WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

БУЛЫЧЕВА Ирина Владиславовна

СОВРЕМЕННЫЕ КРИТЕРИИ ПРОГНОЗА В КОМПЛЕКСНОЙ

ДИАГНОСТИКЕ ПЕРВИЧНЫХ ОПУХОЛЕЙ КОСТЕЙ

(клинико-морфологическое исследование)

14.01.12 - онкология

14.03.02 - патологическая анатомия

Автореферат

диссертации на соискание ученой степени

доктора медицинских наук

Москва - 2011

Работа выполнена в Учреждении Российской академии медицинских наук Российском онкологическом научном центре им. Н.Н.Блохина РАМН (директор академик РАН и РАМН, профессор М.И.Давыдов) и Московской городской онкологической больнице №62 (главный врач доктор медицинских наук, профессор А.Н.Махсон)

Научные консультанты:

академик РАМН, профессор  Ю.Н.Соловьев

доктор медицинских наук, профессор  А.Н.Махсон

Официальные оппоненты:

член-корреспондент РАМН, профессор И.В.Поддубная

доктор медицинских наук, профессор  О.В.Зайратьянц

доктор медицинских наук  В.В.Тепляков

Ведущее учреждение:

ФГУ Российский научный центр рентгенорадиологии МЗ СР РФ

Защита состоится «20» мая 2011 года в ____ часов на заседании Диссертационного совета (Д.001.017.02) Российского онкологического научного центра им. Н.Н.Блохина РАМН (115478, Москва, Каширское шоссе, 24)

С диссертацией можно ознакомиться в библиотеке Российского онкологического научного центра им. Н.Н.Блохина РАМН

Автореферат разослан «___»______________2011 года

Ученый секретарь диссертационного совета

доктор медицинских наук, профессор Ю.А.Барсуков

Введение



Актуальность проблемы. Опухоли и опухолеподобные заболевания костей занимают особое место в патологии человека, являясь в диагностическом аспекте одним из наиболее сложных разделов. Первичные новообразования скелета достаточно редки и составляют 1,5-2% от всех встречающихся опухолей человека (Fletcher D.V. et al., 2002; Barr F.G. et al., 2003). Cтатистические данные последних лет свидетельствуют о неуклонном интенсивном росте заболеваемости и смертности при злокачественных новообразованиях костей. Наряду с этим, отмечается значительный прогресс в совершенствовании комбинированных методов лечения этих заболеваний и, в частности, остеосаркомы и саркомы Юинга (Ю.Н.Соловьев, 2008; Г.Н.Мачак, 2010; А.И.Семенова, 2010; Raymond A.K. et al., 2002).

Известно, что в костной патологии биопсия и рентгенологические исследования предоставляют достоверную информацию для диагностики новообразований (Mirra J.M., 2001). Рентгенографию считают отправным пунктом, а для большей информативности используют КТ и МРТ (McLeod R.A. et al., 1988; Ruley H.E. et al., 1996). Установление степени дифференцировки  является попыткой прогнозирования «биологичеcкого» поведения опухоли (Mandahl N. et al., 2002; Evans H.L., 2003).

Все большее значение приобретают вопросы генетических нарушений, постепенно накапливаются знания и статистические данные в различных группах заболеваний. Цитогенетические изменения при опухолях костей варьируют от простых порядковых или структурных хромосомных аберраций до кариотипов с выраженными изменениями. Так, например, семейство саркомы Юинга характеризуется t(11,22) (q24;q12) транслокацией примерно в 85% случаев (Llombart-Bosch A., 1999) и  слиянием генов EWS/ETS (Huang H-Y., 2005).

Среди диагностических и прогностических критериев при опухолях гематопоэтической системы большое значение приобретает иммунофенотипирование. Так, клетки миеломы по иммунофенотипу не отличаются от обычных плазматических клеток, они экспрессируют антиген плазматических клеток (PCA) и кластер дифференцирующий фактор 38 (СD38). Злокачественная природа oпухоли устанавливается при моноклональной преимущественной продукции или иммуноглобулинов опухолевыми клетками. Опухолевые клетки злокачественной миеломы продуцируют белок CD56/58, который не продуцируется реактивными плазматическими клетками. Большинство опухолевых клеток миеломы положительно реагирут с CD38 и СD79а, а CD138 достаточно надежно выявляет плазматические клетки, как при реактивных состояниях, так и при опухолях. Клетки миеломы могут быть положительными к эпителиальному мембранному антигену (Burchill S.A. et al., 2003). Большинство злокачественные лимфом кости относятся к В клеточным и проявляют положительную реакцию с CD20 (Heiser D. et al., 2004). В костях T-клеточные лимфомы и анапластические крупноклеточные лимфомы встречаются крайне редко, CD15 и СD30 помогают в дифференцировке лимфогрануломатоза, а положительная реакция с миелопероксидазой позволяет подтвердить диагноз гранулоцитарной саркомы.

Диагностический аспект, расширение критериев и методов, используемых в диагностике и оценке прогноза, в настоящее время являются основополагающими в костной патологии и заслуживают пристального внимания.

Изучение биологии сарком костей выходит на первый план в клинической практике для выявления прогностических маркеров и разделения групп риска среди обследованных пациентов с первичным диагнозом саркома кости. Кроме того, новые молекулярные мишени находятся под пристальным вниманием исследователей для выявления факторов эффективной таргетной терапии (Bielack S.S. et al., 2002; Marina N. et al., 2004; Link M.P. et al., 2006). К сожалению, для практического использования, а именно, оценки прогноза и выбора эффективной неоадъювантной химиотерапии большинство маркеров до настоящего времени не считаются общепризнанными. Вместе с тем, все выше изложенное свидетельствует об актуальности комплексного изучения морфологических, рентгенологических, молекулярно-генетических и клинических характеристик опухолей костей с целью эффективной диагностики, лечения и оценки прогноза заболевания.

Цель исследования повышение эффективности диагностики и оценки прогноза первичных новообразований костей на основании использования морфологических, рентгенологических и клинических данных в сочетании с современными иммуногистохимическими, молекулярно-генетическими и электронно-микроскопическими методами исследования опухолей.

Задачи исследования:

  1. Выделить основные морфологические и иммуногистохимические критерии дифференциальной диагностики опухолей костей.
  2. Изучить ультраструктуру некоторых новообразований костей с возможной детализацией их морфологического строения для уточнения гистогенеза, степени злокачественности и биологического потенциала опухоли.
  3. Исследовать морфологические, молекулярно-генетические и иммуногистохимические параметры мелкоклеточных низкодифференцированных опухолей костей для эффективности диагностики, оценки вариантов их клинического течения и прогноза.
  4. Провести иммуногистохимический анализ показателей экспрессии ключевых маркеров и рецепторов ангиогенеза, апоптоза, клеточной адгезии, ферментов протеолиза внеклеточного матрикса в оценке прогноза общей и безрецидивной выживаемости больных опухолями костей.

Научная новизна исследования

Впервые проведен детальный систематизированный анализ первичных опухолей костей с использованием современных методов морфологического, иммуногистохимического, электронномикроскопического и молекулярно-генетического исследованиия.

Выявлена тесная связь между ранним развитием отдаленных метастазов и степенью дифференцировки остеосаркомы, выраженностью ее лечебного патоморфоза, объемом некротизированной ткани, размерами первичного опухолевого узла, количеством митозов и наличием опухолевых эмболов в просвете кровеносных и лимфатических сосудов.

Показано, что дифференциальная диагностика мелкокруглоклеточных опухолей костей на современном этапе должна включать комплекс морфологических, иммуногистохимических, цитогенетических и молекулярно-биологических методов, которые позволяют с высокой точностью поставить диагноз: саркома Юинга (цитогенетические изменения EWS/Fli-1, EWS-ERG), миелома (CD138, и легкие цепи), лимфома (комплекс Т и В клеточных маркеров), мезенхимальная хондросаркома (CD99 - для мелкоклеточного и S-100 - для хрящевого компонентов).

Наиболее часто в остеосаркомах выявляли Bax (77,8%), EGFR (52,5%) и Flt-1/VEGFR1 Ab-1 (97,5%), в каждой третьей опухоли - Her-2/neu (32,5%), Cox-2 (32,3%), p53 (27,5%) и крайне редко - VEGF (15%). Экспрессия выше указанных маркеров не обнаружена в доброкачественных костеобразующих новообразованиях. При этом, показатели экспрессии Bax, EGFR, Her-2/neu, VEGF, Flt-1/VEGFR1 Ab-1, Cox-2, p53 не были связаны с основными клинико-морфологическими характеристиками заболевания (полом пациентов, степенью дифференцировки опухоли и ее локализацией в костях скелета, наличием отдаленных метастазов), однако в остеосаркомах более молодых больных достоверно чаще обнаруживали EGFR, Cox-2 и уровни экспрессии Bax 50%.

Показано, что в большинстве хондросарком кости выявлена экспрессия матриксных металлопротеиназ и их ингибитора 1 типа: ММP-1 (84,6%), ММP-2 (71,8%), ММP-9 (97,4%), ТIМP-1 (82,3%), уровни экспрессии выше указанных маркеров колебались от 10 до 60% и не обнаружены в доброкачественных хрящеобразующих опухолях.

Практическая значимость исследования

Настоящая работа представляет практический интерес для работы морфолога, рентгенолога и клинициста в области костной патологии при диагностике, оценке клинического течения заболевания и его прогнозе. Мультидисциплинарный подход, включающий сочетание клинических, рентгенологических и морфологических данных является высокоэффективным в диагностике костных опухолей. Трепанбиопсия дает положительный результат в 87% случаев, открытая биопсия в 92% случаев.

Показано, что электронно-микроскопическое исследование выявляет диагностические ультраструктурные признаки при: гистиоцитозе (гранулы Birbeck), остеосаркоме (кристаллы гидроксиаппатита), дедифференцированной хондросаркоме (различное строение хрящевого и саркоматозного компонентов).

Показано, что прогноз саркомы Юинга определяет выраженность лекарственного патоморфоза опухоли после неоадъювантной химиотерапии.

Многофакторный анализ выявил достоверную связь показателей экспрессии Her-2/neu, р53 и Сox-2 в остеосаркомах больных с неблагоприятным прогнозом 5-летней общей выживаемости, а Her-2/neu и Сох-2 - с 3-летней безрецидивной выживаемостью, поэтому анализ экспрессии выше указанных маркеров в первичной опухоли следует учитывать при лечении больных остеосаркомой кости.

Наличие в хондросаркомах экспрессии ММP-1 указывает на неблагоприятное течение заболевания и достоверно связано с показателями безрецидивной и общей выживаемости больных, а Bax – с безрецидивной выживаемостью.

Степень дифференцировки хондросаркомы и содержание ММP-9 в опухоли имеют важное значение в прогнозе заболевания, при этом уровень экспрессии белка ММP-9 40% в хондросаркомах следует считать прогностически неблагоприятным фактором безрецидивной и общей выживаемости.

Систематизированный анализ клинических и лабораторных данных с учетом последних открытий молекулярной генетики и иммуногистохимии вносят существенный вклад в работу практического врача.

Апробация работы. Материалы диссертации доложены на III съезде онкологов и радиологов СНГ (Минск, 25-28 мая 2004г.); на конференции «Национальные дни лабораторной медицины России-2005» (Москва, 11-14 октября 2005г.); на II Международной конференции «Молекулярная медицина и биобезопасность» (Москва, 20-21 октября 2005г.); на IX Российском онкологическом конгрессе (Москва, 22-24 ноября 2005г.); 17th International congress on anti-cancer treatment (Paris, 30th January – 2nd February, 2006); 19th Annual Meeting of European Musculo-Skeletal Oncology Society (Moscow, May 24-26, 2006); на научно-практической конференции травматологов-ортопедов России с международным участием «Актуальные проблемы костной патологии у детей и взрослых» (Москва, 23-24 апреля 2008г.); 37th International Society of Oncology and Biomarkers (Amsterdam, Netherlands, September 27-30, 2009); на научно-практической конференции «Лабораторная медицина в свете Концепции развития здравоохранения России до 2020 года» (Москва, 28-30 сентября 2009г.); на Международной конференции «Молекулярная медицина и биобезопасность» (Москва, 10-11 ноября 2009г.); на XVII Российском национальном конгресса «Человек и лекарство» (Москва, 12-16 апреля 2010г.).

Апробация диссертации проведена на совместной научной конференции сотрудников отдела патологической анатомии опухолей человека, хирургического отдела общей онкологии, лаборатории клинической биохимии НИИ клинической онкологии Российского онкологического научного центра им. Н.Н.Блохина РАМН 09 ноября 2010 года; хирургических отделений Московской городской онкологической больницы № 62 22 июля 2010 года, кафедры онкологии Московской медицинской академии им. И.М.Сеченова, кафедры клинической биохимии и лабораторной диагностики ФПДО Московского государственного медико-стоматологического университета.

Публикации. По материалам диссертации опубликованы 42 научные работы, из них 16 в журналах ВАК.

Структура и объем работы. Диссертация состоит из введения, обзора литературы, главы «Материалы и методы исследований», 7 глав «Результатов собственных исследований», обсуждения полученных данных, выводов, практических рекомендаций и указателя цитируемой литературы. Общий объем диссертации 416 страниц машинописного текста. Указатель литературы содержит 506 работ отечественных и зарубежных авторов. Диссертация иллюстрирована 8 таблицами и 112 рисунками.

Материалы и методы исследования

В исследование включено 359 больных (в возрасте от 12 до 87 лет) с различными злокачественными опухолями и 154 больных (в возрасте от 11 до 69 лет) доброкачественными новообразованиями костей (табл. 1 и 2).

Таблица 1.

Характеристика больных злокачественными опухолями костей

Гистологическое строение опухоли

Кол.

Муж. Абс./Отн.%

Жен. Абс./Отн.%

Средний возраст (годы)

Колебания возраста (годы)

Остеосаркома

87

50/57,5

37/42,5

35,0±1,7

12-87

Хондросаркома

165

93/56,4

72/43,6

51,2±1,1

22-81

Саркома Юинга

46

27/58,7

19/41,3

30,3±2,3

16-64

Миелома

33

12/36,4

21/63,6

64,0±2,0

34-83

Лимфома кости

28

10/35,7

18/64,3

60,0±3,0

25-83

Всего

359

192/54,5

167/46,5

-

12-87

Таблица 2.

Характеристика больных доброкачественными опухолями костей

Гистологическое строение опухоли

Кол.

Муж. Абс./Отн.%

Жен. Абс./Отн.%

Средний возраст (годы)

Колебания возраста (годы)

Остеоид-остеома

18

14/77,8

4/22,2

24,5±3,4

16-32

Остеобластома

12

8/66,7

4/33,3

42,5±8,9

21-54

Хондрома

46

26/56,5

20/43,5

52,6±4,2

24-67

Остеохондома

64

30/46,9

34/53,1

32,8±3,2

11-54

Хондробластома

8

5/62,5

3/37,5

34,1±7,9

22-46

Хондромиксоидная фиброма

6

2/33,3

4/66,7

34,5±5,4

26-44

Всего

154

85/55,2

69/44,8

-

11-67

Методы иммуногистохимического исследования. Иммуногистохимическое исследование выполнено на парафиновых срезах опухолей с помощью биотинстрептавидинового иммунопероксидазного метода с моно- и поликлональными антителами, характеристика которых представлена в таблице 3. Для каждого антигена оценивали тип специфического окрашивания, который зависел от локализации продукта реакции в клетке (цитоплазматический, мембранный, ядерный, смешанный).

Таблица 3.

Характеристика использованных в исследовании антител

Антиген

Антитело, клон

Фирма

Рабочее разведение

Функция белка

MMP-1

Rabbit pAb

Diagnostic

BioSystems

1:200

Фермент межклеточного матрикса

MMP-2

Mouse mAb

17B11

Novocastra

1:50

Фермент межклеточного матрикса

MMP-9

Rabbit pAb

Dako

1:50

Фермент межклеточного матрикса

TIMP-1

Mouse mAb

102D1

Diagnostic BioSystems

1:10

Фермент межклеточного матрикса

Coll IV

Mouse mAb

CIV22

Dako mn

RTU

Компонент базальных мембран

c-erbB-2

(Her-2/neu)

Rabbit pAb

Dako

1:550

Рецепторная тирозинкиназа

Ki-67

Mouse mAb

MIB-1

Dako

RTU

Антиген клеточной пролиферации

p53

Mouse mAb

DO-7

Dako

RTU

Регулятор клеточного цикла и апоптоза

Bcl-2

Mouse mAb

124

Dako

RTU

Ингибитор апоптоза

Bax

Rabbit pAb

Dako

1:50

Активатор апоптоза

Сox-2

Mouse mAb

Dako

RTU

Фермент метаболизма арахидоновой кислоты

VEGF

Mouse mAb

VG1

Dako

1:25

Активатор ангиогенеза

Flt-1/VEGFR1 Ab-1

Rabbit pAb

Thermo

Scientific

1:25

Рецептор активатора ангиогенеза

EGFR

Mouse mAb

H11

Dako

1:200

Рецепторная тирозинкиназа

Методы электронно-микроскопического исследования опухолей костей проведены в лаборатории электоронной микроскопии госпиталя Penrose (Colorado Springs, CO, США) по общепринятым стандартам.

Иммуногистохимическое исследование опухолей Юинга проводили с использованием панели моно - (Мкл) и поликлональных (Пкл) антител, представленных в таблице 4.

Таблица 4.

Список использованных в работе антител

Антитело

Тип

Фирма

Разведение

CD20.L26

Mкл

Dako

1/100

CK (AE1-AE3)

Mкл

Dako

1/50

Claudin 1

Пкл

Zymed

1/50

Desmin

Mкл

Dako

1/100

Desmoglein I

Mкл

Santa Cruz

1/200

Desmoglein II

Mкл

Sanra Cruz

1/100

Desmoplakin

Mкл

Santa Cruz

1/100

E-cadherin

Mкл

Novocastra

1/20

EMA

Mкл

Dako

1/200

Fli-1

Пкл

Santa Cruz

1/50

HBA71 (CD99/MIC-2)

Mкл

Dako

1/50

HNK (CD57) (LEU-7)

Mкл

ATCC

10 мкг/мл

Ki-67 (MIB-1)

Mкл

Dako

1/50

LCA (CD45)

Mкл

Dako

1/50

Myogenin

Пкл

Santa Cruz

1/100

Myo-D1

Mкл

Novocastra

1/20

Ocludin

Пкл

Zymed

1/50

p16

Mкл

Santa Cruz

1/100

p53 (DO-7)

Mкл

Dako

1/50

S-100

Пкл

Menarini

1/200

T cells (CD45RO)

Mкл

Dako

1/200

Vimentin

Mкл

Novocastra

1/200

ZO-1

Пкл

Zymed

1/50

Применяли систему детекции LSAB+Immuno-detection («Dako», Дания), комплекс энзим-антиген выявлялся с помощью диаминобензидина (DAB, «Dako», Дания).

Молекулярно-генетические методы исследования. Все образцы 17 опухолей фиксировали в формалине, заключали в парафин, микротомировали и депарафинировали. Комбинировали 17 образцов сарком в тканевую матрицу, состоящую из дубликатов столбиков в 1 мм с использованием ручного тканевого инструмента (Beecher Instruments, Sun Prairie, WI, USA). Все образцы и блок тканевой матрицы окрашивали гематоксилином и эозином, препараты просматривали три независимых патологоанатома и оценивали по классификации ВОЗ (Rds Ch.D.M.Fletcher et al., 2002).

Пробы с разрывом (break-apart) и FISH. В исследовании применяли коммерческие LSI EWSR1 разрывные пробы с двойным окрашиванием (Vysis, Downers Grove, IL) для гибридизации в положение 22q12. Использованные пробы - комбинация двух ДНК FISH проб. Первая проба около 1100 kb проявляется зеленым свечением. Она располагается на расстоянии от EWS гена. Вторая проба в оранжевом спектре располагается проксимально от EWS гена, измеряется около 500 kb. Метки разъединены промежутком в 7 kb в пределах EWS гена. Для предварительной обработки слайдов добавляли смесь предподготовки (1 мл пробы, 7 мл LSI гидролизирующего буфера и 2 мл деионизированной воды). Второй коммерческий состав состоял из пробы ДНК (Q-BIOgene, Irvine, CA), применяемой для FISH анализа, включавшего р16INK4A(СDKN2A) генную специфическую пробу, меченную родамином красным и ABL(9Q34) - специфическую пробу, меченную d Green для выявления хромосом. Определяли FISH критерии для клеток опухоли с нормальным и удаленным р16INК4А геном в положении 9p21.





Молекулярная биология. Trizol метод использовали для выделения РНК из 5-10 толстых (5 мкн) парафиновых срезов ткани, фиксированной в формалине. ПЦР с обратной транскриптазой применяли в одном тубе с Qiagen OneSep RT-PCR Kit c Q раствором. Обратную транскрипцию проводили при температуре 50оС 30 мин. Полимераза активизировалась при 95оС 15 мин с последующими 40 циклами денатурации при 94оС 30 секунд, прокаливая 30 сек. при 67оС с увеличением температуры до 72оС на 30 секунд с окончательной температурой 72оС на 10 мин. Праймер вперед: TCCTACAGCCAAGCTCCAAGTCAATA; праймер в обратную сторону: ATTGCCCCAAGCTCCCTTCTGAC. Продукт реакции ПЦР визуализировали на 2% агар геле, окрашенном этидий бромидом.

Статистический анализ результатов исследования. При выборе статистических процедур учитывали требования Международного конгресса по гармонизации GСP “Статистические принципы для клинических исследований” (ICH Guidelines // Good Clin.Pract.J.-1998.-Vol.5, №4.-р.27-37).

Результаты собственных исследований

Костеобразующие опухоли

Остеоидная остеома доброкачественная, продуцирующая остеоид опухоль, характеризующаяся малыми размерами (< 2 см), ограниченным ростом и непропорционально размерам первичного новообразования, резко выраженным болевым синдромом. Исследовано 18 случаев остеоидной остеомы.

Рентгенологическая картина. На обзорных рентгенограммах очаг поражения характеризуется утолщением и уплотнением кортикального слоя кости вокруг небольшого литического гнезда.

Макроскопическая картина. Остеоидная остеома выглядит как маленький, красноватый, кортикально расположенный, крупнозернистый очажок четко отграниченный от желтовато-белой склерозированной окружающей кости.

Гистологическая картина. Опухоль представлена центральным ядром из соединительной ткани, богатой сосудами с обилием продуцирующих остеоид дифференциованных остеобластов, являющихся основным диагностическим критерием, в структуре опухоли встречаются остеокласты.

Остеоид в ядре остеоидной остеомы может располагаться пластами, но чаще микротрабекулами, окруженными остеобластами с «пухлыми» ядрами, что помогает отличить остеоидную остеому и остеобластому от остеосаркомы. Отсутствие ядерного полиморфизма также свидетельствует в пользу доброкачественной, остеоид продуцирующей опухоли.

Остеобластома (оссифицирующаяся гигантоклеточная опухоль, гигантская остеоидная остеома) - доброкачественная, остеоид продуцирующая опухоль, сходная по строению с остеоидной остеомой, формирующая мелкие спикулы волокнистой кости, окруженные остеобластами, обладает неограниченным потенциалом роста. Исследовано 12 случаев остеобластомы различной локализации.

Рентгенологическая картина остеобластомы представляет литический или смешанный, четко очерченный округлый или овальный дефект целостности кости с периостальной реакцией и зоной реактивного костеобразования.

Макроскопическая картина. Остеобластома хорошо кровоснабжается, поэтому ее поверхность макроскопически имеет ярко красный или красно-коричневый цвет, часто с подобием «песчаной крошки» вследствие продукции мелких костных включений. Опухоль окружена скорлупой или зоной реактивного остеогенеза, обладает оппозиционным характером роста. Инфильтративный рост не характерен для остеобластомы. Возможно образование вторичной аневризмальной кисты.

Гистологическая характеристика. Гистологическое строение остеобластомы полностью повторяет остеоидную остеому. Структура опухоли складывается из хаотически расположенных спикул или трабекул волокнистой кости, выстланных рядом остеобластов. Характерна высокая степень васкуляризации опухолевого узла с капиллярами, наполненными эпитроцитами. Могут встречаться физиологические митозы.

В редких случаях, в структуре опухоли встречаются островки гиалинового хряща, формирующего костные микромозоли. При формировании островков или агрегатов из спикул волокнистой кости необходимо проводить дифференциальный диагноз с остеосаркомой.

Остеосаркома (синонимы: центральная остеосаркома, остеофибросаркома, остеохондросаркома, медуллярная остеосаркома) - злокачественная опухоль, при которой новообразованная кость или остеоид продуцируются непосредственно самими опухолевыми клетками. Среди всех сарком кости, остеосаркома встречается наиболее часто и локализуется в длинных костях скелета.

Рентгенологическая картина. Типичной картиной является наличие очага смешанной деструкции кости с разрушением кортикальной пластинки и формированием мягкотканного компонента опухоли. В процессе роста опухоли, периост приподнимается или отслаивается от коркового слоя, это вызывает новое костеобразование, обычно проксимальнее основного узла, данное явление получило название козырька Кодмана. Зона поражения на рентгеновском снимке имеет различную плотность, а характер матрикса часто облаковидный. КТ и МРТ могут играть важную роль в определении распространенности опухолевого процесса. Радионуклидное сканирование скелета выявляет «skip» метастазы, многоузловые опухоли, системное поражение. В ряде клиник принято использовать артериографию, так как остеосаркомы - гиперваскуляризованные опухоли.

Классификация остеосарком. Выделяют центральную классическую остеосаркому и ее основныe гистологические варианты: остеобластический, хондробластический, фибробластический.

Следует выделять особые варианты остеосарком: телангиэктатическую, мелкоклеточную, высокодифференцированную центральную остеосаркому, вторичную, паростальную, периостальную и поверхностную низкодифференцированную остеосаркому. В работе представлено 87 остеосарком, 41 опухоль отнесена к центральному классическому варианту. Опухоль выявлена преимущественно у лиц мужского пола, а в 92% наблюдали поражение метафизов трубчатых костей конечностей.

Макроскопическая картина при классической остеосаркоме представлена крупным метафизарным узлом, расположенным центрально или эксцентрично. По консистенции опухолевая ткань может быть очень плотной или содержать хрящ, кистозные изменения не характерны. Миксоматоз сторомы узла и кистообразование наблюдали после проведения успешных курсов химиотерапии.

Гистологически остеосаркома может быть упрощенно охарактеризована как веретеноклеточная опухоль. Однако только веретеноклеточного компонента недостаточно, чтобы описать микроскопическое строение остеосаркомы. Необходимым минимумом являются два компонента: элементы саркомы и непосредственная продукция остеоида опухолевыми клетками.

В типичных случаях остеоид, окрашенный в розовый цвет, формирует анастомозирующие сплетения, между которыми находятся опухолевые клетки, вся структура может напоминать «кружево». Только при наличии остеоида с опухолевыми клетками, можно с уверенностью поставить диагноз остеосаркомы. При хондробластических вариантах остеосаркомы, основную массу опухоли составляют дольки хрящевой ткани. Данные структуры обладают зональностью, характерно увеличение количества вытянутых клеток по периферии долек, существует переход от хрящевой центральной зоны дольки к периферическим ее отделам, где преобладают вытянутые клетки. Преобладание веретеноклеточного компонента предполагает диагноз фибробластического варианта остеосаркомы.

Существуют особые гистологические формы остеосаркомы: склерозирующий тип остеосаркомы, остеосаркома, напоминающая остеобластому, хондромиксоидную фиброму, хондробластому, ЗФГ. Отдельными гистологическими вариантами описаны остеосаркома богатая гигантскими клетками и эпителиоидная остеосаркома [рис. 9]

Телангиэктатическая  остеосаркома - вариант остеосаркомы, рентгенологически, макроскопически и морфологически напоминающий аневризмальную костную кисту при которой наблюдается сходная локализация и возраст пациентов. Дифференциальный диагноз, прежде всего, включает аневризмальную кисту кости и гигантоклеточную опухоль. В работе исследовали 3 телангиэктатических остеосаркомы.

Мелкоклеточная остеосаркома - редкий вариант остеосаркомы с наличием мелких округлых или вытянутых клеток, продуцирующих остеоид. Только в 1 из 87 наблюдений выявлена мелкоклеточная остеосаркома, характеризующаяся наличием мелких клеток с гиперхромными ядрами овальной или вытянутой формы. В структуре мелкоклеточной остеосаркомы могут встречаться фокусы гемангиоперицитарного строения, а также хондроидные зоны. Основным заболеванием, с которым проводится дифференциальный диагноз, является саркома Юинга. Дополнительное иммуногистохимическое исследование с моноклональным общим лейкоцитарным антигеном и CD99 помогает в постановке диагноза.

Центральная высокодифференцированная остеосаркома - медуллярно расположенная опухоль, клетки которой продуцируют остеоид, но сохраняют высокую степень дифференцировки, что затрудняет постановку диагноза злокачественного новообразования. В настоящем исследовании только в 1 из 87 наблюдений выявлена центральная высокодифференцированная остеосаркома.

Рентгенологическая картина при высокодифференцированной центральной остеосаркоме представлена литическим очагом с нечеткими, размытыми контурами, обычно опухоль локализуется в метадиафизарных отделах кости, некоторые очаги поражения имеют трабекулярную структуру.

Макроскопическая картина при высокодифференцированной остеосаркоме: ткань опухоли имеет волокнистый, муаровый рисунок, поверхность разреза опухолевого узла не имеет характерного для низкодифференцированных сарком рыхлого, белесовато-серого вида.

Микроскопическая картина выявляет малоклеточный, гиалинизированный, веретеноклеточный очаги поражения кости, опухолевые клетки организованы в разнонаправленные пучки, ядерная атипия не выражена, митозы могут быть единичными. Опухоль внедряется между костными трабекулами  костномозгового канала, в части случаев микроскопическая картина напоминает паростальную остеосаркому, характерный «кружевной» остеоид отсутствует.

Дифференциальная диагностика высокодифференцированной центральной остеосаркомы включает десмопластическую фиброму и фиброзную дисплазию. В отличие от десмопластической фибромы, остеосаркома продуцирует матрикс, при фиброзной дисплазии не отмечается разрушения кортикального слоя кости и мягкотканного компонента опухоли.

Паростальная остеосаркома развивается на поверхности кости, является высокодифференцированной саркомой, отличается высокой степенью минерализации. В настоящем наблюдении выявлено 11 паростальных остеосарком.

Рентгенологическое исследование выявляет характерный минерализованный опухолевый узел, прилежащий к поверхности кортикальной пластинки кости. При длительно текущем процессе, иногда более 3-5 лет, минерализация опухолевого узла становится настолько выраженной, что обычная рентгенография не позволяет установить характер поражения в медуллярной части кости, в таких случаях дополнительную информацию вносят КТ и МРТ.

Макроскопическая картина при паростальной остеосаркоме характеризуется наличием белесоватого, плотного, слоистого опухолевого узла, ткань которого настолько интенсивно минерализована, что с трудом распиливается специализированными инструментами.

Микроскопическая картина при паростальной остеосаркоме складывается из веретеноклеточной высокодифференцированной стромы и четко сформированных костных трабекул, расположенных в параллельном направлении. Атипия ядер  опухолевых клеток проявляется в минимальной степени, клетки мономорфные, митозы редки. Вновь сформированные костные структуры могут обладать минерализованными или «цементированными» линиями и  педжетоидным рисунком.

Для паростальной остеосаркомы характерны фокусы хрящевой дифференцировки. Хрящ на периферии опухолевого узла формирует так называемую «шапочку» и может симулировать костно-хрящевой экзостоз. Помимо костно-хрящевого экзостоза, паростальную остеосаркому необходимо дифференцировать с остеомой, гетеротопической оссификацией, периостальной и низкодифференцированной поверхностной остеосаркомой.

Периостальная остеосаркома - хондробластический вариант умеренно дифференцированной остеосаркомы, локализующейся на поверхности кости без распространения на костномозговой канал. В работе исследовали 3 периостальных остеосаркомы.

Рентгенологическая картина выявляет очаг поражения на поверхности кости. Очаговые фокусы кальциноза, формирование спикул, нечеткая граница опухолевого узла,  мягкотканный компонент, отсутствие поражения медуллярного отдела кости, все названные рентгенологические признаки характерны для периостальной остеосаркомы. Для выявления характера поражения костномозгового канала проводится дополнительное исследование с применением КТ и МТР.

Макроскопическая картина при периостальной остеосаркоме складывается из фокусов дольчатой, преимущественно хрящевидной, белесоватой опухолевой ткани на поверхности кортикальной пластинки кости без внедрения в костномозговой канал.

Микроскопическая картина при периостальной остеосаркоме имеет признаки хондробластического варианта остеосаркомы, но не обладает специфичностью. Характерно дольчатое строение, хондроидная дифференцировка клеток, умеренная степень атипии ядер опухолевых клеток.

Дифференциальная диагностика периостальной остеосаркомы достаточно сложна и включает остеохондрому, паростальную остеосаркому, классическую остеосаркому, поверхностную низкодифференцированную остеосаркому.

Вторичная остеосаркома может развиваться на фоне болезни Педжета, остеобластомы, множественных врожденных экзостозов. В работе выделено 3 остеосаркомы на фоне болезни Педжета, 3 - постлучевых остеосарком и 1 - остеосаркома костей таза при болезни Оллье.

Макроскопическая картина выявляет границу саркоматозного компонента, особенно если разрушена кортикальная пластинка пораженной кости.

Микроскопическая картина остеосаркомы при болезни Педжета - удается выявить мозаичные структуры цементирования в окружении веретеноклеточного саркоматозного компонента, гистологический вариант остеосаркомы и степень дифференцировки опухоли отличается от случая к случаю. В наших наблюдениях все три остеосаркомы обладали признаками  низкой степени дифференцировки с фокусами патологического остеоида.

Оценка результатов предоперационной химиотерапии морфологическими методами. К наиболее чувствительным к химиотерапии относятся телангиэктатическая остеосаркома, остеосаркомы с преобладанием веретеноклеточного компонента по типу фибросаркомы с незначительными по площади фокусами продукции патологического остеоида. Макроскопически, эффект от проводимой терапии выражался в появлении кист, миксоидных изменений стромы, «разрыхления» саркоматозной ткани, кровоизлияний, «крошковатой» консистенции фокусов опухолевой ткани. Для остеосарком, наличие некротизированных участков в структуре опухоли не всегда связано с последствиями химиотерапии, считается, что спонтанному некрозу подвергается до 60% опухолевой ткани, однако тотальный некроз, или повреждение 90% опухолевой ткани возникает только как результат проведения химиолучевого лечения.

Иммуногистохимическое исследование остеосаркомы проведено у 40 больных (21 женщина и 19 мужчин) в возрасте от 16 до 70 лет. Ни в одном из 5 образцов ткани с реактивным остеогенезом  экспрессия исследованных маркеров не выявлена.

р53 выявлен в 27,5% опухолей. Не установлено связи между наличием р53 в остеосаркоме и показателями распространенности опухолевого процесса (критериями Т и М). Экспрессия р53 не выявлена во всех 7 остеосаркомах с показателем дифференцировки G1, тогда как при G3 опухолях маркер обнаружен в 11 из 33 новообразований (33,3%) (р=0,2). Частота выявления р53(+) и р53(-) остеосарком не зависела от локализации опухоли в костях скелета. При остеобластическом варианте остеосаркомы р53 не выявлен в 66,7% (16 из 22) опухолей, при хондробластическом – в 57,1% (4 из 7). При других гистологических вариантах остеосаркомы р53 не выявлен в 100% наблюдений (р=0,16). Анализ кривых общей выживаемости больных с наличием и отсутствием экспрессии р53 в опухоли не обнаружил достоверных различий. Тогда как выявлены достоверные различия в показателях безрецидивной выживаемости между больных с р53(+) и р53(-) остеосаркомами (р=0,03). Медианы общей и безрецидивной выживаемости были почти в 2 раза ниже у пациентов с р53(+) остеосаркомой, а метастазы развились у всех больных с р53(+) опухолью в первые 2 года от начала лечения. Таким образом, наличие экспрессии р53 в остеосаркомах следует считать прогностически неблагоприятным фактором раннего рецидива.

EGFR выявлен в 21 (52,5%) из 40 исследованных остеосарком. При этом, EGFR обнаруживали с одинаковой частотой в остеосаркомах пациентов мужского (52,6%) и женского пола (52,4%). Однако, возраст больных с EGFR(+) остеосаркомой был достоверно ниже, по сравнению с возрастом пациентов с EGFR(-) опухолью (соответственно 28,7±3,1 и 42,2±4,7 лет, р=0,02). С увеличением степени злокачественности остеосарком отмечена тенденция к снижению частоты выявления EGFR(-) опухолей. Частота выявления EGFR(-) остеосарком не была достоверно связана с критерием Т. Не установлено различий в частоте выявления EGFR(-) остеосарком с учетом их локализации в костях скелета: 21/47,6% - бедренная, 4/25% - плечевая, 7/57,1% - большеберцовая, 5/60% - малоберцовая кости. Не обнаружено связи экспрессии EGFR в опухолях с показателями общей и безрецидивной выживаемости.

VEGF в большинстве остеосарком (85%) не выявлен. Не обнаружено связи показателей экспрессии VEGF с основными клинико-морфологическими характеристиками и прогнозом заболевания.

Flt-1/VEGFR1 Ab-1 выявлен в 97,5% остеосарком, а уровни его экспрессии колебались от 20 до 100% и не зависели от пола больных. Однако обнаружена достоверная обратная корреляционная зависимость между уровнем экспрессии Flt-1/VEGFR1 Ab-1 в опухоли и возрастом пациентов (rs=-0,42; p=0,01), зависимость сильнее проявилась в группе мужчин (rs=-0,69; p=0,002) и при распространенности опухолевого процесса Т3 (rs=-0,79; p=0,036). Уровни экспрессии Flt-1/VEGFR1 Ab-1 не зависели от гистологического варианта и степени дифференцировки остеосарком и не связаны с показателями общей и безрецидивной выживаемости.

Bax выявлен в 28 из 36 (77,8%) остеосарком. Показатели маркера колебались от 10 до 100%, не зависели от пола пациентов, но были достоверно выше в остеосаркомах молодых пациентов, а при остеобластическом варианте остеосаркомы достоверно чаще (р=0,04) выявляли уровни экспрессии Bax 50% (56,5%). Уровни экспрессии Bax не были связаны со степенью дифференцировки остеосаркомы. Частота выявления Вах(-) остеосарком была достоверно (р=0,04) выше при критериии Т3 (57,1%). Безрецидивная выживаемость больных остеосаркомой не связана с показателями экспрессии Bax в опухоли, а неблагоприятные показатели общей выживаемости отмечены при экспрессии Вах в опухоли 50%.

Соx-2 выявлен в 11 из 34 (32,3%) остеосарком. Частота выявления Сох-2(-) остеосарком не зависела от пола пациентов, при этом средний возраст больных с Сох-2(-) опухолью (45,5±6,3 лет) был достоверно старше, чем с Cox-2(+) (31,7±3,4 лет; р=0,04). Частота выявления Сох-2(-) опухолей не зависела от гистологического варианта и степени злокачественности остеосаркомы. В то же время установлены достоверные различия в показателях частоты выявления Сох-2(-) остеосарком при учете критерия Т (р=0,009). Уровни экспрессии Сох-2 в остеосаркомах не были связаны с прогнозом заболевания.

HER-2/neu. Показатели общей выживаемости больных остеосаркомой достоверно различались (р=0,01) в группах с уровнем экспрессии Her-2/neu(-) и Her-2/neu(+), поэтому наличие этого маркера в опухоли следует считать прогностически неблагоприятным фактором. Аналогичные результаты выявлены при изучении показателей безрецидивной выживаемости (р=0,007).

Многофакторный анализ выявил, что показатели экспрессии Her-2/neu (p=0,004), р53 (р=0,011) и Сox-2 (р=0,04) в опухоли следует считать независимыми факторами прогноза общей выживаемости больных остеосаркомой кости,

Хрящеобразующие опухоли костей

Остеохондрома (солитарная остеохондрома, костнохрящевой экзостоз) представляет собой вырост на наружной поверхности кости с хрящевым покрытием или так называемой хрящевой шапочкой, при этом центральная часть выроста заполнена костно-мозговым содержимым и, что особенно важно, сохраняет связь с костно-мозговым каналом основной (материнской) кости. Исследованы 39 остеохондром в различных отделах скелета (28 мужчин, 11 женщин).

Рентгенологическая картина. Солитарные остеохондромы могут располагаться на ножке или прилегать к основной кости. КТ и и МРТ, как правило, документируют продолженную связь костномозгового содержимого основной кости и остеохондромы.

Макроскопическая картина. Неравномерное утолщение хрящевого покрытия (> 2 см), является индикатором возможной опухолевой трансформации.

Микроскопическая картина. Хондроциты поверхности шапочки располагаются группами. Хондроциты более глубокого слоя в точности напоминают ростковую пластинку, они располагаются колонками и подвергаются энхондральному окостенению как в зоне роста материнской кости.

Дифференциальный диагноз. Редко возникает необходимость дифференцировать остеохондрому с поверхностной остеосаркомой, которая характеризуется отсутствием костного стержня или ножки, наличием хрящевых долек, инфильтрирующих мягкие ткани. Паростальная остеосаркома обладает участками симулирующими хрящевое покрытие остеохондромы, однако рентгенологическая картина и полная гистологическая характеристика опухоли не вызывают трудностей в дифференциальной диагностике

Хондрома (солитарная энхондрома, центральная хондрома) - доброкачественная опухоль из гиалинового хряща, расположенная в костномозговом канале кости. Обследовали 23 мужчины и 18 женщин с хондромой кости.

Рентгенологическая картина хондромы представляет четко очерченный опухолевый узел. Очаги минерализации в хондромах выглядят достаточно характерно и представлены очаговыми, глыбчатыми или кольцевидными , арочными отложениями извести. Полного разрушения кортикального слоя трубчатой кости с выходом опухолевых масс в мягкие ткани не наблюдается.

Макроскопическая картина. Большинство хондром не превышают в размерах 3 см и подвергаются кюретажу, поэтому макроскопически выглядят как дольчатые фрагментированные образования.

Микроскопическая картина хондром представлена опухолью с преобладанием гиалинового хрящевого матрикса, отличается малой клеточностью и слабой васкуляризацией. Встречаются клетки с развернутым или дисперстным характером хроматина, мелкими нуклеолами. Клетки равномерно расположены в матриксе или формируют скопления. Более одной клетки в лакуне или единичные двуядерные клетки могут наблюдаться в обычных интактных хондромах. Митотическая активность данных опухолей крайне низкая.

Хондробластома (кальцифицирующаяся гигантоклеточная опухоль, эпифизарная хондроматозная гигантоклеточная опухоль) - доброкачественная, хрящевая опухоль, развивающаяся в эпифизарных отделах костей. В настоящем исследовании хондробластома выявлена у 5 мужчин и 3 женщин.

Рентгенологическая картина. Хондробластома выглядит как небольшой, от 3 до 6 см литический очаг, центрально или эксцентрично расположенный, с четкими контурами, занимающий около половины площади эпифизарной зоны. Хондробластома плоских костей и мелких трубчатых костей больших размеров, может сопровождаться припухлостью мягких тканей, вздутием кости и периостальной реакцией. Распространение процесса на метафизарную зону встречается часто.

Макроскопическая картина при хондробластоме выявляет характерные опухолевые структуры. Фрагменты опухолевой ткани, полученные при кюретаже обычно серовато-желтые, зернистые. Нередко отмечается кистообразование.

Микроскопическая картина. При гистологическом исследовании обнаруживаются однотипные овальные или полигональные хондробласты с четко контурированной границей нежной, эозинофильной цитоплазмы и округлым или овальным ядром. Нежные, эозинофильные включения хондроидного вещества различной величины, также характерны для данной опухоли. Зрелый гиалиновый хрящ встречается редко. Важным диагностическим признаком является сетчатое, межклеточное, базофильное обызвествление, напоминающее проволочную изгородь. Формирование вторичной аневризмальной кисты наблюдается в трети всех случаев хондробластомы.

Иммунофенотип. Хондробласты обычно положительно реагируют с S-100 и виментином. Положительная реакция опухолевой ткани с другими маркерами, включая цитокератины, также широко документированы в литературе, однако не выявлено специфических для данной опухоли маркеров.

Хондромиксоидная фиброма - доброкачественная опухолью, представлена дольчатыми структурами из вытянутых и звездчатых клеток, расположенных в обильном миксоидном или хондроидном межклеточном веществе. Обследовали 2 мужчин и 4 женщины с хондромиксоидной фибромой кости.

Рентгенологическая картина. Хондромиксоидная фиброма длинных трубчатых костей в типичных случаях представлена метафизарным или метадиафизарным, эксцентричным, четко очерченным, овальным очагом разряжения костной ткани с истон чением и вздутием коркового слоя с одной стороны.

Макроскопическая картина. Опухолевая ткань при хондромиксоидной фиброме имеет характерный вид несколько выбухающей из границ белесовато-голубой ткани.

Микроскопическая картина хондромиксоидной фибромы представляет сочетание звездчатых или вытянутых клеток в миксоидной или хондроидной строме. В ряде случаев преобладает дольчатая структура с малым количеством клеток в центральных отделах опухолевых долек и гиперклеточными периферическими отделами.

Иммуногистохимия. Клетки хондромиксоидной фибромы положительно реагируют с белком S-100. По периферии долек отмечается иммунореактивность клеток с гладкомышечным актином и CD34. Встречаются клеточные отростки, волнистость клеточной мембраны, цитоплазматические фибриллы и наличие гликогена, а также типичные хондроциты, миофибробласты и промежуточные формы.

Хондросаркома - злокачественная опухоль, развивающаяся из гиалинового хряща. Миксоидные изменения, отложение солей извести и костеобразование характерны для структуры хондросаркомы. Нами проведен анализ 118 клинических наблюдений больных классической первичной хондросаркомой, 32 - вторичной хондросаркомой , 10-дедифференцированной  хондросаркомой, 4 - периостальной хондросаркомой и 1-мезенхимальной хондросаркомой.

На рентгенологическом снимке первичная хондросаркома выглядит как литический очаг с вкраплениями или кольцевидными включениями плотного вещества, документирующего очаги минерализации. Эрозия и разрушение коркового слоя зачастую сопровождают развитие первичной хондросаркомы. Корковый слой утолщен, реакция периоста не характерна для первичной хондросаркомы. МРТ помогает определить степень распространения опухолевого процесса в костномозговом канале, наличие выхода опухолевых масс в мягкие ткани, а КТ помогает охарактеризовать опухолевый матрикс и выявить кальцификацию.

Макроскопическая картина. Поверхность разреза опухолевой ткани имеет голубовато-серый или белый цвет, что соответствует наличию гиалинового хряща. Всегда присутствует характерное дольчатое строение опухолевых узлов, встречаются участки миксоматоза, мелкие кисты. Желто-белые, мелообразные включения характеризуют наличие извести. Изъеденный край кортикальной пластинки, выход в мягкие ткани характерен для хондросаркомы плоских костей.

Микроскопическая картина. При малом увеличении опухоль характеризуется наличием серо-голубого хрящевого матрикса, формированием опухолевых долек различной величины и формы. Дольки разъединены нежными фиброзными перегородками и тонкими костными балками. По сравнению с хондромой, хондросаркома отличается большей клеточностью, но этот признак различается в различных полях зрения.

Хондроциты представлены полиморфными клетками с увеличенными, гиперхромными ядрами. Степень ядерной атипии клеток при хондросаркоме обычно умеренно выражена. В опухоли часто встречаются двуядерные клетки.

Инфильтративное внедрение опухолевых комплексов в структуры костномозгового канала и прорастание кортикального слоя служат отличительным признаком хондросаркомы по сравнению с хондромой. Некротизированные участки опухолевой ткани в сочетании с митотическими фигурами более характерны для низкодифференцированной хондросаркомы. Кроме того, критерии диагностики хондросаркомы в длинных трубчатых и плоских костях различаются от таковых в мелких костях кисти и стопы. Главным дифференциально диагностическим признаком хондросаркомы мелких костей конечностей является инфильтративный характер роста в костномозгвом канале среди костных балок, разрушение кортикальной пластинки, выход опухолевых масс в прилежащие мягкие ткани. Определение степени зрелости хондросаркомы по гистологическим признакам является важным критерием прогноза, производится по шкале 1-3 и основан на величине ядер, характере окраски ядер, клеточности. Подавляющее большинство первичных хондросарком относятся к высокодифференцированным или умеренно дифференцированным опухолям, в редких случаях регистрируется низкодифференцированная первичная хондросаркома.

Вторичная хондросаркома развивается на основе предсуществовавшей доброкачественной хрящевой опухоли, остеохондромы или хондромы. Деструктивное прорастание костной ткани с разрушением кортикального слоя кости и формированием мягкотканного компонента наблюдается при злокачественной трансформации хондромы.

Периостальная хондросаркома (юкстакортикальная хондросаркома) - злокачественная опухоль из гиалинового хряща, развивающаяся на поверхности кости. Опухоль поражает кортикальный слой кости и не имеет четких границ. Размеры узла больше, чем при периостальной хондроме и превышали 5 см. Узел представлен литическим очагом с точечными вкраплениями плотной ткани в участах отложения извести. Узел покрыт вздутым периостом, кортикальный слой в той или иной мере эрозирован. В проведенном исследовании только 4 опухоли классифицированы как периостальная хондросаркома.

Макроскопически опухолевый узел представлен узловатым образованием более 5 см на поверхности кости, а поверхность разреза - сочетанием хрящевой ткани с белесоватыми очагами энхондрального окостенения и оссификатами.

Микроскопическая картина. Гистологическое строение опухоли сходно с классической первичной хондросаркомой. Узловатые опухолевые массы могут проникать в прилежащие мягкие ткани.

Мезенхимальную хондросаркому относят к редким злокачественным хрящевым опухолям с бифазным гистологическим строением, представленным низкодифференцированными мелкими округлыми клетками и островками высокодифференцированного гиалинового хряща. В настоящем исследовании мезенхимальная хондросаркома выявлена у 1 женщины.

Рентгенологическое изображение при мезенхимальной хондросаркоме не обладает специфичностью и во многом сходно с обычной классической хондросаркомой, представлено литическим очагом без четких границ.

Микроскопическая картина. Типичная бифазная гистологическая картина при мезенхимальной хондросаркоме складывается из полей мелких низкодифференцированных клеток, формирующих сосудисты структуры и островков зрелого гиалинового хряща. Количество хрящевых включений различается. Могут наблюдаться отграниченные от основной опухолевой ткани хрящевые структуры. Низкодифференцированные участки опухоли напоминают по строению саркому Юинга, клетки могут обладать вытянутой формой. Единичные остеокластоподобные гигантские клетки являются частой находкой.

Иммуногистохимические маркеры мало помогают в дифференциальной диагностике мезенхимальной хондросаркомы, особенно при необходимости различить низкодиференцированный мелкоклеточный компонент с мелкими круглыми опухолевыми клетками при саркоме Юинга. При мезенхимальной хондросаркоме клетки мелкоклеточного низкодифференного компонента проявляют положительную реакцию с виментином, а также CD99. Клетки хрящевого компонента проявляют положительную реакцию с белком S-100. Гемангиоперицитарное строение подчеркивается при реакции с CD34.

Мелкоклеточный низкодифференцированный компонент представлен мономорфными клетками с минимальным обьемом межклеточного матрикса, имеющими строение примитивных мезенхимальных клеток.

Дедифференцированная хондросаркома (хондросаркома с дополнительным мезенхимальным компонентом) - один из вариантов хондросаркомы, при котором четко различаются два обязательных компонента опухоли. Одним из компонентов является высокодифференцированная хрящевая опухоль, как например, хондрома или высокодифференцированная хондросаркома. Вторым компоненом является низкодифференцированная нехрящевая саркома. Гистологически можно проследить границу между двумя компонентами дедифференцированной хондросаркомы. При этом, наиболее часто, хрящевым компонентом дедифференцированной хондросаркомы является высокодифференцированная (grade 1) хондросаркома. В работе изучено 10 случаев дедифференцированной хондросаркомы.

Нехрящевой саркоматозный компонент в большинстве случаев представлен злокачественной фиброзной гистиоцитомой. В качестве низкодифференцированного саркоматозного нехрящевого компонента дедифференцированной хондросаркомы наблюдается также остеосаркома, фибросаркома, рабдомиосаркома, лейомиосаркома.

Дифференциальная диагностика. При подозрении на дедифференцированную хондросаркому необходимо исключить хондробластический вариант остеосаркомы, которая наиболее часто развивается в возрасте 20-30 лет. При хондробластической остеосаркоме поля опухоли с хрящевой дифференцировкой отличаются клеточностью, представлены низкодифференцированными хрящевыми элементами, переходящими в веретеноклеточную саркому. Веретеноклеточные зоны тесно переплетаются с хрящевыми. При дедифференцированной хондросаркоме практически всегда можно проследить границу между высокодифференцированной хондросаркомой и веретеноклеточной саркомой, оба компонента прилежат друг к другу, но не переплетаются и структурно не смешиваются.

Иммуногистохимическое исследование хондросарком

Иммуногистохимические исследования проведены у 39 больных хондросаркомой (27 мужчин и 12 женщин). У 14 больных выявлена вторичная хондросаркома (у 1 из них на фоне болезни Оллье), у 14 – центральная, у 3 - периостальная, у 7 – дедифференцированная хондросаркома. В качестве группы контроля обследованы 10 больных доброкачественными хрящеобразующими новообразованиями костей (5 - остеохондрома, 5 – хондрома). Следует отметить, что экспрессия маркеров в доброкачественных хрящеобразующих новообразованиях костей не выявлена.

ММР-1 обнаружен в 33 из 39 (84,6%) хондросарком. Частота выявления и уровни экспрессии белка ММР-1 в хондросаркомах не зависели от пола пациентов, однако в возрасте до 45 лет частота выявления MMP-1(+) опухолей составила 60,0%, а после 45 лет – 93,1% (р=0,028 по точному критерию Фишера). При этом, во всех 7 дедифференцированных хондросаркомах кости выявлена экспрессия ММР-1. Частота выявления ММР-1(-) снижалась по мере увеличения критерия распространенности первичной опухоли Т (р=0,027).

Анализ безрецидивной выживаемости у больных хондросаркомой кости с отсутствием и наличием экспрессии ММР-1 в опухоли выявил достоверные различия (р=0,048 по критерию Cox’s F-Test). Так, 3-летняя безрецидивная выживаемость пациентов с ММР-1(-) опухолями составила 60,0±21,9% мес, тогда как у больных с ММР-1(+) хондросаркомами – 28,5±9,4%. Аналогичные результаты получены при анализе 5-летней общей выживаемости: с ММР-1(-) хондросаркомой 5-летняя выживаемость составила 100%, а с ММР-1(+) хондросаркомами - 34,9±11,9% (р=0,03 по критерию Log-Rank Test), что указывает на возможную связь ММР-1 с процессом метастазирования при хондросаркоме.

ММР-2. В 10 из 38 (26,3%) опухолей экспрессия ММР-2 не обнаружена. Различия в уровнях экспрессии ММР-2 между доброкачественными и злокачественными хрящеобразующими опухолями костей достоверны (р=0,001), при этом показатели экспрессии ММР-2 в хондросаркомах не отражали основные клинико-морфологические характеристики заболевания и их прогноз.

ММР-9. Уровни эспрессии ММР-9 в 39 хондросаркомах колебались от 0 до 80%. Не установлено связи степени выраженности экспрессии ММР-9  в опухоли с полом больных хондросаркомой и гистологическим вариантом их строения.  Однако уровень экспрессии ММР-9 в хондросаркомах достоверно повышался с увеличением степени злокачественности опухоли (р=0,009). Многофакторный анализ показал, что степень злокачественности опухоли (р=0,047) и уровень экспрессии белка ММР-9 (р=0,02) могут считаться независимыми факторами прогноза безрецидивной выживаемости больных хондросаркомой кости. Вместе с тем, содержание ММР-9 в опухоли не влияло на показатели 5-летней общей выживаемости больных хондросаркомой.

TIMP-1. Не обнаружено связи показателей экспрессии ТIMP-1 в хондросаркомах с основными клиническо-морфологическими характеристиками заболевания. Показано, что определение соотношения показателей ММР-9/ТIMP-1 при анализе прогноза общей выживаемости больных хондросаркомой предпочтительнее, чем только одного показателя экспрессии ММР-9 в опухоли.

Coll-IV. Экспрессия Coll-IV выявлена в 67,7% хондросаркомах. Однакопрогностическая ценность содержания Coll-IV в хондросаркомах выражена слабее, чем ММР-1 и ММР-9.

Bcl-2 выявлена у 20% больных доброкачественными хрящеобразующими новообразованиями костей и в 72,2% хондросаркомах, различия между группами достоверны (р=0,004), однако, наличие экспрессии Bcl-2 в хондросаркомах кости не является прогностически значимым фактором.

Cox-2. Отмечено повышение частоты выявления Сох-2 в хондросаркомах по сравнению с доброкачественными хрящеобразующими новообразованиями костей, при увеличении критерия Т и степени злокачественности хондросаркомы. Во всех дедифференцированных хондросаркомах обнаружена экспрессия Сох-2. Показатели экспрессия Cox-2 в хондросаркомах не обладали прогностической ценностью.

Bax. Показатель отражает распространенность процесса, степень злокачественности опухоли и выявлен у всех больных дедифференцированной хондросаркомой, а уровни экспрессии Вах в хондросаркомах 40% можно использовать в качестве дополнительного маркера высокого риска раннего рецидивирования.

Элетронно-микроскопическое исследование опухолей костей

Электронно-микроскопическое исследование имеет диагностическую ценность при выявлении гранул Birbeck при эозинофильной гранулеме костей.

Метод позволяет детализировать степень дифференцировки клеток, что приобретает особое значение в прогнозе дедифференцированных хондросарком, а также в диагностике гистологических вариантов строения при остеосаркомах.

Электронная микроскопия подтверждает лакунарное расположение хондроцитов в обильном, рыхлом, фибриллярном межуточном веществе, содержащем мелкие, плотные матриксные включения. Лакуны выглядят как просветления перинуклеарной зоны, что подчеркивается очаговой компрессией фибриллярного матрикса. Зачастую в одной лакуне располагается несколько клеток. Атипичные хондроциты при хондросаркоме имеют неправильную форму, клеточная мембрана звездчатая с тонкими волокнообразными отростками, выступающими в лакуну. Ядро хондроцитов, как правило, располагается эксцентрично. Характерным признаком является хорошо развитый шероховатый эндоплазматический ретикулум, занимающий значительную часть цитоплазмы. Гранулы гликогена в виде агрегатов или мелких озерец располагаются по периферии цитоплазмы. Единичные митохондрии разбросаны по цитоплазме.

При дедифференцированной хондросаркоме, хрящевой компонент, как правило, сохраняет структуру и свойства высокодифференцированной хондросаркомы. Второй мезенхимальный нехрящевой саркоматозный компонент может приобретать строение остеосаркомы, злокачественной фиброзной гистиоцитомы, фибросаркомы, а также рабдомиосаркомы. Клетки имеют нечеткие контуры, характеризуются выраженным комплексом Гольджи и отличаются от случая к случаю количеством аггрегатов липидов и лизосом. Гранул Лангерганса и палочковидных структур (гранулы Birbeck), характерных для пролиферирующих гистиоцитов и гистиоцитоза Х, в дедифференцированной саркоме с нехрящевой саркомой по типу злокачественной фиброзной гистиоцитомы обнаружено не было.

Во всех случаях классической центральной остеосаркомы удавалось обнаружить клетки, продуцирующие коллаген и остеоид. При остеобластическом варианте строения остеосаркомы, эти проявления были выражены в наибольшей степени.

Типичный опухолевый остеобласт, как и его доброкачественный аналог, обладает ярко выраженным комплексом Гольджи, а также шероховатым эндоплазматическим ретикулумом. Цитоплазма опухолевой клетки богата структурами шероховатого эндоплазматического ретикулума, который расширен и формирует переплетающиеся беспорядочно расположенные кавернозные пазухи, содержащие глыбчатый материал. Аппарат Гольджи сформирован из мелких везикул и мембранозных структур, расположенных вокруг ядра. В дополнении к описанным структурам, в цитоплазме опухолевого остеобласта встречается большое количество митохондрий, лизосом, частиц гликогена, рибосом, полирибосом и филаментов. Прилежащий межклеточный матрикс обладает низкой электронной плотностью и представлен коллагеновыми и эластическими волокнами. Ядро содержит эухроматин, а ядерная мембрана несколько изломана.

Ультраструктурное исследование позволяет детально изучить структурные элементы костных опухолей, заострить внимание на наиболее тонких механизмах гистогенеза и эмбриогенеза отдельно взятых нозологических единиц.

Злокачественные мелкоклеточные новообразования костей

(молекулярно-биологические исследования)

Саркома Юинга. Обследовали 46 больных саркомой Юинга (19 женщин и 27 мужчин) в возрасте от 16 до 56 лет. У большинства пациентов опухоль локализовалась в длинных костях скелета и костях таза, единичные опухоли обнаружены в лопатке, позвонках, мелких костях стопы.

Рентгенологическое исследование в большинстве случаев (более 75%) выявило значительное по протяженности поражение кости, в трубчатых костях преобладает поражение метафизарно-диафизарных отделов. Опухоль расслаивает кортикальный слой кости наподобие «луковичной шелухи» и вызывает периостальную реакцию с мягкотканным компонентом. При саркоме Юинга могут формироваться спикулы, что затрудняет дифференциальный диагноз с остеосаркомой. Опухоль Юинга не продуцирует матрикса, однако в очаге поражения может присутствовать реактивный остеогенез. Вследствие периостального новообразования кости, кортикальный слой может быть утолщенным, мягкотканный компонент опухоли может преобладать по сравнению с костным.

Микроскопическая картина при саркоме Юинга заключается в пролиферации мелких округлых однотипных клеток, не продуцирующих матрикс. Опухолевые клетки обладают просветленной цитоплазмой, в которой располагаются однотипные, округлые или овальные ядра, «краш феномен» может наблюдаться, но не очень характерен для саркомы Юинга, веретеноклеточность строения также не является характерным микроскопическим признаком, хотя некоторые авторы указывают на подобные гистологические изменения. «Краш-феномен» и веретеноклеточное строение опухоли осложняли морфологическую диагностику в 12 из 46 (26%) наблюдений, что требовало проведения дифференциального диагноза с целым рядом заболеваний, включавших злокачественную лимфому, различные варианты мелкоклеточных, веретеноклеточных сарком. Ядра клеток саркомы Юинга содержат нежный хроматин и одно или несколько ядрышек. Среди клеток встречаются вытянутые или овальные клеточные элементы с гиперхромными ядрами.

Некроз может быть значительно выражен, сохранная часть опухоли занимает периваскулярное расположение. Ядерная пыль, расположенная в сосудах, создает феномен Azzopardi. Крупноклеточная или атипическая саркома Юинга характеризуется более крупными и полиморфными клетками, в остальных гистологических проявлениях данная опухоль ничем не отличается от обычной саркомы Юинга.

Выделяют крупноклеточный и эпителиоидноклеточный варианты гистологического строения саркомы Юинга. Из 46 наблюдений удалось выделить крупноклеточный или атипический вариант строения опухоли в двух наблюдениях, в одном случае с поражением таранной кости, в другом лопатки.

В 39 из 46 наблюдений саркомы Юинга проведены иммуногистохимические исследования с применением маркера СD99, четкая положительная реакция опухолевых клеток отмечена в большинстве наблюдений.

Цитогенетические исследования позволили выявить специфические хромосомные изменения. Одной из первых мелкоклеточных сарком оказалась саркома Юинга, для которой были установлены специфические транслокации t(11:22) (q24;q12) (Barr F.G. et al., 2003).

Дифференциальный диагноз между саркомами мелкоклеточного строения с поражением кости во многом могут основываться на иммуногистохимической идентификации фенотипа опухоли. Так, низкодифференцированная саркома обычно негативна к CD99, CD57, p53, многим специфическим тканевым белкам, обладает выраженной позитивной реакцией к Fli-1 и нечеткой позитивной реакцией к р16.

Синовиальная саркома проявляет положительную иммунореактивность к CD99, Fli-1, EMA, панцитокератинам, негативна к CD57, р53, десмину, CD45, p16. Эпителиальные молекулы адгезии такие как Е-кадгерин, клаудин, окклюдин, ZO-1, десмоплакин могут оказаться позитивными при синовиальной саркоме. Десмоглеины обычно негативные.

Эмбриональная рабдомиосаркома проявляет положительную экспрессию с миогенином, десмином, миоD-1, Fli-1, панцитокератинами, р16, окклюдином, ZO-1, нечетко выраженную положительную реакцию с антителами к CD99, p53, клаудину-1.

Для злокачественной лимфомы характерна ретикулярная сеть, особенности строения ядер клеток, «краш феномен», наличие сигарообразных клеток, а иммуногистохимическое исследование с CD20 и СВ45 помогают правильно поставить диагноз.

Первичная лимфома кости - злокачественная лимфома кости построена из опухолевых лимфоидных элементов, расположенных в нежной ретикулярной строме. Обследовали 17 мужчин и 11 женщин с первичной лимфомой кости.

Рентгенологическая картина при первичной лимфоме костей неспецифична, в длинных костях чаще вовлекается в процесс диафизарная зона, очаг поражения значительный по протяженности - от 25 до 50% кости, иногда поражается вся кость. Границы очага нечеткие, зоны склероза перемежаются с литическими очагами, что создает характерный симптом «побитой молью» кости.

Микроскопическая картина при первичной костной лимфоме выявляет диффузный характер роста опухоли, костные лимфомы относят к диффузным В-клеточным крупноклеточным вариантам. При малом увеличении отмечается инфильтративный рост опухолевых клеток в межтрабекулярных пространствах, характерна сеточка из тонких ретикулиновых волокон, иногда волокна соединяются в коллагеновые перемычки. Несмотря на то, что первичная лимфома кости относится к крупноклеточному варианту, опухолевые клетки различаются по размерам. Для лимфомы типично сочетание мелких, более крупных и крупных клеточных элементов. Ядра опухолевых клеток с нечеткими очертаниями и часто расщепленные, ядрышки могут быть значительно выраженными, ободок цитоплазмы узкий. Необходимо иметь в виду, что возможны варианты с выраженным склерозом стромы и зажатыми в фиброз вытянутыми опухолевыми клетками при этом картина может напоминать веретеноклеточную саркому, возможно также формирование вихреватых структур, напоминающих муаровые. Зажатые в фиброз и деформированные клетки сигарообразной формы образуют участки, характерные для так называемого «краш-феномена». Поражение костей при злокачественной лимфоме Ходжкина, является вторичным. Лейкемические инфильтраты также могут наблюдаться в костях и часто развиваются при гранулоцитарной саркоме.

Все 28 наблюдений (100%) были отнесены к крупноклеточному B клеточному варианту костной лимфомы, подтвержденному экспрессией маркеров СD20 и CD79. В 12 наблюдениях отмечена положительная экспрессия белка Bcl-2.

Миелома. Принято выделять три основные варианта миеломы при поражении кости: множественная, солитарная или плазмоцитома и остеосклеротический вариант миеломы кости. Диагноз миеломы в высоком проценте случаев (более 85%)ставится на основе пункционной биопсии. Появление моноклонального белка в крови и моче наблюдается в большинстве случаев.

Рентгенологические проявления миеломы бывают классическими с четкими литическими очагами, окруженными ободком склероза, также характерен остеопороз различной степени выраженности, что часто приводит к патологическим переломам. В 25% случаев очаг поражения не выявляется при обычной рентгенографии, при помощи КТ и МРТ выявляют маленькие очаги поражения.

Микроскопическая картина при миеломе на малом увеличении соответствует диффузному росту опухолевых элементов при любой другой мелкокруглоклеточной опухоли. При большем увеличении выявляются характерные особенности ядер плазматических клеток, напоминающих циферблат или спицы в колесе, а также эксцентрическое расположение ядер.

Отложения амилоида встречаются в 10-15% наблюдений и могут сочетаться с наличием гигантских клеток. Характерные поля из плазматических клеток располагаются между глыбками амилоида, в некоторых случаях депозиты амилоида настолько массивные, что не сохраняется клеточной опухолевой ткани.

Опухолевые клетки продуцируют моноклональный цитоплазматический иммуноглобулин, диагностическим признаком является экспрессия либо каппа (), либо лямбда () легких цепей, а также CD138.

В отдельных наблюдениях морфологическая картина отличается от классических проявлений миеломы. Так, могут встречаться очаги опухолевого роста или вся опухоль с резким полиморфизмом ядер клеточных элементов или выраженными склеротическими изменениями стромы опухоли.

Молекулярно-биологические исследования мелкокруглоклеточных

опухолей костей

Большинство исследований свидетельствует о мезенхимальном происхождении данной группы опухолей из стволовых клеток, однако существует также мнение, что мелкокруглоклеточные опухоли костей могут развиваться вследствие генетических нарушений нейроэктодермы, приводящих к повышенной пролиферации и потере способности к дифференцировке.

Обследовали 17 пациентов с мелкокруглоклеточными опухолями костей и мягких тканей (10 мужчин и 6 женщин) в возрасте от 1 до 71 года.

Иммуногистохимическое исследование опухолей проводили с использованием панели моноклональных (Мкл) и поликлональных (Пкл) антител, представленных в таблице 4.  Все ИГХ реакции оценивали полуколичественно.

Морфологические типы опухоли. Первичные диагнозы были установлены как саркома Юинга у 11 пациентов и ПНЭО у 6 пациентов. При пересмотре препаратов и после проведения дополнительных методик многие диагнозы были изменены или детализированы. У 8 пациентов сохранен диагноз классической саркомы Юинга, у 1 - выявлен крупноклеточный вариант саркомы Юинга, у 1 -атипическая саркома Юинга, в 1 - саркома Юинга с эндотелиоматозными признаками, у 2 - диагностирована ПНЭО, у 1 - синовиальная саркома, у 1 - эмбриональная рабдомиосаркома, у 1 - низкодифференцированная саркома и у 1 - диффузная В-клеточная лимфома.

Клетки при классическом и атипическом варианте саркомы Юинга мелкие, темносиние, округлые или овальные. Ядерный хроматин нежный с глыбчатым распределением в ядре, ядрышки выраженные. Необходимо отсутствие воспалительной реакции в строме опухоли. Опухоль расценивалась как ПНЭО при наличии розеток Homer Wright или полурозеток. Атипическая крупноклеточная саркома Юинга представлена крупными, гетерогенными клетками с эозинофильной «гистиоидной» цитоплазмой. Клеточные контуры нечеткие, хроматин с перегородками, ядрышки ярко выражены. Опухоль Юинга с эндотелиальными характеристиками проявляла фокальную сосудистую дифференцировку с изолированными сосудистыми щелями и полостями.

Иммуногистохимия. При саркоме Юинга/ПНЭО отмечена высокая степень иммунореактивности с CD99 и Fli-1. При CD99 отмечается яркая мембранная окраска, Fli-1 обладает ядерной реакцией. HNK-1 оказался положительным только в 5 наблюдениях из 13 (38,4%), локализация реакции цитоплазматическая иногда сопровождалась мембранным окрашиванием. Окрашиванием тканевых матриц полностью дублировало результаты иммуногистохимических реакций с тканями. В саркоме Юинга не выявлено мышечных маркеров. Десмин и прочие маркеры оказались отрицательными во всех наблюдениях экспрессия EMA и цитокератина выявлена в 2 из 13 наблюдений (15,4%) Иногда экспрессировались другие маркеры эпителиальной дифференцировки (клаудин-1, окклюдин, ZO-1. десмоплакин). Частота их выявления соответственно 84,6%, 92,3%, 100% и 69,2%. Другие белки этой группы экспрессировались реже (Е-кадхерин, десмоплакин-1, десмоплакин-2, десмоплакин) в 30,7% наблюдений.

Ядерная экспрессия мутантного р53 выявлена в 9 из 13 сарком Юинга/ПНЭО (69,2%). Экспрессию р16 наблюдали в 12 из 13 сарком Юинга/ПНЭО (92,3%).

Недифференцированная саркома была CD99, CD57, p53 негативной, выраженно позитивной к Fli-1 и слабопозитивной к р16.

Синовиальная саркома проявляла положительную реактивность с Fli-1, CD99, EMA, panCK, и была негативна с CD57, p53, некоторым тканевым маркерам CD45, десмином, слабо положительна с р16. Необходимо отметить положительную реакцию с молекулами эпителиальной адгезии, Е-кадхерином, клаудином-1, окклюдином, ZO-1, десмоплакином и негативную реакцию с десмоглеином.

Эмбриональная рабдомиосаркома экспрессировала миогенин, десмин, Myo-D1, Fli-1, panCK, p16, окклюдин, ZO-1, слабое окрашивание - с CD99, p53, клаудином-1.

Диффузная В-клеточная крупноклеточная лимфома обладала типичным фенотипом,  положительной реакцией с CD20 и СD45.

Ни одна из этих опухолей, за исключением случаев саркомы Юинга/ПНЭО, не обладала EWS/Fli-1 генной реорганизацией.

Пролиферативная активность. В подавляющем большинстве случаев сарком Юинга/ПНЭО пролиферативный индекс Ki-67 был низким (2-18%). Только в одном наблюдении уровень пролиферации достигал 45,5% с выраженной реакцией с Ki-67. Уровень пролиферации в лимфоме был высокий (47,3%). В синовиальной саркоме, низкодифференцированной и рабдомиосаркомах индекс пролиферативной активности Ki-67 был низким.

FISH детекция разрыва гена EWS и статус р16. В 9 наблюдениях отмечена транслокация EWS локуса в положении 22q12. Один случай не сопровождался транслокацией. Оставшиеся 3 случая были неинформативными.

Гомозиготная делеция гена р16 определена в 1 наблюдении (7,7%) эндотелиального типа Юинга. FISH анализ не выявил делеции р16 в оставшихся 12 наблюдениях (92,3%). Гетерозиготная делеция р16 выявлена в случае В-клеточной лимфомы. В других саркомах делеции р16 не наблюдали.

ОТ-ПЦР выполнен в 13 наблюдениях сарком Юинга/ПНЭО с экстракцией РНК из парафиновых блоков. В 7 случаях результаты оказались неинформативными вследствие недостаточного количества амплифицированной РНК. Es/Fli-1 сливающийся транскрипт обнаружен в 5 наблюдениях (3 классических варианта саркомы Юинга, 1 крупноклеточный вариант и 1 атипический вариант гистологического строения опухоли). В одном наблюдении ОТ-ПЦР оказалась отрицательной в классическом варианте саркомы Юинга. Слияние EWS/Fli-1 не выявлено в других исследованных опухолях (в клеточной лимфоме, синовиальной саркоме, рабдомиосаркоме и недифференцированной саркоме).

Гетерогенность саркомы Юинга. В предварительных исследованиях указывали на гетерогенность гистологических вариантов саркомы Юинга. В настоящем исследовании также выявлено несколько гистологических вариантов строения саркомы Юинга: классический, атипический, эндотелиальный. В литературе также описан крупноклеточный вариант строения опухоли. Несмотря на различия в гистологическом строении, большинство этих опухолей проявляют идентичный иммуногистохимический фенотип. Гистологическое строение ПНЭО имеет свои особенности и проявляется наличием характерных розеток Homer Wright или псевдорозеток. Иммуногистохимические и генетические изменения при ПНЭО и саркоме Юинга идентичны.

Специфические маркеры для саркомы Юинга. Специфического маркера для выявления саркомы Юинга до настоящего времени не описано, однако поверхностный антиген CD99/MIC2 широко используется в практической работе. CD99 экспрессируется также в синовиальной саркоме, лимфобластной лимфоме, рабдомиосаркоме, поэтому результаты экспрессии CD99 необходимо оценивать в комплексе с другими методами исследований. Положительная реакция с CD99 отмечена нами в 92,3% опухолей. Другие маркеры обладают либо низкой чувствительностью (HNK-1/CD57), либо низкой специфичностью (Fli-1) - оказывается положительным при лимфоме и других вариантах сарком.

Экспрессия цитокератинов и молекул адгезии. В настоящем исследовании положительная реакция с цитокератинами отмечена в двух наблюдениях классической саркомы Юинга и одном наблюдении ПНЭО, что может указывать на мультипотентную дифференцировку примитивных клеток опухоли.

Экспрессия р53, р16, Ki-67. Экспрессия мутантного гена p53 выявлена в двух третях случаев изученных сарком Юинга, при этом уровень экспрессии р53 был низким за исключением одного наблюдения ПНЭО. Частая экспрессия продуктов гена р16, выявленная в настоящем исследовании соответствует данным FISH анализа, демонстрирующего редкую альтерацию данного гена. Необходимо отметить, что в одном наблюдении с р16 гомозиготной делецией, экспрессия протеина р16 оставалась высокой. Ki-67 широко используется в диагностических целях, в большинстве сарком Юинга/ПНЭО уровень пролиферации был умеренным и колебался от 2,4 до 48,8%.

Значение FISH и молекулярно-биологических исследований. ОТ-ПЦР считается наиболее часто используемым методом для выявления сливающихся транскриптов и специфических хромосомных разрывов, в том числе транслокаций. В настоящем исследовании наличие EWS/Fli-1 слияние определено в 5 наблюдениях сарком Юинга/ПНЭО. Во всех наблюдениях со слившимся геном, выявленным методом ОТ-ПЦР, обнаружена транслокация EWS локуса в положении 22q12 методом FISH. Тем не менее, в наблюдениях с отрицательными результатами, пролученными методом ОТ-ПЦР, cпецифическая транслокация была выявлена методом FISH. Результаты исследования указывают на более эффективное применение FISH по сравнению с ПЦР для выявления транслокации локуса EWS в положение 22q12 для рутинной диагностики. Другие исследованные опухоли не давали положительных результатов при использовании метода FISH.

Применение метода тканевых матриц позволяет стандартизировать все применяемые методики: иммуногистохимический метод и FISH. К недостаткам метода тканевых матриц можно отнести необходимость собирать несколько случаев для выполнения реакций, что резко снижает эффективность метода в рутинной диагностике. Кроме того, две зоны из одной и той же опухоли могут значительно различаться по гистологической структуре и не давать идентичных результатов.

Таким образом, результаты проведенного исследования показывают, что дифференциальный диагноз мелкокруглоклеточных опухолей остается трудной задачей и требует применения дополнительных исследований: иммуногистохимического, цитогенетического и молекулярно-биологического методов исследования.

Выводы

  1. Мультидисциплинарный подход, включающий сочетание клинических, рентгенологических и морфологических данных является высокоэффективным в диагностике костных опухолей. Трепанбиопсия дает положительный результат в 87% случаев, открытая биопсия в 92% случаев.
  2. Дифференциальная диагностика мелкокруглоклеточных опухолей костей на современном этапе включает комплекс морфологических, иммуногистохимических, цитогенетических и молекулярно-биологических методов, которые позволяют с высокой точностью поставить диагноз: саркома Юинга (цитогенетические изменения EWS/Fli-1, EWS-ERG), миелома (CD138, и легкие цепи), лимфома (комплекс Т и В клеточных маркеров), мезенхимальная хондросаркома (CD99 - для мелкоклеточного и S-100 - для хрящевого компонентов).
  3. Электронно-микроскопическое исследование выявляет диагностические ультраструктурные признаки при: гистиоцитозе (гранулы Birbeck), остеосаркоме (кристаллы гидроксиаппатита), дедифференцированной хондросаркоме (различное строение хрящевого и саркоматозного компонентов).
  4. Важную роль в прогнозе хондросаркомы имеет степень дифференцировки опухоли, а также уровень экспрессии ММP-9. Содержание белка ММP-9 40% в хондросаркомах следует считать прогностически неблагоприятным фактором безрецидивной и общей выживаемости.
  5. Выявлена зависимость между ранним развитием отдаленных метастазов и степенью дифференцировки остеосаркомы, выраженностью ее лечебного патоморфоза, размерами опухолевого узла, объемом некротизированной ткани, количеством митозов и наличием опухолевых эмболов в просвете кровеносных и лимфатических сосудов.
  6. Прогноз саркомы Юинга определяет выраженность лекарственного патоморфоза опухоли после неоадъювантной химиотерапии.
  7. Наиболее часто в остеосаркомах выявляли Bax (77,8%), EGFR (52,5%) и Flt-1/VEGFR1 Ab-1 (97,5%), в каждой третьей опухоли - Her-2/neu (32,5%), Cox-2 (32,3%), p53 (27,5%) и крайне редко - VEGF (15,0%). Экспрессия этих маркеров не обнаружена в контроле.
  8. Показатели экспрессии Bax, EGFR, Her-2/neu, VEGF, Flt-1/VEGFR1 Ab-1, Cox-2, p53 и не были связаны с основными клинико-морфологическими характеристиками заболевания (полом пациентов, степенью дифференцировки опухоли и ее локализацией в костях скелета, наличием отдаленных метастазов), однако в остеосаркомах более молодых больных достоверно чаще обнаруживали EGFR, Cox-2 и уровни экспрессии Bax 50%.
  9. Многофакторный анализ выявил достоверную связь показателей экспрессии Her-2/neu, р53 и Сox-2 в остеосаркомах больных с неблагоприятным прогнозом 5-летней общей выживаемости, а Her-2/neu и Сох-2 - с 3-летней безрецидивной выживаемостью, поэтому анализ экспрессии выше указанных маркеров в первичной опухоли следует учитывать при лечении больных остеосаркомой кости.
  10. В первичной опухоли у преобладающего числа больных хондросаркомой кости выявлена экспрессия матриксных металлопротеиназ и их ингибитора 1 типа: ММP-1 (84,6%), ММP-2 (71,8%), ММP-9 (97,4%), ТIМP-1 (82,3%), а уровни экспрессии выше указанных маркеров колебались от 10 до 60%. Экспрессия ММP и ТIМP-1 не обнаружена в доброкачественных хрящеобразующих опухолях.
  11. Наличие в хондросаркомах экспрессии ММP-1 указывает на неблагоприятное течение заболевания и достоверно связано с показателями безрецидивной и общей выживаемости больных, а Bax – с безрецидивной выживаемостью.

Список работ, опубликованных по теме диссертации

  1. Fibrocartilaginous mesenchymoma of bone // Am. J. Surg. Pathol.-1993.-Vol.17.-p.830-836 (Bulychova I.V., Unni K.K., Bertoni F., Beabout J.W.).
  2. Дедифференцированная хондросаркома // В материалах III съезда онкологов и радиологов СНГ (Минск, 25-28 мая 2004г.) // Минск.-2004.-с.269 (Булычева И.В.).
  3. Растворимая форма молекулы адгезии эндотелия сосудов типа 1 (sVCAM-1) и интерлейкин-6 при остеогенной саркоме и хондросаркоме кости // В материалах конференции «Национальные дни лабораторной медицины России-2005» (Москва, 11-14 октября 2005г.). Клиническая лабораторная диагностика.-2005.-№9.-с.23 (Руссо Е.Ю., Борисов Д.А., Соловьев Ю.Н., Булычева И.В., Лякина Л.Т.).
  4. Интерлейкин-6 и его растворимый рецептор у больных опухолями костей // Клиническая лабораторная диагностика.-2005.-№9.-с.22 (Кушлинский Н.Е., Соловьев Ю.Н., Бабкина И.В., Булычева И.В., Борисов Д.А.).
  5. Особенности продукции интерлейкина-6 у больных злокачественными и доброкачественными опухолями костей // В материалах II Международной конференции «Молекулярная медицина и биобезопасность» (Москва, 20-21 октября 2005г.).-М.-2005.-с.172 (Кушлинский Н.Е., Соловьев Ю.Н., Борисов Д.А., Кузнецов И.Н., Булычева И.В.).
  6. Фактор роста эндотелия сосудов в сыворотке крови больных остеогенной саркомой // В материалах IX Российского онкологического конгресса (Москва, 22-24 ноября 2005г.).-М.-2005.-с.154 (Кузнецов И.Н., Соловьев Ю.Н., Булычева И.В., Борисов Д.А., Руссо Е.Ю.).
  7. Особенности продукции интерлейкина-6 у больных злокачественными и доброкачественными опухолями костей // В материалах Международной конференции «Молекулярная медицина и биобезопасность» (Москва, 20-21 октября 2005г.).-М.-2005.-с.169 (Кушлинский Н.Е., Соловьев Ю.Н., Борисов Д.А., Кузнецов И.Н., Булычева И.В.).
  8. Soluble form of type 1 vascular edothelial cell adhesion molecule (sVCAM-1) in bone tumors // In abstract book 17th ICACT (17th International congress on anti-cancer treatment, Paris, 30th January – 2nd February, 2006).-Paris.-2006.-p.320 (Kuznetsov I.N., Kushlinsky N.E., Solovyev Yu.N., Russo Ye.Yu., Borisov D.A., Bulytcheva I.V.).
  9. Peculiarities of interleukin-6 production in patients with bone neoplasms // In abstract book 17th ICACT (17th International congress on anti-cancer treatment, Paris, 30th January – 2nd February, 2006).-Paris.-2006.-p.320 (Kushlinsky N.E., Borisov D.A., Solovyev Yu.N., Bulytcheva I.V.).
  10. Адамантинома длинных трубчатых костей // Архив патологии.-2006.-Том 68, №1.-с.14-19 (Махсон А.Н., Булычева И.В., Кузьмин И.В., Павленко Т.В.).
  11. Внутрисуставной хондроматоз // Архив патологии.-2006.-Том 68, №5.-с.28-30 (Булычева И.В., Семенова Л.А.).
  12. Оссифицирующая фибромиксоидная опухоль // Архив патологии.-2006.-Том 68, №2.-с.41-44 (Махсон А.Н., Булычева И.В., Кузьмин И.В.).
  13. Vascular endothelial growth factor (VEGF) in the sera of bone neoplasms’ patients // Preceedings of the 19th Annual Meeting of European Musculo-Skeletal Oncology Society (May 24-26, 2006, Moscow, Russian Federation) /J. of N.N.Bokhin Russian Cancer Research Center RAMS.-2006.-Vol.17, N.1.-p.29 (Kushlinsky N.E., Soloviev Yu.N., Kuznetsov I.N., Bulycheva I.V., Russo E.Yu., Borisov D.A., Aliev M.D.).
  14. Онкология (Под ред. В.И.Чиссова и С.Л.Дарьяловой). Опухоли опорно-двигательного аппарата // М.-Издательская группа «ГЕОТАР-Медиа».-2007.-с.269-282.
  15. Хондромиксоидная фиброма // Архив патологии.-2007.-Том 69, №2.-с.37-40 (Семенова Л.А., Булычева И.В.).
  16. Хондробластома // Архив патологии.-2007.-Том 69, №3.-с.53-56 (Булычева И.В., Семенова Л.А., Махсон А.Н., Жуков А.Г.).
  17. Хондромы (энхондрома, периостальная хондрома, энхондроматоз) // Архив патологии.-2007.-Том 69, №5.-с.45-48 (Семенова Л.А., Булычева И.В.).
  18. Аномальная (причудливая) паростальная остеохондроматозная пролиферация (болезнь Нора) // Архив патологии.-2008.-Том 70, №5.-с.35-38 (соавт. Махсон А.Н., Булычева И.В., Кузьмин И.В.).
  19. Хондросаркома гортани // Архив патологии.-2007.-Том 69, №6.-с.50-52 (Буланов Д.В., Семенова Л.А., Махсон А.Н., Булычева И.В.).
  20. Хондросаркома костей: клинико-морфологическое сопоставление // Архив патологии.-2008.-Том 70, №5.-с.51-56 (Булычева И.В., Махсон А.Н., Кузьмин И.В., Абрамович М.С., Искиндирова А.К.).
  21. Мелкокруглоклеточные опухоли костей и мягких тканей (саркома Юинга/PNET), основные критерии морфологической и дифференциальной диагностики. В материалах научно-практической конференции травматологов-ортопедов России с международным участием «Актуальные проблемы костной патологии у детей и взрослых» (Москва, 23-24 апреля 2008г.) // М.-2008.-с.48-50 (Буланов Д.В., Булычева И.В., Махсон А.Н.).
  22. Практические вопросы хирургической патологии костных опухолей. В материалах научно-практической конференции травматологов-ортопедов России с международным участием «Актуальные проблемы костной патологии у детей и взрослых» (Москва, 23-24 апреля 2008г.) // М.-2008.-с.50-51.
  23. Остеосаркомы костей. Вопросы классификации и прогноз. В материалах научно-практической конференции травматологов-ортопедов России с международным участием «Актуальные проблемы костной патологии у детей и взрослых» (Москва, 23-24 апреля 2008г.) // М.-2008.-с.68-69 (Главацкий С.В., Казачок И.В., Павленко Т.В., Булычева И.В., Махсон А.Н.).
  24. Паратиреоидная остеодистрофия. Ошибки и трудности диагностики. В материалах научно-практической конференции травматологов-ортопедов России с международным участием «Актуальные проблемы костной патологии у детей и взрослых» (Москва, 23-24 апреля 2008г.) // М.-2008.-с.66-68 (Главацкий С.В., Жуков А.Г., Новожилова Е.Н., Павленко Т.В., Булычева И.В., Махсон А.Н.).
  25. New approaches in the diagnosis of small-cell round tumors of bone and soft tissue // Ark. Path.-2009.-Vol.71, N.1.-p.34-40 (Petrov S.V., Machado I., Boulycheva I., Noguera R., Pellin A., Bacchini P., Bertoni F., Llombart-Bosch A.)
  26. Дедифференцированная хондросаркома // Архив патологии.-2009.-Том 71, №1.-с.46-52 (Булычева И.В., Махсон А.Н., Кузьмин И.В., Павленко Т.В.).
  27. Факторы роста фибробластов (первого и второго типа) и плацентарный фактор роста в сыворотке крови больных первичными опухолями костей // Вопросы биологической, медицинской и фармацевтической химии.-2009.-№4.-с.34-36 (Кушлинский Н.Е., Осипов Д.В., Бабкина И.В., Соловьев Ю.Н., Булычева И.В., Мачак Г.Н., Алиев М.Д.).
  28. Type 1 and 2 fibroblast growth factors in blood sera of patients with bone tumors In abstract book 37th International Society of Oncology and Biomarkers (Amsterdam, Netherlands, September 27-30, 2009).-2009.-p.94 (Babkina I.V., Osipov D.V., Bulycheva I.V., Machak G.N., Solovyev Yu.N., Alieyev M.D.).
  29. Хондрома мягких тканей // Архив патологии.-2009.-том 71, №2.-с.29-30 (Булычева И.В., Махсон А.Н., Кузьмин И.В., Денисов К.А.).
  30. Эндостатин, плацентарный фактор роста и факторы роста фибробластов первого и второго типа в сыворотке крови больных первичными опухолями костей // Бюлл. Экспер. Биол. Мед.-2009.-том 148, №8.-с.218-222 (Бабкина И.В., Осипов Д.А., Соловьев Ю.Н., Булычева И.В., Мачак Г.Н., Алиев М.Д., Кушлинский Н.Е.).
  31. Критерии диагностики доброкачественных, пограничных и злокачественных хрящевых опухолей костей (иммуногистохимическое исследование) / Труды научно-практической конференции «Лабораторная медицина в свете Концепции развития здравоохранения России до 2020 года» (Москва, 28-30 сентября 2009г.) // М.-«Лабора».-2009.-с.31-32 (Булычева И.В., Савелов Н.А., Искиндирова А.К., Махсон А.Н.).
  32. Тканевой ингибитор матриксных металлопротеиназ 1 типа (ТИМП-1) в сыворотке крови больных первичными опухолями костей / Труды научно-практической конференции «Лабораторная медицина в свете Концепции развития здравоохранения России до 2020 года» (Москва, 28-30 сентября 2009г.) // М.-«Лабора».-2009.-с.28-29 (Бабкина И.В., Герштейн Е.С., Кушлинский Н.Е., Соловьев Ю.Н., Булычева И.В., Мачак Г.Н., Алиев М.Д.).
  33. Факторы роста фибробластов 1 и 2 типа в сыворотке крови больных опухолями костей / Труды научно-практической конференции «Лабораторная медицина в свете Концепции развития здравоохранения России до 2020 года» (Москва, 28-30 сентября 2009г.) // М.-«Лабора».-2009.-с.40-41 (Осипов Д.В., Бабкина И.В., Соловьев Ю.Н., Булычева И.В., Алиев М.Д., Кушлинский Н.Е.).
  34. Молекулярно-биологические маркеры в сыворотке крови больных первичными опухолями костей // Саркомы костей, мягких тканей и опухоли кожи.-2009.-№1.-с.79-82 (Кушлинский Н.Е., Бабкина И.В., Соловьев Ю.Н., Булычева И.В., Мачак Г.Н.).
  35. Тканевой ингибитор матриксных металлопротеаз 1 типа в сыворотке крови больных опухолями костей // В материалах Международной конференции «Молекулярная медицина и биобезопасность» (Москва 10-11 ноября 2009г.).-М.-ММА им. Сеченова И.М.-2009.-с.38-40 (Бабкина И.В., Герштейн Е.С., Осипов Д.В., Короткова Е.А., Булычева И.В., Мачак Г.Н., Руссо Е.Ю., Кушлинский Н.Е., Алиев М.Д.).
  36. Фактор роста эндотелия сосудов и его растворимые формы рецепторов в сыворотке крови больных первичными саркомами костей // Вопросы биологической, медицинской и фармацевтической химии.-2009.-№6.-с.18-20 (Березов Т.Т., Кузнецов И.Н., Кушлинский Н.Е., Соловьев Ю.Н., Булычева И.В., Бабкина И.В., Дворова Е.К., Мачак Г.Н., Алиев М.Д.).
  37. Матриксные металлопротеиназы 2, 7, 9 и тканевой ингибитор матриксных металлопротеиназ 1-го типа в сыворотке крови больных опухолями костей // Бюлл. Экспер. Биол. Мед.-2010.-том 149, №2.-с.194-196 (Кушлинский Н.Е., Соловьев Ю.Н., Бабкина И.В., Герштейн Е.С., Булычева И.В.).
  38. Экспрессия матриксных металлопротеиназ 1, 2, 9 и их тканевого ингибитора 1-го типа в хрящеобразующих опухолях костей // Бюлл. Экспер. Биол. Мед.-2010.-том 149, №3.-с.317-322 (Булычева И.В., Кушлинский Н.Е., Дворова Е.К., Казачок И.В., Махсон А.Н.).
  39. Экспрессия молекулярных маркеров в опухоли и прогноз выживаемости при остеосаркоме // Бюлл. Экспер. Биол. Мед -2010.-том 150, №8.-с.202-207 (И.В.Булычева, Ю.Н.Соловьев, Н.Е.Кушлинский, А.Н.Махсон).
  40. Экспрессия молекулярно-биологических маркеров в остеосаркомах костей // Вопросы биологической, медицинской и фармацевтической химии.-2011.-№2.-с.78-82. (И.В.Булычева, Ю.Н.Соловьев, Н.Е.Кушлинский, И.В.Казачок, А.Н.Махсон).
  41. Матриксные металлопротеиназы 1, 2, 9 в хрящеобразующих опухолях костей // Вопросы биологической, медицинской и фармацевтической химии.-2010.-№10.-с.59-64 (И.В.Булычева, Н.Е.Кушлинский, Ю.Н.Соловьев, А.К.Искиндирова, И.В.Казачок, Е.К.Дворова, А.Н.Махсон).
  42. Фактор некроза опухолей А (TNF-A) в сыворотке крови больных опухолями костей // В материалах XVII Российского национального конгресса «Человек и лекарство» (Москва, 12-16 апреля 2010г.).-М.-2010.-с.36 (Бабкина И.В., Соловьев Ю.Н., Тен Е.А., Булычева И.В.).





© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.