WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

Федеральное государственное бюджетное учреждение "Гематологический научный центр" Министерства здравоохранения и социального развития Российской Федерации (ФГБУ ГНЦ Минздравсоцразвития России).

Судариков Андрей Борисович Молекулярная диагностика вирусов гепатита C, B, G и парвовируса B19 у гематологических больных.

Автореферат диссертации на соискание ученой степени доктора биологических наук

по специальности 14.01.21 "гематология и переливание крови".

Москва, 2011

Работа выполнена в Федеральном государственном бюджетном учреждении "Гематологический научный центр" Министерства здравоохранения и социального развития Российской Федерации (ФГБУ ГНЦ Минздравсоцразвития России).

Научный консультант:

доктор медицинских наук, профессор, академик РАМН Савченко Валерий Григорьевич

Официальные оппоненты:

доктор химических наук, профессор, член-корреспондент РАН Габибов Александр Габибович доктор медицинских наук, профессор, Лукина Елена Алексеевна доктор биологических наук, Лунин Владимир Глебович.

Ведущая организация:

Федеральное государственное учреждение Институт физико-химической медицины Федерального медико-биологического агентства России.

Защита состоится "__" ____ 2012 года в ____ часов на заседании диссертационного совета Д 208.135.02 в Федеральном государственном бюджетном учреждении "Гематологический научный центр" Министерства здравоохранения и социального развития Российской Федерации (125167, г.

Москва, Новый Зыковский проезд, дом 4).

С диссертацией можно ознакомиться в библиотеке ФГБУ ГНЦ Минздравсоцразвития России Автореферат разослан "_____" ________________ 2011 г.

Ученый секретарь диссертационного совета, кандидат медицинских наук Зыбунова Елена Евгеньевна.

Введение.

Гематологические больные составляют группу риска заражения трансмиссионными вирусными инфекциями, т.к. получают множественные гемотрансфузии, в т.ч. компонентов крови, карантинизация которых не всегда возможна (например, тромбоцитов). Необходимо отметить, что в условиях цитопении и иммунодефицита, вызванных непосредственно гематологическим заболеванием, либо возникших как побочный эффект агрессивной цитостатической или иммуносупрессивной терапии, симптомы вирусных инфекций могут быть стерты [Лукина Е.А. 2000]. В этой ситуации стандартные серологические методы диагностики и мониторинга инфекций бывают ненадежны или неэффективны. Таким образом, молекулярные методы диагностики вирусных инфекций, основанные на выявлении РНК или ДНК соответствующих патогенов, приобретают особую важность в гематологической клинике.

Одним из современных методов молекулярной диагностики вирусных инфекций является полимеразная цепная реакция (ПЦР). Принцип ПЦР впервые сформулировал Хьелль Клеппе из лаборатории нобелевского лауреата Хары Гобинды Хораны [Kleppe 1971]. Однако, в то время эта идея не нашла практического применения. Полимеразная цепная реакция была вновь открыта в 1983 году Кэри Маллисом [Saiki 1985]. В исходном варианте метода использовалась обыкновенная ДНК-полимераза, что требовало добавления фермента в каждом цикле. Впоследствие стали использовать термостабильный фермент, что существенно упростило, ускорило и позволило автоматизировать процедуру [Saiki 1988]. В 1993 г. Маллис получил за этот цикл работ Нобелевскую премию. Метод ПЦР был запатентован корпорацией Цетус/Перкин-Эльмер, сотрудником которой являлся Кэри Маллис в то время. В 1992 году Цетус продала права на метод и патент на использование Taqполимеразы компании Хофман-Ла Рош за 300 млн долларов. Однако, тот факт, что Taq-полимераза была выделена из термофильных бактерий и охарактеризована русским биохимиком Алексеем Калединым еще в 1980 году [Kaledin 1980], [Kaledin 1981], [Kaledin 1982], послужил основанием для судебного иска со стороны компании Промега об ограничении исключительных прав Хофман-Ла Рош на этот фермент. Срок действия американского патента на метод ПЦР истёк в марте 2005 г. Необходимо сказать еще пару слов о самом термине "полимеразная цепная реакция". Существует точка зрения, что название отражает синтез полимеразой "цепей" ДНК. Однако, это не так.

Цепные реакции были открыты Николаем Николаевичем Семеновым [Семенов 1933], [Семенов 1934], [Семенов 1942], за что ему была присвоена Нобелевская премия по химии в 1956г. Отличительным свойством цепных реакций (к которым относится и полимеразная цепная реакция) по Семенову является тот факт, что накапливающиеся (образующиеся) в процессе реакции продукты в качестве субстрата снова вступают в реакцию. При этом реакция носит "взрывной" характер с экспоненциальным накоплением продуктов.

Полимеразная цепная реакция (ПЦР) позволяет выявлять среди огромного количества участков ДНК определенные фрагменты ДНК и их синтезировать.

Иными словами, с помощью ПЦР можно найти в испытуемом образце относительно короткий участок ДНК и многократно размножить (амплифицировать) его. Таким образом, ПЦР - это высокочувствительный и высокоспецифичный метод. Однако, высокая чувствительность метода предъявляет повышенные требования к культуре экспериментальной и диагностической работы и заставляет использовать специальные подходы и методы для предотвращения ложных результатов. Одним из наиболее эффективных подходов является введение внутренних стандартов реакции.

Могут использоваться стандарты, которые амплифицируются с теми же праймерами, что и исследуемая мишень, что делает реакцию амплификации конкурентной, позволяя проводить количественные оценки концентрации исследуемой мишени по известной концентрации внутреннего стандарта.

Кроме того, внутренний стандарт играет роль контроля прохождения реакции в отдельной пробирке. Для ПЦР в реальном времени также применимы неконкурентные стандарты, амплификация которых контролируется по альтернативному каналу флюоресценции. Для определения вирусных патогенов, содержащих РНК в качестве носителя генетической информации, перед ПЦР необходимо провести синтез цепи ДНК на РНК. К сожалению, практически все известные коммерческие системы ПЦР-тестирования РНКсодержащих вирусов, не контролируют эту стадию процесса, что, вообще говоря, некорректно. Для адекватного контроля и стандартизации реакций в данном случае необходимо введение РНК-стандартов, что выдвигает дополнительные требования. Во-первых, в отличие от ДНК, молекулы РНК нестабильны, легко подвергаются рибонуклеазному расщеплению. Упаковка РНК в белковую оболочку позволяет решить эту проблему. Кроме того, упакованная РНК, в отличие от свободной, имитирует по строению исследуемый вирус, что позволяет контролировать все стадии процесса выделения РНК, обратной транскрипции и ПЦР. Необходимость разработки и внедрения надежных методов ПЦР-тестирования на вирусные патогены в гематологической клинике и службе крови не бесспорна и в большинстве стран такие методы широко внедрены уже более 10-ти лет. В частности в Германии при добавлении ПЦР-диагностики к серологическому тестированию риск необнаружения вируса падает в 2 раза по HIV, в 7 раз по HCV и в 3 раза по HBV [Offergeld 2005].

Таблица 1. Эффект от введения ПЦР-диагностики дополнительно к серологическому анализу (снижение риска необнаружения инфекционности).

без ПЦР с ПЦР Кратность тестирования тестированием HIV 1 : 2 770 000 1 : 5 540 000 HCV 1 : 670 000 1 : 4 400 000 HBV 1: 230 000 1 : 620 000 Необходимо отметить, что инфицированность в Германии одна из самых низких в мире. В странах с высокой инфицированностью (к которым относится и Россия) ожидаемая кратность снижения риска в разы больше. Так в Таиланде (где часто встречается гепатит B) ПЦР тестирование бракует 1-го из 800 HbS антиген-негативных доноров [Nantachit 2007]. Что касается экономической эффективности ПЦР тестирования, то она оказывается выше всего в странах с дешевыми ресурсами и рабочей силой (к которым, увы, относится и наша страна). Так, например, в Словении, введение ПЦР-тестирования на HCV дополнительно к антительному тесту добавило к стоимости обследования всего 1.8 Euro. При этом стоимость обнаружения одного ПЦР-положительного образца среди антител-отрицательных составила всего 643 Euro [Seme 2007].

ПЦР-диагностика вирусных инфекций у гематологических больных отличается нестандартными начальными условиями. Пробы могут содержать ингибиторы (гепарин, интеркалирующие цитостатики и др.), клеточный состав крови варьирует от цитопении до гиперлейкоцитоза, при лизисе опухоли в кровь попадают ферменты (в т.ч. РНКазы). Таким образом, к контролю эффективности выделения, обратной транскрипции и амплификации вирусных нуклеиновых кислот из проб, полученных от гематологических больных, предъявляются дополнительные требования. В связи с вышеизложенным тема настоящей работы - разработка оригинальных подходов к ПЦР-диагностике вирусных патогенов, оптимальных для использования в гематологии, представляется весьма важной и актуальной.

Цель.

Разработать оптимальные для гематологии молекулярные методы определения вирусов гепатита C, B, G и парвовируса B19.

Задачи.

1. Разработать метод получения РНК-стандартов для контроля обнаружения и количественного определения РНК-содержащих вирусов.

2. Разработать метод получения ДНК-стандартов для контроля обнаружения и количественного определения ДНК-содержащих вирусов.

3. Разработать метод генотипирования вируса гепатита С.

4. Разработать методы ПЦР-диагностики парвовируса B19 и вируса гепатита G.

5. Разработать метод мультиплексного определения вирусов гепатита C, B и парвовируса B19 у гематологических больных.

Научная новизна.

Предложен новый тип внутреннего стандарта для конкурентной ПЦР - это РНК-стандарт на основе ретровирусного вектора. Стандарт представляет собой ретровирусные частицы, секретирующиеся в культуральную среду клоном пакующей линии клеток PG13, полученным после трансфекции дефектным по репликации и непатогенным ретровирусным вектором pBabe, содержащим модифицированную последовательность вируса гепатита С, используемую для амплификации в ПЦР, и селективный маркер -ген устойчивости к пуромицину, дающий возможность вычислять титр вирусных частиц стандарта после инфицирования восприимчивых клеток-мишеней серийными разведениями вируса. Предложен универсальный и методически простой способ конструирования внутреннего стандарта для одностадийной конкурентной ПЦР, который может быть использован при создании количественного ПЦРдиагностикума для любого ДНК-содержащего патогена. Разработан оригинальный подход для одновременного обнаружения и генотипирования вируса гепатита С. Праймеры взяты из наиболее консервативного участка генома вируса гепатита С и позволяют достоверно и с высокой чувствительностью обнаруживать в сыворотке человеческой крови РНК всех известных к настоящему времени типов и подтипов вируса. Праймеры подобраны таким образом, что амплифицируется тот же район вирусной РНК, который в дальнейшем используется для определения генотипа вируса.

Разработаны методы определения парвовируса В19, и впервые в России проведено масштабное исследование инфицированности этим вирусом среди доноров и больных гематологического стационара. Получены данные о достоверной связи инфицированности вирусами гепатитов В, С и G с объемом трансфузионной терапии у гематологических больных.

Практическая значимость.

Предложенный в работе подход целесообразно использовать при получении внутренних РНК- стандартов для конкурентной ПЦР и real-time ПЦР для диагностики любых РНК-содержащих патогенов. Разработан методически простой способ конструирования внутреннего стандарта для определения любых ДНК-содержащих патогенов в одностадийной конкурентной ПЦР. С целью выявления мутантных вирусных штаммов использовался метод аллельспецифической ПЦР. Установлено, что данная методика применима в диапазоне концентраций ДНК от 104 до 107 геном/мл. Разработаный и внедренный в ФГБУ ГНЦ Минздравсоцразвития России мультиплекс-диагностикум для одновременного определения вирусов гепатитов В, С и парвовируса Впозволил существенно удешевить анализ инфицированности пациентов и доноров, по сравнению с коммерческими наборами, не снижая его достоверности и чувствительности.

Положения, выносимые на защиту.

1. Разработаный новый тип внутреннего стандарта для качественного и количественного определения РНК HCV в конкурентной ПЦР позволяет контролировать все стадии анализа, начиная от выделения РНК.

Концентрация ретровирусного стандарта может быть определена независимым методом (подсчетом колоний), стандарт легко нарабатывается при помощи культуры пакующих клеток и не патогенен для человека.

2. Предложен новый одностадийный подход для конструирования ДНК стандартов, основанный на свойстве праймеров при пониженной температуре связываться с участками частичной 3'-концевой гомологии.

3. При тестировании инфицированности вирусами гепатитов В, С и G больных апластической анемией и гемобластозами получены данные, свидетельствующие о достоверной связи инфицированности с количеством гемотрансфузий.

4. Получены данные по распространенности в России парвовируса Всреди доноров и больных гематологического стационара. Впервые выявлена локальная вспышка инфекции (8%), что важно учитывать при заготовке крови и компонентов.

Апробация работы.

Работа доложена на заседании проблемной комиссии "Фундаментальные исследования в гематологии, трансплантологии, трансфузиологии: Гемопоэз, молекулярная биология, биотехнология, иммуногематология; биохимия;

биофизика" 6 декабря 2011 года.

Объем и структура диссертации.

Диссертация изложена на 220 страницах, состоит из введения, обзора литературы, описания материалов и методов, изложения результатов и их обсуждения, заключения, выводов и списка цитируемой литературы. Работа содержит 47 рисунков и 5 таблиц. Список цитированной литературы включает 388 наименований.

Материалы и методы.

В работе использованы препараты, полученные от больных, находившихся на лечении в ФГБУ ГНЦ Минздравсоцразвития России и доноров. Все манипуляции с кровью, плазмой, сыворотками; выделение РНК и ДНК проводили по стандартным методикам. Последовательности олигонуклеотидных праймеров, использованных в работе, приведены в таблице 2.

Таблица 2. Последовательности праймеров, использованных в работе.

Вирус гепатита С SU1 5' gtgcttgcgagtgc 3' #36 5' aacactactcggctagcagt 3' ASU1 5' agggtrtcgatgac 3' #32А 5' ctggaggaactactgtctt 3' SU2 5' ggaggtctcgtagaccgtg 3' #33 5' ttcacgcagaaagcgtctag 3' ASU2 5' ggtrtcgatgacyttaccca 3' #48 5' gttgatccaagaaaggaccc 3' AS1b 5' gagccatcctgcccacccca 3' #186 5' aygtaccccaygagrtcggc 3' AS2a 5' ccaagagggacgggaacctc 3' #256 5' cgcgcgactaggaagacttc 3' AS1a 5' gggataggctgacgtctacc 3' #186 5' aygtaccccaygagrtcggc 3' AS3a 5' accgttcagaagttttacgc 3' #104 5' agraarrcttcsgagcgrtc 3' Lhcv 5' ctcatggtgcacggtctac 3' Lint 5' gactttccacaccctaactgac 3' Rhcv 5' cgaaaggccttgtggtact 3' Rint 5' cagtgtggtggtacgtaggaat 3' R1hcv 5' ctgcggaaccggtgagta 3' HYBint 5' ROX acacattccacaggtcgaccactgt BHQ2 3' Hybhcv 5' FAM cactcgcaagcaccctatcagg BHQ1 3' Вирус гепатита В Вирус гепатита G HBS 5' cttcgcttcacctctgc 3' GS1 5' cargttgggtgctt 3' HBA 5' gcctcaaggtcggtcgttgac 3' GA1 5' gggcaatgaacttacctttg 3' L_hbv 5' cttcgcttcacctctgc 3' GS2 5' gggcaatgaacttacctttg 3' R_hbv 5' caaggtcggtcgttgac 3' GA2 5' gtcccttcaagtatctcytg 3' Hyb_hbv_F 5' FAM acataagaggactcttggactctcagcaat Парвовирус ВAM BHQ1 3' ymdMGs 5' tgacaaaccgaaagtcaatatac 3' VisB19f-in 5' ctttaggtatagccaactgg 3' ymdMAs 5' tgacaaaccgaaagtcaatat 3' VisB19r-in 5' acactgagtttactagtggc 3' ymdVs 5' tgacaaaccgaaagtcaatac 3' VisB19f-out 5' ctttaggtatagccaactgg 3' ymdIs 5' tgacaaaccgaaagtcaatataa 3' VisB19r-out 5' acactgagtttactagtggc 3' ymdCOMas 5' gattggaaagtatgtcaacg 3' B19f-out 5'-actatgaaaactgggcaataaac-3' precWCs 5' acggaacccaccgaaac 3' B19r-out 5'-caccaccactgctgctgata 3' HYB_ precMTs 5' acggaacccaccgaaat 3' 5' Cy aattaatgcagatgccctccacccagac BHQ 3' PVBprecCOMas 5' gcaaagaattgcttgcctga 3' Jak2F 5' ggaccctacacagtttgaagag 3' B19r-inner 5' tgtctgtgacaattggggtg 3' Jak2R 5' acctcgccagtgttgtcct 3' Jak2oligo 5' FAM agatgtgccgctatgacccgctg RTQ1 3' Конструирование внутреннего РНК-стандарта для ПЦР-определения вируса гепатита С.

Для конструирования стандарта использовали ретровирусный вектор pBabe-Puro [Morgenstern 1990]. Вектор содержит селективный маркер - ген устойчивости к пуромицину. Схема конструирования внутреннего стандарта и получения пакующей линии клеток приведена на рис. 1. Из сыворотки крови больного вирусом гепатита С генотипа1b выделили РНК. Провели обратную транскрипцию и ПЦР с универсальными праймерами SU1 и ASU(последовательности см. В Таб. 2). Получили кДНК вируса гепатита С (размер амплификата 417 п.н.) и клонировали её в вектор pGEM-TEasy c помощью "pGEM®-TEasy Vector Systems" (Promega) в соответствии с инструкцией по применению. Плазмидную ДНК нарастили в E.coli, выделили и модифицировали вставив по сайту KpnI (находящемуся внутри фрагмента кДНК вируса гепатита С) фрагмент ДНК длиной 628 п.н.

Рис. 1. Схема получения внутреннего стандарта на основе ретровирусного вектора.

Далее модифицированная кДНК вируса гепатита С была вырезана по сайтам рестриктазы EcoRI и переклонирована в вектор pBabe-Puro.

Полученный в результате лигирования вектор pBabe/HCV* использовали далее для наработки внутреннего стандарта. Для этого конструкцию pBabe/HCV* трансфецировали в мышиную пакующую линию PG13 [ATCC СRL-10686] методом электропорации при помощи прибора Gene-Pulser™(Bio-Rad).

Трансфецированные клетки селектировали на среде, содержащей 4 мкг/мл пуромицина. После селекции проводили клонирование методом лимитирующих разведений в среде DMEM с добавлением 20% FBS. Культуральную среду клонов, содержащую упакованную в ретровирусные частицы РНК-матрицу (внутренний стандарт), собирали, замораживали и хранили при -70оС. Титр ретровирусных частиц в культуральном супернатанте оценивали по числу колоний, выросших после инфицирования клеток-мишеней на селективной среде. Клеточную линию человеческих легочных фибробластов Wi38 высевали в количестве 500000 на 25см2 культуральные флаконы. На следующий день добавляли известный объем среды с ретровирусными частицами и 8 мкг/мл полибрена (hexadimethrine bromide) (Sigma). На следующий день после инфицирования клетки помещали в среду, содержащую 1мкг/мл пуромицина.

После 7 дней селекции подсчитывали число выросших пуромицин-устойчивых колоний. Титр препарата определяли как количество колониеобразующих единиц (инфекционных единиц - инф.ед.) в 1мл вирусной суспензии. В результате получен РНК-стандарт, который может быть добавлен в исследуемую пробу, выделен, использован в реакции обратной транскрипции и амплифицирован вместе с РНК гепатита С. Амплификация происходит с теми же праймерами, что и для исследуемой ДНК (получается фрагмент большего молекулярного веса). Пример использования стандарта на Рис 2.

Рис 2. Амплификация РНК вируса гепатита С вместе со стандартом. Верхняя полоса соответствует амплификации стандарта; нижняя полоса - РНК гепатита С. Левая панель - стандарт добавлен в концентрации 1x103 в мл; отсутствие амплификации стандарта во второй дорожке позволяет предотвратить ложноотрицательный результат. Конкурентный характер реакции позволяет оценить количество вирусной РНК титрованием (правая панель).

Конструирование внутреннего стандарта для ПЦР-определения вируса гепатита В.

Конструирование внутреннего стадарта для ДНК-содержащих вирусов (в частности, вируса гепатита В) приципиально проще, чем конструирование РНК-стандарта, т.к. ДНК стабильна и количество копий плазмид легко рассчитывается из концентрации. Однако стадии клонирования и модификации вставки достаточно длительны и трудоемки. Нам удалось разработать метод, позволяющий свести их к минимуму. Мы исходили из того, что при температуре, существенно меньшей, чем оптимальная температура отжига праймеров в ПЦР, специфичность взаимодействия "праймер-матрица" снижается. В этих условиях, в ПЦР с произвольной ДНК и праймерами к определенному участку выявляемой ДНК, нарабатывается множество неспецифических амплификационных фрагментов, т.к. для инициации процесса ДНК-полимеризации достаточно комплементарности нескольких оснований в последовательности ДНК-матрицы и нескольких нуклеотидов, прилегающих к 3’-концу используемых праймеров. Далее в ходе реакции при оптимальной температуре отжига праймеров нарабатываются ДНК-фрагменты, имеющие последовательности, комплементарные использованным праймерам и, следовательно, коамплифицирующиеся с исследуемой ДНК. Следует отметить, что данная методика применима для получения внутреннего стандарта только для одностадийной ПЦР, когда не требуется наличия специфических участков внутри амплификационного фрагмента, использующегося в качестве внутреннего стандарта. Мы провели амплификацию с праймерами, фланкирующими один из участков нуклеотидной последовательности ДНК вируса гепатита В. Причем условия амплификации были следующими: в первых 5 циклах реакции температура отжига была на 19°С ниже температуры, оптимальной для данной пары праймеров, а в последующих 30 циклах отжиг осуществлялся при оптимальной температуре. В результате мы получили смесь фрагментов ДНК различной длины, имеющих на концах последовательности, комплементарные использованным праймерам. Далее мы выбрали фрагмент длиной 500 п.н., последовательность которого определили прямым секвенированием (Рисунок 3). Сравнение полученной последовательности с базой данных GeneBank показало, что это фрагмет гена топоизомеразы E.coli.

Как и ожидалось, на концах фрагмента были последовательности, комплементарные праймерам для выявления ДНК вируса гепатита В. Для получения необходимого количества внутреннего стандарта данный фрагмент лигировали в плазмиду и клонировали в клетках E. coli. Соответствующая плазмида выделена из E.coli, очищена и растворена в воде, и, после подсчета количества копий плазмидной ДНК в миллилитре водного раствора, такой раствор использовался в качестве внутреннего стандарта для определения количества ДНК гепатита В методом конкурентной ПЦР.

Рисунок 3. Схема получения внутреннего стандарта для вируса гепатита В.

Эффективность совместной амплификации внутреннего стандарта и ДНК вируса гепатита В проверялась в конкурентной ПЦР с плазмидной ДНК, содержащей клонированный участок ДНК вируса гепатита В. Было показано, что, несмотря на разницу в размере ампликона внутреннего стандарта и вирусной ДНК, при коамплификации в равных концентрациях (в пределах порядка) они имеют сопоставимую интенсивность флуоресценции в УФ-лучах.

Возможно, это связано с тем, что разница эффективности амплификации данных матриц компенсируется тем, что в более длинную молекулу ДНК может интеркалировать большее количество этидий-бромида, а это в свою очередь приведет к увеличению яркости свечения в УФ. После определения эффективности коамплификации внутренний стандарт использовался в конкурентной ПЦР для количественного определения ДНК вируса гепатита В в сыворотке крови. Для этого, исходя из общепринятой методики, мы готовили последовательные разведения раствора, содержащего внутренний стандарт в известной концентрации, в которые добавляли один и тот же объем исследуемой сыворотки крови. С этой смесью проводили ПЦР. В реакции, согласно принципу конкурентной ПЦР, равные количества продуктов должны были амплифицироваться в том случае, если начальные концентрации внутреннего стандарта и выявляемой ДНК равны. Поэтому при визуализации ПЦР-продуктов в агарозном геле можно выявить пробу, в которой ампликон, соответствующий внутреннему стандарту в определенной концентрации, и ампликон, соответствующий ДНК вируса гепатита В, имеют сопоставимую интенсивность флуоресценции в УФ. Таким образом, на базе полученного внутреннего стандарта мы создали in house тест-систему для количественного определения ДНК вируса гепатита В в биологических жидкостях.

Разработка диагностикума для вируса гепатита G.

На основании компьютерного анализа нуклеотидных последовательностей генома вируса гепатита G были подобраны и синтезированы две пары олигонуклеотидных праймеров для "nested" ОТ-ПЦР, позволяющих амплифицировать один из наиболее консервативных регионов генома вируса гепатита G (NS 5b регион). Прямой праймер GS1 был идентичен последовательности мРНК поз. 7234 -7257 (по GeneBank Acc.No U444402).

Обратный праймер GA1 был соответственно комплементарен кодирующей последовательности поз. 7705 - 7682. Таким образом, размер геномного амплификата между местами отжига выбранных нами праймеров составляет 444 пары нуклеотидов. Для повышения чувствительности и специфичности использовали другую пару "вложенных" (nested) праймеров: прямой праймер GS2 - и обратный праймер GA2 - 5- (см таблицу 2). Правильность подбора праймеров была подтверждена прямым секвенированием ПЦР-продукта.

Секвенирование ПЦР-продукта выявило последовательность полностью совпавшую с GeneBank Acc.No U444402. Синтезированные праймеры позволили выявить инфицированных вирусом гепатита G среди больных апластической анемией и в группах больных гемобластозами. Достоверных различий по уровню инфицированности в группе больных гемобластозами и апластической анемией не было получено. У большинства больных апластической анемией и гемобластозами вирус гепатита G идентифицировался в сочетании с вирусами гепатитов В и С, чаще с HCV.

Группы больных Число инфициро (n=107) ванных B, C и G Больных (%) (n=43) I гр (n=29) < 20 5 (10%) II гр (n=78) > 20 38 (50%) p<0,HCV HBV+HGV HBV HGV HCV+HGV Рисунок 4. Исследование инфицированности гематологических больных вирусами гепатитов В, С и G.

В группе больных, получивших более 20 трансфузий, количество инфицированных было достоверно выше, чем в группе с меньшим количеством трансфузий (Рис. 4). Таким образом, в этой работе нами впервые были получены данные, что обнаружение вирусов гепатитов В, G и G у гематологических больных достоверно кореллирует с полученным объемом гемотрансфузионной терапии.

Разработка диагностикума для одновременного скринирования и генотипирования вируса гепатита С.

Для диагностики и определения тактики лечения вирусного гепатита С большое значение имеет генотип вируса. Необходимо отметить, что требования к скрининговому ПЦР-тесту и генотипирующему ПЦР-тесту находятся в противоречии. Для скрининга необходимо использовать праймеры, комплементарные наиболее консервативным последовательностям вируса и, таким образом, амплифицирующие любой из генотипов. Для генотипирования аллель-специфичной ПЦР праймеры должны быть комплементарны генотипспецифичным участкам и не амплифицировать другие генотипы. Поэтому, обычно ставится скрининговая реакция, определяются положительные сыворотки, и потом отдельно ставятся типирующие реакции с положительными образцами. Нам удалось найти такие районы в геноме вируса гепатита С, которые фланкированы консервативными последовательностями, а внутри содержат вариативные последовательности, пригодные для генотипирования основных генотипов (1a, 2a, 3a, 1b). Это позволило нам предложить метод генотипирования вируса на материале, полученном в скрининговой реакции.

При этом отпадает необходимость в повторном выделении РНК и проведении реакции обратной транскрипции (а именно эти стадии анализа наиболее ресурсо- и трудоемки). Карта вирусных последовательностей, используемых для скрининга и генотипирования приведена на рисунке 5.

Рисунок 5. Схема района вируса гепатита С, используемого для одновременного скрининга и генотипирования и позиции праймеров.

Рисунок 6. Электрофореграмма результатов ПЦР-определения разных генотипов вируса гепатита С.

Разработанным методом нами были определены генотипы вируса гепатита С у 1147 больных, наблюдавшихся в Гематологическом центре.

Частоты встречаемости приведены на рисунке 7. Как и ожидалось, чаще всего встречался генотип 1b. Не удалось определить генотип (т.е. встетился иной чем 1a или 2a или 3a или 1b) менее чем в 1% случаев. В 2% случаев зарегистрирована коинфекция двумя наиболее распространенными генотипами (1b+3a).

Рисунок 7. Частота встречаемости основных генотипов (1a, 2a, 3a, 1b) вируса гепатита С.

Определение YMDD и precore мутаций вируса гепатита B.

Одной из задач нашей работы была разработка методов мониторинга мутационных изменений вируса гепатита В, важных для прогноза лечения и выбора адекватной терапии. YMDD- и precore-мутации G1896А в ДНК HBV выявляли методом аллель-специфической ПЦР, для чего подобрали праймеры, способные выявлять "дикий" тип вируса и все возможные замены нуклеотидов ДНК HBV в случае этих мутаций. Варианты аллель-специфических олигонуклеотидных праймеров, использующихся для выявления "дикого" и YMDD-мутантных штаммов HBV, представлены в Табл. 2. Нами установлено, что для получения адекватных результатов, концентрация вируса в исследуемом образце не должна превышать 107 геном/мл. Если концентрация вируса в сыворотке больного превышает 107 геном/мл, то при проведении ПЦР с аллельспецифическими праймерами образуются ПЦР-продукты, соответствующие как "дикому", так и всем мутантным штаммам вируса (см. рисунок 8). В случае сыворотки с высокой вирусной нагрузкой (более 107 геном/мл) обнаружение ПЦР-продуктов, соответствующих наличию вирусов всех форм, связано с появлением неспецифических ПЦР-продуктов. Разведение сыворотки до концентрации вирусной ДНК 107 геном/мл и менее позволяет отсечь вклад неспецифических реакций и (возможных) минорных, незначимых для терапии, примесей мутантных штаммов. Так, если в нативной сыворотке концентрация мутантных штаммов вируса составляет 0,1% и менее относительно "дикого" штамма, то при ее разведении до указанной концентрации после проведения ПЦР не будет зарегистрировано наличия ПЦР-продуктов, соответствующих мутантным штаммам, т.к. их количество находится за пределами чувствительности метода. В этом случае мы можем говорить о том, что в крови больного превалирует вирус "дикого" типа. Если же при разведении в образце ДНК до концентрации 107 геном/мл после ПЦР регистрируются оба ("дикий" и мутантный) штамма вируса, то в исследуемом образце концентрация вирусов, несущих YMDD- или precore-мутацию была не менее 104 геном/мл, следовательно, концентрации "дикого" и мутантного штаммов в такой сыворотке различаются не более, чем в 1000 раз, и в крови одновременно присутствуют две формы вируса. Наличие ПЦР-продуктов, соответствующих только мутантным штаммам вируса, свидетельствует о том, что в крови больного количество вируса с мутацией на три порядка превышает немутантную форму.

Рисунок 8. Разные концентрации ДНК вируса гепатита В "дикого" типа (+ ПЦРопределение с праймерами на "дикий" тип; mut - с праймерами на мутантные формы).

Определение парвовируса В19.

У больных с патологией системы крови парвовирус может вызвать серьезные осложнения, такие как транзиторная анемия, парциальная красноклеточная аплазия костного мозга, фульминантный гепатит. Банки крови США, Германии, Австрии, Великобритании осуществляют тестирование донорской крови на наличие PV B19. В нашей стране данные по распространенности парвовируса В19 на момент начала исследования отсутствовали. Перед нами была поставлена задача разработать тест-системы для выявления и количественного определения PV B19 методом ПЦР. Нами подобраны праймеры для двухэтапной полимеразной цепной реакции.

Преимущество предложенного нами метода состоит в том, что ДНК парвовируса В19 определяется непосредственно в сыворотке крови человека без предшествующей обработки ферментом proteinase K, последующей его инактивацией и выделением ДНК. Это ускоряет и удешевляет постановку теста, не уменьшая его чувствительности. Кроме того, подобранные нами две пары праймеров таковы, что, за счет существенной разницы в температуре отжига внешней и внутренней пары, исключено участие внешних праймеров на второй стадии реакции, что дает возможность проведения двух этапов в одной реакционной пробирке, а это, в свою очередь, также снижает вероятность контаминации образцов. Для количественного определения ДНК PV B19, были использованы праймеры, предложенные в работе [Compston 2008], и флурересцентный зонд собственной разработки. В качестве внутреннего контроля за прохождением всех этапов процесса мы использовали фрагмент кДНК гена JAK2 мыши, не имеющий гомологий с последовательностью ДНК PV B19 и ДНК человека. В качестве калибратора использовали фрагмент ДНК PV B19 длиной 123 п.н., клонированный в коммерческую плазмиду pGEMTEasy. Для построения калибровочной кривой использовали ряд последовательных разведений плазмиды pGEM-TEasy/PV B19 (1010 копий/мл, 109 копий/мл, 108 копий/мл, 107 копий/мл, 106 копий/мл, 105 копий/мл, 1копий/мл, 103 копий/мл, 102 копий/мл). Чувствительность тест-системы составила 100 копий/мл сыворотки крови. При помощи разработанных методов нами было протестировано 1500 доноров и 1000 больных. Частота обнаружения ДНК PV B19 в крови доноров составила 1,0%-1,3%, что соответствует частоте в других Европейских и Азиатских странах. Впервые обнаружено локальное повышение уровня инфицированности PV B19 (8%, декабрь 2008г., г. Балашиха, Россия), что необходимо учитывать при анализе популяционных данных, а также при планировании выездной деятельности службы крови.

Инфицированность PV B19 возрастает у больных, длительное время находящихся в стационаре, и не зависит от интенсивности трансфузий.

Инфицированность PV B19 у доноров и больных не коррелирует с инфицированостью гепатитами В и С.

Мультиплексное определение вирусов гепатита С, гепатита В и парвовируса В19 в сыворотке крови больных и доноров.

Как уже было сказано выше, вирусы гепатитов В и С представляют особую опасность для гематологических больных, получающих многочисленные трансфузии компонентов крови в процессе лечения.

Парвовирус B19 (PV B19), передается как трансфузионным, так и воздушнокапельным путем и может приводить к анемии и парциальной красноклеточной аплазии костного мозга. Кроме того, PV B19 был выявлен у ряда гематологических больных с проявлением клинических признаков гепатита неА, не-В, не-С, и имеются данные, указывающие на то, что PV B19 может вызывать фульминантный гепатит у иммуноскомпрометированных больных [Karetnyi 1999], [Wong 2003]. Таким образом, комплексный мониторинг HBV, HCV и PV B19 у этой категории больных в период всего лечения поможет вовремя выявить инфекцию или прояснить причину клинически диагностированного гепатита. На сегодняшний день подобное исследование является довольно дорогостоящим и технически сложным. Для его проведения необходимо использовать диагностические наборы для определения трех различных вирусов (HBV, HCV и PV B19), причем подготовка проб для исследования каждым набором также различна - выделение ДНК при определении HBV и PV B19 и РНК при определении HCV. Нами разработан метод, предусматривающий единообразное выделение ДНК и РНК из образца и позволяющий определять наличие одновременно HBV, HCV и PV B19.

Вирусные нуклеиновые кислоты из исследуемых образцов выделяли с помощью модификации метода P. Chomczynski, N. Sacchi [Chomczynski 1987] - использовали лизирующий буфер с pH 6,5. Это позволяет выделять из пробы одновременно как вирусную РНК, так и вирусную ДНК. После выделения все образцы проходили стадию обратной транскрипции, необходимую для последующего выявления РНК HCV. Как показали предварительные эксперименты, проведение обратной транскрипции с препаратами вирусных ДНК не влияет на их последующую амплификацию. Таким образом, после прохождения обратной транскрипции можно было выявить кДНК HCV, ДНК HBV и ДНК PV B19 при наличии их в образце. Для подтверждения прохождения всех стадий, а именно выделения нуклеиновых кислот, обратной транскрипции и ПЦР в реальном времени, в качестве внутреннего контроля мы использовали генноинженерный ретровирус, который добавляли в лизирующий буфер на первом этапе работы в определенной концентрации (праймеры и проба имеют маркировку "INT" в таблице). Система для мультиплексной ПЦР в реальном времени для выявления HBV, HCV и PV B19 основана на прохождении реакции в формате Taqman. Для каждого из трех вирусов и внутреннего контроля были подобраны соответствующие пары праймеров и зонды с флюорофорами, имеющими непересекающиеся спектры флюоресценции. При подборе праймеров для мультиплексной ПЦР особое внимание обращали на то, чтобы температуры отжига олигонуклеотидов для каждой из 4-х вирусных ДНК были одинаковы. Также исключали 3'-концевую гомологию праймеров и зондов так, чтобы при совместном использовании не образовывались димеры. Все 4 пары праймеров и четыре зонда смешивали с рабочей смесью для ПЦР и Taq-полимеразой. Результаты реакции регистрировали в реальном времени по 4-м независимым каналам флюоресценции, благодаря чему мы могли одновременно определять вирусы HBV, HCV, PV B19 и внутренний контроль в образце. Результаты считали достоверными только при амплификации внутреннего контроля. Затраты времени от момента взятия пробы до получения окончательных результатов о наличии 3 вирусов составляли не более 4 часов. Таким образом, протокол пробоподготовки адаптирован таким образом, чтобы выделять одновременно ДНК и РНК; реакция ставится в одной пробирке (проверено, что этап обратной транскрипции РНК никак не сказывается на определении ДНК); праймеры и зонды не "мешают" друг другу; регистрация разных реакций происходит по непересекающимся каналам флюоресценции. Применение этой системы позволило осуществить мониторинг HBV, HCV и PV B19 у больных Гематологического научного центра. Данные по количеству обследованных больных приведены в таблице 3.

Таблица 3. Общее количество анализов, выполненных с помощью разработанных методов ПЦР-диагностики на вирусы гепатита В, С и парвовируса В19.

Всего Из них Из них с генотипированием количественных B 5193 273 С 7480 329 21B19 2663 2663 Большой объем полученных данных и динамическое наблюдение позволило оценить вероятности развития клинических симптомов гепатитов В и С у больных с момента появления первых положительных тестов на маркеры HBV и HCV. В совместной работе с Гармаевой Т.Ц. было показано, что клиническая реализация инфицирования достигает 56% к 500 дню у больных, инфицированных HBV, 85% к 300 дню у больных, инфицированных HCV, и практически 100% к 624 дню наблюдения у коинфицированных больных HBV+HCV. Эти данные указывают на то, что при современном уровне развития технологий тестирования вероятность ложно-положительного результата на самом деле очень низка. Низкая вероятность ложно-положительного результата и несопоставимо высокая цена ошибки в случае ложно-отрицательного результата ставят под сомнение необходимость "подтверждающих" анализов, по крайней мере, в случае тестирования доноров. Также следует признать, что применение методов ПЦР диагностики для детекции ДНК HBV и РНК HCV у иммуноскомпрометированных больных с факторами риска вероятного инфицирования служит необходимым условием для адеватной диагностики этих инфекций.

Выводы.

1. Разработаны принципиально новые методы создания молекулярных диагностикумов для количественного определения патогенных вирусных РНК и ДНК с использованием специальных стандартов, исключающих получение ложно-отрицательных результатов на всех этапах и стадиях диагностики (Патенты РФ на изобретения № 2186388 и № 2194761).

2. Разработана и запатентована оригинальная тест-система для одновременного обнаружения вируса гепатита С (всех генотипов) и типирования основных генотипов (Патент РФ на изобретение № 2150505);

определена частота встречаемости основных генотипов.

3. Разработана и запатентована тест-система для определения парвовируса В19 (Патент РФ на изобретение № 2146372); измерена частота обнаружения PV B19 у доноров (1,0%-1,3%), и впервые обнаружено локальное повышение уровня инфицированности (до 8%), что необходимо учитывать при заготовке крови и компонентов.

4. Определена одинаковая частота встречаемости вируса гепатита G при апластической анемии и гемобластозах, а также преимущественное его выявление в сочетании с маркерами вирусов гепатитов В или С; установлена статистически значимая связь инфицированности с числом гемотрансфузий.

5. Определены концентрационные пределы применимости аллельспецифической ПЦР для мониторинга мутантных штаммов гепатита В (от 104 до 107 геном-эквивалент/мл).

6. Разработана мультиплексная система для одновременного определения вирусов гепатитов C, B и парвовируса B19 методом ПЦР в реальном времени; активное мониторирование позволяет обнаружить первые положительные тесты задолго до манифестации болезни; в дополнение к методам рутинной серологической диагностики вирусных гепатитов В и С у больных гемобластозами и депрессиями кроветворения, на фоне цитостатической и иммуносупрессивной терапии, необходимо использовать методы ПЦР-диагностики.

Внедрение.

Предложенные методы диагностики вирусов гепатита С, В и парвовируса В19 используются в клинике ФГБУ Гематологический начный центр. Всего на настоящий момент выполнено более 13000 анализов. Разработанные тестсистемы прошли Государственную регистрацию и на них были получены фармакопейные статьи предприятием "Гематолог".

Список сокращений.

ATCC - Американская коллекция клеточных культур DMEM - среда Игла в модификации Дальбекко FBS - эмбриональная телячья сыворотка GeneBank - банк данных нуклеотидных последовательностей HBV - вирус гепатита В HCV - вирус гепатита С HGV - вирус гепатита G PV B19 - парвовирус Вreal-time ПЦР - полимеразная цепная реакция с регистрацией результатов в режиме реального времени ДНК - дезоксирибонуклеиновая кислота ОТ-ПЦР полимеразная цепная реакция с предварительным этапом обратной транскрипции п.н. - пар нуклеотидов ПЦР - полимеразная цепная реакция РНК - рибонуклеиновая кислота РНКаза - рибонуклеаза УФ - ультрафиолетовое излучение Список работ опубликованных по теме диссертации.

1. Судариков А.Б., Огрель О.Д.. Патент на изобретение "Способ выявления вируса гепатита С в сыворотке крови человека" № 2150505. // Изобретения.

Полезные модели. 2000 стр 348.

2. Судариков А.Б., Февралева И.С.. Патент на изобретение "Способ определения парвовируса Б19" № 2146372. // Изобретения. Полезные модели. 2000 стр. 216.

3. Макарик Т.В., Романова Е.А., Глинщикова О.А., Судариков А.Б. Вирусный гепатит С. Новое в эпидемиологии, методах диагностики и терапии (обзор литературы) // Гематология и трансфузиология. 2001. v.46. No. 1. pp. 86-91.

4. Ягужинская О.Е., Пивник А.В., Февралева И.С., Судариков А.Б., Лисовина Ю.С., Логинова И.В., Шитарева И.В.. Диагностика инфекции парвовирусом В19 у гематологических больных, в сочетании с парциальной красноклеточной аплазией костного мозга. // Терапевтический архив. 2001. v.73. No. 8. pp. 50-56.

5. Судариков А.Б., Глинщикова О.А.. Патент на изобретение "Способ количественного определения РНК вируса гепатита С в сыворотке крови" № 2186388. // Изобретения. Полезные модели. 2002 стр. 424.

6. Судариков А.Б., Февралева И.С., Пичковская В.А.. Патент на изобретение "Способ конструирования внутреннего стандарта для количественного определения ДНК методом конкуренттной полимеразной цепной реакции" № 2194761. // Изобретения. Полезные модели. 2002. стр. 309.

7. Февралева И.С., Пичковская В.А., Судариков А.Б.. Новая технология конструирования внутреннего стандарта для количественной полимеразной цепной реакции. // Проблемы гематологии и переливания крови. 2002. v.. No. 1.

pp. 89.

8. Ядрихинская В.Н., Михайлова Е.А., Судариков А.Б., Глинщикова О.А., Булекова Ю.А., Куликов С.М., Савченко В.Г. Мониторинг инфицирования вирусами гепатитов В, С, G у больных апластической анемией и острыми лейкозами. // Проблемы гематологии и переливания крови. 2002. v.. No. 1. pp.

104.

9. Глинщикова О.А., Куликов С.М., Судариков А.Б.. Внутренний стандарт на основе ретровирусного вектора для определения вируса гепатита С в конкурентной полимеразной цепной реакции // Журн. микробиол., эпидемиол. и иммунобиол.. 2004. v.6. No. 6. pp. 84-88.

10. Пичковская В.А., Февралева И.С., Ибрагимова М.М., Соловьева Т.И., Крель П.Е., Судариков А.Б. Детекция YMDD-мутации в ДНК вируса гепатита В с помощью аллельспецифической полимеразной цепной реакции // Молекулярная генетика, микробиология и вирусология. 2004. v.. No. 1. pp. 27-29.

11. Гармаева Т.Ц., Куликов С.М., Карякин А.В., Терентьева Л.А., Туполева Т.А., Сомова А.В., Грумбкова Л.О., Ярославцева Н.Г., Филатов Ф.П., Февралева И.С., Глинщикова О.А., Макарик Т.В., Судариков А.Б., Михайлова Е.А., Савченко В.Г.. Мониторирование факторов риска и индикаторов инфицированности вирусами гепатитов В и С гематологических больных // Гематология и трансфузиология. 2006. v.51. No. 1. pp. 23-27.

12. Савченко В.Г., Гармаева Т.Ц., Куликов С.М., Филатов Ф.П., Судариков А.Б., Михайлова Е.А. Эффективность и безопасность трансфузионной терапии гематологических больных // Терапевтический архив. 2006. v.78. No. 7. pp. 1218.

13. Куликов С.М., Гармаева Т.Ц., Зингерман Б.В., Филатов Ф.П., Судариков А.Б., Михайлова Е.А., Терентьева Л.А., Карякин А.В., Савченко В.Г., Загоскина Т.П., и другие. Вирусная безопасность гемотрансфузий и методы ее оценки // Гематология и трансфузиология. 2008. v.53. No. 4. pp. 3-5.

14. Февралева И.С., Глинщикова О.А., Макарик Т.В., Судариков А.Б..

Мультиплексная диагностика вирусов гепатитов В, С и парвовируса В19 у больных, получающих множественные гемотрансфузии // Гематология и трансфузиология. 2008. v.. No. 4. pp. 54-56.

15. Гармаева, Т.Ц.., Куликов, СМ., Михайлова, ЕА., Игла, РЕ., Шматова, ТФ., Гемджян, ЭГ., Грумбкова, ЛО., Ярославцева, НГ., Сомова, АВ., Туполева, ТА., others. Динамика инфицирования вирусами гепатитов в и с больных с заболеваниями системы крови // Гематология и трансфузиология. 2009. v.. No. 5.

pp. 16-23.

16. Гармаева, ТЦ., Куликов, СМ., Михайлова, ЕА., Шматова, ТФ., Гемджян, ЭГ., Туполева, ТА., Грумбкова, ЛО., Ярославцева, НГ., Сомова, АВ., Макарик, ТВ., others. Клинико-эпидемиологическая характеристика инфицированности вирусами гепатитов В и С больных с заболеваниями системы крови при поступлении в стационар // Гематология и трансфузиология. 2009. v.54. No. 1.

pp. 3-9.

17. Творогова М.Г, Чуланов В.П., Волкова Р.А., Судариков А.Б., Михайлов М.И., Исаева О.В., Малахов В.Н. Результаты оценки качества выявления РНК вируса гепатита С методом ПЦР в ФСВОК в 2005-2007 гг. // Журн. микробиол., эпидемиол. и иммунобиол.. 2009. v.. No. 1. pp. 59-62.

18. Февралева И.С., Глинщикова О.А., Элижбаева М.А., Зингерман Б.В., Гудилина Ю.Ю., Гармаева Т.Ц., Куликов С.М., Судариков А.Б., Савченко В.Г.

Распространенность PV B19 среди больных гематологического стационара. // Гематология и трансфузиология. 2011. v.. No. 6. pp. 24-28.

19. Элижбаева М.А., Февралева И.С., Глинщикова О.А., Сильвейстрова О.Ю., Шипулина О.Ю., Домонова Э.А., Сафонова А.П., Овчинникова Е.Н., Татаева З.М., Судариков А.Б.. Выявление парвовируса в19 в крови российских доноров // Гематология и трансфузиология. 2011. v.. No. 2. pp. 10-13.

20. Гармаева Т.Ц., Куликов С.М., Михайлова Е.А., Гемджян Э.Г., Гапонова Т.В., Грумбкова Л.О., Ярославцева Н.Г., Туполева Т.А., Сомова А.В., Макарик Т.А., Глинщикова О.А., Февралева И.С., Судариков А.Б., Филатов Ф.П., Савченко В.Г.. Долгосрочные результаты инфицированности вирусами гепатитов В и С больных с заболеваниями системы крови // Терапевтический архив. 2011. v.83.

No. 7. pp. 17-26.

21. Glinschikova O.A., Sudarikov A.B. GenBank AY171560. // http://www.ncbi.nlm.nih.gov/nuccore/AY171522. Гармаева Т.Ц., Куликов С.М., Судариков А.Б., Филатов Ф.П., Михайлова Е.А., Городецкий В.М., Савченко В.Г. О необходимости использования методов генодиагностики для тестирования доноров крови, компонентов крови и реципиентов многочисленных гемотрансфузий. // 2011 Гематология и трансфузиология v. 56. No. 4. pp. 36-23. Пивник А.В., Андросова М.И., Кравченко С.К., Судариков А.Б.

Исследование этиологии парциальной красноклеточной аплазии костного мозга: количественное определение парвовируса b19 // Информационный бюллетень РФФИ. 1997. v.. No. 4. pp. 500.

24. Пивник А.В., Февралева И.С., Андросова М.И., Кравченко С.К., Судариков А.Б., Огрель О.Д. Исследование этиологии парциальной красноклеточной аплазии костного мозга: количественное определение парвовируса b19 // Информационный бюллетень РФФИ. 1999. v.. No. 4. pp. 362.

25. Ядрихинская В.Н., Савченко В.Г., Михайлова Е.А., Судариков А.Б.

Определение вируса гепатита G у больных аплазиями костного мозга. // Материалы 3 Всероссийская научно-практическая конференции "Генодиагностика в современной медицине". 2000.

http://www.hepatitinfo.ru/confgend/23.htm 26. Глинщикова О.А., Макарик Т.В., Романова Е.А., Судариков А.Б.

Определение генотипов вируса гепатита С у гематологических больных. // Материалы 3 Всероссийская научно-практическая конференции "Генодиагностика в современной медицине". 2000.

http://www.hepatitinfo.ru/confgend/24.htm 27. Пичковская В.А., Февралева И.С., Судариков А.Б.. Разработка тестсистемы, основанной на методе полимеразной цепной реакции, для количественного определения ДНК вируса гепатита В в сыворотке крови. // Вестник РГМУ. 2001. v.. No. 17. pp. 153-154.

28. Глинщикова О.А., Романова Е.А., Макарик Т.В., Судариков А.Б..

Количественное определение РНК вируса гепатита С в сыворотке крови больных. // Материалы научно-практического симпозиума "Технологии генодиагностики в практическом здравоохранении" М.: НПО "Литех". 2002. v..

No.. pp. 34-36.

29. Февралева И.С., Пичковская В.А., Судариков А.Б.. Разработка экспрессдиагностикума для количественного определения ДНК гепатита В в сыворотке крови. // Материалы научно-практического симпозиума "Технологии генодиагностики в практическом здравоохранении" М.: НПО "Литех". 2002. v..

No.. pp. 31-33.

30. Garmaeva T, Kulikov S, Michailova E, Sudarikov A, Filatov F, Savchenko V.

Prolonged follow-up of patients with hematological malignancies infected by HBV and HCV. // Haematologica. 2009. аbstr 0466. pp. 187-131. Гармаева Т.Ц., Куликов С.М., Михайлова Е.А., Филатов Ф.П., Судариков, А.Б. Савченко В.Г. Мониторирование факторов риска и индикаторов инфицирования вирусами гепатитов В, С у гематологических больных. // Материалы Всероссийской научно-практической конференции "Генодиагностика инфекционных заболеваний", 19-21 октября 2004, Москва, 2004.

32. Куликов С.М., Гармаева Т.Ц., Зингерман Б.В., Филатов Ф.П., Судариков А.Б., Михайлова Е.Ф., Савченко В.Г., Загоскина Т.П., Беляев В.В., Горовой В.П..

Остаточный риск инфицирования HCV как объективный показатель вирусной безопасности трансфузий. // Сборник трудов 6 Всероссийской научнопрактической конференции с международным участием "Молекулярная диагностика - 2007" под ред. академика РАМН В.И. Покровского. 2007. v.. No..

pp. 224-227.

33. Гармаева Т.Ц., Куликов С.М., Паровичникова Е.Н., Михайлова Е.А., Филатов Ф.П. Судариков А.Б., Савченко В.Г. Вирусные гепатиты В и С у больных с заболеваниями системы крови. // Российский журнал гастроэнтерологии, гепатологии, колопроктологии. 2011. v. 1. приложение №37. pp. 84.

34. Элижбаева М.А., Февралева И.С., Ягужинская О.Е., Глинщикова О.А., Овчинникова Е.Н., Лазаренко М.И., Судариков А.Б. Распространенность парвовируса В19 среди доноров московского региона. // Материалы Российской научно-практической конференции "Актуальные вопросы гематологии и трансфузиологии". Санкт-Петербург. Трансфузиология.. 2009. v.. No. 1-2. pp. 7373.

35. Гармаева Т.Ц., Куликов С.М., Михайлова Е.А., Филатов Ф.П. Судариков А.Б., Савченко В.Г. Риски и эффективность гемотрансфузионной терапии у больных с опухолевыми заболеваниями системы крови. // Вестник гематологии, 2011, v. 2, pp 12.

36. Сильвейстрова О.Ю., Элижбаева М.А.,. Шипулина О.Ю, Февралева И.С., Сафонова А.П., Глинщикова О.А., Шипулин Г.А., Судариков А.Б. Исследование плазмы донорской крови на наличие ДНК Parvovirus B19. // Материалы VII Всероссийской научно-практической конференции с международным участием "Молекулярная диагностика - 2010". Москва. Сборник трудов.. 2010. v.. No.. pp.

347-350.

37. Garmaeva T, Kulikov S, Michailova E, Sudarikov A, Filatov F, Savchenko V.

Hepatitis B and hepatitis C co-infection in patients with hematological malignancies.

Blood (ASH Annual Meeting Abstracts), 2011, abstr 2090, p 916-917.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.