WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

Лушникова Анна Александровна

  Структура и экспрессия MMTV-родственного провируса

у больных раком молочной железы

А В Т О Р Е Ф Е Р А Т

  диссертации на соискание ученой степени

  доктора биологических наук

  14.01.12. -  Онкология

  Москва 2010

Работа выполнена в НИИ канцерогенеза, Учреждения Российской Академии медицинских наук Российского Онкологического Научного Центра  им.Н.Н.Блохина РАМН; директор – академик РАН и РАМН, профессор М.И.Давыдов.

Научный консультант:

Доктор биологических наук  И.Н.Крюкова

Официальные оппоненты:

Доктор медицинских наук,  профессор  З.Г.Кадагидзе 

Доктор биологических наук, профессор  Г.Г.Миллер

Доктор биологических наук, профессор  В.С.Прасолов

Ведущая организация:

Учреждение Российской Академии медицинских наук Институт вирусологии им.Д.И.Ивановского РАМН

Защита состоится « 28  »  октября  2010 г.  в часов на заседании  Диссертационного совета Д.001.017.02 РОНЦ им.Н.Н.Блохина РАМН по адресу: 115478  Москва , Каширское шоссе, 24.

С диссертацией можно ознакомиться в библиотеке РОНЦ им.Н.Н.Блохина РАМН

Автореферат разослан «  »  2010 г.

Ученый секретарь Диссертационного совета РОНЦ им.Н.Н.Блохина РАМН,

доктор медицинских наук, профессор Ю.В.Шишкин

  1. Общая характеристика работы

1.1.

Актуальность проблемы

Рак молочной железы (РМЖ) составляет около 15% всех злокачественных неоплазий человека и  занимает первое место по заболеваемости и по смертности от онкологических заболеваний[ среди российских женщин. (Чистяков и др., 2009, Любченко Л.Н., 2009). Существуют  значительные межпопуляционные различия частот заболеваемости РМЖ, причем  у мигрантов, приезжающих в страны с высокой частотой РМЖ заболеваемость со временем также растет. Это указывает на специфичные факторы риска РМЖ. В последнее десятилетие появилось множество работ, посвященных  вирусной этиологии РМЖ.  В частности, были проанализированы частоты распределения в ткани РМЖ штаммов HPV высокого риска и их ассоциация с  онкопатологией молочной железы  (Khan N.A. et al. 2008,  Mendizabad-Ruiz A.P. et al. 2008). В качестве возможного этиологического агента РМЖ в некоторых популяциях рассматривается также вирус Эпштейна-Барр (EBV).  Однако,  вероятность участия этих вирусов  в  развитии РМЖ  у человека мала и доказательств в пользу  данной гипотезы пока недостаточно (Mant C., Cason J. , 2009; Lawson J.S., Gunzburg W.H., Whitaker N.J., 2006). В литературе широко обсуждается роль в канцерогенезе молочных желез семейства эндогенных бета-ретровирусов человека (HERV),  которое содержит около 830  элементов  и составляет 8-9%  от генома человека.  С помощью микрочипов было показано, что уровень транскрипции 18 членов  семейства, включая  HERV-T, HERV-F, HML-6 и др., в нормальной и опухолевой ткани  протокового РМЖ  различен  (O.Frank et al. 2008).  В других исследованиях была выявлена корреляция между высоким уровнем  экспрессии в опухолевой ткани  провирусов  группы HERV-K и РМЖ (Flockerzi A. еt al. 2008) .  Однако,  значимых различий по уровню транскрипции наиболее специфичных для РМЖ  провирусов HERV-K113 и  HERV-K115 между здоровыми женщинами  и пациентками с  РМЖ соответствующего возраста не обнаружено  (Burmeister  et al. 2004). 

  В  последнее время появились новые данные, проливающие свет на роль  в канцерогенезе МЖ человека ретровируса, родственного  вирусу опухолей молочных желез мышей (MMTV). Этот ретровирус, впервые описанный Дж. Биттнером в 1936 г., относится к онкогенным ретровирусам типа В (Betaretroviruses) и индуцирует РМЖ  у мышей (Coffin J.M et al. 1999). Жизненный цикл  MMTV связан с лимфоцитарным путем циркуляции в организме и вертикальной (эндогенный  mmtv) или горизонтальной (экзогенный MMTV) передачей потомству. В геноме человека выявлено  несколько классов MMTV-гомологичных последовательностей  эндогенного (НML-2, HML-6, HERV-K)  и  экзогенного происхождения (hMTV, HMTV, HBRV).  Экзогенные MMTV–родственные ретровирусы  были обнаружены как в ткани РМЖ, так и в  перипортальных лимфатических узлах, а также в эпителии печеночных протоков у пациентов с первичным билиарным циррозом  (L.Hu et al. 2009).  Последовательности с высокой гомологией гену env MMTV выявлены с помощью гнездовой ПЦР в опухолевых клетках, экспрессирующих рецепторы к прогестерону (PrR), в 16% (14/89) образцов рака яичников, 36% (53/147) -  рака простаты, 10% (5/50) - рака эндометрия, 9% (13/141) - рака кожи ( Johal H. et al. 2010). В сыворотках  крови  и в опухолевой ткани российских больных РМЖ и  некоторых здоровых женщин  были обнаружены антигены, иммунологически родственные белкам MMTV (Kryukova I.N., Komarova E.A., 1980; А.А.Лушникова и др. 1998). Была  выявлена экспрессия этих белков  in vitro в 13%  опухолевых клеток из нескольких первичных культур  РМЖ человека. (Melana S.M. et al. 2009; Taneja P. et al. 2009).

  Вопрос об участии MMTV-родственного ретровируса  в кацерогенезе ряда опухолей МЖ человека  активно  обсуждается, начиная с  1970-1980 гг., и по-прежнему актуален (Zotter S. еt al. 1981; Westley B. Et al.,  1984;  Salmons B. et al., 1987; Лушникова А.А. 2007).  Какова роль hMTV  в патогенезе  и его вклад  в прогрессию РМЖ и других неоплазий человека?  Существуют ли принципиальные структурно-функциональные  отличия мышиного и человеческого ретровирусов и в чем они заключаются? Каковы особеннсти биологии hMTV: его циркуляции в организме человека, путях передачи и возможных механизмах канцерогенеза? Несмотря на то, что известны некоторые структурные элементы генома и  соответствующие нуклеотидные последовательности  провируса hMTV, остается неясным, ассоциированы ли они с онкопатологиями молочной железы и другими неоплазиями человека. Решение этих вопросов важно для фундаментальной вирусологии и молекулярной биологии ретровирусов; ответ на них позволит обосновать риск заболеваемости РМЖ и сочетанными неоплазиями, расширить возможности предклинической диагностики РМЖ .

1.2. Цель и задачи исследования

  Целью данной работы является изучение  особенностей структуры и экспрессии MMTV-родственного провируса (hMTV) в лимфоидной и опухолевой ткани  больных  с различными типами РМЖ. Для достижения этой цели были поставлены следующие задачи:

  1. Выявить и проанализировать особенности геномной структуры hMTV в разных группах больных РМЖ.
  2. Сравнить их структуру с каноническими геномными последовательностями МMTV.
  3. Охарактеризовать специфичные функционально значимые области генома МMTV-родственного провируса (hMTV).
  4. Изучить экспрессию этих областей генома hMTV в лимфоидной и опухолевой ткани больных, страдающих РМЖ с помощью ОТ ПЦР, нозерн- и/или вестерн-гибридизации.
  5. Предложить доступный метод обнаружения экспрессирующегося провируса в периферической крови и/или опухолевой ткани МЖ, пригодный для клинической практики.

1.3. Научная новизна

Впервые в России нами проанализирована структура и экспрессия  hMTV  в группах  больных с различными клиническими характеристиками: со спорадическим и  наследственным РМЖ,  ассоциированным с беременностью и лактацией РМЖ (РМЖАБ), с листовидными опухолями молочной железы, с двусторонним РМЖ, РМЖ в сочетании  с неоплазиями ЖКТ и гемобластозами, с РМЖ и гинекомастией у мужчин. Были обнаружены структурные особенности провирусного  генома и высокий уровень экспрессии провируса в быстро прогрессирующих опухолях молочной железы при РМЖАБ и  в рецидивирующих листовидных опухолях.  Впервые  выявлены специфичные  особенности структуры hMTV: нуклеотидные замены  в сайте рибосомного фреймшифта и делеции в Sag-кодирующей области 3’LTR, которые  могут обусловить неконтагиозность  обнаруживаемых в человеческом молоке вирусных частиц за счет дефектного корового белка Gag  и  нарушения  активации клеток-мишеней с участием  вирусного суперантигена.

Впервые предложена  экспериментальная модель:  трансформированные MMTV клетки эпителия эмбриональной почки человека, позволяющая изучить  интеграцию провируса в геном человека,  его геномную структуру и экспрессию. С помощью экспериментальной клеточной модели и гибридизации in situ,  а также  ПЦР-анализа геномной ДНК из опухолевой и нормальной тканей доказана экзогенность  hMTV  для человека и способность эпителиальных клеток человека поддерживать вирусную инфекцию с последующей трансформацией этих клеток.

Впервые описана циркуляция  hMTV в организме:  экспрессирующиеся провирусные последовательности обнаружены в  лимфоидных клетках периферической крови, в опухолевой ткани молочной железы, в отдаленных метастазах у больных РМЖ,  в гиперплазированных лимфатических узлах и в костном мозге  у некоторых  больных гемобластозами.

Впервые сделана попытка многофакторного анализа  носительства  hMTV  в ассоциации с мутациями  в генах-супрессорах  BRCA1/2 и TP53, экспрессией  EsR, PrR и Her2/neu (по результатам иммуногистохимии).

Впервые предложен доступный метод детекции в плазме крови и опухолевых лизатах РМЖ продукта гена env hMTV, кодирующего аминокислотные мотивы в составе клеточных иммунорецепторов и играющего роль в трансформации эпителиальных клеток. Результаты позволяют обосновать роль экзогенного  MMTV- родственного ретровируса (hMTV) в индукции и прогрессии РМЖ, и возможно, ряда других неоплазий (неходжкинских лимфом и  ювенильного  острого миелобластного лейкоза).

    1. Научно-практическая значимость работы.

  Полученные результаты  вносят вклад в представления о возможных механизмах индукции опухолей молочной железы, связанных с носительством экзогенных ретровирусов и нестабильностью генома.

В сотрудничестве с профильными  отделениями НИИ клинической онкологии РОНЦ им.Н.Н.Блохина и лабораторией клинической онкогенетики  расширена компьютерная база медико-генетических и молекулярно-биологических данных, создан и пополняется банк  образцов биологического материала и ДНК.  Предложена методика ПЦР- и иммунодиагностики  для  различных групп  пациентов, страдающих РМЖ и сочетанными неоплазиями, позволяющая улучшить  раннюю диагностику, лечение и профилактику РМЖ с целью снижения заболеваемости и смертности пациентов.

    1. Апробация работы.

  Диссертация  была апробирована 28 января 2010 г. на совместной конференции лабораторий онкогеномики, лаборатории вирусного канцерогенеза, лаборатории  механизмов регуляции иммунитета, лаборатории иммунохимии,  и отдела молекулярной биологии  вирусов НИИ  Канцерогенеза РОНЦ им.Н.Н.Блохина РАМН.  Основные результаты работы были представлены в виде стендовых сообщений и тезисов на  19 Российских и международных конференциях и конгрессах, а также доложены на Съездах онкологов и радиологов СНГ, Минск, 2004, Баку, 2006, Ташкент, 2008; Международных конференциях «ВИЧ/СПИД и родственные проблемы», Санкт-Петербург, 1997, 1998, 2000 гг.; Российских Онкологических  Конгрессах, Москва, 2006,  2008 гг.;  4-ой Российской конференции по фундаментальной онкологии,  Санкт-Петербург,  2008; VII Milan Breast Cancer Conference, Мilan, 2007; 19th International Congress on Anti-Cancer Treatment (ICACT), Paris, France, 2008; 3-rd Familial Cancer Conference, Madrid, Spain,  2008; European Human Genetics Conference, Barselona, Spain, 2008 и Vienna, Austria, 2009.

  По теме диссертации опубликовано 58 печатных работ в российских и зарубежных, включая  рецензируемые журналы. 

    1. Структура и объем диссертации

  Диссертация состоит из  введения, обзора литературы, описания использованных материалов и методов, изложения собственных результатов и  их обсуждения,  выводов и списка цитируемой литературы . Диссертационная работа изложена на 230 страницах машинописного текста, включает  68 рисунков, 13 таблиц и список литературы из 329 источников.

  1. Содержание работы

2.1. Обзор литературы

В обзоре литературы  описываются  геномная структура MMTV, регуляция транскрипции и  экспрессии  провируса, обсуждаются этапы и механизмы ретровирусной инфекции с последующей трансформацией клеток-мишеней, а также и циркуляция MMTV в организме хозяина,  приведены литературные данные о MMTV-родственных последовательностях, обнаруженных  в геноме человека, обсуждаются возможные пути передачи MMTV-родственного ретровируса (hMTV)  человеку, дается заключение по  исследованной  проблеме.

  2.2. Материалы и методы

2.2.1. Характеристика больных

  Неотобранные выборки пациентов, страдающих различными формами спорадического и наследственного РМЖ, в основном , были сформированы в соответствующих хирургических отделениях НИИ Клинической онкологии РОНЦ им.Н.Н.Блохина РАМН, а группы пациенток с доброкачественными новообразованиями МЖ - на базе отделения амбулаторных методов диагностики и лечения НИИ Клинической онкологии РОНЦ им.Н.Н.Блохина РАМН. Контрольная группа здоровых женщин  в возрасте до 40 лет была отобрана на базе женской консультации и родильного дома №16 СЗАО г.Москвы (беременные и не рожавшие женщины ) и в Центре акушерства, гинекологии и перинатологии РАМН (здоровые беременные женщины). Донорами  крови  были  спортсменки общества «Динамо» г.Москвы сравнимого возраста,  не  имеющие в анамнезе и в родословной онкологических заболеваний.

Таблица 1. Характеристика исследованных групп пациентов и контроля.

Группа

Размер выборки

Возраст диагноза

Спорадический РМЖ

n=104 (6 - из онкологически отягощенных семей)

19-65 (47,7±5,6)

2РМЖ

n=83; n=  51 – наследственный РМЖ,

n=32- спорадический РМЖ

25-58(43,0±2,6)

27-75(51,4±5,8)

Наследственный РМЖ

n=26 (пациентки из наследственно отягощенных  семей со злокачественными новообразованиями разной локализации, вкл. РМЖ)

25-53 (38,0±4,2)

РМЖАБ

n=68; n= 36 -  РМЖ  на фоне беременности, n=24- РМЖ на фоне лактации, n= 8-в течение 1-го года после завершения беременности )

21-46(32,7±5,24)

РМЖ у мужчин

n=6

27-72 (48,2±6,43)

ЛО МЖ

n=8 

19-36 (27,2±3,5)

ФА

  n=17  (без других онкопатологий)

19-75 ( 4,6±5,6)

Гинекомастия

  n=11

37-58(41,4±3,8)

Здоровые

(без онкопатологии в семьях)

  n=20 (здоровые беременные )

n=45 ( доноры)

18-37(25,4±3,1)

20-36 (26,2±2,7)

Анамнез  всех исследованных пациентов  был проведен либо  путем опроса  пробанда и членов  семьи при медико-генетическом консультировании, либо  при анализе записей в истории болезни. Гистологические препараты  были пересмотрены в отделении патанатомии РОНЦ. Общую и безрецедивную выживаемость определяли с помощью программы PrismPad. Для проведения сравнительного многофакторного анализа была отобрана группа пациенток молодого возраста  n=57, страдающих спорадическим РМЖ, в семьях которых не было случаев онкологических заболеваний. С целью получения корректных оценок пациентки этой группы были отобраны по возрасту, стадии заболевания и сходной терапии. С помощью унифицированного кода  был сформирован компьютерный банк данных, учитывающий  наследственную отягощенность пациентов. Молекулярно-генетическая диагностика для выявления герминальных мутаций в генах BRCA1/2 и TP53  и подтверждения генетического диагноза наследственного рака проводилась совместно с  лабораторией генетики редких наследственных болезней МГНЦ РАМН.

2.2.2.  Сбор биологического материала и выделение нуклеиновых кислот

  Образцы периферической крови были получены от нелеченых первичных больных,  образцы опухолевых и нормальных тканей – после  хирургического вмешательства; их помещали в стерильный физиологический раствор или сжиженный азот и  немедленно  выделяли ДНК/РНК, затем оставшуюся ткань  хранили при -700С. Во избежание контаминации выделение нуклеиновых кислот из биологического материала,  ПЦР и клонирование ПЦР-продуктов  проводили в стерильных пространственно разделенных боксах  с использованием одноразового пластика, дозаторов и наконечников с фильтрами, стерильных рабочих растворов. Полученные образцы ткани хранились при -700С, образцы ДНК/РНК – при -200С, в виде аликвот. При постановке ПЦР был предусмотрен отрицательный (ПЦР-смесь без добавления матрицы) и бланк-контроли (вода). Для  внутреннего контроля ПЦР использовали праймеры к клеточным генам, кодирующим GAPDH и -актин человека. Геномную ДНК из цельной крови и тканей выделяли несколькими стандартными методами, включая фенольную экстракцию и выделение ДНК после частичного гемолиза крови  с помощью лизирующего буфера с последующим осаждением этанолом или буфером Extra Gene (ООО Изоген, ИОГен РАН, Москва). Для выделения геномной ДНК хорошего качества  из архивного материала  и опухолевой ткани использовали  наборы DNA MiniPrep (ЗАО Силекс, Москва) и Invisorb Genomic DNA Kit II (Invitek,  Германия),  по инструкции производителей. Для  выделения вирусного генетического материала из крови и опухолей  использовали  набор RTP DNA/RNA Virus MiniKit (Invitek, Германия), по инструкции производителя. При выделении  эписомной фракции из высокомолекулярной геномной ДНК охлажденную суспензию опухолевых клеток  инкубировали при перемешивании 3 часа  при 500С  в 10 объемах буфера, содержащего 0,5М ЭДТА, рН 8,0, 100 мг/мл протеиназы К и 0,5% саркозила, затем трижды  экстрагировали насыщенным фенолом и отбирали  нижнюю ДНК - содержащую фазу. После  диализа с использованием буфера, содержащего 50мМ Трис-HCl, рН 8,0, 10мМ ЭДТА, 10мМ NaCl,  в течение часа при комнатной температуре инкубировали препарат  с РНКазой (10мкг/мл ) и разделяли водную фазу на колонке с Biogel А-150 (Boehringer Mannheim, Германия) с буфером ТЕ, рН 8,0 и 0,1% SDS. Для отбора  низкомолекулярных фракций использовали электрофорез в 1,5%-ной агарозе.  ДНК  осаждали на ночь 5M CH3OONa,  рН 5,2 и этанолом  (1:20 по объему)  с последующим центрифугированием 10 мин при 14000 об/мин.  Для выделения тотальной РНК применяли  стандартный метод с использованием ГИТЦ (Трезол, ООО Хеликон, Москва),  а также наборы  Yellow Solve (Clonogen, С-Петербург)  или  RNАeasy mini kit (Qiagen Sciences,  USA),  по инструкциям производителей. Для выделения мРНК использовали  магнитные частицы со стрептавидином  (ЗАО Силекс, Москва).

2.2.3. Постановка ПЦР и ОТ ПЦР

Для предварительных ПЦР на матрице геномной ДНК использовали праймеры и условия, представленные ниже.  Состав и температуру отжига праймеров определяли с помощью программы BLAST 2.0 на основании последовательностей в базе данных, а также  после клонирования  и секвенирования  полученных на матрице геномной ДНК  ПЦР-продуктов. Для высокоспецифичной ПЦР в опытах с культурами трансформированных клеток и для повторных ПЦР на hMTV-позитивных образцах ДНК с последующим клонированием провирусных последовательностей использовали также  праймеры к Sag-кодирующей области 3’LTR MMTV(hMTV): F/ 5-GACAGTGGCTGGACTAATAGAACATT-3 (897- 922, по  Brandt-Carlson et al., 1999), R/ 5AATGTTCTATTAGTCCA-3’; к гену gag: R/ 5CTCCTTCTTCGGGAAACCAAG3  (151 -131н.п. от старт. кодона  gag);  F/ 5ATGGGGGTCTCGGGCTCAAAAGGG3 (1-24 н.п. от старт. кодона  gag); R/  5GGGACTGCCCCTTTACAAGTTTTTTGA3 (1888-1762 н.п. от старт.кодона  gag); F/  5-GATGGGAATCCACTTCCTCCC-3 (1720 -1740 н.п. от старт.кодона gag);  к гену  env R/5-GGACCCAGATTGGTGTTTCGGCAT-3 (24-1 н.п. от старт.кодона env); F/  5-ATGCCGAAACACCAATCTGGG-3 (1-21н.п.от старт.кодона env). Для  поиска MMTV-гомологичных последовательностей использовали праймеры к U3-LTRMMTV:F1/5'-TCCTGACTTGGCTTGGTATC-3';R1/5'-GGCCGACCTGAGGGTGAC-3'; HRE-содержащей области LTR: F1/5'-TTAAGTAAGTTTTTGGTTACAAACT-3'; R1/5'-TGGAAAGTGAAGGATAATGACGA-3'.Для локализации сайтов интеграции провируса  в культуре  эпителиальных клеток эмбриональной почки человека в первом и втором  раунде ОТ ПЦР  использовали коммерческие рэндом -  праймеры ( НПО Литех, Москва). Во втором раунде использовали  также праймеры к участкам генома MMTV, подобранные с помощью программы  BLAST 2.0:

LTRorf  5’ : 5’ –  ATG CCG CGC CTG CAG  CAG CAG AA – 3’ (1)

LTRorf  3’ :  5’ - TTA TTT ATT ATA CCT TAT GTC AAA – 3’ (2) 

LTR5’ : 5’-  GGT GGC AAC CAG GGA CTT AT -3’  (3)

envRT/1 F : 5’- CCA GAT CGC CTT TAA GAA G -3’  (4)

envRT/1R :  5’- TAC AGG TAG CAC TAT GG -3’ (5)

envMMTV/ 2F : 5’- TGC GCC TTC CCT GAC CAG GG -3’ (6)

env MMTV/ 2R:  5’- GTA ACA CAG GCA GAT GTA GG – 3’ (7)

Gag1/ R: 5’ -  GAT GAT GAG CTA ATC CTT  CC – 3’ (8)

Pol 1/R:  5’ – GGG TCT TTA CTA AAT AAT TC – 3’ (9)

Gag 1/F:  5’- GAC AGC TTG TCT ACC TCT GT -3’  (10)

Pol 2/R: 5’- TGT AGC AGT CCC TAA AGG AT-3’ (11)

gp/ F:  5’ -  ATC CTC ACT GCC AGA TCG C -3’  (12)

gp /R: 5’-  AAT CTG TGG CAT ACC TAA AGG -3’ (14)

LTR/ F: 5’- GGT GGC AAC CAG GGA CTT AT -3’  (15)

LTR/ R: 5’- CGA ACA GAC ACA AAC ACA CG – 3’ (16)        

  Область 3’LTR амплифицировали на матрице геномной ДНК, выделенной из ЛПК и опухолевой ткани с использованием  пар праймеров (1) ,(2),(3),(15), (16). Затем  некоторые специфичные ПЦР-продукты были клонированы в векторе pGEM-Т по инструкции производителя (Promega, USA) и секвенированы. Полученные последовательности сравнивали с  гомологичными последовательностями из базы данных BLAST 2.0, Clustal W, DNAStar. Для сравнения С-концевых полиморфных последовательностей Sag-кодирующих областей  3’LTR MMTV использовали алгоритм ANGIS, 2005 (Felsenstein, 1989).  Для  поиска MMTV-гомологичных последовательностей с помощью ПЦР на матрице геномной ДНК из опухолевой ткани и ЛПК использовали также праймеры, подобранные с помощью DNAStar  и BLAST к геному экзогенного MMTV (штаммы С3Н и HeJ), дающие ПЦР-продукты с частичной гомологией эндогенным MMTV-родственным вирусам. Поскольку протяженная часть генома  MMTV гомологична HERV-K, специфичность ПЦР-продуктов длиной 255 п.н. и 575 п.н. (ген env) и 680 п.н. (3’LTR) была подтверждена с помощью блотинга, клонирования и/или  выборочного секвенирования соответствующих последовательностей. Последовательность транскриптов определяли с помощью программ BLAST и DNAStar. Для определения  вторичной структуры РНК в области gag-pro мРНК MMTV (псевдоузелках) использовали программу SEGFOLD, предсказывающую термодинамическую стабильность фрагмента молекулы РНК путем сравнения данной  последовательности со стандартным набором  фрагментов молекулы, имеющих  фиксированные параметры. (X.Chen et al., 1995). Для ОТ ПЦР на матрице тотальной РНК (по 20 нг в реакцию) использовали пары праймеров:F1: 5’- GCCTTTAAGAAG-3’ ;  695-714;  (BLAST AF43689)  R1: 5’- TACAGGTAGCAGCACTATGG-3’; 1269–1289 ;(AF43689) F2: 5’- TGCGCCTTCCCTGACCAGGG-3’, 762–781;(AF43689) R2: 5’- GTAACACAGGCAGATGTAGG-3’; 1048–1117 ;  AF43689. F3 : 5' CGTCTCCGCTCGTCACTTAT 3'; R 3 : 5' TCAGCACTCTTTTATATTATGG 3'; F4: 5'- CGTCTCCGCTCGTCACTTAT- 3' (1370-1390);R4 : 5'- TCAGCACTCTTTTATATTATGG -3' (9877-9899).  Для амплификации  генов, кодирующих  GAPDH  праймеры:  F/5'-ССGGAGTCAACGGATTTGG-3'; R/5' -GGCAACAATATCCACTTTACCAGA GT- 3’; -актин F/ 5’ – TCC GAC СAG TGT TTG CCT TTT ATG -3’;  R/  5’- ACTGCTGTCACCTTC ACCCTTC – 3’ и/или обратную транскриптазу  MMLV (НПО Силекс, Москва), Hfi-полимеразу  (ЗАО Евроген, Москва),  полимеразу Кленова и  Taq-полимеразу  (НПО Силекс, Москва). Для амплификации концов кДНК при идентификации  последовательностей, фланкирующих ПЦР-фрагмент, использовали метод  RACE (Rapid Аmplification of cDNA Еnds), по Chenchik A. et al., 1998;  J Larrick, 2001). Для  ОТ ПЦР на матрице тотальной РНК или (полиА+)РНК в одноэтапном режиме использовали обратную транскриптазу ST/ single tube (ЗАО Силекс, Москва), а в стандартном режиме -  SuperScript II , 200 Ед/мкл (Life Technologies, США) с соответствующими  буферами и добавлением 20 мM MnCl2, 0.1 M DTT, смеси dNTP,  по 10 мM  каждого нуклеотида. При использовании во втором раунде полимеразы Кленова для ПЦР применяли буфер, содержащий  300 мM трицин-KOH (pH 9.1), 160 мM сульфата аммония, 30 мM MgCl2 , 0.2 мг/ мл BSA.

2.2.4. Анализ гомологии ПЦР-продуктов и экспрессии  генов gag  и env.

  ПЦР - продукты  выборочно секвенировали  с использованием  автоматического оборудования  ABI PRISM 3 100-Avant, USA  ( МГНЦ РАМН и Институт вирусологии  им. Ивановского РАН). Для дополнительного контроля и характеристики MMTV-гомологичных последовательностей  в ряде случаев проводили гибридизацию по Саузерну с меченными 32Р или дигоксигенином пробами: MMTV -специфичными ПЦР-продуктами, полученными на матрице ДНК из селезенки мышей вирус-продуцирующей линии С3Н (GR) и  пробой - геном  env MMTV, клонированном  в плазмиде  pBluescript SK+/- , производной  pUC19 (любезно предоставлена д-ром Т.В.Головкиной, США).  Плазмиду выделяли щелочным методом из суточной культуры трансформированных клеток E.coli и после рестрикции PstI анализировали вставку в 1,5%-ном  агарозном геле. Элюированный из геля фрагмент длиной около  1,5 т.п.н. метили дигоксигенином с помощью рэндом-праймеров по инструкции производителя (Boehringer Mannheim, Германия). Для доказательства гомологии ПЦР-продуктов и уточнения  их последовательностей использовали также  выборочное клонирование этих последовательностей  в векторе pGEM-T по инструкции производителя (Promega, USA). Нозерн-гибридизацию проводили стандартным методом.

  Для  анализа экспрессии белка - продукта гена  gag MMTV методом вестерн-гибридизации использовали коммерческие моноклональные мышиные  антитела mAbP2 anti-gag MMTV (любезно предоставлены д-ром П.Хейно, P. Hainaut, Университет Льежа, Бельгия). Визуализацию белков проводили  с помощью  кроличьего IgG, меченного  антителами против IgG, конъюгированными с пероксидазой хрена (GE Bio-Science, США), а также окрашиванием белка с помощью кумасси (метод Брэдфорд). Иммунологически родственный gp52 белок выделяли с помощью магнитных частиц c иммобилизованным  IgG, конъюгированным с меченными моноклональными мышиными антителами mAbP2 anti-gp52 IgG  (любезно предоставлены д-ром П.Хейно), согласно инструкции производителя (ЗАО Силекс, Москва).

2.2.5.  Определение сайтов интеграции провируса

Для детекции сайтов интеграции провируса в трансформированных клетках эпителия эмбриональной почки человека (ПКЭПЧ) и в трансформированных клетках НЕК 293-Т использовали ПЦР-продукты, полученные с использованием праймеров к  LTR MMTV и коммерческих рэндом-праймеров для амплификации кДНК. Подбор нуклеотидной последовательности  экзогенного провируса  от сайта рестрикции EcoRI к концу U5 3’LTR проводили пользуясь банком нуклеотидных последовательностей  BLAST.  Геномную ДНК, выделенную из клеток после 6-7 пассажей клеток,  обрабатывали EcoRI и лигировали  с олигонуклеотидными затравками АР1 и АР2 по инструкции производителя (GenomeWalker adaptor , Clontech Laboratories, Inc., Palo Alto, CA). После двух раундов ПЦР на матрице лигированных фрагментов ДНК  с использованием  специфичного для линкера праймера  АР1  и праймера к  MMTV LTR (F: 5' CGTCTCCGCTCGTCACTTAT- 3'), а затем полугнездовой ПЦР с праймерами АР2 и LTR F,  продукты  секвенировали и определяли гомологию фланкирующих провирус последовательностей  с помощью  BLAST 2.0 (UCSC Genome Bioinformatics) и DNAStar. В двух случаях ( две культуры трансформированных клеток НЕК 293Т) использовали метод  RACE.  Последовательность, локализованную левее интегрированного провируса  (дупликации  6-ти нуклеотидов), определяли с помощью ПЦР с использованием MMTV-специфичного обратного праймера:  (начиная с 9400-й п.н.): 5' СCACCAAGGAGGTCTAGCTCTG 3'  и праймера АР1.

2.2.6. Трансформация клеток эпителия почки человека

  Полученные культуры трансформированных клеток использовались в качестве модели для исследования структуры и экспрессии провирусного генома, а также  некоторых сайтов его интеграции в хромосомы человека.  Две различные эмбриональные почки человека были любезно предоставлены в  НИИ акушерства и гинекологии  МЗ РФ, а клеточная линия  эпителия эмбриональных почек человека НЕК 293 Т – в НИИ ФХБ им. А.Н.Белозерского МГУ.  Первичные культуры получены на среде RPMI-640 (SERVA)  с добавлением  12% эмбриональной телячьей сыворотки  (НПО ПанЭко, Москва). Клетки-продуценты MMTV выделяли путем  суспендирования селезенки мыши линии С3Н, взятой до появления у нее РМЖ.  Измельченную селезенку гомогенизировали  в фосфатно-солевом буфере и для лучшей адгезии  вирусных частиц в гомогенат добавляли полибрен (Aldrich, Германия), 8 мкл/мл. Суспензию клеток селезенки, обработанных митомицином (10-3М), наслаивали на монослой пролиферирующих эпителиальных клеток почки. После  инкубации 2 час. при 370С жидкую фазу удаляли  и  наслаивали свежую среду. Через 1-2 дня  среду заменяли на свежую с внесением инсулина  и дексаметазона (Sigma, USA), 10-6M . К этому времени все  клетки селезенки мыши вступали в апоптоз. Контролем служили флаконы без внесения клеток мышиной селезенки, но с добавлением в среду гормонов. Спустя 14 дней после внесения вирус-продуцирующих клеток  с недельным интервалом выделяли из части пересеваемых клеток ДНК и РНК (500 нг) для ПЦР и ОТ ПЦР. Для ПЦР использовали праймеры к gp52-кодирующей  области

гена env (ПЦР-продукты длиной 575п.н. и 255п.н.): F1/5’-ATCCTCACTGCCAGATCGC-3’;R1/5’-TCTGTGGCATACCTAAAGG-3’; F2/5’-TACATCTGCCTGTGTTAC-3’; R2/5’-ATCTGTGGCATACCT-3’ и LTR MMTV : F/5’-GGTGGCAACCAGGGACTTAT-3’; R/5’-CGAACAGACACAAACACACG-3’.

Для клонирования специфичных  ПЦР-продуктов использовали также пары праймеров, указанные выше.  ПЦР-продукты были секвенированы  и клонированы  в системе pGem-T (Promega, USA), по инструкции производителя. Некоторые из отобранных плазмидных клонов также секвенировали с помощью MegaBace-500 (Amersham). Часть  активно делящихся клеток  с признаками трансформации фиксировали в смеси метанол – уксусная кислота (3:1) и кариотипировали стандартным методом с помощью дифференциальной окраски по Гимза. Для  доказательства  хромосомной локализации  провирусных последовательностей  использовали гибридизацию  in situ с  меченными биотином  по инструкции производителя (ЗАО Силекс, Москва)  ПЦР-продуктами длиной 255 п.н. и  575 п.н , гомологичными гену env MMTV .

2.3. Результаты и обсуждение

2.3.1. MMTV-гомологичные последовательности у пациенток со спорадическим РМЖ

Ранее  MMTV-гомологичные  последовательности были обнаружены в некоторых популяциях  у 15- 39% пациенток со спорадическим РМЖ (Mok et al., 2008). Последовательности с высокой степенью гомологии кодирующей области генов  env MMTV и 3’LTR  MMTV  были выявлены нами  также  у  64% больных РМЖАБ и у 52% пациенток,  страдающих РМЖ с семейным накоплением РМЖ/РЯ  (Lushnikova et al., 2007).  Для сравнения мы исследовали частоту встречаемости и геномную структуру hMTV в репрезентативной выборке пациенток с диагнозом спорадический РМЖ. Было проанализировано 104 пациентки с первичным  РМЖ, (у 26 из них проанализированы образцы опухолей). Больные наблюдались в РОНЦ  РАМН с 1998-2008 гг. Анамнез выявил среди них 10% (10/104)  больных с наследственной отягощенностью (более 2-х кровных родственников страдали онкологическими заболеваниями, включая РТК, РЖ, РПЖ, РШМ).  Средний возраст  пациенток во время постановки диагноза  составил 47,7 лет (27 - 65 лет).  Для  ПЦР использовали  праймеры  к gp52- кодирующей области гена envMMTV  и Sag-кодирующей области 3’LTR  MMTV . Позитивными  оказались 38,4%  пациенток  (40/104). Выборочное прямое секвенирование полученных ПЦР–продуктов, а также секвенирование 3-х клонированных ПЦР-продуктов, соответствующих gp52-кодирующей области гена envMMTV, выявило  92-97% гомологии с канонической последовательностью гена env MMTV(С3Н и HeJ). Экспрессия этих последовательностей наблюдалась в  75% (30/40)  проанализированных образцов ЛПК  и  в 54,5% (6/11)  образцах опухолей, которые были hMTV -позитивными по результатам ПЦР.  Доля hMTV-позитивных пациенток  с гормон-положительными опухолями  была  выше  по сравнению с гормон-отрицательными: 29/54 эстроген-  и 4/7 прогестерон-положительных опухолей ,  5/32 эстроген  и 0/7 прогестерон-отрицательных опухолей. Обращает также внимание, что большинство MMTV-позитивных пациенток оказалось  с фиброзно-кистозной болезнью (32/40). Пролиферативная форма фиброзно-кистозной болезни  и рак молочной железы возникают и развиваются под влиянием одних и тех же эндогенных и экзогенных факторов. Безрецидивная выживаемость пациенток в данной группе составила от 5 мес. до 7 лет, общая выживаемость – от 2,5 до 10 лет. Cравнение пятилетней общей и безрецидивной выживаемости у позитивных (n=31) и негативных (n=28) пациенток со спорадическим РМЖ выявило тенденцию к меньшей         безрецидивной выживаемости в первой группе. Оба  показателя  снижаются через 1,5-2 года после лечения первичного РМЖ и особенно резко – у  позитивных больных

2.3.2. MMTV-гомологичные последовательности у пациенток  с  РМЖ, ассоциированным с беременностью (РМЖАБ).

  РМЖАБ встречается в клинической практике достаточно редко: от 1:1500 до 1:10.000, с пиком заболеваемости в возрасте от 32 до 38 лет. Проведенные исследования показали, что больные с РМЖАБ чаще имеют крупные опухоли, метастатически измененные регионарные лимфатические узлы, раковые эмболы, распространяющиеся по лимфатическим щелям. При этом у пациенток с РМЖАБ  отдаленные метастазы выявляются в 2,5 раза чаще, чем при спорадическом РМЖ (Пароконная и др., 2008). Эти характерные особенности, а также высокий  уровень эстрогенов создают благоприятный фон для аккумуляции и диссеминации hMTV у больных РМЖАБ.  Известно  14 случаев метастазирования РМЖ в плаценту плода (Pavlidis, Petrek, 2004). В то же время, в ДНК из клеточной линии хориокарциномы были выявлены последовательности, на 60-65% гомологичные MMTV. Кроме того, обнаружены  метастазы  в ткани плода при лимфоме, и гепатоцеллюлярном раке  у беременных женщин (Rothman, Potter, 2004).  При этих  неоплазиях также выявлены  пациенты-носители MMTV-гомологичных последовательностей (Melana et al, 2009).  Эти находки  позволяют предполагать вертикальный путь передачи провируса hMTV от матери  плоду, хотя  механизм преодоления вирусным агентом иммунологического барьера пока не выяснен. Предварительное изучение пациенток с РМЖАБ  показало высокую частоту встречаемости  MMTV-гомологичных последовательностей  как в геномной ДНК из лимфоцитов периферической крови, так и в ДНК из опухолевой ткани таких пациенток (Лушникова и др., 2006). Эти данные были подтверждены  другими исследователями ( Faedo еt al., 2007). Сравнительно высокую частоту обнаружения hMTV в этой группе больных (64% против 39% при спорадическом РМЖ) можно объяснить гормонозависимой  экспрессией провируса, а также  активной пролиферацией эпителиальных клеток  в растущей  во время беременности молочной железе, что создает благоприятные возможности для  циркуляции провируса в организме беременных. Мы исследовали 68 пациенток, лечившихся в  РОНЦ им. Н.Н.Блохина РАМН по поводу рака молочной железы, ассоциированного с беременностью и лактацией (табл 1). Последовательности, гомологичные геному MMTV (группа hMTV+) были обнаружены с помощью ПЦР и выборочного секвенирования ПЦР-продуктов у 44 (64,6%) больных,  в 24 (35,4%) случаях гомологии геномной ДНК с провирусными последовательностями  (ген env MMTV и область LTR) не обнаружено. Экспрессия функционально значимых последовательностей гена env MMTV, включая ITAM-кодирующую последовательность, а также  Sag-кодирующей области  3’LTR в подавляющем  большинстве образцов MMTV-позитивных опухолевых тканей (8/10, 80%,  проверено по 10 образцов) указывает на  возможность трансляции вирусных белков и на репликацию провируса. Выборочное секвенирование  амплифицированных продуктов (8 образцов) выявило  высокую гомологию: 89-95% с геномом экзогенного MMTV. Выявлены  протяженные ORF (открытые рамки считывания) в области гена  env длиной 670 и 965 н.п. Необычная структурная особенность MMTV заключается в том, что за счет неспаренного аденина формируются две  «жесткие» коаксиальные петли и два спиральных участка . Область стыка этих петель играет роль промотора фреймшифта (сдвига рибосомы в положение –1 от  открытой рамки,  обеспечивающий  «перескок» рибосомы  через кодон терминации транскрипции гена gag и, следовательно, экспрессию полицистронной мРНК) . Результаты прямого секвенирования ПЦР-продукта, полученного на матрице опухолевой ДНК и соответствующего гену gag MMTV показывают неполную гомологию района псевдоузелка ПЦР-продукта с канонической последовательностью. Анализ этой последовательности с интерполяцией вторичной структуры  обнаружил существенные различия, которые могут обусловить нарушение фреймшифта и, следовательно, трансляции полицистронной мРНК так что  синтезируется  дефектный белок сердцевины, что нарушает инфекционные свойства MMTV (Golovkina et al., 1998).  Возможно, это одна из причин дефектности вирионов, обнаруженных в человеческом молоке. Свидетельством тому являются результаты иммуноблотинга разделенных в 7-15% градиентном ПААГе белковых фракций сывороток крови и лизатов опухоли  с конъюгированными  моноклональными мышиными антителами anti-gag. Сыворотки и опухолевая ткань были получены от 2-х hMTV-позитивных пациенток с РМЖАБ. Оказалось, что соответствующая  продукту гена gag MMTV фракция не представлена ни в опухолевой, ни в нормальной ткани МЖ (контроль).  Таким образом, в быстро растущих опухолях  РМЖАБ наблюдается нарушение сплайсинга полицистронной мРНК, с которой транслируется  белок сердцевины вириона. Это наблюдение демонстрирует  особенности тканеспецифичной экспрессии MMTV-гомологичного проровируса (рис. 1).

(1)TTGTTTGTTGCTTTCCCCGCGGGGTGTGTT—TC-CCTTCT-GGGTTTTCCT-GC-TGT-TCCTTT—3’

(2) TTTTT-GTTGCTT-CCCCGCGGG-TGTGTTTTCCC-TTC-GGG-TTT-CCTTG—TGTTCCT—TT-3’

(3) АAAAAACUUCGAAAGGGGCGCCCCACUCAAAAGGGGAUGUCCCCUAAAGGUACGUACUAGGAUUAA-3’ 

Рис. 1. Сравнение последовательностей секвенированных ПЦР продуктов (1-2) в области предполагаемого сайта фреймшифта в области gag-pol (подчеркнутый мотив) и экстраполяция соответствующих последовательностей РНК (3).

  При исследовании 21 беременной без онкологических заболеваний аналогичного возраста MMTV-гомологичных последовательностей  в лимфоцитарной ДНК у  них не выявлено, за исключением одной женщины в возрасте 36 лет с диагнозом фиброзно-кистозная болезнь, которую можно отнести к группе риска. По этому признаку здоровые беременные сходны с донорами, у которых частота детекции hMTV  составляет 0-8%.

  Анализ характерной для российской популяции мутации 5382insC в экзоне 20 гена BRCA1 в изучаемой группе пациенток с РМЖАБ выявил более высокую ее частоту по сравнению с больными спорадическим РМЖ  (17,5% против 5-10%). Обращает также внимание высокая доля пациенток с семейной формой РМЖ в исследуемой группе больных с мутацией BRCA1, поскольку уже в 77% случаев из анамнеза известна их семейная отягощенность. При этом 29 из 43 (70%) hMTV-положительных пациенток с РМЖАБ оказались именно из группы наследственно отягощенных носительниц мутаций генов  BRCA1/2, а 76,9% носительниц мутаций были MMTV-положительными. Эта закономерность подтвердилась при иследовании пациенток с двусторонним РМЖ, для которых также характерна  высокая частота мутаций генов-супрессоров BRCA1/2 и ТР53  (данные Н.И.Поспеховой, МГНЦ РАМН, Москва). Клинико-патологические характеристики у hMTV-негативных и hMTV-позитивных пациенток с РМЖАБ включая динамику пятилетней выживаемости, характер метастазирования и гистологию опухолей, существенно различались. При отсутствии  метастатических лимфатических узлов у  hМTV-негативных больных общая и безрецидивная выживаемость была высокой на протяжении всех лет наблюдения. В этой группе случаи смерти и прогрессирования заболевания не отмечены. В то же время, 5 (25%) из 20 -ти hMTV-позитивных пациенток без метастазов в лимфоузлы за время наблюдения умерли. В группе  hМTV-позитивных больных отмечается тенденция к снижению общей выживаемости, начиная с 3-лет наблюдения и снижение  безрецидивной выживаемости, начиная с 1-го года наблюдения.

Рис 1. Безрецидивная выживаемость hMTV-негативных и  hMTV-позитивных  больных РМЖАБ

Рис 2. Общая выживаемость hMTV-негативных и  hMTV-позитивных  больных РМЖАБ.

Рис 2. Общая выживаемость hMTV-негативных и  hMTV-позитивных  больных РМЖАБ.

Частота и локализация отдаленных метастазов у hMTV-позитивных пациенток  также отличались от группы hMTV-негативных больных РМЖАБ (рис 3). Это подтверждает нашу гипотезу о роли лимфатической системы в циркуляции и диссеминации провируса.

Рис. 3  Частота локальных рецидивов (1) и метастазов в печень (2), легкие (3) головной мозг (4) , средостение (5) и яичники (6)  у  пациенток с РМЖАБ  в группах  (hMTV-) первый ряд и (hMTV+) – второй ряд. 

2.3.3. MMTV-гомологичные последовательности у  мужчин с РМЖ и гинекомастией

Заболеваемость РМЖ у мужчин составляет около 1% от всех  случаев РМЖ, в 100 раз реже, чем у женщин. В последнее время  отмечена тенденция к росту заболеваемости. Большинство случаев РМЖ у мужчин связано с  мутациями в гене BRCA2, которые отвечают за развитие семейных форм РМЖ. К другим  генетическим факторам риска  РМЖ у мужчин относятся синдром Клайнфельтера, синдром Кауден, семейный анамнез, позитивный  в отношении РМЖ. Риск РМЖ как у мужчин, так и у женщин усиливает  высокий уровень эстрогенов, стимулирующий  пролиферацию клеток эпителия молочных желез; продукты обмена  эстрогенов могут  оказывать прямое мутагенное действие на эти клетки  (Imyanitov, Hanson, 2004). Пониженная чувствительность клеток к андрогенам вследствие мутации гена, кодирующего соответствующий  рецептор, также усиливает риск развития РМЖ у мужчин.  Этот риск повышен и в других случаях гормонального дисбаланса. Пациентов с гинекомастией относят к группе риска, частота развития РМЖ у мужчин с гинекомастией в 3-5 раз выше  среднепопуляционной. Человеческий антиген, родственный  gp52 MMTV  и ассоциированный с РМЖ, обнаруживается  в сыворотке крови пациенток с РМЖ и  их здоровых родственний, но не выявляется у мужчин из российской популяции (Крюкова  и др., 2001, 2002).  Для  объяснения этого феномена  мы исследовали env MMTV-гомологичные последовательности, пациентов с РМЖ и гинекомастией. Было проанализировано  2 образца нативной опухолевой ткани молочной железы и  3 образца фиксированной ткани, полученных от  мужчин, страдающих РМЖ, а также  11  архивных образцов гинекомастийной ткани, заключенной в парафин . У 4-х пациентов с РМЖ и 4 – с гинекомастией были взяты образцы периферической крови. За исключением одного пациента с РМЖ, они не имели  ближайших родственников, страдающих РМЖ или гинекомастией. При повторных исследованиях образцов  ДНК из ЛПК, полученных от 4-х пациентов с РМЖ и 4-х  -  с гинекомастией был выявлен всего 1 MMTV-позитивный пациент, страдающий РМЖ. Из 5-ти образцов  ДНК, выделенных из опухолевой ткани  и  11-ти образцов гинекомастийной ткани позитивным был  образец, полученный от этого же пациента с РМЖ, все другие образцы оказались отрицательными. При последующей гибридизации по Саузерну из 16 образцов ДНК также выявлен  1 позитивный. С помощью ОТ ПЦР показано, что  обнаруженные env MMTV-гомологичные последовательности экспрессируются.  Три амплификата длиной 255 п.н., а также амплификат Sag –кодирующей области 3’LTR были секвенированы,  показана 92% (3’LTR) и 96%-ная гомологии  (env) с геномом  MMTV (штаммы  C3H, HeJ). Согласно анамнезу, у env MMTV-позитивного пациента  в возрасте  65 – ти лет  была диагностирована гинекомастия, а  9 лет спустя  - РМЖ на стадии T2N1M0, пациент был оперирован.  Его мать также оперировалась по поводу РМЖ в возрасте 46-ти лет, а сестра матери – по поводу  двустороннего метахронного РМЖ с множественными метастазами. У бабушки этого  пациента  по  материнской линии  был выявлен РТК.  Герминальных мутаций гена BRCA2  у  данного пациента не  обнаружено.

Рис 5. Результаты ПЦР–анализа  ДНК из образцов гинекомастийной  (1-11)  и опухолевой (12-16) тканей, полученных от 16-ти пациентов; М-маркер , С3Н- амплификат  ДНК из селезенки мыши линии С3Н длиной 255 п.н. Внизу – амплификат клеточного гена GAPDH длиной 190 п.н. (внутренний контроль). 

 

Рис 6. Результаты  гибридизации по Саузерну  амплифицированной  ДНК из гинекомастийной и опухолевой ткани от  тех же 16-ти пациентов с меченной дигоксигенином последовательностью gp52-кодирующей области гена  env MMTV;  15-позитивный образец от больного  РМЖ, С3Н- образец ДНК из селезенки мыши линии С3Н. 

Рис 9. ОТ ПЦР  с образцом РНК, выделенной из архивного образца  опухоли  MMTV-позитивного  пациента с РМЖ, праймеры к gp52-кодирующей области гена  env MMTV.

Таким образом, в отличие от результатов Форд с соавторами  (Ford et al. 2004),  частота MMTV-позитивных опухолей молочной железы у российских мужчин оказалось  значительно ниже и сопоставима с таковой у доноров: 1 из 5 больных РМЖ и 0 из 11 пациентов с гинекомастией. Это согласуется с  результатами анализа человеческого антигена, ассоциированного с РМЖ (ЧАГРМЖ), а также с результатами  ПЦР и ОТ ПЦР  геномной ДНК в группе доноров. Различия в частоте обнаружения  MMTV-гомологичных последовательностей у больных РМЖ мужчин  из австралийской и российской популяций по-видимому связаны как с генетическими особенностями популяций, так и с  распространением MMTV-родственного провируса.

2.3.4.MMTV-гомологичные последовательности у больных

двусторонним  РМЖ, включая  семьи с накоплением  неоплазий

Двусторонний рак молочной железы (2РМЖ)  составляет по различным

данным  1% - 20 %  от  всех случаев  РМЖ, ( Керимов, 2005). Риск

возникновения контралатерального  РМЖ значительно выше для больных

молодого возраста и/или имеющих  семейную историю онкологических

заболеваний, особенно РМЖ и РЯ.  Около 10% случаев РМЖ связано с 

наследованием высокопенетрантных  мутаций в генах предрасположенности

BRCA1 и BRCA2. Инсерция провируса  в  геном клеток эпителия  МЖ может нарушить экспрессию клеточных генов  и обусловить  их злокачественную трансформацию. Механизмы такой трансформации различны: от активации клеточных онкогенов до гиперактивации клеточных сигнальных путей  с участием  иммунорецепторов, несущих домены ITAM. (Callahan, Smith, 2008, Lushnikova et al., 2004).  Мы исследовали структуру и частоту провирусных последовательностей у пациенток с контралатеральным РМЖ (2РМЖ) и ассоциацию  носительства hMTV с онкопатологическим генотипом, а также клиническими особенностями РМЖ. Было проанализировано  83 пациентки с диагнозом 2РМЖ (табл 1). Среди родственниц I-II степени родства у 51 пациентки из изученной группы имелись случаи заболевания РМЖ и/или РЯ.  У 32 пациенток семейная отягощенность отсутствовала. Синхронный 2РМЖ был диагностирован у 17 (20%) пациенток, метахронный рак - у 66 (80%). В группе из 83 больных было выявлено 32 (38,6%) носительницы герминальных мутаций,  при этом 27 пациенток имели мутацию в гене BRCA1, 4 – в гене BRCA2 и 1 - в гене ТР53. У 46-ти из 83 (55,4%) исследованных пациенток  с  помощью специфичных ПЦР были обнаружены  последовательности с 95-98%-ной  гомологией  gp52-кодирующей области гена  env MMTV и  93-97 % - ной гомологией  Sag- и HRE- кодирующей  области 3’LTR MMTV. При этом большинство (37/46 - 80,4%) hMTV-позитивных пациенток  были из группы с BRCA1/2-патологическим генотипом. Аналогичная  тенденция отмечалась при  исследовании группы пациенток с РМЖАБ и свидетельствует о  повышенной частоте носительства hMTV на фоне нестабильного генома.  . У пациенток со спорадическим 2РМЖ было выявлено 5 мутаций:  в гене BRCA1 (4)  и в гене ТР53 (1) . При этом у пациентки с мутацией гена ТР 53 выявлены MMTV-гомологичные последовательности. У пациенток с семейным  2РМЖ/РЯ  обнаружены герминальные мутации только  в гене BRCA1, 5 из них , т.е. 10% общей выборки,  были носительницами hMTV .  Во всех исследованных нами выборках больных разными типами РМЖ у hMTV-позитивных пациенток  преобладал  инфильтративно-протоковый РМЖ  (до 98%).  Мутации в генах предрасположенности BRCA1/2 и генах-модификаторах обусловливают подавляющее число случаев наследственного РМЖ. Результаты нашего исследования показывают, что заметная часть  случаев BRCA-ассоциированного наследственного РМЖ связана также и с носительством  hMTV.

2.3.5. MMTVгомологичные последовательности у больных листовидными опухолями молочной железы.

Листовидные опухоли (ЛО) представляют собой  смешанные  саркомы и фиброаденомы МЖ и составляют около 2% всех злокачественных неоплазий МЖ. Редкость заболевания не позволяет достаточно полно исследовать молекулярно-генетические особенности этой патологии (Воротников , 2000). Мы исследовали  8 пациенток  с ЛО (табл 1). У 3-х их них диагноз был поставлен  на фоне беременности, у одной  – через 6мес. после медицинского аборта. У  2-х пациенток отмечены двусторонние ЛО МЖ: у одной из больных – 2 рецидива, у второй - 4  в интервале 2,5 года. У большинства пациенток (5/8) была диагностирована переходная форма ЛО: листовидная фиброаденома с эпителиальным и стромальным компонентами. Такая пропорция  наблюдалась и в других исследованиях этой патологии МЖ (Воротников, Ермилова, 2004). Анализ ДНК, выделенной из  ЛПК и опухолевой ткани  не обнаружил характерных для РМЖ мутаций генов BRCA1/2. Последовательности, гомологичные  геному MMTV, были обнаружены у 2 из 3 пациенток с ЛО МЖ на фоне беременности и у из 2 из пациенток с диагнозом ЛО МЖ. Прямое секвенирование ПЦР-продуктов выявило некоторые структурные  особенности. В 2-х образцах опухолевой ДНК были обнаружены инсерции в области гена env MMTV на границе с gp36-кодирующей областью. Возможно, это приводит к трансляции более протяженного аминокислотного мотива и каким-то образом влияет на функцию иммунорецептора, задействованного в сигналинге (Katz et al., 2006). Другой особенностью стала делеция  15-ти п.н. в Sag-кодирующей области U3 LTR MMTV, выявленная в образцах ДНК из ЛПК и опухоли беременной пациентки  с быстрорастущей двусторонней ЛО МЖ промежуточного гистологического  типа на фоне беременности  (Пароконная, Воротников и др., 2008).  Небольшие делеции Sag-кодирующей области были описаны нами  ранее при анализе секвенированных ПЦР-продуктов, полученных на ДНК из трансформированных клеток эмбриональной почки человека и на ДНК, выделенной из  лимфоузлов  пациенток с РМЖ в сочетании с лимфомами .

Дальнейший  анализ с помощью  BLAST 2.0 показал, что  эти делеции  не оказывают существенного влияния на структуру суперантигена.  С помощью ОТ ПЦР на образцах РНК, выделенной из  свежей опухолевой ткани, мы убедились в экспрессии описанных функционально важных провирусных последовательностей в 3-х из 4-х проанализированных образцов ЛПК и опухолевой ткани МЖ.  При выделении геномной  ДНК/РНК  MMTV c помощью набора, предназначенного для выделения  экстрахромосомного вирусного генетического материала (Virus DNA/RNA Minikit, Invitek)  уровень экспрессии был значительно выше. Это указывает на присутствие в опухолевой  ткани свободных  ретровирусов, возможно дефектных, а также  короткоживущих экстракопий  провирусной ДНК, которые выявляются также  после обработки выделенной фракции  РНКазой.

Следует подчеркнуть  наличие экспрессирующихся провирусных последовательностей  у всех 3-х изученных пациенток с злокачественными ЛО МЖ на фоне беременности и доброкачественной ЛО после медицинского аборта. У одной из этих MMTV-позитивных пациенток наступление беременности стимулировало  быстрый рост  неоплазий в обеих МЖ и увеличение  опухоли в 3 раза, при сроке беременности 20 нед. У другой пациентки беременность сопровождалась четвертым рецидивом ЛО.

2.3.6. MMTV-гомологичные последовательности  у больных РМЖ  и  неходжкинскими Т-клеточными лимфомами.

  Одной из причин этого заболевания может служить вирус Эпштейна-Барр, ДНК которого была обнаружена в опухолевой ткани  больных. С помощью ПЦР, ОТ ПЦР и электронной микроскопии в сыворотках крови пациентов, страдающих лимфомой  в сочетании с РМЖ были выявлены  частицы эндогенных ретровирусов семейства  HERV-K (HML-2), (Contreras-Galindo et al., 2008). Показано, что у мышей некоторых инбредных линий  MMTV может вызывать, помимо РМЖ,  В- и Т-клеточные лимфомы (  Dudely et al, 2005, Bhandra et al, 2005).  Для лимфомагенного варианта MMTV  характерно  наличие Т-специфического энхансера и утрата  репрессии транскрипции за счёт  делеции или супрессии области  негативного репрессора  (NRE).  При инъекции  мышам с иммунодефицитом экстрактов тканей  РМЖ  человека в ряде случаев наблюдалась  индукция Т-клеточных лимфом с фенотипом TcR/+CD4/8  (Wakasugi et al, 1995). С помощью ПЦР и  секвенирования соответствующих ПЦР продуктов в Т-клеточной лимфоме  у пациентки с РМЖ и лимфомой ранее  были обнаружены последовательности, на 99% гомологичные гену  env MMTV  штамма  BR6  и на 100%  - гену env MMTV штамма C3H.  Затем  последовательности, гомологичные  env MMTV и Sag-кодирующей ORF 3’- LTR MMTV,  были обнаружены  еще у 6 из 12 больных РМЖ и Т-клеточными лимфомами (Etkind et al., 2004). Если у мышей лимфомагенный  вариант  MMTV  несет делецию в ORF LTR  и транскрибируется укороченная иРНК  Sag, то у  исследованных пациенток  такой  делеции выявлено не было. Клонирование и секвенирование  этих последовательностей  показало различие  клонированных ПЦР-продуктов, полученных от  разных пациенток.  Это  говорит в пользу множественной инфекции  разными штаммами  MMTV.

Для  уточнения имеющихся в литературе немногочисленых данных мы  проанализировали образцы ДНК, полученные от  8 пациенток с РМЖ и Т-клеточной лимфомой (табл.1).  Лимфомы  были  диагностированы у этих пациенток одновременно или вскоре после  обнаружения РМЖ, одна из больных в момент  диагноза была  в первом триместре беременности.  Исследовали  ткань РМЖ,  ДНК из ЛПК и  гиперплазированные лимфоузлы (ГЛУ). Для сравнения исследовали опухолевую ткань, полученную от 5 пациенток с неходжкинскими лимфомами, наблюдавшихся в  РОНЦ им.Н.Н.Блохина РАМН.

С помощью специфичной ПЦР с праймерами к gp52- кодирующей области  гена env MMTV  и к Sag-кодирующему участку  3’LTR MMTV  последовательности, относящиеся к  hMTV, были выявлены у 4 из 8 пациенток.  Секвенирование  ПЦР-продуктов на матрице ДНК из лимфомной ткани выявило  делецию 15-ти нуклеотидов в области 3’ LTR и  однонуклеотидные замены в области  env MMTV, что может привести к преждевременной терминации транскрипции .

Рис 10.  Результаты ПЦР-анализа  ДНК из ГЛУ (1) и ЛПК (2),  показаны различные по длине  ПЦР-продукты  из-за делеции 15 п.н. Sag-кодирующего участка 3’LTR, электрофорез в ПААГе.

  Таким  образом, мы подтвердили  данные о  наличии  MMTV-гомологичных последовательностей  не только в ткани РМЖ, но в ЛПК и ГЛУ  больных, страдающих РМЖ и Т-клеточной лимфомой. В то же время,  ПЦР-анализ не  выявил этих последовательностей в образцах ГЛУ, полученных от пяти  пациенток с неходжкинскими лимфомами, но без других онкопатологий,  включая РМЖ.

  У одной из позитивных больных РМЖ лимфома была обнаружена  в ранние сроки беременности. При изучении ассоциации hMTV с РМЖ и лимфомами у человека  предполагается  сходство  механизмов  MMTV-индуцированного канцерогенеза РМЖ и лимфом. Скорее всего, эти опухоли развиваются одновременно или с небольшим интервалом времени.  Отметим, что  гемобластозы, включая лимфомы, могут развиваться и в результате геномной нестабильности клеток вследствие лучевой терапии РМЖ. 

  Различия в структуре  MMTV-гомологичных последовательностей,  обнаруженных в ткани РМЖ и Т-клеточных лимфом, указывают на возможность  дивергенции  латентного провируса, реплицирующегося в ЛПК или на  множественную инфекцию человека разными штаммами  MMTV (hMTV).

ATCCTCACTGCCAGATCGCCTTTAAGAAGGACGCCTTCTGGGAGGGAGACGAGTCTGCTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

ATCCTCACTGCCAGATCGCCTTTAAGAAGGACGCCTTCTGGGAGGGAGACGAGTCTGCTC  1496

CTCCACGGTGGTTGCCTTGCGCCTTCCCTGACCAGGGGGTGAGTTTTTCTCCAAAAGGGG  120

|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||

CTCCACGGTGGTTGCCTTGCGCCTTCCCTGACAAGGGGGTGAGTTTTTCTCCAAAAGGGG  1556

CCCTTGGGCTACTTTGGGATTTCTCCCTTCCCTCGCCTAGTGTA-ATCAGTCAGATCAGA  179

|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||

CCCTTGGGTTACTTTGGGATTTCTCCCTTCCCTCGCCTAGTGTAGATCAGTCAGATCAGA  1616

TTTTAAA-CAAAAAGGAGCTCTTTGGGGATTTTATTCTCCCTGTGTATATAGAGGAGGTT  238

||  ||| ||||||||| || |||||  ||| || || ||||||  ||| | || |||||

TTA-AAAGCAAAAAGGATCTATTTGGAAATTATACTCCCCCTGTCAATA-A-AG-AGGTT  1672

CATCGGAGTGGTATGAAGCAG-ATGGGTAGAACCTACTTGGTTCTGGGAAAATTCTCCTA  297

||||| | ||||||||||||| ||||||||||||||| ||||||||||||||||||||||

CATCG-A-TGGTATGAAGCAGGATGGGTAGAACCTACATGGTTCTGGGAAAATTCTCCTA  1730

AAGATCCCAATGATAGAGATTTTACTGCTCTAGTTCCCCATACAGAATTGTTTCGCTTAG  357

| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

AGGATCCCAATGATAGAGATTTTACTGCTCTAGTTCCCCATACAGAATTGTTTCGCTTAG  1790

TTGCAGCCTCAAGACATCTTATTCTCAAAAAGCCAGGATTTCAAGAACATGAGATGATTC  417

|||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||

TTGCAGCCTCAAGACATCTTATTCTCAAAAGGCCAGGATTTCAAGAACATGAAATGATTC  1850

CTACATCTGCCTGTGTTACTTACCCTTATGCCATATTATTA  458

|||||||||||||||||||||||||||||||||||||||||

CTACATCTGCCTGTGTTACTTACCCTTATGCCATATTATTA  1891

Б

GGTGGCAACCA-GGACTTATAGGGGACCTTACATCTACAGACCAACAGACGCCCCGCTAC  59

||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||

GGTGGCAACCAGGGACTTATAGGGGACCTTACATCTACAGACCAACAGACGCCCCGCTAC  736

CATATACAGGAAGATACGATTTAAATTTTGATAGGTGGGTCACAGTCAAACGGCTATAAA  119

||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||

CATATACAGGAAGATACGATTTAAATTTTGATAGGTGGGTCACAGTC-AACGGCTATAAA  795

GTGTTGTAACAGATTCCTTCCCTTTCGGGAAAGAATCGGCAGAGACTAGAAACTCCTTGT  179 

||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||

GTGTTGT-ACAGATCCCTCCCCTTTCGTGAAAGACTCGCCAGAG-CTAG-ACCTCCTTG-  851

GTGTGTCTGTAAACTCTCAGAGAGAGAAAAGAGAAGATATAAAACAAGGGGTACGTGATT  239

||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||

GTGTGTGT-T-AA--CTCAG-GA-AGAAAA-AGACGACATAAAACAACAGGTACATGATT  904

ATATTTATCTAGGAAGTGGAATGAACGTTTTGGGGAAAGATTTTTCATTATACCAAGGAG  299

||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||

ATATTTATCTAGGAACTGGAATGAACG-TTTGGGGAAAGATTTTTCATTATACCAAGGAG  963

GGGGCAGTGGCTAGACAATTAGAACACATTTTCTGCAGATACTTTTGGCATGAGCTATAA  359

|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||

GGGGCAGTGGCTAGACAATTAGAACACA-TTTCTGCAGATACTTTTGGCATGAGCTATAA  1022

TGGATAACCTTTATGAGCCCAACCTTGCGGTTCCCAAGGTTTAAGTAAGTTCAGGGTCAC  419

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

TGGATAACCTTTATGAGCCCAACCTTGCGGTTCCCAAGGTTTAAGTAAGTTCAGGGTCAC  1082

AAACTGTTTCTTTAAAACCAAGGATGTGAGACAAGTGGTTTCCTGACTTGGTTTGGTATC  479

|||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||

AAACTG-TTC-TTAAAA-CAAGGATGTGAGACAAGTGGTTTCCTGACTTGGTTTGGTATC  1139

AAATGTTTTGATCTAAGCTCTGAGTGTTCTATTCTCCTATGTTCTTTTGGAACTTATCCA  539

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

AAATGTTTTGATCTAAGCTCTGAGTGTTCTATTCTCCTATGTTCTTTTGGAACTTATCCA  1199

AGTCTT  545

||||||

AGTCTT  1205

Рис 11.   Сравнение  ПЦР-фрагментов, гомологичных gp52-кодирующей области гена envMMTV (А) и области  3’LTR MMTV (Б), амплифицированных на ДНК из ГЛУ больной РМЖ в сочетании с лимфомами (нижняя строка) с каноническими последовательностями  MMTV (геном мышей линии GR, верхняя строка); области делеций и/или нуклеотидных замен выделены жирным шрифтом. Гомология между сравниваемыми последовательностями составляет 94%.

2.3.7.Семейный случай РМЖ с острым миелоидным лейкозом.

  Мы исследовали ДНК из  архивных образцов РМЖ, полученные в результате радикальной мастэктомии у пациентки в возрасте 37-ми лет из онкологически неотягощенной семьи (РОНЦ), а также ДНК из костного мозга, полученного от ее сына 11-ти лет, страдающего ОМЛ и наблюдавшегося в Отд.гематологии РДЦКБ, г.Москва. В контрольной группе было 6 мальчиков в возрасте от 2-х до  13-ти лет и 4 девочки в возрасте от 7-ми  до 15-ти  лет с первичным диагнозом ОМЛ, наблюдавшихся в отделении детской гематологии НИИ детской онкологии РОНЦ. По результатам цитогенетического анализа,  пациенты с ОМЛ отнесены к группе носителей транслокации t(8;21),  (данные  Е.В.Флейшман и О.И.Соковой, НИИ канцерогенеза РОНЦ).

  Амплификация  ДНК, выделенной из заключенной в парафин  опухолевой ткани пациентки с РМЖ,  выявила  ПЦР-продукт, гомологичный gp52-кодирующей области гена envMMTV.  Гомология  выявленного продукта была подтверждена с помощью Саузерн-блотинга. Прямое секвенирование ПЦР-продукта  также обнаруживает  96-98% гомологии с геном  envMMTV. ПЦР-анализ  11-ти  пациентов с ОМЛ выявил 4 MMTV-позитивных образца ДНК из костного мозга (3 мальчика  9,11 и 13 лет и 1 девочка  15 лет), включая  пациента, мать кторого страдала РМЖ.  Все 6 пациентов с ОЛЛ оказались MMTV-негативными.  Секвенирование  env MMTV и 3’LTR MMTV-гомологичных продуктов выявило 93-94% гомологии с экзогенным  MMTV (линии  С3Н и HeJ).  MMTV-гомологичные последовательности были впервые выявлены нами  у 4-х из 11-ти  детей с диагнозом ОМЛ, наблюдавшихся в НИИ детской онкологии РОНЦ. Полученные результаты свидетельствуют о вовлеченности  MMTV -родственного ретровируса  не только  в лимфомагенез, но, возможно, и другие  гемобластозы, включая ювенильный ОМЛ  (Lushnikova, Smirnova, 2006). По-видимому, главную роль в диссеминации  MMTV у таких больных играет инфекция  дендритных и/или полипотентных  гемопоэтических стволовых клеток миелоидной линии с последующей амплификацией провируса в  активно пролиферирующих клетках костного мозга. С другой стороны, у нескольких больных ОЛЛ детей  выявить  MMTV-гомологичные последовательности  нам не удалось (Lushnikova  et al., 2006).  Это указывает, что инфекция  ретровирусом клеток-предшественников  В- и Т-лимфоцитов, дающих начало лимфобластам,  маловероятна или происходит с меньшей частотой, чем инфекция  клеток миелоидной линии.  Известно, что  инфекция  полноразмерным клонированным в плазмиде провирусом MMTV (JYC-MMTV) четырехнедельных  беременных самок  мышей линии  CВА/CaJ, не несущих эндогенных копий  MMTV ,  приводит к появлению инфекционных вирионов в молоке самок, появившихся  от скрещивания между собой  указанных  инфицированных самок. Причем экспрессирующийся экзогенный  JYC-MMTV был обнаружен  не только в ткани молочной железы, но также в селезенке и костном мозге  самок из потомства инфицированных животных. Ретровирус для клонирования был выделен у китайских мышей дикого типа с высокой частотой РМЖ, а его репликация поддерживалась в эпителиальных клетках крысы линии  RBA (Xu et al. 2000). Обнаружение MMTV-гомологичных последовательностей в клетках костного мозга у  сына MMTV-позитивной  пациентки, болевшей РМЖ,  подтверждает возможность  вертикальной передачи провируса от матери к детям и роль лимфоидных клеток в его диссеминации.

2.3.8. MMTV-гомологичные последовательности  у пациентки с РМЖ и другими неоплазиями

  Анализ геномной ДНК, выделенной из ЛПК и опухолевой ткани больных РМЖ, а также  доноров и  пациентов с онкопатологиями другой локализации  показывает, что носителями  MMTV-гомологичных последовательностей (hMTV) являются  далеко не все из исследованных образцов.  Отсутствие hMTV в нормальной ткани без  неопластических изменений, а также  у целого ряда пациентов с неоплазиями четко свидетельтвует об экзогенности  этого ретровируса. При исследовании  одной из пациенток, страдающей РМЖ в сочетании с раком толстой кишки (РТК)  нам удалось проследить пути циркуляции hMTV в организме человека и получить доказательства его экзогенного происхождения.  При плановом обследовании пациенток из наследственно отягощенных семей, наблюдавшихся в  НИИ клинической онкологии РОНЦ,  в ДНК из ЛПК  у пациентки К. были выявлены  последовательности , на 93-97%  гомологичные  3’LTR  и гену  env MMTV.  В возрасте 48 лет этой пациентке был поставлен диагноз рак толстой кишки и хирургически удалена массивная опухоль, а также часть тонкого и толстый  кишечник. Гистологически материал был описан и верифицирован в отд. патоморфологии РОНЦ. За три года до этой операции  пациентка  перенесла одностороннюю мастэктомию по поводу РМЖ. Среди родственников  больной  у бабушки  по материнской линии был диагностирован РМЖ, у деда – рак мочевого пузыря, а у отца – рак легких . Мы исследовали кратковременные культуры клеток, полученных при соскобеэпителия  хирургически удаленного кишечника и срезы фиксированной  нормальной и опухолевой ткани кишечника  этой больной, заключенной в парафин. Контролем служили хирургически удаленные  ткани стенки кишечника одной больной полипозом кишечника и  двух пациенток с раком  толстого кишечника, ближашие родственники которые не болели РМЖ. Нужные микрофрагменты ткани: инфильтрированные лимфоцитами узелки и не инфильтрированные ими участки опухоли выделяли со среза путем микродиссекции.  В  образцах геномной ДНК, выделенной из ЛПК данной пациентки  с помощью ПЦР с последующей гибридизацией по Саузерну были выявлены последовательности, гомологичные  геному MMTV (hMTV). Для того, чтобы убедиться в экзогенности этих последовательностей, мы проанализировали  с помощью ПЦР образцы ДНК из различных участков  тканей кишечника.  В ДНК, выделенной из  фрагментов  стенки кишечника, содержится также  лимфоцитарная ДНК из Пейеровых бляшек – морфологически обособленных лимфатических узелков в стенке тонкого и верхнего отдела толстого кишечника.  Если MMTV-гомологичные последовательности действительно экзогенного происхождения, т.е. попадают в организм человека извне, то  наиболее вероятна  передача ретровируса человеку путем инфицирования лимфоидных клеток. Эти клетки по-видимому, играют основную роль в передаче ретровирусного агента вертикально,  включая  внутриутробную инфекцию пролиферирующих клеток эпителия (Лушникова и др.2009). Механизмы преодоления  иммунологического барьера не вполне ясны, однако  известны факты  передачи  инфекции потомству при заражении  экспрессирующимся экзогенным  MMTV беременных самок мышей (Xu et al., 2000). Возможность инфекции мышиным MMTV эмбриональных клеток эпителия  с последующей их трансформацией  была продемонстрирована нами на модельных культурах  эпителиальных клеток ПКЭПЧ и  линии  НЕК 293-Т  in vitro, однако возможность внутриутробной инфекции  in vivo пока не доказана.

2.3.9. MMTV-гомологичные последовательности в отдаленных метастазах  у пациенток с РМЖ.

  Как было показано в наших  работах,  MMTV-родственный провирус использует для  своей циркуляции в организме человека лимфоидные клетки.  Кроме того, анализ клинических особенностей hMTV-позитивных опухолей МЖ говорит о более высокой  частоте метастазов по сравнению с hMTV-негативными неоплазиями.  Так например,  частота  отдаленных метастазов  у hMTV-позитивных пациенток с РМЖАБ по сравнению с hMTV-негативными была достоверно выше. У одной из таких  hMTV-позитивных пациенток в возрасте 37-ми лет с односторонним спорадическим РМЖ  4-й степени и отдаленными метастазами в головной мозг, легкие и скелетные кости  были проанализированы  образцы ДНК, выделенной из архивных образцов  метастатических  узлов  в теменной области головного мозга, полученные при паталогоанатомическом вскрытии. Пациентка наблюдалась в МОНИКИ им. Вишневского,  и  прожила после хирургической  операции 2,5 года, химиотерапии и лучевой терапии не проводилось. Параллельно был проанализирован образец ДНК, выделенной из заключенной в парафин ткани РМЖ,  опухоль была получена после хирургической операции – резекции части пораженной МЖ. Контролем служили  5 образцов замороженной ткани головного мозга здоровых лиц, погибших в ДТП, полученные из Института скорой помощи, Москва.  При ПЦР на образцах ДНК из ткани РМЖ и печени в качестве контроля  использовали  2 образца хирургически удаленной гепатокарциномы, полученные  в Отд.патоморфологии РОНЦ. Анализ образцов ДНК из метастазов у первой пациентки и анализ образцов ДНК из ткани РМЖ и печени у второй  позволил выявить MMTV-гомологичные последовательности как в опухолевой ткани, так и в метастазах. Секвенирование ПЦР-продуктов, соответствующих gp52-кодирующей области гена  env MMTV и Sag- кодирующей области  3’LTR не выявило значительных различий между  соответствующими  последовательностями в провирусной ДНК разной локализации  у двух исследованных пациенток. Это указывает на  общность происхождения MMTV-гомологичных последовательностей в опухоли МЖ и отдаленных метастазах в разные органы.

Гомология  указанных последовательностей  с геном env MMTV и Sag-

кодирующей областью  3’LTR провирусной ДНК штаммов  НеJ  и C3H

составила  96-98% и 92-95% , соответственно.

  Клонирование и секвенирование  провирусных последовательностей, изолированных путем  ПЦР,  показало  от 88 до 94% гомологии с  геномом MMTV (gi9626965)  и  91-98% гомологии  между отдельными  клонами  hMTV, изолированными из  культур РМЖ разными авторами  (Liu В. et al. 2001; Ford С. et al 2003).  Эти структурные различия  обусловлены различиями  применяемых  методов клонирования и секвенирования отобранных клонов, а также  географическими особенностями распростанения  различных штаммов  MMTV- родственного ретровируса в человеческих популяциях (Levine  P.H. et al., 2004).

2.3.10. Структурные особенности  hMTV.

  Обнаружение  провируса hMTV у пациенток, страдавших РМЖ в сочетании с другими неоплазиями, включая гемобластозы, позволяет  предполагать  дивергенцию MMTV-гомологичных последовательностей  и, следовательно,  полиморфную структуру  провирусного  генома, экспрессируюшегося в различных тканях.  Напомним, что в организме человека представлен  также широкий спектр эндогенных  MMTV-гомологичных  последовательностей, например суперсемейств HERV, HML  и некоторых других. Все это осложняет  ПЦР-анализ образцов ДНК, выделенных из  ЛПК и опухолей. 

  В своей работе  мы сосредоточились на  изучении структуры  функционально важных и непротяженных  консервативных областей провирусного генома, имеющих минимальную гомологию с  соответствующими генами наиболее близкого семейства HERV-K: от 9% до 15%. Выборочное секвенирование  выявило несколько  структурных вариантов  gp52-кодирующей области  гена еnv MMTV и Sag- кодирующей области 3’LTR в провирусном  геноме.  Последовательности, выявленные в  опухолевой ткани, лимфатических узлах  и ЛПК больных спорадическим контралатеральным двусторонним РМЖ  по степени гомологии ближе к геному экзогенного MMTV,  чем еnv MMTV–гомологичные последовательности, выявляемые в  ткани РМЖ, лимфоузлах и ЛПК пациенток с РМЖАБ  и  двусторонним РМЖ, а также  у пациенток с РМЖ в сочетании с неходжкинскими лимфомами.  Этот вариант представляет особый интерес, поскольку содержит  однонуклеотидные замены в области  env MMTV, что может привести к появлению стоп-кодонов и  терминации транскрипции гена  на С-конце, т.е. возможна трансляция укороченного предшественника р73. К такому же результату приводит частичная делеция основного промотора Р1 в геноме рекомбинантного провируса.  Однако, эта делеция  не влияет на гормонозависимую транскрипцию гена  еnv MMTV, а  приводит к потере  вирусом инфекционных свойств,

В основном, выявленный нами полиморфизм провирусной ДНК hMTV представлен однонуклеотидными заменами, не приводящими к  сдвигу рамки считывания, но влияющими на степень гомологии провирусной ДНК  с мышиным провирусом. В Sag- кодирующей области 3’LTR hMTV мы выявили  делеции одного или нескольких нуклеотидов, что также  обусловливает полиморфизм  в данной  области 3’LTR и в  С-концевой области белка  Sag. С-концевая область суперантигена  является гипервариабельной  и важна для активации  специфичных Т-клеток CD4+,  несущих определенные  V--цепи  Т-клеточных рецепторов  (TCR). Известно, что Sag MMTV  презентируется на поверхности  В-и Т-клеток, а также ДК в составе  молекул МНС  II класса, связанных с гликопротеином оболочки  MMTV -  gp52. Поскольку разные штаммы  передающегося с молоком экзогенного  MMTV  кодируют суперантиген с разной  аминокислотной последовательностью на С-конце, при инфекции этими штаммами происходит  стимуляция или делетирование разных субпопуляций Т-клеток. Взаимодействие лигандов CD40 и  CD40L  на поверхности В- и Т-клеток, соответственно,  приводит к активации В-клеток и обеспечивает  дальнейшую  амплификацию и распространение  MMTV  в организме мышей (Okeoma et al., 2008). По-видимому, сходные механизмы  Sag-зависимой активации  лимфоидных клеток действуют и в человеческом организме.  Косвенным доказательством  этому  является вариабельная структура  последовательности, кодирующей С-концевой аминокислотный мотив суперантигена.  Область 3’LTR MMTV – наиболее протяженная среди  длинных концевых повторов известных ретровирусов. Сходный полиморфизм (возможно, следствие структурной дивергенции) Sag-кодирующей области 3’LTR  был обнаружен ранее  при анализе  3 штаммов MMTV у мышей одной и той же линии с высокой частотой  ранних гормонозависимых опухолей МЖ  (Sarkar., 2004).  Полиморфизм  провирусной ДНК, частичная гомология с эндогенными  MMTV-родственными ретровирусами и наличие гипервариабельных участков в области 3’LTR hMTV  создают трудности для  ПЦР-анализа  геномной ДНК из лимфоидной и опухолевой тканей и детекции MMTV-гомологичных последовательностей. Этого требуется  ПЦР с менее специфичными праймерами, охватывающими область нескольких генов (gag pol env) и длинные концевые повторы, а затем  - ПЦР с высокоспецифичными  праймерами для  выявления  gp52-кодирующей  области гена  env MMTV  и  Sag- кодирующей  области 3LTR, не амплифицирующейся  у эндогенного  Mtv.  В ряде случаев для  подтверждения  структуры  MMTV-гомологичных последовательностей требуется сравнение последовательностей клонированного и напрямую секвенированного ПЦР-продуктов. Путем  ПЦР с праймерами  к 5’LTR и области гена gag MMTV с последующим клонированием и секвенированием соответствующего продукта мы исследовали изменение структуры гена gag hMTV в области  сайта фреймшифта в  провирусной ДНК  из опухолевой ткани больной РМЖАБ. С помощью вестерн-блотинга и  антител против корового белка gag MMTV были обнаружены изменения экспрессии гена gag,  возможно,  обусловливающие неконтагиозность вирусных частиц, которые обнаруживаются в грудном молоке у  некоторых больных РМЖ и здоровых женщин из группы риска (так называемый фактор молока). 

  По данным гибридизации  in situ, в человеческих лимфоцитах имеется несколько сайтов преимущественной интеграции  MMTV-гомологичных последовательностей, в частности  на хромосомах 1p, 3q, 5q, 8p и 8q  ( Lushnikova et al. , 2001:  Лушникова и др. 2007).  Однако мы не обнаружили  каких-либо специфичных сайтов интеграции провируса в геном эпителиальных клеток (ПКЭПЧ, НЕК 293Т). По-видимому, в активно пролиферирующих трансформированных клетках провирус встраивается  случайным образом, при этом возможно образование экстракопий провирусной ДНК. По-видимому, это способствует ускоренной репликации провируса в инфицированных эпителиальных клетках. Кроме того, случайная интеграция провируса в геном клеток повышает вероятность  активации клеточных онкогенов в области +/- 25 т.п.н. от  промотора MMTV(hMTV) с последующей трансформацией клеток. Cтохастическая интеграция провируса в геном стволовых клеток и клеток-предшественников, локализованных в растущей МЖ, по-видимому индуцирует целый каскад  событий: от активации клеточных онкогенов  (Wnt, FGF, Rspo, Notch4), индуцированной энхансерами  MMTV, до нарушения экспрессии ряда клеточных генов и генетической нестабильности (Callahan, Smith, 2008).  Различная картина  экспрессии целого  ряда регуляторных и структурных клеточных генов в MMTV-позитивных и негативных изогенных линиях  РМЖ человека подтверждает это предположение (Melana et al., 2001).  Диспергированное распределение сайтов интеграции провируса подтверждается также результатами компьютерного анализа  сайтов интеграции hMTV,  фланкированного короткими повторами  длиной 6 п.н. по концам провируса,  и  ряда других ретровирусов  в геном человека.

Рис 11.  Результаты компьютерного анализа сайтов интеграции МMTV-гомологичного провируса (hMTV)   в геном эпителиальных клеток человека  по сравнению с другими ретровирусами (цифрами обозначены относительные расстояния, база данных BLAST 2.0).

2.3.11. Экспрессия MMTV-гомологичных последовательностей у человека.

  Ранее нами было показано, что  обнаруживаемый в сыворотках крови больных РМЖ и некоторых здоровых  женщин  антиген, иммунологически родственный структурному белку оболочки gp52  транслируется с мРНК  env MMTV (Лушникова  др. 1998). Поверхностному гликопротеину gp52 отводится важная роль  в инфекции  Т- и В-клеток. Кроме того, ген env MMTV кодирует тирозинсодержащий  аминокислотный мотив иммунорецепторов (ITAM), участвующих в клеточном сигналинге, а в случае их гиперактивации -  в неопластической трансформации эпителиальных клеток  (Ross et al., 2008 ).

  Имеющиеся в литературе данные  по экспрессии  hMTV основаны  на иммуногистохимической окраске срезов  ткани РМЖ с использованием антител против gp52, которые были получены  с помощью  гибридом, экспрессирующих поверхностный и трансмембранный белки  - anti MMTV SU  и TM.  Кроме того, экспрессия анализировалась с помощью нозерн-блоттинга и  иммуноблотинга с  использованием  вирус-специфичных поликлональных антител (Faedo et al., 2004, Indik et al., 2006). Мы попытались проанализировать экспрессию  важнейшего для  жизненного цикла ретровируса белка gp52 с использованием мышиных моноклональных  антител против  gp52 MMTV и  обратимого связывания их с магнитными частицами, на которых иммобилизованы молекулы IgG (ЗАО Силекс, Москва). Было показано, что концентрация иммунологически родственного gp52 MMTV белка в опухолевой ткани РМЖ  достоверно выше, чем в крови, что  отражает различия в уровне экспрессии провируса (табл.2).

Таблица 2. Концентрация  gp52 MMTV в сыворотке и опухолевой ткани 2 пациенток с РМЖАБ.

 

  Ткань

Диагноз,

стадия

  Концентрация  конъюгированного с anti- gp52 белка (мкг/мл)

Сыворотка крови/

РМЖАБ, T1N0M0

0,025±0,007

  Опухоль,

РМЖАБ, T1N0M0

3,8±0,04

  1. Заключение

MMTV-родственный провирус (hMTV) имеет уникальную структуру. Кроме известных генов  gag-pro-pol-env  его геном  содержит не менее четырех  участков, кодирующих функционально важные ретровирусные белки: УТФазу, интегразу, суперантиген Sag  и РНК-транспортер (Rem). В геномной ДНК имеется один основной и несколько дополнительных промоторов. Мутации в основном помотере Р1 негативно влияют на инфекционные свойства ретровирусных частиц, однако не нарушают транскрипцию гена  env MMTV и сплайсинг мРНК, кодирующей  белок gp52 и аминокислотный мотив ITAM с функцией онкобелка.  Это обусловливает возможную роль hMTV в индукции неоплазий даже  при наличии дефектных вирионов.  Вариабельность некоторых областей генома MMTV/hMTV, а также  их гомология с эндогенными ретровирусами  (Mtv и  HERV-K)  затрудняют ПЦР-анализ  экзогенных MMTV-гомологичных последовательностей в геномной ДНК, выделенной из лимфоидной и опухолевой ткани пациентов с РМЖ и с  другими неоплазиями. Зачастую  требуются дополнительные методы детекции провирусной кДНК: блот-гибридизация,  клонирование  ПЦР-продуктов и их секвенирование. Была показана  корреляция между наличием  транскриптов гена  env MMTV и экспрессией в сыворотках крови больных РМЖ антигена, иммунологически родственного gp52. Нами предложен  простой метод детекции в сыворотке или в лизате гомогенизированной ткани РМЖ продукта  гена env MMTV с помощью моноклональных мышиных антител против gp52 (mabP2 anti-gp52 IgG), связанных с  магнитными частицами, на которых иммобилизованы молекулы  IgG. 

ВЫВОДЫ

1. Геном  провируса  hMTV, обнаруженного в лимфоидной ткани  и в опухолях МЖ человека, содержит консервативные и вариабельные области с высокой гомологией MMTV. Выявлены структурные  изменения в области генов  gag,  gp52-кодирующей области  гена env и Sag- кодирующей области 3’LTR, которые влияют на транскрипцию провирусной ДНК и сплайсинг  мРНК, а  также  на инфекционные свойства ретровируса.

2. Доказана роль лимфоидных клеток в циркуляции и диссеминации hMTV  у человека. Показана  значимость лимфоидной ткани кишечника и лимфатических узлов для  депонирования  провируса.

3. Специфичные для консервативных областей генома hMTV последовательности обнаруживаются не только в опухолях и лимфоидных клетках пациенток с РМЖ, но и в отдаленных  метастазах в головной мозг и печень.

4. Доказана возможность инфекции MMTV первичных и стабильных культур  эпителиальных клеток человека  in vitro  с последующей трансформацией этих клеток. Предложена модель трансформированных клеток эпителия эмбриональной почки человека.

5. Показано  случайное распределение сайтов интеграции провируса hMTV в хромосомы  эпителиальных клеток в отличие от  более специфичных и  редких - в лимфоцитах периферической крови.

6. Экспрессия hMTV  наблюдается в 60-80% позитивных по ПЦР опухолей МЖ и коррелирует с высоким содержанием эстрогенов/прогестерона (РМЖАБ), а также с нестабильностью генома (наличие герминальных мутаций в генах-супрессорах  BRCA1/2).

7. Анализ клинико-патологических особенностей РМЖАБ и спорадического РМЖ обнаруживает тенденции к быстрой прогрессии опухолей, а также к снижению общей и безрецидивной выживаемости в группах hMTV-позитивных пациенток.

8. Предложен  способ идентификации иммунологически родственного  gp52 MMTV белка в сыворотках крови и в ткани РМЖ, основанный на конъюгации  этого белка с антителами, которые связаны с молекулами IgG, иммобилизованными на  магнитных частицах.

Список основных работ, опубликованных по теме диссертации:

1.А.А.Лушникова Корреляция между экспрессией антигена, иммунологически родственного gp52 и транскрипцией гомологичных env MMTV последовательностей ДНК в лимфоцитах периферической крови больных раком молочной железы / А.А.Лушникова, И.Н.Крюкова, Т.Ф.Маливанова и др.// Мол.генет.Микробиол. Вирусол. – 1998. - № 3. - С.33-.

2.Лушникова А.А. Экспрессия env MMTV-гомологичных последовательностей  в лимфоцитах периферической крови больных раком молочной железы / А.А. Лушникова, Т.Ф. Маливанова, П.Б. Махов  и др. //  Мол.генет.Микробиол. Вирусол. - 2001. - №2. - С.57- 62.

3. Крюкова И.Н., Лушникова А.А., Махов П.Б.  Влияние 5-азацитидина на экспрессию последовательностей ДНК, гомологичных гену  env вируса рака молочной железы мышей, в лимфоцитах здоровых доноров / И.Н. Крюкова А.А. Лушникова, П.Б. Махов // Мол.Генет.,Микробиол.,Вирусол. - 2002. - №2. - С.36 - 39.

4. Крюкова И.Н. О возможном участии ретровирусов в индукции рака молочной железы человека / И.Н. Крюкова, А.А. Лушникова, Т.Ф. Маливанова  // Вопросы вирусологии. – 2002. -  №4. - С.4 - 9.

5. Лушникова А.А. Обнаружение последовательностей, гомологичных гену env MMTV, в лимфоидной ткани кишечника больной раком молочной железы / А.А.Лушникова, И.Н. Крюкова , Д.Л. Ротин, Л.Н. Любченко // Докл.Акад.Наук. -  2004. - Т. 399. -  №1. – С. 118-121.

6. Лушникова А.А. Обнаружение env MMTV-гомологичных последовательностей у беременных и кормящих женщин с опухолями молочных желез / Лушникова А.А., Крюкова И.Н., Пароконная А.А., Полевая Е.Б./ Молекулярн. Медицина. - 2006. – №1. –  С. 48-52.

7. А.А.Лушникова. MMTV-гомологичные последовательности у мужчин с раком молочной железы и гинекомастией / А.А.Лушникова, И.Н.Крюкова, Е.Б.Полевая, Л.Н.Любченко // Молекулярн. Медицина - 2006.- № 4.- С. 53-56.

8. Л.Н. Любченко. Клинико-молекулярные аспекты наследственного рака молочной железы /Л.Н. Любченко, С.М. Портной, В.В. Брюзгин, Н.И. Поспехова, А.А. Лушникова и др.// Молекулярн. Медицина. – 2007. -  № 1. – С. 8-15.

9. Лушникова А.А. MMTV и канцерогенез молочных желез у человека. / А.А.Лушникова // Молекулярн. Медицина. – 2007. -  №4. - С.19-26.

10.  Пароконная А.А. Прогноз и течение рака молочной железы на фоне беременности и лактации: вирусно-генетические особенности / А.А. Пароконная,  А.А. Лушникова, Л.Н. Любченко и др. // Сибирский Онкол. Журн. - 2008. - №2 . - С. 15-20.

11. Пароконная А.А. Неэпителиальная опухоль молочной железы на фоне существующей беременности. Клинико-генетические особенности / А.А. Пароконная, М.И. Нечушкин, И.К. Воротников , А.А. Лушникова и др.// Вестник РОНЦ. -  2008. – Т.19. –№1. – С.71-75.

12.Лушникова А.А. Инфицирование клеток эмбриональных почек человека вирусом рака молочных желез мышей (MMTV) / А.А.Лушникова, И.Н.Крюкова, Л.Н.Любченко, А.А. Пароконная // Доклады Академии Наук. –2009. – Т.424. –№1. – С.130-134.

13. Крюкова И.Н. ММТV-гомологичные последовательности и их экспрессия у больных раком молочной железы в сочетании с лимфомами / И.Н. Крюкова ,А.А.Лушникова, Л.Н. Любченко, А.А. Пароконная // Молекулярн. Медицина. - 2009. – № 2.- С 8-15.

14. Л. Н. Любченко. Клинико-генетический скрининг при опухолях женской репродуктивной системы /Л. Н. Любченко, Н.И. Поспехова,  А.А. Лушникова и др.//. Вопросы Онкологии . – 2008. - Т.54. – С. 17-18. 

15. Любченко Л.Н., Поспехова Н.И., Пароконная А.А., Лушникова А.А.,

  Чевкина Е.М. Рак молочной железы и /или яичников в составе наследственного онкологического синдрома / Л.Н. Любченко, Н.И. Поспехова, А.А.Пароконная, А.А.Лушникова, Е.М.Чевкина// Опухоли женской репродуктивной системы. – 2009. - №  1-2. -  С. 59-63.

16. Поспехова Н.И.  Двусторонний рак молочной железы в российской популяции: семейная  отягощенность, молекулярно-генетические и клинические характеристики /Н.И. Поспехова, А.А.Лушникова, Л.Н.Любченко,  А.В.Карпухин// Молекулярн. Медицина. -  2010. - №3. - 9с.

17. Лушникова А.А. Экспрессия VEGFR-2 в опухолевой ткани больных раком  молочной железы / Лушникова А.А., Насунова И.Б., Любченко и др..// Доклады Академии Наук. -  2010. -  в печати.

18. Lushnikova A. Supposed expression of MMTV-related DNA sequences in peripheral blood lymphocytes of breast cancer patients /A. Lushnikova, P.Makhov, I. Kryukova et al. //  Virus Res. – 1997.- V.47.- N2. - P.106.

19. A.A.Lushnikova. Detection of the env MMTV-homologous sequences in Payer’s patches and peripheral blood lymphocytes of familial breast cancer patients /A.A.Lushnikova, I.N.Kryukova, L.N.Lyubchenko// Breast Cancer and Treatment - Dec.2003 - N 12. - P. 78.

20Lushnikova A.A. A possible role of the env MMTV–homologous sequences in breast cancer carcinogenesis / A.A. Lushnikova, I.N. Kryukova, P.B. Makhov, E.B. Polevaya // Cancer Research -  2003. - N4. - Abstr.327.

21. Lushnikova A. High frequency of the env MMTV – homologous sequences detection in breast cancer patients / A. Lushnikova, A. Parokonnaya, E.Polevaya,  I. Kryukova  // Clinical Cancer Research. - Dec. 2004. –Р. 234.

22.  Lushnikova A. The env MMTV-homologous sequences in familial breast cancer patients and their relatives / A. Lushnikova, I. Kryukova, A. Parokonnaya et al. // Mat. of Milan Breast Cancer Conference, June 2005. – P. 26.

23. Lushnikova A. MMTV-related sequences in male breast cancer and gynecomastia patients / A. Lushnikova,  A. Parokonnaya, I. Kryukova, E. Polevaya  // European Journ. Of Cancer. – Oct - Nov 2005. – P. 365.

24. L. Lyubchenko. Prognostic factors for  BRCA1-associated familial breast cancer from Russian population/ L. Lyubchenko, N. Pospekhova, A. Lushnikova, A.Karpukhin.// European Journ. Of Cancer . - 2005. - V. 3. - N. 2. - P. 322.

25. Kryukova I. MMTV-homologous sequences in breast cancer patients with lymphomas / I. Kryukova, A. Lushnikova , A. Parokonnaya, E. Polevaya // Mat. of the 9-th Int. Conf. on malignant lymphoma, Paris. June 2005. – P. 236.

26. Lushnikova A. MMTV-related sequences expression in the patients with the breast phyllodes tumors / A.Lushnikova, A. Parokonnaya, E.Peredereeva et al. // Breast Cancer and Treatment. - Dec. 2007. – P. 148-149.

27. Lyubchenko L. Clinical and genetics analysis of  breast and ovarian cancer patients from Russian population /L. Lyubchenko, A. Lushnikova, N. Pospekhova et al. // Breast Cancer and Treatment. - Dec. 2007. – P. 123-124.

28. Parokonnaya A. Molecular genetics analysis of the breast cancer patients during pregnancy and lactation / A. Parokonnaya,  A. Lushnikova, L.  Lyubchenko, I. Kryukova // VII Milan Breast Cancer Conference. - 2007. – Abstr. 20323.

29. Lushnikova A.A. MMTV involves into breast cancer progression during pregnancy and lactation /.A. Lushnikova, L. N. Lyubchenko,  A.A. Parokonnaya , E.G. Peredeeva // J.Virology. - Mat. оf the Third European Congress of Virology, Nurnberg, Germany, 1-5 Sep. 2007. – Abstr. # 01232.

30.  L.N.Lyubchenko / BRCA1 and TP53 mutations in pregnancy-associated breast cancer in Russian  patients /L.N.Lyubchenko,N.Pospekhova, A.A.Lushnikova et al. // Annals of Oncology/ - 2009 / - Suppl.-  Abstr. #307.

31. A.A.Lushnikova.  MMTV-homologous sequences revealed in feline breast cancer tumors /A.A.Lushnikova. , A.A.Preobrazenskaya, V.A.Pavlov,  S.V.Zontov //Cancer Research, Suppl. 32 SABCS Abstract Book. - Dec. 2009 – Abst. #1486SABCS09D1.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.