в регуляции ГЦ-индуцированного ответа клеток.

Полученные результаты согласуются с нашей гипотезой о том, что ГЦ усиливает генерацию АФК в нейтрофилах, выделенных из очага острого воспаления не только путем воздействия на NMDA-рецепторы. В реализации этого воздействия оказываются задействованы также А2а рецепторы, хотя детальный механизм обсуждаемого эффекта требует дальнейших и более подробных исследований.

21


ЗАКЛЮЧЕНИЕ

В настоящей работе мы впервые продемонстрировали, что влияние гомоцистеина на нейтрофилы зависит от функционального состояния клеток. ГЦ, не вызывая активации интактных нейтрофилов, в значительной степени стимулирует генерацию активных форм кислорода клетками, полученными из очага воспаления, индуцированного invivo, действуя через глутаматные рецепторы NIVIDA-класса, аналогично специфическому агонисту данных рецепторов, NMDA. Мы предполагаем, что данный эффект связан с активацией NADPH-оксидазы, для сборки которой, как известно из литературы, необходима активации Са -зависимых ферментов, таких как протеинкиназа С и тирозинкиназы [Liu et al, 1998; Kelher et al, 2003].

С другой стороны, в отсутствие дополнительной активации иммунокомпетентных клеток, гомоцистеин выступает в роли ловушки гипохлорит-аниона, аналогично таурину или карнозину, нейтрализуя гипохлорит, продуцируемый миелопероксидазой. Мы также продемонстрировали, что ГЦ уже в физиологических концентрациях обладает способностью ингибировать миелопероксидазу, снижая уровень свободных радикалов, продуцируемых нейтрофилами при локальной активации.

Появление в активированных invivoнейтрофилах NMDA-рецепторов, регулирующих активность этих клеток, частично объясняет цитотоксический эффект ГЦ. В случае, когда развитие патологических процессов сопровождается накоплением таких токсических метаболитов, как ГЦ, который является аналогом глутамата, способным активировать NMDA-рецепторы, его действие может быть направлено не только на нейроны, но и на клетки иммунной системы, экспрессирующие эти рецепторы. Недавно была показана способность ГЦ стимулировать образование АФК лимфоцитами периферической крови [Владыченская и соавт., 2006, Mashkina et al, 2007]. Все эти факты свидетельствуют, что в условиях гипергомоцистеинемии, осложненной любым воспалительным процессом, может иметь место избыточная драматическая активация клеток иммунной системы.

22


выводы

  1. ГЦ оказывает противоположно направленный эффект на нейтрофилы, находящиеся в различных функциональных состояниях.
  2. ГЦ подавляет дыхательный взрыв интактных нейтрофилов, выделенных из кровяного русла, путем прямого ингибирования миелопероксидазы, одновременно связывая продукт миелопероксидазной реакции, гипохлорит.
  3. В нейтрофилах, полученных из очага острого воспаления, в отличие от интактных клеток, обнаружено присутствие NR1 и NR2B субъединиц NMDA-рецептора. Метаботропные глутаматные рецепторы I и III классов отсутствуют у нейтрофилов как в интактном, так и в активированном состоянии.
  4. ГЦ вызывает увеличение продукции АФК в нейтрофилах, выделенных из очага острого воспаления, посредством действия на NMDА-рецепторы.
  5. Впервые показано, что нейтрофилы, выделенные из очага воспаления, обладают способностью экспрессировать NR1 субъединицу NMDA-рецептора denovo.
  6. Установлено, что в реализации прооксидантного эффекта ГЦ принимают участие аденозиновые рецепторы II типа.

23


СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

  1. Е.А. Брюшкова (2008). Влияние гомоцистеина и гомоцистеиновой кислоты на генерацию активных форм кислорода нейтрофилами грызунов. Международная конференция студентов, аспирантов и молодых ученых Ломоносов-2008 (Москва, Россия), с.32.
  2. А.А. Болдырев, Е.А. Владыченская, Л.В. Карпова, Е.А. Брюшкова, Е.Е. Аккуратов, М.С. Беляев, И.С. Добротворская, О.А. Трунова (2008). Роль природных факторов в защите мозга от окислительного стресса. Международная конференция Нейрохимические механизмы формирования адаптивных и патологических состояний мозга (Санкт-Петербург, Россия), с. 19.
  3. L. Karpova, Е. Bryushkova, A. Makhro, A. Mashkina, Е. Bulygina, Е. Vladychenskaya, М. Stepanova, Т. Fedorova, A. Boldyrev. Toxic effect of homocysteine on nervous and immune system (2008). Abstr. of II Ehrlich World Conference on Magic Bullets (Nurenberg, Germany), p. 151.
  4. E. Bryushkova, E. Vladychenskaya, T. Fedorova, A. Boldyrev. Molecular mechanisms of homocysteine toxicity (2009). Abstr. of 7f Int. Conference on Homocysteine Metabolism (Prague, Czech Republic), p.60.
  5. E. Bryushkova (2009). Toxic effect of homocysteine on neutrophils is mediated by NMDA-receptors. Abstr. of I2l Int. Congress on Molecular Mechanisms of Neurological and Psychiatric Disorders. (Martin, Slovakia), p.3 8.
  6. A. Boldyrev, E. Bryushkova, A. Mashkina, E. Vladychenskaya, T. Fedorova, M. Maximova, S. Illarioshkin (2011). Hyperhomocysteinemia as a risk factor for neuronal and immune systems. In the book «Molecular Mechanisms of Neurological and Psychiatric Disorders». (Babusikova E., Dobrota D. and Lehotsky J., Eds.), 1, 86-101.
  7. E.A. Брюшкова, E.A. Владыченская, М.С. Степанова, А.А. Болдырев (2011). Влияние гомоцистеина на свойства нейтрофилов, активированных in vivo. Биохимия, 76(4), 573-580.
  8. Е.А. Bryushkova, O.V. Tyulina (2011). Dual effect of homocysteine on rat neutrophils. Abstr. of 6l European Meeting for Vascular Biology and Medicine (Krakow, Poland), p.152.
  9. А.А. Болдырев, E.A. Брюшкова, E.A. Владыченская (2012). NMDA-рецепторы в клетках иммунной системы. Биохимия, 11(2), 160-168.

24


ДЛЯ ЗАМЕТОК

25


ДЛЯ ЗАМЕТОК

26

 
Авторефераты по темам  >>  Разные специальности - [часть 1]  [часть 2]



© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.