Добро пожаловать!


На правах рукописи

Саттаров Венер Нуруллович

морфология медоносных пчел Apis mellifera l. и стратегия сохранения их в республике башкортостан

Специальность 06.02.01 – диагностика болезней и терапия животных, патология, онкология и морфология животных


диссертации на соискание ученой степени

доктора биологических наук

Уфа 2011

Работа выполнена на кафедре биологии, пчеловодства и охотоведения ФГОУ ВПО «Башкирский государственный аграрный университет»

Научный консультант:

доктор биологических наук, профессор

Туктаров Варис Рафкатович

Официальные оппоненты:

доктор биологических наук, профессор Андреева Альфия Васильевна

доктор биологических наук, профессор

Селезнев Сергей Борисович

доктор биологических наук профессор Абрамова Людмила Леонидовна

Ведущая организация:

ФГОУ ВПО «Московская государственная академия ветеринарной медицины и биотехнологии им. К.И. Скрябина»

Защита состоится 27 мая 2011 г. в 1200 часов на заседании диссертационного совета Д 220.003.02 при ФГОУ ВПО «Башкирский государственный аграрный университет» по адресу: 450001, г. Уфа, ул. 50-летия Октября, 34, корп. 4

       С диссертацией можно ознакомиться в библиотеке ФГОУ ВПО «Башкирский государственный аграрный университет» и на сайте http//www.bsau.ru/.

Автореферат разослан «____» __________ 2011 г.

       Автореферат размещен на официальном сайте ФГОУ ВПО «Башкирский государственный аграрный университет» www.bsau.ru

Автореферат разослан __ ______ 20__ г.

Ученый секретарь

диссертационного совета,

доктор ветеринарных наук,


Ф.А. Каримов

общая характеристика работы

Актуальность темы: Аборигенные породы медоносных пчел Apis mellifera являются ценными генетическими ресурсами; они проявляют устойчивость к тем подчас крайне тяжелым экологическим условиям, в которых они формировались, отличаясь при этом высокой устойчивостью к различным болезням. Благодаря этим своим качествам они с успехом могут использоваться в селекционных программах. Сохранение аборигенных пород (рас) пчел является неотъемлемой частью стратегических программ, основанных на национально-культурных традициях и наследиях человечества (А.М. Ишемгулов, 2001, Н.И. Кривцов, 2003). Разработка этих программ требует фундаментальных популяционных исследований состояния исчезающих пород и внедрение экономически допустимых мероприятий (Ю.П. Алтухов, 1995, 2001, 2003; И.Г. Моисеева, С.В. Уханов и др., 2006).

Урал является уникальной природной зоной с богатым видовым разнообразием фауны и флоры. В последние десятилетия прошлого века в связи с усилением антропогенного воздействия и недостаточной изученностью вопросов сохранения башкирской популяции среднерусской породы (расы) пчел Apis mellifera mellifera L., происходит определенная трансформация и метизация этой уникальной популяции (А.В. Бородачев, 1999, 2001; М.Г. Гиниятуллин и др., 1999; Н.И. Кривцов, 1995; 1998; 1999; 2000; В.А. Тюльпанов, 1958; Г.И. Чиглинцев, 1961, И.В. Шафиков, 1992; 1999; 2003;). Прогрессирующее ухудшение состояния среды обитания пчел, отсутствие целенаправленной программы разведения и бессистемная стихийная гибридизация привели к частичной гибели и значительному сокращению численности пчелиных семей, снижению объема производимой продукции и нарушению уникальных многовековых популяционных систем среднерусской расы (Г.Д. Билаш, 1991; А.Н. Бурмистров, Н.И. Кривцов, В.И. Лебедев, 2006; Н.И. Кривцов, 2000; 2003; Ю.А. Черевко и др., 2006;), в т. ч. башкирской популяции Apis.

Согласно, концепции популяционных систем виды живых организмов имеют динамическую субпопуляционную структуру. Однако, усиление антропогенного влияния отрицательно сказывается на данной структуре и является одной из причин необратимых изменений генетического разнообразия популяций. В целях сохранения, размножения и совершенствования генетического разнообразия сельскохозяйственных популяций животных, в том числе пчел разработаны специальные методы селекции (А.М. Ишемгулов, 2001), сочетающие умеренный отбор по признакам продуктивности с одновременным стабилизирующим отбором по адаптивно-значимым признакам. Разработка методов стабилизации генетической структуры сельскохозяйственных популяций и принципов управления наследственным разнообразием природных популяций служит основой для устойчивого существования современных сельскохозяйственных популяций (А.В. Яблоков, 1987; Ю.П. Алтухов, 2003).

В связи с вышеизложенным очевидно, что особую актуальность на современном этапе приобретают исследования перспектив интенсивного развития пчеловодства, что, непосредственно, связано с проведением оценки современного состояния популяционных структур пчел. Основополагающим принципом при проведении данных работ является оценка чистопородности пчел с применением комплекса методов идентификации морфологических породоопределяющих признаков и разработка на этой основе комплексных стратегических мер по сохранению, разведению и распространению локальных популяций.

Цель работы комплексное изучение морфологии породоопределяющих признаков пчел и анализ антропогенного влияния на генетическую устойчивость башкирской популяции среднерусской расы (породы) медоносной пчелы. Разработка нового научно-методического подхода к оценке морфологических и хозяйственно-полезных признаков медоносных пчел. На основании оценки морфологии породоопределяющих признаков, разработка локальной системы сохранения и разведения башкирской популяции среднерусской породы (расы) медоносной пчелы Apis mellifera mellifera L. и проведение паспортизации породной принадлежности Apis по административным районам Республики Башкортостан (РБ).

Задачи исследований:

  • Изучить морфологию породоопределяющих признаков рабочих пчел на территории Республики Башкортостан для определения интенсивности антропогенного влияния на породную структуру башкирской популяции среднерусской породы (расы) Apis mellifera mellifera L.;
  • Изучить морфологию породоопределяющих признаков трутней для определения чистопородности маток в выявленных резерватах Apis mellifera mellifera L.;
  • Определить популяционно-генетические изменения породной структуры пчел на территории Республики Башкортостан, используя молекулярно-генетический метод;
  • Разработать новый научно-методический подход к оценке морфологических и хозяйственно-полезных признаков медоносных пчел, позволяющий регулировать и рационально использовать их породные ресурсы;
  • На основании оцененных морфологических признаков создать паспорта породной принадлежности Apis mellifera по административным районам Республики Башкортостан;
  • Разработать логико-смысловую модель и стратегию, сохранения генофонда, размножения и разведения среднерусской породы (расы) медоносной пчелы.

Научная новизна. В работе изложены материалы комплексных исследований современного состояния популяционной структуры Apis mellifera на территории Республики Башкортостан, представляющих развитие нового подхода при проведении селекционно-племенных мероприятий в пчеловодстве. Впервые с помощью морфометрического метода идентификации породной принадлежности трутней проведена комплексная оценка чистопородности маток на территории Республики Башкортостан. При реализации данных мероприятий разработан и впервые использован модифицированный метод оценки окраски волос трутней (шкала оценки Гетце переведена в числовую индексацию), унифицирован метод оценки длины волосков на 5-ом сегменте брюшка рабочих пчел. Проведен учет и анализ антропогенного воздействия на породный состав пчел по административным районам Республики Башкортостан. Впервые разработана логико-смысловая модель сохранения башкирской популяции среднерусской породы (расы) пчел; на основании оценки морфологии породных признаков Apis mellifera, разработана методика и проведена паспортизация породной принадлежности пчел по административным районам Республики Башкортостан, для решения проблем с сохранением и распространением пчел башкирской популяции Apis mellifera mellifera L.

Практическая значимость и реализация результатов исследований.

Знание породной ситуации башкирской популяции среднерусской породы (расы) пчел служит теоретической и практической базой для ведения современных и научно обоснованных мероприятий по дальнейшему сохранению, разведению, размножению и распространению пчел данной популяции. Апробированные методы морфометрической идентификации чистопородности трутней и молекулярно-генетическая оценка рабочих пчел позволяют контролировать чистопородность племенного материала при проведении селекционно-племенных мероприятий. Использование традиционного метода идентификации пчел по рабочим особям служит руководством пчеловодам-практикам при проведении экспресс анализа первичного материала. Создание на основе проведенных исследований паспорта административного района по породности пчел обеспечивает переход на качественно новый уровень проведения селекционно-племенных мероприятий. Разработанная логико-смысловая модель и стратегия сохранения башкирской популяции Apis mellifera mellifera L. используются впервые и позволяют изменить традиционные подходы к данной отрасли. В качестве участников реализации стратегии рассматриваются различные слои и направления современного общества, в частности, стратегические мероприятия, должны проводиться не только в рамках агропромышленного комплекса, но и охватывать индивидуумы, начиная с профильных классов общеобразовательных учреждений, с учетом влияния личности учителя, нормативно-правовых актов и т.д.

На основании проведенных исследований разработана методическая рекомендация:

- «Применение метода идентификации породной принадлежности медоносных пчел Apis mellifera, основанной на полиморфизме локуса COI-COII мтДНК с применением технологии ПЦР» (Утверждена РАСХН, протокол №4 от 4.06.08г.).

Полученные данные включены в учебные и учебно-методические пособия:

«Пчеловодство» / Учебное пособие. Допущено УМО ВУЗ РФ в качестве учебного пособия для студентов высших учебных заведений, обучающихся по специальности 111401- Зоотехния и 111201- Ветеринария. Уфа, РИО РУНМЦ МО РБ, 2010. - 434с.,

«Медоносная пчела Республики Башкортостан» / Учебное пособие. (Уфа, РИО РУНМЦ МО РБ, 2004.-76с.);

«Современные методы идентификации медоносной пчелы» / Учебно-методическое пособие. (Уфа, РИО РУНМЦ МО РБ, 2004.-31с.).

Они также могут быть использованы, в качестве справочного материла, в учебном процессе при чтении лекций, и проведении лабораторно-практических занятий у студентов зооинженерного, ветеринарного и биологического факультетов. Данные методические рекомендации могут быть использованы в научно-исследовательских институтах, лабораториях, селекционно-племенных пасеках, а также в ВУЗ при проведении занятий по пчеловодству, генетике, популяционной биологии и зоологии.

Апробация работы. Материалы диссертации доложены на конференции «Проблемы физико-химической биологии» (Пущино, 2000), научно-практической конференции «Проблемы сохранения биоразнообразия на Южном Урале» (Уфа, 2004), международной научно-практической конференции «Проблемы и пути интенсификации племенной работы в отраслях животноводства» (Уфа, 2004), на Всероссийской конференции с участием зарубежных ученых «Сибирская зоологическая конференция» посвященная 60-летию ИС и ЭЖ СО РАН (15-22 сентября 2004 г.), конференции «Вклад особо охраняемых природных территорий в экологическую устойчивость региона», посвященной 75-летию БГП заповедника (Уфа, 2005), Всероссийской научно-практической конференции УРАЛЭКОЛОГИЯ природные ресурсы (Оренбург, 2005), на конференции «Достижения энтомологии, на службе АПК, лесного хозяйства и медицины. XIII съезд Русского энтомологического общества», (Краснодар, 2007), международной научно-практической конференции проведенной Ставропольским отделением Русского энтомологического общества (Ставрополь, 2008), международной научно-практической конференции «Современная экология – наука XXI века» (Рыбное, 2008), Всероссийской научно-практической конференции «Передовые технологии в животноводстве» в рамках проведения 70-летия кафедры кормления сельскохозяйственных животных БГАУ (Уфа, 2008), заочной международной научно-практической конференции «Биоразнообразие, охрана природы и здоровье в РБ» (Стерлитамак, 2008), на XI Российской агропромышленной выставке, Российской агропромышленной неделе «Золотая осень-2009», диплом, серебряная медаль (Москва, ОАО ГАО ВВЦ, 2009); международной научно-практической конференции, посвященной 80-летию ФГОУ ВПО БГАУ (Уфа, 30 сентября-1 октября 2010).

Связь работы с научно-исследовательскими темами. «Физиолого-биохимические особенности холодоустойчивости башкирской популяции среднерусской породы медоносной пчелы» (АН РБ, № 1, 1996-1998); «Генетико-биохимические особенности башкирской популяции среднерусской расы медоносной пчелы» (РАН, № 01.9.60001037, 1996-1998); «Молекулярно-генетическая паспортизация генофонда башкирской популяции медоносной пчелы» (АН РБ, № 15, 1999-2000); «Молекулярные механизмы адаптивности южно-уральской популяции Apis mellifera mellifera к современным условиям обитания» (РАН, № 01.99.0008299, 1999-2000); «Разработка комплекса молекулярно-генетических методов для контроля состояния генофонда башкирской пчелы» (АН РБ, № 17, 1999-2000гг); «Биологическое разнообразие энтомофауны Республики Башкортостан» (АН РБ, № 19-127-05 на выполнение работ по НИР по государственной научно-технической программе, 2005-2008).

Публикации. По теме диссертации опубликовано 35 научных работ, из них: одна монография, одна методическая рекомендация (Утверждена РАСХН, протокол №4 от 4.06.08г.); десять изданий, рекомендованных ВАК РФ, одно учебное пособие «Пчеловодство» (допущено УМО ВУЗ РФ в качестве учебного пособия для студентов ВУЗ по специальности 111401- «Зоотехния» и 111201- «Ветеринария») и программы по дополнительной профессиональной образовательной программе «Школьное пчеловодство».

Структура и объем диссертации. Работа состоит из введения, обзора литературы, материалов и методов исследований, результатов собственных исследований и обсуждения, выводов, заключения, практических предложений, библиографического списка и приложения. Библиографический список содержит 430 наименований отечественных и зарубежных авторов. Диссертационная работа изложена на 390 страницах машинописного текста, иллюстрирована 80 таблицами и 40 рисунками.

Основные положения, выносимые на защиту:

1. Морфология породоопределяющих признаков рабочих пчел и трутней на территории Республики Башкортостан

2. Цифровая шкала окраски волос трутней;

3. Длина волосков на 5-ом сегменте брюшка рабочих пчел;

4. Модифицированная методика проведения бонитировки пчелиных семей.

5. Паспортизация пасек в административных районах Республики Башкортостан;

6.Логико-смысловая модель и локальная (региональная) система сохранения и разведения башкирской популяции среднерусской породы (расы) Apis mellifera mellifera L.

Материал и методы исследований

Работа выполнялась с 1996 по 2010 гг. Развитие современного пчеловодства в конкретном регионе полностью зависит от эволюционно сложившихся природно-климатических зон. В связи с интенсивным развитием отраслей АПК на современной территории Республики Башкортостан выделяют 6 природно-сельскохозяйственных зон: северная, северо-восточная и южная лесостепные, предуральская и зауральская степные и горно-лесная (Ф.Х. Хазиев и др., 1995; А.М. Ишемгулов, 2005) (рис. 1.).

Рисунок 1. Природно-сельскохозяйственные зоны

Республики Башкортостан (по А.М. Ишемгулову, 2005)

1 - Абзелиловский, 2 - Альшеевский, 3 - Архангельский, 4 - Аскинский, 5 - Аургазинский, 6 - Баймакский, 7 - Бакалинский, 8 - Балтачевский, 9 - Белебеевский, 10 - Белокатайский, 11 - Белорецкий, 12 - Бижбулякский, 13 - Бирский, 14 - Благоварский, 15 - Благовещенский, 16 - Буздякский, 17 - Бураевский, 18 - Бурзянский, 19 - Гафурийский, 20 - Давлекановский, 21 - Дуванский, 22 - Дюртюлинский, 23 - Ермекеевский, 24 - Зианчуринский, 25 - Зилаирский, 26 - Иглинский, 27 - Илишевский, 28 - Ишимбайский, 29 - Калтасинский, 30 - Караидельский, 31 - Кармаскалинский, 32 - Кигинский, 33 - Краснокамский, 34 - Кугарчинский, 35 - Кушнаренковский, 36 - Куюргазинский, 37 - Мелеузовский, 38 - Мечетлинский, 39 - Мишкинский, 40 - Миякинский, 41 - Нуримановский, 42 - Салаватский, 43 - Стерлибашевский, 44 - Стерлитамакский, 45 - Татышлинский, 46 - Туймазинский, 47 - Уфимский, 48 - Учалинский, 49 - Федоровский, 50 - Хайбуллинский, 51 - Чекмагушевский, 52 - Чишминский, 53 - Шаранский, 54 - Янаульский.

Учет породной принадлежности пчел на пасеках невозможен, без учета административных факторов. Поэтому сбор пчел и анализ данных проводился по природно-сельскохозяйственным зонам, но с учетом административных районов. Следующий аспект, который был учтен при сборе и анализе данных, связан с горно-лесной зоной, где располагаются благоприятные условия для сохранения резерватов пчел среднерусской (расы) породы (ГПЗ «Шульган-Таш»).

Объектами исследований явились имаго медоносных пчел: рабочие особи и трутни. Экспедиционные исследования проводились на пасеках, в 33 административных районах РБ. Камеральная обработка материала проводилась в лабораториях энтомологии кафедры биологии и биологического образования, зоологического музея ГОУ ВПО «БГПУ им. М.Акмуллы» и кафедры биологии, пчеловодства и охотоведения ФГОУ ВПО «БГАУ».

В работе использован комплексный подход оценки морфологии породоопределяющих признаков Apis mellifera, сочетающий три метода идентификации породной принадлежности:

  • общепринятый морфометрический метод оценки рабочих пчел с компьютерным анализом данных в программе Microsoft Office Excel, 2007;
  • модифицированный метод оценки длин волосков на 5-ом сегменте брюшка рабочих пчел с компьютерным анализом данных в программе Microsoft Office Excel, 2007;
  • модифицированный европейский морфометрический метод оценки трутней с компьютерным анализом данных (Microsoft Office Excel, 2007);
  • молекулярно-генетический метод, основанный на полиморфизме локуса COI-COII мтДНК с применением технологии ПЦР.

Статистическая обработка. Для анализа сводных (цифровых) данных использовалась компьютерная программа Statistica версия 6.1., Copyright9 StatSoft, lnc. 1984-2004 и программное обеспечение Microsoft Office Excel, 2007. Сопоставление полученных результатов проводили с общепринятыми европейскими стандартами (Н.И. Кривцов, 1998; Ф. Руттнер, 2006).

Методы сбора проб рабочих пчел и трутней для морфометрического анализа. Проба на отбор насчитывала по 30 рабочих пчел и трутней. (Н.И. Кривцов, 1986). Морфометрические признаки рабочих пчел определяли по стандартной общепринятой методике. Оценку признаков трутней проводили по идентичной методике, но определение окраски волос трутней по шкале Гетце производили до стандартной обработки водой, доведенной до кипения.

Препарирование и измерение хитиновых частей тела пчелы. При проведении измерений использовали окуляр-микрометр стереоскопического микроскопа МБС-10. Линейные промеры, выполненные в делениях окуляр микрометра, переводили в мм, а индексы выражали в процентах (кроме трутней).

Определение длины волосков на 5-ом сегменте брюшка рабочих пчел. Измерение длины волосков на пятом сегменте проводили до стандартной обработки пчел кипятком. Для проведения эффективных и точных измерений длины волосков использовали модифицированный метод измерения с помощью ручной лупы (“CARLZEISS – JENA”) (рис. 2) с десятикратным увеличением, на которой имеются деления 1/10 мм.

Рисунок. 2. Ручная лупа фирмы “Carlzeiss Jena”

Определение морфометрических признаков рабочих пчел и трутней. Определяли 15 признаков рабочих пчел и три признака трутней: окраска волос по шкале Гетце (рис. 3), кубитальный индекс, длина хоботка. Для удобства работы и возможности цифровой обработки данных, полученные цвета по шкале Гетце перевели в цифры. Цифровую индексацию провели по 8-ми бальной шкале, начиная от светлых тонов, т.е. желто-гороховый – 1, желто-айвовый – 2; серо-песчаный – 3, серо-глинистый – 4; коричнево-ржавый – 5, коричнево-кофейный – 6; черно-дымный – 7 и черный-сажа – 8 баллов.

Рисунок 3. Цветовая шкала для определения

окраски волосков у трутней (по Гетце)

Молекулярно-генетический метод. Основан на полиморфизме локуса COI-COII мтДНК с применением технологии ПЦР. По нуклеотидному составу мтДНК A. m. mellifera L. отличается высоким содержанием АТ-пар. Участок, расположенный между генами CO-I и CO-II, за исключением последовательности гена тРНК, сильно отличается по нуклеотидному составу, например, элемент Р-протяженность 54пн, состоит только из АТ-пар, а содержание этих нуклеотидов в Q-элементе (длине 196пн) составляет 93% (Cornuet, et al., 1991) (рис. 4). В качестве праймеров подобраны два олигонуклеотида: CACATTTAGAAATTCCATTA и ATAAATATAAATCATGTGGA, приходящиеся, соответственно, на 31 и 51 концевые последовательности генов CO-I и CO-II.

Размер фрагментов ДНК (пн)

Рисунок 4. Специфический для Apis mellifera вариабельный участок мтДНК (Crozier, Crozier, 1993)

Рисунок 5. ПЦР-анализ со специфичными праймерами (локус COI-COII мтДНК Apis mellifera). М - ДНК фага (маркер), А, Б - среднерусская раса, В - кавказская раса

Ожидаемый размер амплифицируемых праймеров, фрагментов мтДНК составляет 350±10пн в случае комбинации Q и 600±10пн при комбинации PQQ (Ю.М. Никоноров и др., 1998). Результаты амплификации мтДНК отдельных особей медоносной пчелы представлены на рис. 5. Секвенирование нуклеотидной последовательности амплифицированного фрагмента мтДНК бортевой пчелы башкирской популяции A. m. mellifera L. показало, что участок состоит из 600пн и включает следующие последовательности: 31-конец гена-CO-I-ген-тРНКLeu-элемент Р-элемент Q-элемент Q–51-конец гена CO-II. Выявлены определенные замены нуклеотидов в пределах исследуемого участка мтДНК A. m. mellifera L. по сравнению с ранее опубликованной последовательностью (Cornuet et al, 1991) (рис. 6.).

Рисунок 6. Нуклеотидная и аминокислотная последовательности локуса COI-COII мтДНК Apis mellifera mellifera L. 1 - нуклеотидная последовательность определенная нами; 2-нуклеотидная последовательность, определенная Cornuet et al. (1991)

Выделение ДНК из индивидуальных особей проводили стандартным методом гуанидинтиоционатно-фенольно-хлороформной экстракции (Маниатис и др., 1984; Сhomezynski, Sacchi, 1987). Амплификацию мтДНК проводили методом полимеразной цепной реакции (ПЦР) в термоциклере «Циклотерм» (Chomezynski, Sacchi, 1987). Фракционирование и электрофоретический анализ продуктов амплификации проводили в 1,5%-ном агарозном геле. После окончания электрофореза гель окрашивали в растворе бромистого этидия и просматривали в проходящем УФ-свете с длиной волны 312нм (трансиллюминатор ТМ-36 фирмы «UV-Products» (Vieira, Messing, 1987).

Результаты и обсуждение

1. Морфометрический полиморфизм рабочих особей медоносной пчелы Apis mellifera

Для оценки морфологических особенностей экстерьерных признаков рабочих пчел, были собраны следующие количества проб: северная лесостепная зона восемь из 14 районов (1700 п/с), северо-восточная лесостепная - пять районов (1100 п/с), южная лесостепная – шесть из 11 районов (1200 п/с), предуральская степная – восемь из 17 районов (1750 п/с), зауральская степная – четыре района (900 п/с) и горно-лесная – два из трех районов (400 п/с). Таким образом, нами были проведены исследования рабочих пчел в 33 из 54 административных районов РБ. Общее количество проб составило 7050 п/с. Полученные результаты оценки морфометрических признаков пчел представлены в табл. 1.

По результатам исследований морфометрических признаков рабочих пчел в целом на территории Республики Башкортостан наблюдается неблагоприятное влияние антропогенных факторов на башкирскую популяцию среднерусской породы медоносной пчелы, о чем свидетельствует наличие гибридизированных форм Apis mellifera (60,6%). Более подробная картина выглядит следующим образом (табл. 2): в четырех природно-сельскохозяйственных зонах республики количественный состав гибридизированных пчел представлен в интервале от 56 до 92,7%, и соответственно, пчелы идентифицированы как среднерусские от 44 до 7,3%. Лишь в двух зонах исследования позволили выявить доминантное содержание пчел среднерусской породы: горно-лесная - 84% и северная лесостепная - 62%.

Таблица 1. Результаты морфометрических измерений рабочих пчел в природно-сельскохозяйственных зонах Республики Башкортостан

Название морфометрических параметров


Наименование природно-сельскохозяйственных зон и результаты оценки морфометрических признаков

рабочих пчел Apis mellifera


Северная Зауральская степная

Южная лесостепная

Северо-восточная лесостепная

Северная лесостепная

Длина хоботка, мм













Длина правого переднего крыла, мм













Ширина правого переднего крыла, мм













Площадь правого переднего крыла, мм2













Кубитальный индекс, %













Длина 4-го тергита, мм













Ширина 4-го тергита, мм













Площадь 4-го тергита, мм2













Длина 4-го стернита, мм













Ширина 4-го стернита













Площадь 4-го стернита, мм2













Длина воскового зеркальце, мм













Ширина воскового зеркальце, мм













Площадь воскового зеркальце, мм2













Тарзальный индекс, %













Данная тенденция, наблюдаемая в природно-сельскохозяйственных зонах, имеет свои особенности, которые характеризуют специфику этих зон и связаны с различными факторами. На доминантное содержание пчел среднерусской породы (расы) в северной лесостепной зоне влияют следующие факторы: наличие выявленного резервата в Татышлинском районе, двух племенных хозяйств по пчеловодству и приграничное расположение Пермской области, где ранее проведенными исследованиями было выявлено высокое содержание среднерусских пчел (Р.А. Ильясов, 2006). К этим факторам можно отнести также низкое содержание сельскохозяйственных угодий (47,8% - средняя и слабая, местами очень слабая сельскохозяйственная нагрузка), наличие липовых насаждений (1/3 всех липовых лесов РБ) и расположенность в данной зоне заказников (Бирский, Аскинский), которые предусматривают проведение природоохранных мероприятий, способствующих, возможно, второстепенно на сохранность пчел в данной зоне. Тем не менее, наши исследования выявили наличие гибридизированных пчел, что связано с наличием в этой зоне Башкирской опытной станции пчеловодства (Иглинский район), где ранее нами было выявлено 82% гибридизированных форм. Кроме того, в данном районе сконцентрировано самое большое количество пчелосемей по республике (14206 шт.). Вследствие этого, на данной территории сформировались условия, способствующие гибридизации пчел.

В северо-восточной лесостепной зоне проведенные исследования позволили выявить высокий процент «биологического загрязнения» (92,7% гибридизированных форм пчел). Это вызвано, на наш взгляд, с приграничным расположением данной зоны с Челябинской и Свердловской областями, а также сильная, местами очень сильная сельскохозяйственная нагрузка. Видимо это связано с тем, что даже при наличии существующих и планируемых особо охраняемых территорий в этой зоне популяционная структура не выдерживает антропогенного влияния.

На породный состав пчел южной лесостепной зоны влияет фоновое расположение некоторых районов на границе с Республикой Татарстан, близкое расположение Башкирской опытной станции пчеловодства (Иглинский район), а также расположенность многих районов данной зоны в центральной части Республики Башкортостан с высокой антропогенной нагрузкой. Положительное влияние на породную структуру популяции в данной зоне оказывают следующие факторы: близость горно-лесной зоны, для которой характерна географическая изоляция; обилие липовых и кленовых лесов, являющихся источником массовых медосборов; наличие заповедников, национальных и природных парков и заказника. Эти факторы способствуют высокому содержанию пчел среднерусской породы и умеренному количественному составу гибридизированных форм (16%).

Породная структура медоносных пчел предуральской степной зоны характеризуется наличием гибридизированных форм благодаря наличию большого количества сельскохозяйственных угодий (70%, средняя, сильная, местами очень сильная нагрузка) и приграничным расположением многих районов с Оренбургской областью. Наличие сельскохозяйственных угодий способствует высокой плотности энтомофильных культур, что вызывает многократные перевозки пчел в течение сезона и, естественно, данное мероприятие будет способствовать гибридизации пчел при наличии завоза пакетов и маток иной породы.

Таблица 2. Соотношение пчелиных семей среднерусской породы (расы)

Apis mellifera mellifera L. и гибридизированных форм в природно-сельскохозяйственных зонах Республики Башкортостан

№ п/п

Название природно-сельскохозяйственных зон

Количество исследованных семей, шт.

Соотношение пчелиных семей среднерусской породы (расы)

Apis mellifera mellifera L.

и  гибридизированных, шт/%




Северная лесостепная


1050 (62%)

650 (38%)


Северо-восточная лесостепная


80 (7,3%)

1020 (92,7%)


Южная лесостепная


530 (44%)

670 (56%)


Предуральская степная


378 (24%)

1172 (76%)


Зауральская степная


321 (36%)

579 (64%)




337 (84%)

63 (16%)



2696 (39,4%)

4154 (60,6%)

Высокое процентное соотношение гибридизированных пчел в зауральской степной зоне (64%), на наш взгляд, вызвано, наличием аналогичных причин, как и в предуральской степной зоне (сельскохозяйственная нагрузка и приграничное расположение с соседними областями).

В заключение необходимо отметить, что наблюдаемая картина породной структуры пчел на территории Республики Башкортостан требует разработки и реализации, стратегических мер и программ по сохранению и размножению башкирской популяции среднерусской породы медоносной пчелы. При сохранении, как видов, так и пород необходимо поддерживать высокую численность популяции, так как малые численности ведут, по крайней мере, к трем опасным последствиям:

  • снижение аллельного разнообразия, полиморфизм популяции утрачивается в результате генетического дрейфа;
  • инбредная депрессия, снижающая жизнеспособность и в перспективе могущая привести к вымиранию популяции;
  • возрастание угрозы вымирания в силу внешних случайных причин: эпизоотий, стихийных бедствий, неправильных административных решений (И.Г. Моисеева, С.В. Уханов, и др., 2006).

1.1. Результаты морфометрических измерений пчел по длине волосков на 5-ом сегменте брюшка рабочих пчел Apis mellifera

Нами была апробирована и модифицирована (применена ручная лупа фирмы “CARLZEISS – JENA” с десятикратным увеличением, на которой имеются деления 1/10 мм) методика определения породной принадлежности пчел по длине волосков на 5-ом сегменте брюшка рабочих пчел. Сопоставление полученных результатов длин волосков проводили со стандартами (Ф. Руттнер, 2006) из доступных нам литературных источников: среднерусская – длинные (0,4-0,6 мм); краинская, итальянская – короткие (0,25-0,35 мм) и карпатская породы – короткие (0,25-0,35 мм). При этом статистическая взаимосвязь (коэффициент корреляции или парный коэффициент корреляции) полученных величин (табл. 3) составила 0,83, что отражает наличие сильной связи между этими морфометрическими показателями (длина хоботка, кубитальный индекс, волоски на 5-ом сегменте).

Таблица 3. Показатели морфометрических признаков медоносных пчел Apis mellifera частных пасек Республики Башкортостан



хоботка, мм


индекс, %


5-го сегмента, мм













































































Таким образом, данные результаты показывают информативность определения породной принадлежности пчел по длине волосков на 5-ом сегменте брюшка рабочих пчел.

Нами также было выявлено, что загрязнение кормов различными экотоксикантами, вызывает наряду со снижением количества расплода, изменения массы разных отделов тела и морфологических показателей пчел Apis mellifera.

2. Морфометрический полиморфизм трутней Apis mellifera

В современном пчеловодстве при оценке породной принадлежности пчелиных семей значительное внимание уделяется морфологической характеристике рабочих пчел. Морфология трутней в большинстве исследований или опускается вообще, или ей придается второстепенное значение. Между тем, имея гаплоидный характер наследования, трутни могут с большей точностью характеризовать породную чистоту пчелиных семей (чистопородные матки производят однотипных трутней, в то время как трутни от помесных маток наследуют широкое разнообразие признаков, вследствие гибридизации). Переход на чистопородное разведение и поддержание породности в чистоте методом создания насыщенного чистопородного трутневого фона можно осуществлять на любой пасеке, но особенно ощутимые результаты будут получены там, где в процесс по чистопородному разведению пчел одновременно включаются хозяйства района, области или региона. Вследствие этого, определение чистопородности маток в выявленных резерватах проводили на основе морфологических особенностей экстерьерных признаков трутней. Полученные данные представлены в табл. 4.

Таблица 4. Результаты морфометрических измерений трутней в разрезе природно-сельскохозяйственных зон Республики Башкортостан

Название морфометрических параметров



Наименование природно-сельскохозяйственных зон и результаты оценки морфометрических признаков трутней

Северная лесостепная

Северо-восточная лесостепная



Предуральская степная

Зауральская степная


Окраска волос, индекс















Длина хоботка,
















Кубитальный индекс















Анализ полученных результатов показывает, что из общего количества 16 районов (всех природно-сельскохозяйственных кормовых зон), где нами была проведена оценка экстерьерных признаков рабочих особей, выделяются 13 районов, в которых породоопределяющие признаки, как рабочих пчел, так и трутней в исследованных семьях идентичны (соответствуют стандарту среднерусской (расы) породы). Сложившаяся ситуация по исследованным нами морфологическим признакам говорит о чистопородности маток в исследованных семьях этих пасек, которые располагаются в данных (13) административных районах. Такая ситуация, по нашему мнению, сложилась в изученных районах вследствие умеренного антропогенного влияния (табл. 5.).

Поскольку у пчел не существует самостоятельной наследственности по мужской линии, трутень имеет гаплоидное число хромосом, т.е. он несет геном матери и служит передаточным звеном в обмене маток наследственностью. Наследственность, передаваемая трутнями в последующих поколениях, начинает преобладать. Таким образом, наблюдаемая нами картина в этих районах может говорить о происходящем поглотительном скрещивании.

Таблица 5. Соотношение чистопородности пчелиных семей по морфометрическим признакам рабочих пчел и трутней





исследованных пчелосемей, шт.

Кол-во и % семей к кол-ву исследованных семей

по рабочим пчелам

по трутням

Северная лесостепная природно-сельскохозяйственная зона




250 (100%)

250 (100%)




200 (100%)

200 (100%)




200 (100%)

200 (100%)




200 (100%)

200 (100%)




200 (100%)

200 (100%)



1050 (100%)


Северо-восточная лесостепная природно-сельскохозяйственная зона




120 (60%)

80 (40%)



120 (60%)

80 (40%)

Южная лесостепная природно-сельскохозяйственная зона




200 (100%)

200 (100%)




200 (100%)

200 (100%)



400 (100%)


Предуральская степная природно-сельскохозяйственная зона




93 (46,5%)

93 (46,5%)




147 (38,8%)

147 (58,8%)




138 (55,2%)

195 (78%)



378 (54%)

435 (62,1%)

Зауральская степная природно-сельскохозяйственная зона




195 (78%)

195 (78%)




157 (78,5%)

157 (78,5%)




83 (41,5%)

83 (41,5%)



435 (66,9%)

435 (66,9%)

Горно-лесная природно-сельскохозяйственная зона




157 (78,5%)

200 (100%)




180 (90%)

180 (90%)



337 (84,3%)

380 (95%)

Итого по Республике Башкортостан


2720 (75,6%)

2780 (77,2%)

В оставшихся трех районах, где были проведены исследования, нами выявлена неоднородность при проведении идентификации морфологических признаков рабочих пчел и трутней в пчелиных семьях. В частности в Дуванском, Миякинском и Белорецком районах при идентификации рабочих пчел было установлено, что в исследованных районах выделяются населенные пункты, где содержатся гибридизированные медоносные пчелы. Но при проведении исследований морфометрических признаков трутней нами было установлено, что в этих, же трех населенных пунктах трутни соответствуют среднерусской (расе) породе (матки чистопородные), Это говорит о межпородном скрещивании, которое произошло в результате антропогенного влияния на данных пасеках (кочевка, завоз пчелиных пакетов или маток). Данная ситуация обусловлена гаплоидной природой наследования трутней. Но с учетом того, что все трутни, развиваясь из неоплодотворенных яйцеклеток, получают только материнскую наследственность (геном матери), не смешанную с генами оплодотворяющих ее трутней, мы можем предположить, что в дальнейшем трутни-сыновья сохраняя материнскую генетическую конституцию, будут способствовать процессам поглотительного скрещивания.

Таким образом, исследования оценки антропогенного влияния на морфологические признаки трутней (в выявленных резерватах пчел среднерусской породы), позволили установить следующее. Несмотря на то, что происходит усиленное влияние человека на породную структуру пчел, на территории республики обнаружены населенные пункты, где сохранились пчелиные семьи, содержащие чистопородных маток и формирующие отдельные структурные элементы популяции или субпопуляции. Однако обнаруженные пчелиные семьи, где были зафиксированы гибридизированные рабочие пчелы, при одновременной идентификации трутней среднерусских пчел или наоборот, говорит о недостаточности традиционного подхода при оценке породной принадлежности семей лишь по рабочим особям.

Следовательно, в современном пчеловодстве успех проводимых селекционно-племенных мероприятий определяется в значительной степени качеством исходного племенного материала. Существующий на сегодняшний день нормативно-правовой документ оценки пчелиных семей не соответствует данным целям. В сложившейся ситуации разработанный нами новый научно-методологический подход к оценке хозяйственно-полезных и фенотипических признаков пчелиных семей позволит, с учетом традиционных методов оценки, провести комплексный анализ пчел.

3. Полиморфизм мтДНК (локус СОI-СОII) рабочих особей Apis mellifera в Республики Башкортостан

Благодаря особенностям наследования и изменчивости, мтДНК широко и успешно используется в различных исследованиях по эволюции и филогении (Cannet al., 1987; Kocher et al., 1989; Harrison et al., 1995; Ingman et al., 2000), в анализе популяционной структуры и исторической биогеографии (филогеографии) вида (Avise, 1994; 2000; Bernatchez, Wilson, 1998); в анализе гибридизации, интрогрессии митохондриального генома, последствий интродукции и акклиматизации (Billington, Hebert, 1991; Fontaine et al., 1997). На современном этапе развития популяционной биологии исследования по мтДНК широко используются при идентификации породной принадлежности пчел (М.А. Монахова, И.И. Горячева, Н.И. Кривцов, 2007). В частности, ранее проведенными нами точечными исследованиями природно-сельскохозяйственных кормовых зон было показано, что в большинстве исследованных точках частота встречаемости аллеля PQQ (среднерусская раса) колеблется в интервале от 0,09 до 0,56 (табл. 6). В общей картине породной идентификации выделялись медоносные пчелы заповедника «Шульган-Таш», где доля встречаемости среднерусских пчел составляло 0,99, а в среднем по Республике Башкортостан частота среднерусских пчел составило 0,56.

Согласно «островной модели» популяционной системы С. Райта, популяция состоит из «ядра» и периферических субпопуляций, которые постоянно обмениваются друг с другом генетическим материалом, подвержены случайному дрейфу генов, равно как и давлению различных форм. (Ю.Г. Рычков, 1969, 1973). Иными словами, изолированная популяция, если она не исчезает в ходе истории, развертывается «в самое себя», поддерживая динамическое равновесие с окружающей средой (Ю.Г. Рычков, 1969, 1973; Ю.П. Алтухов, Ю.Г. Рычков, 1970; Ю.П. Алтухов, 1974; Ю.П. Алтухов; Б.Л. Калабушкин, 1976; Ю.П. Алтухов, 2003).

Таблица 6. Встречаемость аллелей PQQ и Q полиморфного локуса COI-COII мтДНК Apis mellifera на территории Республики Башкортостан

Районы и пасеки

Кол-во исслед-ных семей

Встречаемость аллелей локуса






Доля PQQ

Северная лесостепная природно-сельскохозяйственная зона

Аскинский район

Пасека 1






Караидельский район

Пасека 1






Благовещенский район

Пасека 1






Иглинский район






Пасека Тюлько-Тюба






Пасека Тюлько-Тамак






Пасека Жилина






Пасека Орловская






Пасека матковыводная






Пасека тавтимановская






Краснокамский район






Д. Шарипова






Д. Амзя






Д. Купербаш






П. Имангулова






Янаульский район






П. Янаул






Пасека 2






Бураевский район

Поселок Бураево






Бирский район

Совхоз им. «Ленина»






Итого по зоне






Южная лесостепная природно-сельскохозяйственная зона

Шаранский район

Д. Чалмалы






Уфимский район






Д. Николо-Березовка






Д. Начапкино






Д. Дема






Д. Николаевка






Аургазинский район

Д. Чуваш-Карамалы






Кармаскалинский район

Колхоз «Карла Маркса»






Итого по зоне






Предуральская степная природно-сельскохозяйственная зона

Туймазинский район






АККХ им. «1 Мая»






Пасека ГПЗ






Белебеевский район






Д. Ново-Семенкино






Г. Белебей






Д. Анновка






Кугарчинский район

Д. Ново-Увал






Давлекановский район

П. Вперед






Буздякский район






П. Туктамышева






Д. Таулу-Куль






П. Буздяк






Ермекеевский район

Д. Новый






Итого по зоне






Северо-восточная лесостепная природно-сельскохозяйственная зона

Мечетлинский район

Д. Ново-Мечетлино






Салаватский район






П. Малояз






Пасека 2






Дуванский район

Д. Михайловка






Итого по зоне






Зауральская степная природно-сельскохозяйственная зона

Учалинский район






Пасека 1






П. «Красный партизан»






Д. Ново-Байрамгулово






Абзелиловский район






Д. Аскарово






Итого по зоне






Горно-лесная природно-сельскохозяйственная зона

Бурзянский район






Пасек Капова пещера






Пасека Коран-Елга






Д. Галиакберово






Борти и колоды






Итого по зоне






Итого по республике






* * Средние частоты

В соответствии с вышеизложенным мы можем предположить наличие «периферических» субпопуляций вокруг ФГУ ГПЗ «Шульган-Таш» (в разрезе административных районов). В подтверждение данному факту, мы провели ДНК-анализ в шести районах, расположенных вокруг Бурзянского района: Белорецкий, Гафурийский, Ишимбайский, Кугарчинский, Абзелиловский и Зилаирский. Количество собранных проб составило 1250 пчелосемей (табл. 7.).

Результаты проведенных исследований показали, что в окружающих заповедник «Шульган-Таш» районах частота встречаемости пчелосемей с аллелем PQQ (среднерусская порода или раса) колеблется от 0,75 до 0,92 и, соответственно, частота пчел с аллелем Q – 0,08 – 0,25.

Таким образом, относительно высокая частота встречаемости среднерусских пчел в данной зоне связана с наличием чистопородного резервата пчел в заповеднике «Шульган-Таш» и географической изоляции исследуемых районов.

Таблица 7. Встречаемость аллелей PQQ и Q полиморфного локуса COI-COII мтДНК Apis mellifera в горно-лесной природно-сельскохозяйственной зоне

Республики Башкортостан



Общее число семей

Число семей

с аллелем Q

Частота встречаемости семей

с аллелем Q

Число семей

с аллелем PQQ

Частота встречаемости семей

с аллелем PQQ











































* Средние частоты

Наличие пчелосемей с аллелем Q отражает приграничное расположение районов лесостепной и степной зон, где ранее проведенные исследования позволили выявить наличие «южных» пчел. Поэтому при правильно проводимых дальнейших селекционно-племенных работах, с учетом влияния трутневого фона, картину на наш взгляд можно изменить в лучшую сторону, то есть полностью восстановить структуру башкирской популяции среднерусской породы медоносной пчелы.

Таким образом, высокая частота встречаемости пчелосемей с аллелем PQQ (среднерусская (раса) порода - от 0,75 до 0,92) в районах, прилегающих к заповеднику «Шульган-Таш», подчеркивает наличие динамической субпопуляционной структуры медоносной пчелы на территории республики, что является основным механизмом сохранения и поддержания внутривидового генетического полиморфизма. Игнорирование этой структуры видов в процессе их хозяйственного использования является одной из главных причин необратимых изменений генетического разнообразия биоты (Ю.П. Алтухов, 2003). Одним из принципов природоохранной генетики является создание новых систем популяций в тех регионах, где существуют необходимые естественно-исторические и экономические условия. На наш взгляд, в исследованных районах для этого существуют все условия: труднодоступность и низкая населенность горно-лесной зоны; географическая изоляция (труднодоступные леса, горная местность, малая народонаселенность); обилие липовых и кленовых лесов, являющихся источником массовых медосборов и наличие особо охраняемых природных территорий, как специализированных по пчеловодству (заповедник «Шульган-Таш»), так и не специализированных (заказники, заповедники, природные и национальные парки).

4. Паспортизация породности Apis mellifera пасек расположенных в исследованных административных районах Республики Башкортостан

Во многих популяционно-генетических работах исследователи имеют дело не с реальными популяциями, а со случайными выборками, что не позволяет составить адекватную картину специфики генетических процессов, протекающих в популяциях (Ю.П. Алтухов, 2003). На основании проведенных комплексных исследований, антропогенного влияния на породную структуру медоносных пчел на территории РБ нами, разработаны паспорта породной принадлежности по исследованным населенным пунктам в 33 административных районах РБ, где было охвачено 145 населенных пунктов по идентификации рабочих пчел; 79 пунктов по трутням и 31 по молекулярно-генетическим исследованиям. Более подробная картина выглядит следующим образом:

  • для определения антропогенного влияния на породный состав медоносной пчелы на территории РБ и оценки морфометрических особенностей морфометрических признаков были собраны следующие количества проб: северная лесостепная зона 8 из 14 районов (1700 п/с), северо-восточная лесостепная - 5 из 5 районов (1100 п/с), южная лесостепная – 6 из 11 районов (1200 п/с), предуральская степная – 8 из 17 районов (1750 п/с), зауральская степная – 4 из 4 районов (900 п/с) и горно-лесная – 2 из 3 районов (400 п/с). Таким образом, нами были проведены исследования рабочих пчел в 33 из 54 административных районов Республики Башкортостан, и общее количество проб для анализа рабочих пчел составило 7050 пчелиных семей
  • исследования чистопородности маток в выявленных резерватах проводили на основе морфологических особенностей экстерьерных признаков трутней. Для решения этих задач были собраны следующие количества проб: северная лесостепная зона 5 из 14 районов (1050 п/с), северо-восточная лесостепная - один район (200 п/с), южная лесостепная – два района (400 п/с), предуральская степная – три района (700 п/с), зауральская степная – три района (650 п/с) и горно-лесная – два района (400 п/с). Таким образом, нами были проведены исследования трутней в 16 из 33 административных районов РБ. Общее количество проб составило 3000 пчелиных семей.
  • молекулярно-генетические исследования были проведены в приграничных районах с заповедником «Шульган-Таш». Идентификация была проведена в следующих районах: южная лесостепная – два района (400 п/с), предуральская степная – один район (200 п/с), зауральская степная – один район (250 п/с) и горно-лесная – два района (400 п/с). Общее количество пчелиных семей по молекулярно-генетическому исследованию составило: 1250 шт.

Таким образом, для получения реальной картины породного состава пчел в административных районах необходимо продолжить работу по созданию паспорта породной принадлежности Apis mellifera с дальнейшим ежегодным мониторингом (проведение ежегодных бонитировочных мероприятий во всех пасеках). Данные мероприятия позволят в перспективе детально оценить состояние башкирской популяции среднерусской породы медоносной пчелы и перейти на чистопородное разведение не только в отдельно взятых пасеках, но в целом, как в административных районах, так и в Республике Башкортостан.

5. Комплексная стратегия или логико-смысловая модель сохранения башкирской популяции среднерусской расы (породы) Apis mellifera mellifera L.

В современном пчеловодстве происходит глобальная гибридизация пчел и в создавшейся ситуации единственно правильным выходом является чистопородное разведение, основанная на работе с аборигенными породами.

В связи с этим, актуально создание сети трехступенчатой системы разведения пчел, состоящей из: 1 - племенных заводов, 2 - репродукторов и 3 - товарных и личных пасек. Племенные заводы следует располагать в «ядре» башкирской популяции (горно-лесная зона), а племенные репродукторы на периферии и некоторых центральных районах республики (периферические субпопуляции) (рис. 7.). В дальнейшем, с учетом того, что в горно-лесной зоне традиционными занятиями населения в основном являются скотоводство и пчеловодство, необходимо учредить территории традиционного аграрного хозяйствования с соответствующей экономической компенсацией, которая предотвратила бы внедрение сюда новых пород пчел.

Необходимо обратить внимание на то, что создание данной сети генофондных хозяйств, требует перехода на новые методы работы с племенным материалом. В частности, контроль над чистопородностью пчел в племенных хозяйствах необходимо проводить с помощью 2-х методов: морфометрического и молекулярно-генетического (полиморфизм локуса COI-COII мтДНК с применением технологии полимеразной цепной реакции). В племенных заводах необходимо организовать молекулярно-генетические лаборатории, а также расширить количество измеряемых морфометрических признаков при проведении ежегодных бонитировок на пасеках (Новая инструкция по бонитировке медоносных пчел). Создание племенных хозяйств будет первым шагом в переходе на чистопородное разведение медоносной пчелы.

Дальнейшим шагом является переход на создание зон и областей чистопородного разведения в РБ. Основным инструментом при этом будет являться работа по созданию «трутневого барьера» или влияние трутневого фона.

Восстановление, сохранение и дальнейшее рациональное использование генофонда башкирских пчел, возможно при наличии федеральных и региональных программ, национальной стратегии и плана действий по сохранению, которых на сегодняшний день не хватает. Реализация данных мероприятий требует осмысления и внедрения фундаментальных современных стратегий, которые будут включать в себя: разработку, утверждение и исполнение комплекса научных исследований, организационно-хозяйственные, административные и правовые меры. Сюда же необходимо отнести выделение материально-технических и финансовых средств, использование возможностей современных образовательных технологий и инновационных разработок в средних и высших учебных заведениях, влияние личностей учителей и педагогов, что в конечном итоге изменит традиционную стратегию ведения селекции как в пчеловодстве, так и в других отраслях агропромышленного комплекса (рис. 8.). Таким образом, современная стратегия по сохранению башкирской популяции среднерусской породы (расы) медоносной пчелы должна охватывать два комплексных направления, складывающихся из 8 основных элементов, в свою очередь состоящих из различных ступеней развития данных направлений:

В итоге необходимо отметить, что на сегодняшний день основными аргументами в пользу сохранения генофонда башкирской популяции медоносной пчелы являются: экономико-биологические, научные, культурно-исторические. Решение всех этих проблем требует реализации комплексных и стратегических мероприятий, охватывающих различные направления и слои общества: образование, отрасли агропромышленного комплекса, перспективные селекционно-племенные программы, внедрение сети генофондных хозяйств, современные методы идентификации и т.д.

Рисунок 7. Размещение племенных заводов и репродукторов

1 - Абзелиловский, 2 - Альшеевский, 3 - Архангельский, 4 - Аскинский, 5 - Аургазинский, 6 - Баймакский, 7 - Бакалинский, 8 - Балтачевский, 9 - Белебеевский, 10 - Белокатайский, 11 - Белорецкий, 12 - Бижбулякский, 13 - Бирский, 14 - Благоварский, 15 - Благовещенский, 16 - Буздякский, 17 - Бураевский, 18 - Бурзянский, 19 - Гафурийский, 20 - Давлекановский, 21 - Дуванский, 22 - Дюртюлинский, 23 - Ермекеевский, 24 - Зианчуринский, 25 - Зилаирский, 26 - Иглинский, 27 - Илишевский, 28 - Ишимбайский, 29 - Калтасинский, 30 - Караидельский, 31 - Кармаскалинский, 32 - Кигинский, 33 - Краснокамский, 34 - Кугарчинский, 35 - Кушнаренковский, 36 - Куюргазинский, 37 - Мелеузовский, 38 - Мечетлинский, 39 - Мишкинский, 40 - Миякинский, 41 - Нуримановский, 42 - Салаватский, 43 - Стерлибашевский, 44 - Стерлитамакский, 45 - Татышлинский, 46 - Туймазинский, 47 - Уфимский, 48 - Учалинский, 49 - Федоровский, 50 - Хайбуллинский, 51 - Чекмагушевский, 52 - Чишминский, 53 - Шаранский, 54 - Янаульский.

-племенные репродукторы- племенные заводы

Рисунок 8. Логико-смысловая модель сохранения башкирской популяции

среднерусской породы (расы) медоносной пчелы Apis mellifera mellifera L.


1. Установлено, что применение комплексной оценки морфологических признаков рабочих пчел и трутней Apis mellifera представляет собой развитие нового подхода при проведении селекционно-племенных мероприятий в современном пчеловодстве.

2. Мониторинг морфологических породопределяющих признаков рабочих пчел в разрезе природно-сельскохозяйственных зон Республики Башкортостан показал, что в четырех природно-сельскохозяйственных зонах степень гибридизации башкирской популяции пчел высок и представлен в интервале от 56 до 92,7% (южная лесостепная – 56% или 670 п/с; зауральская степная – 64% или 579 п/с; предуральская степная – 76% или 1172 п/с; северо-восточная – 92,7% или 1020 п/с). В этих зонах по морфометрическим признакам признакам Apis mellifera наблюдалось не полное соответствие основных измерений стандартам среднерусской породы (длина хоботка 6,75±0,25, lim – 6,30-7,20 мм; кубитальный индекс 59,12±2,95, lim – 51,49-65,71%; ширина 4-го стернита 3,98±0,04, lim – 3,90-4,12 мм.).

В двух зонах исследования позволили выявить доминантное содержание пчел среднерусской породы Apis mellifera mellifera L.: горно-лесная - 84% (337 п/с) и северная лесостепная - 62% (1050 п/с). Морфометрические показатели рабочих пчел, в этих зонах, соответствовали стандартам и колебались в следующих пределах: длина хоботка - 6,00-6,40 мм; длина правого переднего крыла - 9,00-10,00 мм; ширина правого переднего крыла - 3,00-3,50 мм; кубитальный индекс – 60-65%; длина 4-го тергита - 2,30-2,60 мм, ширина 4-го тергита - 4,80-5,00 мм; длина 4-го стернита - 3,00-3,20 мм; ширина 4-го стернита - 4,75-5,00 мм; длина воскового зеркальце - 2,45-2,70 мм; ширина воскового зеркальце - 1,50-1,70 мм; тарзальный индекс - 50,00-55,00%.

Комплексная оценка морфологических особенностей экстерьерных признаков рабочих пчел на территории Республики Башкортостан, свидетельствует о значительной гибридизации или наличии «биологического загрязнения» медоносных пчел

3. Изучение морфологических особенностей породоопределяющих признаков трутней в выявленных резерватах свидетельствует об умеренном или стабильном антропогенном влиянии и протекающих процессах поглотительного скрещивания. Были выявлены 13 из 16 административных районов, где породоопределяющие признаки, как рабочих пчел, так и трутней в исследованных семьях были идентичны и соответствовали стандарту среднерусской породы. Сложившаяся ситуация по исследованным морфологическим признакам (индекс окраски волос - M±m 5,58±0,314, Lim 5,00-6,00 (стандарт – 5-6); длина хоботка - M±m 4,32±0,406, Lim 3,45-5,00 мм (стандарт – 3,3-5,0 мм); кубитальный индекс - M±m 1,32±0,063, Lim 1,17-1,50 (стандарт – 1,0-1,5)) говорит о чистопородности маток в исследованных семьях этих пасек. Данные исследования позволяют выделить на территории Республики Башкортостан две субпопуляции северно-восточная и горно-предгорная.

4. Молекулярно-генетический анализ медоносных пчел в разрезе природно-сельскохозяйственных зон республики, позволил, в целом, выявить отрицательные тенденции генетических изменений субпопуляционной структуры башкирской популяции пчел Apis mellifera mellifera L. (в среднем частота встречаемости аллеля PQQ (среднерусская порода) в природно-сельскохозяйственных кормовых зонах колеблется в интервале от 0,09 до 0,56).

В общей картине породной идентификации выделялись медоносные пчелы заповедника «Шульган-Таш», где доля встречаемости пчел среднерусской породы составляло 0,99, и прилегающих к данной территории административных районах с частотой аллеля PQQ от 0,75 до 0,92.

Данная картина, подчеркивает о наличии относительной динамической субпопуляционной структуры медоносных пчел на территории Республики Башкортостан, что является основным механизмом сохранения и поддержания внутривидового генетического полиморфизма Apis mellifera mellifera L.

5. Разработана и проведена научно-обоснованная комплексная паспортизация породной принадлежности пчел в 33 административных районах, где было охвачено 145 населенных пунктов по идентификации рабочих пчел; 79 пунктов по трутням и 31 по молекулярно-генетическим исследованиям. Паспортизация позволила оценить нынешнюю ситуацию и дает возможность прогнозировать, проводить мониторинг и инвентаризационные мероприятия ресурсов генофонда башкирской популяции среднерусской породы медоносной пчелы.

6. Унифицирован новый научно-методический подход («Инструкция по бонитировке пчелиных семей») к оценке хозяйственно-полезных и фенотипических признаков медоносных пчел позволяющий, в совокупности с традиционными методами оценки, провести комплексный анализ породной принадлежности семей и регулировать и рационально использовать породные ресурсы, имеющие стратегическое значение в охраняемых территориях (племенные заводы и репродукторы) и за их пределами (общественный и частный сектор), для обеспечения их устойчивого использования.

7. Разработана комплексная стратегия, основанная на логико-смысловой модели сохранения башкирской популяции среднерусской породы Apis mellifera mellifera L. Данная стратегия включает в себя комплекс административных, научных, экономических, социологических, культурно-исторических мероприятий по сохранению и дальнейшему разведению высокоэффективной медоносной пчелы на территории РФ.

Практические предложения

1. Идентификацию породной принадлежности медоносных пчел в научно-исследовательских институтах по пчеловодству, лабораториях, селекционно-племенных и матковыводных пасеках, племенных заводах и репродукторах, наряду с классическими методами необходимо проводить согласно методическим рекомендациям: «Применение метода идентификации породной принадлежности медоносных пчел Apis mellifera, основанной на полиморфизме локуса COI-COII мт ДНК с применением технологии полимеразной цепной реакции (ПЦР)» (утвержден РАСХН, протокол №4 от 4.0608г.);

2. В пчеловодстве при проведении ежегодных бонитировок необходимо руководствоваться разработанной «Инструкцией по бонитировке пчелиных семей», позволяющей проводить комплексную оценку хозяйственно-полезных и фенотипических признаков пчел при ведении селекционно-племенных мероприятий.

Список работ автора, опубликованные по теме диссертации

Статьи в ведущих научных журналах Российской Федерации,

рекомендованных ВАК

Саттаров В.Н. ДНК-анализ в пчеловодстве / Саттаров В.Н., Мигранов М.Г., Николенко А.Г // Пчеловодство. - 2005. - №4. - С. 25.

Саттаров В.Н. Кластерный анализ / Саттаров В.Н., Мигранов М.Г. // Пчеловодство. – 2005. - №7 - С. 22-23.

Саттаров В.Н. Башкирская бортевая пчела / Мигранов М.Г., Саттаров В.Н. // Биология в школе. - 2007. - №4.- С.15-18.

Саттаров В.Н. ДНК-анализ при оценке породного состава пчел / Саттаров В.Н. // Пчеловодство. - 2007. - №7. - С.9-10.

Саттаров В.Н. Пчеловодство и школа / Саттаров В.Н. // Пчеловодство. - 2008. - №2. - С.8-9.

Саттаров В.Н. Породный состав пчел горно-лесной зоны Башкортостана / Саттаров В.Н. // Пчеловодство. - 2009. - №7. - С. 20-21.

Саттаров В.Н. Численность популяции медоносной пчелы в лесостепной и степной зонах Башкортостана / Саттаров В.Н. // Пчеловодство. - 2009. - №6. - С. 20-21.

Саттаров В.Н. Комплексная стратегия сохранения башкирской пчелы и ее логико-смысловая модель / Саттаров В.Н., Туктаров В.Р., Иванцов Е.М. // Педагогический журнал Башкортостана. - 2010. - №4 (29). - С.248-258.

Саттаров В.Н. Некоторые аспекты оценки морфометрических признаков медоносной пчелы / Саттаров В.Н. Туктаров В.Р., Борисов И.М., Мигранов М.Г., Хабиров А.Ф. // Пчеловодство. - 2010. - №7. - С.17-21.

Саттаров В.Н. Влияние стационарных источников экотоксикантов на среду обитания медоносных пчел в Республике Башкортостан / Саттаров В.Н., Туктаров В.Р., Борисов И.М. и др. // Пчеловодство. - 2011. - №2 - С.10-11.

Статьи в других изданиях

Саттаров В.Н. Применение молекулярно-биологического метода для выявления резерватов чистопородной популяции среднерусской породы Apis mellifera m. / Николенко А.Г., Поскряков А.В., Саттаров В.Н. // Актуальные проблемы биологии и экологии. Матер. междун. науч.-практ. конференции. Сыктывкар, 2000. – С.160-161.

Саттаров В.Н. Применение молекулярно-биологического метода при идентификации среднерусской расы медоносной пчелы на территории Республики Башкортостан в условиях высокой степени гибридизации / Саттаров В.Н. // Проблемы физико-химической биологии. Матер. междун. науч.-практ. конференции - Пущино, 2000. - С.22-25.

Sattarow W.N. Molecular-genetic assessment of gene pool stste of Apis mellifera / Nikolenko A.G., Benkowskaya G.V., Sattarow W.N. // Biodiversity and dynamics of ecosystems in North Eurasia. – Novosibirsk, 2000. - P. 87-89.

Sattarow W.N. Gen pool state of the Bashkir population Apis mellifera mellifera / Nikolenko A.G., Sattarow W.N. // 4th Congress of Animal Genetics. USA, 2000. - P.79.

Саттаров В.Н. Использование модифицированного морфометрического метода Алпатова при проведении селекционно-племенной работы в пчеловодстве / Саттаров В.Н., Мигранов М.Г. // Проблемы и пути интенсификации племенной работы в отраслях животноводства. Матер. междун. науч.-практ. конференции - Уфа, 26-28 апреля 2004 – С.192-196.

Саттаров В.Н. Использование ДНК-анализа в исследовании генетического полиморфизма медоносной пчелы в заповеднике «Шульган-Таш» / Саттаров В.Н., Мигранов М.Г. // Сибирская зоологическая конференция. Всероссийская конференция с участием зарубежных ученых. - ИС и ЭЖ СО РАН, 15-22 сентября 2004. - С.120-121.

Саттаров В.Н. Проблемы сохранения биоразнообразия медоносной пчелы (Apis mellifera) на Южном Урале / Саттаров В.Н., Мигранов М.Г. // Природные ресурсы УРАЛЭКОЛОГИЯ. Всероссийская научно-практическая конференция – Уфа, ООО «Виртуал» 2005. - с. 202-203.

Саттаров В.Н. Башкирская бортевая пчела / Мигранов М.Г., Саттаров В.Н. // Атлас Республики Башкортостан ГУП «Башкортостан» - 2005, С. 328.

Саттаров В.Н. Молекулярно-генетические аспекты устойчивости медоносной пчелы Республики Башкортостан / Саттаров В.Н., Мигранов М.Г. // Вестник БГПУ, Уфа, БГПУ. – 2006. - №1 (7).- С.49-53.

Саттаров В.Н. Фенотипический полиморфизм медоносной пчелы Apis mellifera L. (Hymenoptera, Apidae) на территории Республики Башкортостан / Саттаров В.Н., Мигранов М.Г. // Достижения энтомологии на службе агропромышленного комплекса, лесного хозяйства и медицины. Тезисы докладов XIII съезда Русского энтомологического общества, Краснодар, 9-15 сентября 2007. - С.239.

Саттаров В.Н. Численный состав медоносной пчелы в гречишно-подсолнечниково-донниковой медоносной зоне Республики Башкортостан и перспективы развития пчеловодства в этой зоне / Саттаров В.Н., Мигранов М.Г., Султанова Г.Г. // Труды Ставропольского отделения Русского энтомологического общества. Вып.4. Матер. междун. науч.-практ. конференции. – Ставрополь, АГРУС, 2008. – С.382-385

Саттаров В.Н. Состояние и перспективы разведения медоносной пчелы на территории Республики Башкортостан и вопросы влияния трутневого фона на чистопородность пчел / Саттаров В.Н. // Труды Ставропольского отделения Русского энтомологического общества. Вып.4: Матер. междун. науч.-практ. конференции  – Ставрополь: АГРУС, 2008. – С.378-382.

Саттаров В.Н. Биоразнообразия медоносной пчелы на территории РБ и роль трутней в поддержании породной структуры пчел / Саттаров В.Н. // Современная экология – наука XXI века. Матер. междун. науч.-практ. конференции – Рыбное, 17 октября 2008 - С.332-335.

Саттаров В.Н. Пчеловодство как метод экологического воспитания студентов и школьников / Саттаров В.Н. // Современная экология – наука XXI века. Матер. междун. науч.-практ. конференции – Рыбное, 17 октября 2008 - С.14-16.

Саттаров В.Н. Оценка эффективной численности пчел для опыления сельскохозяйственных медоносов гречишно-подсолнечниково-донниковой медоносной зоны Республики Башкортостан / Саттаров В.Н., Мигранов М.Г., Султанова Г.Г. // Современная экология – наука XXI века. Матер. междун. науч.-практ. конференции – Рыбное, 17 октября 2008 – С.611-614.

Саттаров В.Н. Современные методы внутривидовой идентификации медоносной пчелы / Саттаров В.Н., Туктаров В.Р. // Передовые технологии в животноводстве. Материалы Всероссийской науч.-практ. конференции в рамках проведения 70-летия кафедры кормления сельскохозяйственных животных Башкирского ГАУ. – Уфа, 6-7 ноября 2008.- С.165-167.

Саттаров В.Н. Пчеловодство как метод экологического образования школьников / Саттаров В.Н. // Биоразнообразие, охрана природы и здоровье в Республике Башкортостан. Материалы заочной международной науч.-практ. конф. - Стерлитамак, 5-6 ноября 2008 - С.169-170.

Саттаров В.Н. Некоторые аспекты численного состава медоносной пчелы в гречишно-подсолнечниково-донниковой медоносной зоне РБ / Саттаров В.Н., Мигранов М.Г. // Биоразнообразие, охрана природы и здоровье в Республике Башкортостан. Материалы заочной международной науч.-практ. конф. - Стерлитамак, 5-6 ноября 2008 – С.101-104

Саттаров В.Н. Медоносная пчела: национальное достояние, экология, этика и педагогика / Саттаров В.Н., Туктаров В.Р., Смирнов А.М. // Педагогический журнал Башкортостана. – 2008. - № 6 (19). - С.101-107.

Саттаров В.Н. Комплексная оценка морфологических особенностей породоопределяющих морфометрических признаков медоносных пчел на территории Южной лесостепной зоны Республики Башкортостан / Туктаров В.Р., Саттаров В.Н., Иванцов Е.М. // Материалы международной научно-практической конференции, посвященной 80-летию ФГОУ ВПО Башкирский ГАУ – Уфа, 30 сентября-1 октября 2010.- С.231-233.

Монографии, учебные, учебно-методические пособия и программы

Саттаров В.Н. Генетические аспекты сохранения биологического разнообразия / Янбаев Ю.А., Косарев М.Н., Бахтияров Р.М., Николенко А.Г., Саттаров В.Н.,  и др. // (коллективная монография). - Уфа, БГУ. - 2000. - 108 с.

Саттаров В.Н. Популяционно-генетический полиморфизм башкирской популяции среднерусской расы медоносной пчелы Apis mellifera L / Саттаров В.Н., Мигранов М.Г. // (Монография) - Уфа, РИО РУНМЦ МО РБ. - 2007. – 104с.

Саттаров В.Н. Медоносная пчела Республики Башкортостан / Саттаров В.Н., Мигранов М.Г. // (Учебное пособие). – Уфа, РИО РУНМЦ МО РБ. - 2004. 76с.

Саттаров В.Н. Современные методы идентификации медоносной пчелы / Саттаров В.Н., Мигранов М.Г. // (Учебно-методическое пособие). – Уфа, РИО РУНМЦ МО РБ. - 2004. - 31с.

Саттаров В.Н. Применение метода идентификации породной принадлежности медоносных пчел Apis mellifera, основанной на полиморфизме локуса COI-COII митохондриальной ДНК с применением технологии полимеразной цепной реакции (ПЦР) /Саттаров В.Н., Туктаров В.Р. // Методические рекомендации (Утверждена РАСХН, протокол №4 от 4.06.08г.). – 19с.

Саттаров В.Н. Пчеловодство / Смирнов А.М., Саттаров В.Н., Туктаров В.Р., Мигранов М.Г. // Допущено УМО ВУЗ РФ в качестве учебного пособия по специальностям 111401-Зоотехния, 111201 – Ветеринария. - Уфа, БГПУ. – 2010 - 434с.

© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.