WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

СТАХЕЕВА МАРИНА НИКОЛАЕВНА

РОЛЬ ИММУННОЙ СИСТЕМЫ В ПАТОГЕНЕЗЕ РАКА МОЛОЧНОЙ ЖЕЛЕЗЫ ПРИ КОМБИНИРОВАННОМ ЛЕЧЕНИИ

14.03.03 патологическая физиология

14.01.12 онкология

АВТОРЕФЕРАТ

Диссертации на соискание ученой степени

доктора медицинских наук

Томск - 2011

Работа выполнена в учреждении Российской академии медицинских наук научно-исследовательском институте онкологии СО РАМН

Научные консультанты:

доктор биологических наук, профессор                Чердынцева Надежда Викторовна

 

доктор медицинских наук, профессор                Слонимская Елена Михайловна

Официальные оппоненты:

доктор медицинских наук                                Скурихин Евгений Германович 

доктор медицинских наук, профессор,

заслуженный деятель науки РФ                        Ветлугина Тамара Парфеновна 

доктор медицинских наук, профессор                Дыхно Юрий Александрович

Ведущая организация:  учреждение Российской академии наук Институт иммунологии и физиологии Уральского отделения РАН, г. Екатеринбург

Защита состоится «____»_____________________2011 г. в_____часов на заседании диссертационного совета  Д 001.031.01 при учреждении Российской академии медицинских наук научно-исследовательском институте фармакологии СО РАМН (634028, г. Томск, пр. Ленина, 3).

С диссертацией можно ознакомиться в библиотеке учреждения Российской академии медицинских наук НИИ фармакологии СО РАМН.

Автореферат разослан «____»_________________________2011 г.

Ученый секретарь

диссертационного совета,

доктор биологических наук  Амосова Е.Н.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность проблемы: Вопрос участия иммунной системы в патогенезе злокачественных новообразований стоит перед исследователями с момента открытия феномена иммунного ответа. Несмотря на богатый феноменологический материал [Барышников А.Ю., 2007, Бережная Н.М., Чехун В.М., 2005, Кадагидзе З.Г., 2005, Schirrmacher V. et al., 2002, Ben-Baruch A., 2003, Kurtenkov O. et al., 2005, DeNardo D.G., Coussens L.M., 2007, Curiel T.J., 2007 T.J., 2007, Swann J.B., Smyth M.J., 2007, DeNardo D.G. et al. 2008, Hornychova H. et al., 2008, Standish L. et al. 2008, Gobert M., 2009, Nicolini A., Carpi A., 2009, Zitvogel L. et al., 2008, Bacacs T., Mehrishi J., 2010 и пр.] до настоящего времени суждения о роли иммунной системы в патогенезе большинства солидных злокачественных новообразований носят противоречивый характер [Swann J.B., Smyth M.J., 2007 Curiel T.J., 2007 T.J., 2007, Nicolini A., Carpi A., 2009]. С чем связана такая неоднозначная позиция в оценке влияния иммунной системы на опухолевый рост?

Во-первых, эволюционно взаимоотношения иммунной системы и опухоли складываются как амбивалентные [Бережная Н.М., Чехун В.М., 2005]. Активность иммунной системы в отношении злокачественных клеток находит выражение в реализации, как минимум, двух вариантов развития событий – элиминации опухоли или содействии ее росту и прогрессии [Ben-Baruch A., 2003, Nicolini A., Carpi A., 2009, Curiel T.J., 2007 T.J., 2007, Swann J.B., Smyth M.J., 2007]. Наличие противоопухолевой активности у иммунной системы при раке молочной железы (РМЖ) подтверждается тем, что снижение количества или функциональности специализированных эффекторов связано с более тяжелым клиническим течением заболевания, низкой эффективностью лечения и худшими показателями выживаемости. Подобная взаимосвязь показана как в отношении механизмов врожденного (NK-клетки, естественные антитела, полиморфизм генов TLR4) [Kurtenkov O. еt al., 2005, Zitvogel L. еt al., 2008], так и адаптивного иммунного ответа [Hornychova H.et al., 2008, Schirrmacher V.et al., 2002].  

Однако противоопухолевая активность иммунной системы во многих случаях неэффективна в результате ускользания опухоли из-под иммунологического контроля [Антонов В.Г., Козлов В.К., 2004, Curiel T.J., 2007 T.J., 2007, Swann J.B., Smyth M.J., 2007, Nicolini A., Carpi A., 2009]. При этом важное значение имеют механизмы толерантности, осуществляемые иммунной системой в отношении новообразования, возникающего, как известно, из клеток организма-хозяина. Среди наиболее важных супрессорных эффекторов следует отметить  T-регуляторные клетки и цитокины IL-10 и TGF- [Кадагидзе З.Г., 2005, Curiel T.J., 2007 T.J., 2007, Gobert M., 2009].

Способствующую опухолевой прогрессии активность иммунной системы у больных РМЖ, в основном, связывают с механизмами хронического воспаления, реализация которого обеспечивается продукцией широкого спектра факторов, содействующих инвазии, неоангиогенезу и метастазированию опухоли. Эти процессы обусловлены функционированием макрофагов 2 типа, формированием Th2-зависимого иммунного ответа, нарушением баланса про- и противовоспалительных цитокинов, хемокинов [Ben-Baruch A., 2003, DeNardo D.G., Coussens L.M., 2007, DeNardo D.G. еt al. 2008, Standish L. еt al. 2008]. При этом иммунная система активна, и ее функционирование направлено на создание условий для поддержания опухоли.

Современная концепция иммунологического редактирования злокачественного роста рассматривает эти состояния – контроль опухолевого роста иммунной системой, равновесие между активностью опухоли и иммунной системой и избегание опухолью иммуно-опосредованных защитных механизмов со стороны хозяина – как смену последовательных фаз [Swann J.B., Smyth M.J., 2007]. При этом предполагается, что иммунная система также последовательно меняет функциональную направленность от противоопухолевой к проопухолевой по мере генерализации процесса [Балдуева И.А.,

Семиглазов В.Ф., 1996], что подразумевает определенную детерминированность

состояния иммунной системы в зависимости от распространенности опухолевого процесса [Гранов А.М., Молчанов О.Е., 2008] и невозможность ее изменения.

Вторым аспектом, не позволяющим однозначно определить роль иммунной системы в патогенезе злокачественно роста, является множественность  механизмов взаимо(противо)действия опухоли и иммунной системы [Swann J.B., Smyth M.J., 2007, Nicolini A., Carpi A., 2009]. Большинство исследований направлено на выявление какого-либо одного ключевого механизма, определяющего про- или противоопухолевое действие иммунной системы. К настоящему времени сменилось несколько основных претендентов на место ключевого механизма: фагоциты, цитотоксические Т-лимфоциты, лимфокин-активированные лимфоциты, NK, интерфероны как противоопухолевые эффекторы, с одной стороны [Kurtenkov O. еt al., 2005, Zitvogel L. еt al., 2008, Hornychova H. et al., 2008, Schirrmacher V. et al., 2002], и опухолеассоциированные макрофаги, Т-регуляторные клетки, миелоидные супрессоры, провоспалительные цитокины как факторы содействия опухолевому росту, с другой стороны [Ben-Baruch A., 2003, DeNardo D.G., Coussens L.M., 2007, DeNardo D.G. еt al. 2008, Standish L. еt al. 2008]. Однако, само обилие выявляемых механизмов определенно указывает на существование многочисленных путей, направленных как на взаимо-, так и противодействие опухоли и иммунной системы. В каждую фазу взаимодействия одновременно функционируют механизмы той и другой направленности. Эффективное преобладание одной из них определяет общую стратегию иммунной системы. При изменении внешних или внутренних условий механизм, доминирующий на каком-либо этапе «естественной истории опухоли», может утратить свою значимость [Swann J.B., Smyth M.J., 2007], и тогда  возможно обращение фазы взаимодействия «опухоль-организм».

Следующая причина неоднозначности в оценке роли иммунной системы в патогенезе злокачественных новообразований заключена в том, что влияние иммунной системы на опухолевый процесс рассматривают преимущественно на уровне эффектов непосредственно в опухолевом микроокружении [Ben-Baruch A., 2003, DeNardo D.G., Coussens L.M., 2007, DeNardo D.G. еt al., 2008,]. Иммунная система является одной из ключевых для поддержания гомеостаза организма и осуществляет жизненно важные функции, такие как обеспечение адаптации, естественной резистентности, противоинфекционной защиты, регуляции кроветворения и иммунопоэза, регенераторных возможностей [Абрамов В.В., Абрамова Т.Я., 1996, Гольдберг Е.Д. и др., 1996, Корнева Е.А., 2003,Чередеев А.Н., Ковальчук Л.В., 1997, Сепиашвили Р.И. и др., 2000, Ширинский В.С. и др., 2000, Юшков Б.Г. и др., 2010]. Вследствие этого иммунная система способна оказывать воздействие на злокачественный процесс опосредованно, изменяя клинический статус пациента. Системный принцип организации требует оценки морфофункционального состояния иммунной системы как комплекса взаимосвязанных разнонаправленных функций, осуществляемых ею в целом на разных уровнях функционирования [Li Y. еt al., 2008]. 

Не вызывает сомнений, что функции иммунной системы в существенной мере определяются генотипом организма. Индивидуальные различия связаны с нормальной генетической изменчивостью – полиморфизмом вовлеченных в функционирование иммунной системы генов, среди которых важное значение имеют гены основных медиаторов межклеточных взаимодействий – цитокинов [Баранов В.С., 2000, de Jong M., 2002, Wai C.T., 2003, Ben-Ari Z., 2003.]. На функциональную компетентность иммунной системы онкологического больного, наряду со злокачественным процессом и генетическими вариациями, также может влиять наличие иммунопатологических синдромов инфекционно-аллергической или аутоиммунной природы, приобретенных в онтогенезе [Swann J.B., Smyth M.J., 2007].

В настоящее время комбинированное противоопухолевое лечение является стандартом для большинства злокачественных новообразований. Лечение больных с операбельными формами РМЖ включает сочетанное или последовательное применение различных методов воздействия на опухоль с целью удаления первичного узла (неоадьювантная цитостатическая терапия, оперативное удаление опухоли) и профилактики метастазов (адьювантная химио-, радио- или гормонотерапия). Противоопухолевое лечение оказывает выраженное влияние как на опухоль, так и на организм, в связи с чем его следует позиционировать как фактор патогенеза [Zitvogel L. et al., 2008]. Рассматривая воздействие проводимого лечения на иммунную систему, можно выделить два аспекта. Первый аспект заключается в том, что цитостатические средства способны модифицировать ответ иммунной системы на злокачественное новообразование. В частности, под влиянием ряда химиопрепаратов селективно удаляются клоны клеток, обладающих иммуносупрессивной активностью. Транзиторная лимфопения, вызываемая цитостатическим лечением, приводит к индукции гомеостатической пролиферации иммунокомпетентных клеток [Zagozdzon R. et al, 2001, Ehrke M.J., 2003, Ostrand-Roseberg S. et al., 2004, Carson W.E., 2004,  Lutsiak M.E. et al., 2005, Suzuki E.., 2005]. Второй аспект связан с вовлечением механизмов иммунной системы как необходимого звена в реализацию эффектов цитостатического лечения [Apetoh L. et al., 2007, Zitvogel L. et al., 2008]. Недавно появились доказательства, вскрывающие механизм вовлечения эффекторов естественной резистентности в опухолевый надзор. Показано, что индукция сигнального пути в ответ на повреждение ДНК в клетке под влиянием экзогенных и эндогенных генотоксических агентов  приводит к экспрессии NKG2D лигандов, которые распознаются натуральными клетками-киллерами (NK) и / Т-лимфоцитами, что приводит к запуску эффекторного NK, NKT и Т-клеточного ответа на трансформированные клетки [Bauer S. et al., 1999, Gasser S. et al., 2005]. Хроническая активация этого ответа, а также индукция  еще целого ряда стресс-индуцированных молекул в опухолях при воздействии цитостатических агентов может вносить вклад в распознавание и уничтожение опухолевых клеток в процессе химиотерапии [Бережной А.Е. и др., 2008].

Амбивалентный характер взаимодействия иммунной системы с опухолью, множественность, разнонаправленность и динамичность этих путей, системный принцип функционирования позволяют употребить термин «стратегия функционирования иммунной системы» при осуществлении ею программы сдерживания опухолевого роста или содействия ему. При этом объективным клиническим критерием направленности стратегии может выступать наличие или отсутствие прогрессирования заболевания.

Именно разнородность критериев оценки влияния иммунной системы на  опухолевый процесс следует отметить в качестве еще одного объяснения неоднозначности сведений о ее роли в регуляции опухолевой прогрессии. Очевидно, что для корректного подтверждения участия иммунной системы в патогенезе онкологического заболевания необходимо при формировании групп сравнения нивелировать воздействие основных патогенетически значимых факторов злокачественного роста, которые по сути выступают  стандартными критериями оценки прогноза клинического течения заболевания, и включают в себя распространенность процесса, биологические характеристики злокачественных клеток, а также клинико-анамнестические особенности пациента и мероприятия проведенного противоопухолевого лечения [Божок А.А. и др., 2005, Perou C.M. et al., 2000].

Таким образом, для адекватной оценки роли иммунной системы в патогенезе РМЖ следует учесть все выше перечисленные моменты. Стратегию иммунной системы следует оценивать на системном уровне функционирования, т.е. как интегрированного целого, включающего в себя весь комплекс осуществляемых ею на разных уровнях функций. Для классификации про- или противоопухолевой стратегии, реализуемой иммунной системой у больных РМЖ, ее состояние должно быть исследовано во взаимосвязи с клинически подтвержденным исходом, а именно, благоприятным (без признаков прогрессирования) или неблагоприятным (прогрессирование, основным фатальным  проявлением которого является гематогенное метастазирование). При этом должна быть обеспечена релевантность групп сравнения по основным патогенетическим характеристикам процесса, влияющим на исход заболевания. Следует учитывать, что условия,  в которых происходит формирование про- или противоопухолевой стратегии иммунной системы обеспечиваются в совокупности свойствами организма, опухоли и применяемых средств и методов лечения. Поскольку противоопухолевое лечение позиционируется как значимый фактор патогенеза РМЖ, оценку направленности стратегии иммунной системы необходимо проводить на каждом из основных этапов лечебных мероприятий. Комплексный подход, включающий клинические и экспериментальные исследования, а также адекватный аппарат математической обработки больших массивов данных предоставили возможность изучить роль иммунной системы в патогенезе РМЖ на этапах комбинированного лечения и ее влияние на исход заболевания.

  Цель исследования: Патогенетическое обоснование различных стратегий иммунной системы, сопряженных с особенностями клинического течения и исходом рака молочной железы (без прогрессирования, различные типы прогрессирования), и исследование механизмов про- и противоопухолевой направленности функционирования иммунной системы у больных РМЖ при проведении комбинированного лечения.

  Задачи исследования:

  1. Обосновать методологический подход для исследования роли иммунной системы в патогенезе РМЖ.
  2. Оценить взаимосвязь состояния иммунной системы как интегрированного целого с характером клинического течения и исходом РМЖ.
  3. Исследовать механизмы, лежащие в основе про- и противоопухолевой стратегии, реализуемой иммунной системой у больных РМЖ до начала и на этапах специфического лечения.
  4. Исследовать структуру факторов, определяющих различия в состоянии иммунной системы у больных РМЖ при проведении противоопухолевого лечения.
  5. Исследовать роль генетической регуляции на основе оценки полиморфизма патогенетически значимых генов в формировании про- и противоопухолевой стратегии иммунной системы у больных РМЖ.
  6. Исследовать влияние противоопухолевого лечения на состояние иммунной системы у больных РМЖ и оценить возможность изменения направленности функционирования (противоопухолевая или опухолестимулирующая стратегия) в процессе проводимых лечебных мероприятий.
  7. Исследовать вовлечение механизмов иммунной системы в обеспечение различий в клиническом течении РМЖ в условиях применения препарата с адаптогенным действием.
  8. Оценить информативную значимость оценки состояния иммунной системы до начала, во время проведения и после завершения комбинированного лечения в качестве дополнительного критерия прогноза клинического течения и исхода РМЖ.

  Научная новизна. Создана и апробирована оригинальная модель оценки состояния иммунной системы на системном уровне функционирования. Модель основана на представлении состояния иммунной системы как многомерного наблюдения и его визуализации в пространстве многомерных признаков.

Впервые получены данные о различии в состоянии иммунной системы у больных РМЖ в зависимости от клинического течения и исхода заболевания при соблюдении принципа релевантности стандартных, патогенетически значимых признаков злокачественного процесса и проводимого противоопухолевого лечения в сравниваемых группах, что свидетельствует об участии системы иммунитета в патогенезе данного заболевания  и  влиянии на его исход.

Показано, что важную роль в изменении стратегии функционирования иммунной системы у больных РМЖ играет осуществляемое противоопухолевое лечение. Получены приоритетные данные, указывающие на динамичность состояния иммунной системы у больных РМЖ на различных этапах комбинированного лечения. Выявлено, что иммунная система в условиях противоопухолевой терапии способна изменить состояние от содействующего опухолевому процессу (проопухолевая стратегия) к обеспечивающему длительную клиническую ремиссию (противоопухолевая стратегия).

В условиях in vitro при воздействии апоптоз-индуцирующих агентов, таких как моноклональные антитела к CD95 для индукции Fas-опосредованного апоптоза, моноклональные антитела к CD3 для индукции активационного апоптоза и цитостатического препарата вепезида, оценены показатели клеточной гибели и связанных с этим механизмов активации и пролиферации мононуклеарных клеток периферической крови. Показаны существенные различия в свойствах клеток периферической крови групп пациентов с разным исходом заболевания: возможность благоприятного исхода РМЖ связана не столько с устойчивостью клеток иммунной системы к индукции клеточной гибели, сколько с пролиферативной активностью и способностью восстанавливать количественные потери, т.е. с механизмами гомеостатической пролиферации при проведении цитостатического лечения.

Впервые показано, что морфофункциональное состояние иммунной системы у больных РМЖ до начала лечения и через 1 год после его завершения формируется, в основном, под влиянием особенностей организма (генотип, адаптационный статус, иммунопатологические состояния), в процессе лечения – под влиянием опухолевого процесса (стадия, степень злокачественности). Влияние схемы, режима и  объема проведенного лечения на состояние иммунной системы пациенток сохраняется после его завершения.

Впервые на основе оценки широкого спектра морфофункциональных показателей иммунной системы, характеризующих ее эффекторный и регуляторный потенциал, показано различие организации внутрисистемных процессов ее функционирования в зависимости от особенностей клинического течения злокачественного процесса. Получены новые данные о генетической компоненте регуляции функционирования иммунной системы у больных РМЖ, при этом структура регуляторного паттерна «ген-эффект» изменяется в зависимости от характера воздействий, применяемых на этапах противоопухолевого лечения.

Выявлено, что уровень продукции цитокинов у больных РМЖ до лечения находится под преобладающим влиянием генов провоспалительных цитокинов. На этапе неоадъювантной химиотерапии (НАХТ) регуляция продукции цитокинов зависит от генов CCR5, р53 и TGF-. После завершения лечения наибольшее значение имеет ген противовоспалительного цитокина IL-10.

Показано, что использование препарата рекомбинантного IL-1 беталейкина у больных РМЖ приводит к улучшению адаптационного статуса в процессе противоопухолевого лечения и увеличению периода безрецидивной выживаемости у пациенток с выраженной лимфогенной распространенностью процесса N2 (патент на изобретение № 2304445 «Средство, обладающее адаптогенным действием, и Способ подготовки больных раком молочной железы к проведению специфического противоопухолевого лечения  с включением полихимиотерапии»). При этом эффект применения беталейкина связан с его влиянием на состояние иммунной системы.

  Практическая значимость. Предложен инструмент интегральной оценки состояния иммунной системы у больных РМЖ как содействующего опухолевой прогрессии, либо как сдерживающего опухолевый рост. Использование предложенного подхода позволяет осуществлять прогноз клинического течения РМЖ до начала, во  время проведения и после завершения комбинированного лечения (положительное решение  по заявке № 2010129630 от 3.05.2011, приоритет от 15. 07. 2010, «Способ прогнозирования гематогенного метастазирования у больных раком молочной железы, основанный на оценке состояния иммунной системы при проведении противоопухолевого лечения»).

  Показана потенциальная возможность регуляции состояния

иммунной системы проведением комбинированного лечения с целью влияния на характер клинического течения РМЖ и индивидуализации противоопухолевых мероприятий. Обоснована возможность использования препаратов, обладающих адаптогенным действием, для регуляции состояния иммунной системы на этапах противоопухолевого лечения.

  Полученные данные свидетельствуют о целесообразности оценки состояния иммунной системы на этапах противоопухолевого лечения и динамического наблюдения для прогноза клинического течения РМЖ, риска прогрессирования заболевания, а также для адекватного назначения методов и средств иммунокоррекции. Полученные данные являются основой для валидации параметров, необходимых для адекватной оценки состояния иммунной системы у больных РМЖ на каждом из этапов противоопухолевого лечения и динамического наблюдения.

  Основные положения, выносимые на защиту:

  1. При РМЖ существуют различные варианты функционирования иммунной системы, патогенетически связанные с характером клинического течения и исходом заболевания. Про- или противоопухолевая стратегия иммунной системы при РМЖ реализуется на системном уровнем ее функционирования и представляет собой комплекс взаимосвязанных механизмов, действующих на разных уровнях организации системы.
  2. Стратегическая направленность функционирования иммунной системы при РМЖ формируется в результате взаимодействия генетически детерминированных и  функциональных параметров организма, клинико-патологических характеристик  опухолевого процесса. Вариабельность иммунологических параметров у больных РМЖ, определяющая морфофункциональные возможности системы,  до начала противоопухолевого лечения и через 1 год после его завершения, в основном, связана с индивидуальными особенностями организма (генотипические вариации в продукции патогенетически значимых цитокинов, морфофункциональная асимметрия, адаптационный статус, иммунопатологические состояния), на этапах противоопухолевого лечения – с параметрами опухолевого процесса (стадия, биологические свойства опухолевых клеток).
  3. Состояние иммунной системы при РМЖ динамично: проведение специфического лечения (неоадъювантная химиотерапия, оперативное удаление первичной опухоли) способствует изменению проопухолевой стратегии иммунной системы на противоопухолевую. Механизмы, определяющие стратегию функционирования иммунной системы у больных РМЖ, связаны с характером воздействий, осуществляемых на этапах специфического лечения.
  4. Оценка состояния иммунной системы у больных РМЖ на этапах противоопухолевого лечения и динамического наблюдения может быть использована в качестве дополнительного критерия прогноза клинического течения РМЖ, риска прогрессирования заболевания, а также для адекватного назначения методов и средств иммунокоррекции.

Апробация работы. Материалы диссертационной работы доложены и обсуждены на Всероссийской конференции, посвященной памяти и 95-летию со дня рождения В.А.Пегеля (Томск, 2001), Всероссийской конференции «Компенсаторно-приспособительные процессы: фундаментальные и клинические аспекты» (Новосибирск,  2002),  Обществе онкологов в (Томск 2003, 2005, 2007) на Объединенном Иммунологическом Форуме (Екатеринбург, 2004), на VIII, IX, XI Всероссийском научном

форуме с международным участием «Дни иммунологии в Санкт-Петербурге» (С-Петербург, 2004, 2005, 2007), Всероссийской научно-практической конференции «Дни иммунологии в Сибири» (Красноярск, 2006), республиканской научной конференции

«Создание новых лекарственных препаратов» (Томск, 2007), научной

конференции с международным участием «Дни иммунологии в Сибири — 2008» (Томск, 2008),  Четвертой всероссийской научно-практической конференции с международным участием «Фундаментальные аспекты компенсаторно-приспособительных процессов» (Новосибирск, 2009), Российской научно-практической конференции с международным участием «Проблемы современной онкологии» (Барнаул, 2009), Всероссийской научной конференции «Молекулярно-генетические основы функционирования цитокиновой сети в норме и при патологии» (Новосибирск, 2010), Siberian-Taiwan Forum: Tomsk Region and Taiwan: Experience of Scientific – Technical and Innovation Cooperation, 16-17 September (Tomsk, 2009), International conference “Tumor and host: novel aspects of old problem” (Kyiv, 2010).

  Публикации. По материалам диссертации опубликовано 73 работы, в том числе 16 – в центральных журналах, рекомендованных “Перечнем…” ВАК Минобрнауки, 2 в зарубежной печати. Получен патент на изобретение № 2304445 «Средство, обладающее адаптогенным действием, и Способ подготовки больных раком молочной железы к проведению специфического противоопухолевого лечения  с включением полихимиотерапии» (заявлено 20.10.2004, опубликовано 20.08.2007, Бюл. № 23). Получено положительное решение по заявке № 2010129630 от 3.05.2011 (приоритет от 15. 07. 2010) на изобретение «Способ прогнозирования гематогенного метастазирования у больных раком молочной железы, основанный на оценке состояния иммунной системы при проведении противоопухолевого лечения».

  Внедрение результатов исследования. Выявленные критерии прогноза клинического течения РМЖ на основании оценки состояния иммунной системы внедрены для практического применения в лаборатории иммунологии и отделении общей онкологии НИИ онкологии СО РАМН. Результаты исследования используются в учебном процессе для преподавания раздела иммунологии  опухолевого роста на кафедре иммунологии и аллергологии ГОУ ВПО СибГМУ.

Объем и структура работы. Диссертация изложена на 377 страницах машинописного текста и состоит из введения, восьми глав, включающих обзор литературы, материалы и методы исследования, шести глав с изложением собственных результатов, заключения, выводов, списка цитируемой литературы, содержащего 412  источника, из них 98 российских, 314 иностранных. Работа иллюстрирована 65 таблицами и  23 рисунками.

МАТЕРИАЛ И МЕТОДЫ ИССЛЕДОВАНИЯ

В настоящую работу включены наблюдения за 430 больными с впервые установленным РМЖ, стадии T1-4N0-3M0, находившимися на лечении в отделении общей онкологии НИИ онкологии СО РАМН г. Томска с 1999 по 2009 гг. Диагноз рака молочной железы в каждом случае установлен на основании данных клинического, маммографического и ультразвукового методов обследования и верифицирован морфологически в соответствии с «Гистологической классификацией опухолей молочной железы» (ВОЗ, Женева, 2003). Критериями исключения из исследования являлись признаки гематогенного метастазирования РМЖ на этапе установления диагноза.

Все больные прошли курс противоопухолевого лечения. Предоперационное лечение включало проведение 2 - 4 курса НАХТ по схемам: CMF (5-фторурацил 600 мг/м2 в/в в 1, 8 дни, метотрексат по 40 мг/м2 в/в в 1, 8 дни, циклофосфан по 100 мг/м2 в/м с 1 по 14 дни); FAC (5-фторурацил 500 мг/м2 в/в в 1 и 8 день, адриамицин 50 мг/м2 в/в в 1 день; циклофосфан 500 мг/м2 в/в в 1 и 8 день); CAF (адриамицин 30 мг/м2 в/в в 1, 8 дни, 5-фторурацил 500 мг/м2 в/в в 1, 8 дни, циклофосфан по 100 мг/м2 в/м с 1 по 14 дни). Хирургическое вмешательство выполнялось через 7-14 дней после окончания НАХТ в объеме радикальной мастэктомии, радикальной резекции или секторальной резекции с аксиллярной лимфаденэктомией. В послеоперационном периоде по показаниям проводилась адъювантная химиотерапия по стандартным схемам CMF, CAF, FAC, лучевая и гормональная терапия.

В соответствии с поставленными задачами были выделены 3 основные группы исследования (таблица 1).

  Первая основная группа: Исследование состояния иммунной системы и выявление факторов, определяющих вариабельность иммунологических показателей на этапах противоопухолевого лечения и динамического наблюдения, выполнено у 198 больных. При изучении взаимосвязи состояния иммунной системы с характером клинического течения РМЖ первая основная группа была разделена на 2 подгруппы, иммунологические показатели которых составили обучающую (75 пациенток) и обучаемую (123 больные) выборки. Целью формирования обучающей выборки была процедура визуализации образов и построения классификационных дискриминантных функций, описывающих состояние иммунной системы у больных РМЖ на этапах противоопухолевого лечения как ассоциированное с благоприятным или неблагоприятным клиническим течением заболевания. В качестве критерия, отражающего характер клинического течения РМЖ, использовали показатель наступления прогрессирования заболевания в течение 3-х лет с момента установления диагноза. В подгруппу благоприятного течения вошли больные (n=31), которые пережили 3 года без признаков прогрессирования РМЖ. У 44 пациенток в течение 3-х лет отмечено прогрессирование РМЖ в форме гематогенных метастазов в отдаленные органы (n=35), рецидивов опухолевого роста (n=5) и одновременного гематогенного метастазирования и рецидивирования (n=4). Пациентки с выявленными признаками прогрессирования были включены в соответствующие отдельные подгруппы обучающей выборки. Группы сравнения по частоте встречаемости основных критериев прогноза [Божок А. А. и др., 2005; Perou C. M. et al., 2000] и объему проведенного лечения были равноценны. Обучаемая выборка была использована для верификации полученной модели классификации состояния иммунной системы и прогноза РМЖ.

Исследование роли генетической регуляции в формировании про- и противоопухолевой стратегии иммунной системы и изучение взаимосвязи генетического полиморфизма генов цитокинов и гена белка-онкосупрессора р53 с механизмами прогрессии РМЖ (показателями безрецидивной выживаемости) выполнено у 382 пациенток, представляющих вторую основную группу. В число наблюдений данной группы частично вошли представительницы первой и третьей исследовательских групп (178 и 12 пациенток соответственно).

Третья основная группа (40 пациенток) была сформирована с целью исследования влияния препарата рекомбинантного интрелейкина-1 беталейкина (НИИ ОЧБ, г. С-Петербург) на адаптационный и иммунный статус у больных РМЖ при проведении противоопухолевого лечения. Группа пациенток, в схему лечения которых был включен беталейкин, состояла из 21 человека. В контрольную группу вошли 19 больных РМЖ. Группы больных, вошедших в исследование, по возрасту, состоянию репродуктивной функции, размеру первичного опухолевого узла были репрезентативны.

Сроки наблюдения за больными в первой основной группе составили 4 года и более, во второй группе 2 года и более, в третьей – более 9 лет.

Работа проводилась с соблюдением принципов добровольности и конфиденциальности в соответствии с «Основами законодательства РФ об охране здоровья граждан» (Указ Президента РФ от 24.12.93 № 2288), имеется разрешение локального комитета по биомедицинской этике НИИ онкологии СО РАМН.

Сведения об особенностях анамнеза и клинического течения заболевания, схеме, объеме и эффективности  проведенного  лечения,  сроках  наступления  прогрессирования

Таблица 1 – Распределение больных РМЖ по группам наблюдения в соответствии с поставленными задачами и использованными методами

Группы наблюдения

Задачи исследования

Методы исследования

Первая группа

n=198;

из них

обучающая выборка n=75;

без прогрессирования более 3-х лет n=31;

гематогенные метастазы в течение 3-х лет n=35;

рецидив n=5;

одновременно рецидив и метастазы n=4;

обучаемая выборка n=123

Исследование взаимосвязи состояния иммунной системы с характером клинического течения РМЖ;

Исследование механизмов формирования различий в состоянии иммунной системы, значимых для клинического течения РМЖ;

Прогноз течения РМЖ на основании оценки состояния иммунной системы.

Методы оценки иммунного статуса 1 и 2 уровня;

Визуализация состояния иммунной системы как интегрированного целого;

Построение классификационных дискриминантных уравнений;

Исследование организации внутренних процессов иммунной системы (факторный анализ);

Исследование чувствительности МНПК к апоптоз-индуцирующим воздействиям in vitro;

Прогнозирование риска прогрессирования заболевания;

Дисперсионный анализ показателей иммунной системы

Вторая группа

n=382

Оценка роли генетической регуляции в формировании про- и противоопухолевой стратегии иммунной системы у больных РМЖ.

ПЦР и ПЦР-ПДРФ-анализ полиморфизма генов цитокинов и белка-онкосупрессора ТР53;

Методы оценки иммунного статуса 1 и 2 уровня;

Анализ безрецидивной выживаемости

Третья группа

n=40;

беталейкин n=21,

контроль n=19

Изучение влияния препарата рекомбинантного IL-1 беталейкина на адаптационный и иммунный статус у больных РМЖ в динамике противоопухолевого лечения.

Методы оценки иммунного статуса 1 и 2 уровня;

Определение типа адаптационной реакции;

Анализ безрецидивной выживаемости

РМЖ получены при анализе первичной медицинской документации – истории болезни и амбулаторных карт. Эффективность НАХТ оценивали по критериям ВОЗ инструментальными методами (УЗИ и маммография) и констатировали полную регрессию (100% уменьшение опухоли), частичную регрессию (50-99 %), стабилизацию (0-50 %) и прогрессирование (увеличение опухолевого узла), а также оценивали степень лекарственного патоморфоза опухолевых клеток. Анализировали основные клинико-морфологические факторы прогноза, такие как: возраст пациенток, менструальный статус, стадия (TNM), гистологический тип опухоли, степень дифференцировки, рецепторный статус опухолевых клеток, фоновая патология. Больные, вошедшие в группы исследования состояния иммунной системы, прошли процедуру опроса на выявление признаков иммунопатологических синдромов [Ветлугина Т. П. и др., 2001].





Методика применения препарата рекомбинантного IL-1 беталейкина.  Препарат беталейкин, созданный в НИИ ОЧБ (г. С-Петербург, Россия), вводили до начала предоперационной химиотерапии. Курс лечения состоял из 5 ежедневных капельных внутривенных инфузий в дозе 5 нг/кг массы тела пациента на 500 мл изотонического раствора натрия хлорида. Продолжительность инфузии варьировала от 60 до 180 мин.

Материалом для исследования состояния иммунной системы и генетических особенностей у больных РМЖ служила периферическая кровь, взятая утром натощак из локтевой вены. Состояние иммунной системы исследовали до начала противоопухолевого лечения, после завершения 2 курсов НАХТ, после 3-4 курсов НАХТ, через 10-12 дней после оперативного удаления первичного опухолевого узла, через 1 год после завершения противоопухолевого лечения. Генетические исследования осуществляли однократно.

Для оценки иммунологических показателей фракцию мононуклеарных клеток из периферической крови выделяли общепринятым методом наслаивания на градиент плотности фиколла и верографина (=1,077) с последующим центрифугированием [Boyum A., 1968].

Определение фенотипа мононуклеарных клеток периферической крови (МНПК) осуществляли иммуноцитохимическим методом с использованием моноклональных антител к антигенам CD3, CD4, CD8, CD56, CD22, CD25, CD95, HLA-DR (Novocastra Lab Ltd, UK) [Тотолян А.А. и др., 2001].

Оценку апоптоза мононуклеарных клеток периферической крови осуществляли методом суправитального окрашивания с использованием флюоресцентного красителя Hoechst 33342 – бисбензимида, обладающего свойством пермеабилизации клеточной мембраны и связывающегося с тимином или аденином ДНК [Zhang X. et al., 2001, Stridh H. et al., 2002]. Для индукции апоптоза клеток периферической крови in vitro использовали следующие агенты:

  1. моноклональные антитела к CD95, клон LOB3-17 (NovoCastra, Великобритания) -  250 нг/мл, индуцирующие апоптоз по классическому Fas-FasL механизму [Stridh H. et al., 2002., Кайдашев И.П. и др., 2006.];
  2. моноклональные антитела к CD3, клон UCHT1 (NovoCastra, Великобритания) -  2,5 мкг/мл, обеспечивающие активацию Т-лимфоцитов  при взаимодействии с TCR-рецептором и приводящие к активационному апоптозу [Леплина О.Ю. и др., 2000];
  3. цитостатик вепезид (этопозид/VP-16-213, «Bristol-Myers Squibb», Италия) – 4,5 мкг/мл в физиологическом растворе, неспецифический апоптоген [Потапнев М.П. и др., 2005].

  Спонтанную и стимулированную митогенами продукцию интерлейкинов (IL) 1, 2, 4, 10, фактора некроза опухоли- (TNF-), интерферона- (IFN-) МНПК исследовали с использованием наборов для иммуноферментного анализа (ООО «Цитокин», Санкт-Петербург, Россия).

  Пролиферативную активность лимфоцитов периферической крови оценивали по включению 3Н-тимидина в ДНК клеток в реакции бласттрансформации лимфоцитов (РБТЛ) [Хоробрых В.В. и др., 1983, Levesque B.M. et al., 2000].

  Функциональную активность нейтрофильных гранулоцитов определяли в тесте восстановления нитросинего тетразолия (НСТ-тест) по их способности восстанавливать активные формы кислорода [Нестерова И.В. и др., 1999]. Содержание сывороточных факторов, находящихся в циркуляции, таких как иммуноглобулины  классов M, A, G (IgM, IgA, IgG) и растворимые формы рецептора sFas (CD95) и его лиганда sFas-L исследовали с использованием наборов для иммуноферментного анализа (ЗАО «Вектор-Бест», Россия). Активность системы комплемента и уровень циркулирующих иммунных комплексов в сыворотке крови определяли методом нефелометрии.

Выделение ДНК осуществляли стандартным методом фенол-хлороформным экстракции. Анализ полиморфных вариантов специфических участков генома проводили с использованием методов полимеразной цепной реакции и анализа полиморфизма длин рестрикционных фрагментов, используя специфическую структуру праймеров и соответствующие ферменты рестрикции (таблица 2).

Таблица 2 – Структура праймеров и ферменты рестрикции для анализа полиморфных вариантов генов цитокинов и белка-онкосупрессора ТР53

Ген

Полиморфизм

Структура праймеров

Фермент рестрикции

IL-4

590CT

5’-actaggcctcacctgatacg-3’

5’-gttgtaatgcagtcctcctg-3’

Bsm FI

IL-10

592CA

5’- atccaagacaacactactaa -3’

5’- taaatatcctcaaagttcc -3’

Rsa I

TNFA

308AG

863АС

238АG

5’-agg-caa-tag-gtt-ttg-agg-gcc-at-3’ 5’-aca-ctc-ccc-atc-ctc-ccg-gct-3’

Bsp19I

BstBAI

Msp I

IL-1

-31CT

F: аgaagcttccaccaatactc

R: agcacctagttgtaaggaag

AluI

+3954CT

F: ctcaggtgtcctcgaagaaatcaaa

R: gcttttttgctgtgagtcccg

TaqI

TGF1

509CT

F: cagtaaatgtatggggtcgcag

R: ggtgtcagtgggaggaggg

Bsu36I

Eco81I

CCR5

CCR5del32

5’-aaggtcttcattacacctg-3’

5’-agaattcctggaaggtgttc-3’

p53

G199C

ctggtaaggacaagggttgg

actgaccgtgcaagtcacag

BstFN I 

GAPDH

F: aggctggggctcatttgcagg

R: tagccaaattcgttgtcataccag

Примечание: F – прямой праймер, R – обратный праймер, С, А и G – аллель-специфические праймеры

Продукты амплификации подвергали рестрикции соответствующими эндонуклеазами (таблица 2). Продукты рестрикции разделяли с помощью электрофореза в 2%-ном агарозном геле, содержащем 0,5 мг/мл бромида этидия и визуализировали в УФ-свете при помощи УФ-трансиллюминатора «Vilber Lourmat» (Франция).

Иммуногистохимическое исследование проводили по стандартной методике. Для исследования экспрессии рецепторов эстрогенов на опухолевых клетках использовали антитела фирмы «Dako» (клон 1D51, готовые к применению, мышиные), рецепторов прогестерона (клон PgR6311, готовые к применению, мышиные), онкопротеина c-erbB-2(кроличьи),  Ki67 (клон MIB-1, мышиные) и для белка-онкосупрессора ТР53 применяли антитела фирмы “NovoCastra” (клон CM1). Экспрессию рецепторов к онкопротеину c-erbB, TP53, Ki67 оценивали в процентном содержании положительно окрашенных клеток в паренхиматозном компоненте первичной опухоли. Экспрессию рецепторов к половым

гормонам оценивали по 3-балльной шкале (слабая, средняя и выраженная степени).

  Тип адаптационной реакции определи по процентному содержанию лимфоцитов в лейкоцитарной формуле и их отношению к содержанию сегментоядерных нейтрофилов [Гаркави Л.Х. и др., 1998].

Статистическую обработку данных проводили с использованием стандартного пакета программ «Statistica» (версия 6.1, серия 1203d, StatSoft Inc.) и «NovoSpark® Visualizer 2.1» (Канада). Для проверки законов распределения исследуемых переменных на нормальность использовали критерий Колмогорова-Смирнова. Для оценки значимости различий выборок использовали непараметрические критерии Манна-Уитни, Вилкоксона, Краскала-Уоллеса. Различия считали значимыми при р<0,05. При проведении попарного сравнения частот аллелей и генотипов полиморфных вариантов генов, а также частоты встречаемости прочих изучаемых признаков в анализируемых группах использовали критерий 2 с поправкой Йетса на непрерывность и/или точный критерий Фишера. С целью исследования основных факторов, организующих морфофункциональную структуру иммунной системы у больных РМЖ на этапах проведения противоопухолевого лечения, был применен факторный анализ [Иберла К., 1980, Боровиков В.П., 1998]. Для классификации и описания состояния иммунной системы у больных РМЖ с различным клиническим течением был использован метод дискриминантного анализа.

Принцип метода визуализации многомерных данных. В проведенном исследовании состояние иммунной системы, характеризуемое большим количеством показателей, у каждой пациентки, было рассмотрено как многомерное измерение. Для такого представления был использован метод визуализации многомерных данных NovoSpark Corporation (Канада). Визуализация состояния биосистемы, как единого целого, предполагает отображение совокупности всех показателей, описывающих состояние системы, в одном «интегральном» образе [Кистенев Ю. В. и др., 2011].

Рассматриваемый метод визуализации многомерных объектов и процессов основан на изометричности двух пространств, где объекты одного пространства (пространства данных) считаются оригиналами, в то время как объекты другого играют роль изображений.  Основой выявления  сходства  или различия  в оригинальных данных

является визуальная близость соответствующих этим данным образов, выражаемая в расстоянии Махалонобиса [Eidenzon D. et al. http://www. tsu.ru].

Одной из важных функций программы NovoSpark является выбор информативных показателей, который  сводится к получению визуально различимых образов (форма кривой) и/или визуально непересекающихся образов, упорядоченных по величине расстояния оригиналов от выбранной точки отсчета, например, многомерного центра координат или многомерного среднего контрольного набора данных. С точки зрения визуализации идентификация закономерностей многомерных измерений тесно связана с выбором информативных показателей и приводит к результатам, достигаемым при использовании количественных методов [Eidenzon D.V., Volovodenko V.A., 2009].

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ

Дискуссия о роли иммунной системы в противоопухолевой защите организма  длится уже более ста лет. В настоящее время существуют концепции, отрицающие какое-либо значение иммунологических механизмов в противоопухолевой защите организма [Антонов В.Г., Козлов В.К., 2004, Абелев Г.И., 2000]. Ряд авторов отводит иммунной системе определенную роль в контроле ограниченного ряда злокачественных новообразований, таких как опухоли лимфатической системы [Klein G., 2009]. Наиболее адекватной и аргументированной представляется концепция иммунологического редактирования опухолевого роста, рассматривающая роль иммунной системы как амбивалентную и зависящую от фазы взаимодействия «опухоль – иммунная система» [Гранов А.М. и др., 2008, Swann J.B., Smyth M.J., 2007, Nicolini A., Carpi A., 2009].

Обоснованием для концепции иммунологического редактирования опухолевого роста являются  накопленные к настоящему времени многочисленные экспериментальные и клинические данные. Одни из источников указывают на существование иммунологических механизмов элиминации злокачественных клеток и сдерживание опухолевого роста при уже возникшем процессе [Бережная Н.М., Чехун В.М., 2005, Бережной А.Е. и др., 2008]. Другие авторы приводят факты содействия опухолевой прогрессии [Curiel T.J., 2007 T.J., 2007, Ben-Baruch A., 2003, Luboshits G. et al., 1999]. Несмотря на достигнутый концептуальный компромисс в теории иммунологического редактирования злокачественного роста, остается нерешенной главная проблема: признавая двойственное участие механизмов иммунной системы в возникновении и развитии опухолевого процесса, необходимо выяснить  патогенетические особенности, отличающие стратегию иммунной системы, направленную на сдерживание злокачественного роста, от стратегии, содействующей опухолевой прогрессии. Важно понять, как эти отличия реализуются у конкретного больного на различных этапах противоопухолевого лечения и динамического наблюдения.

Исследование системного уровня функционирования иммунной системы у больных РМЖ с разным клиническим течением заболевания. Накопленный к настоящему времени феноменологический материал о взаимосвязи отдельных иммунологических показателей с клинико-морфологическими параметрами опухолевого процесса, эффективностью лечения и прогнозом не дает однозначного ответа на поставленные  выше вопросы. Одной из причин такой неоднозначности, на наш взгляд, является тот факт, что в подавляющем большинстве исследований не учитывается  системный принцип организации и функционирования иммунной системы. Согласно системному подходу, существенными для живой системы являются свойства целого, которыми не обладает ни одна из его частей. Новые свойства системы возникают из взаимосвязей между частями. При системном подходе свойства отдельных элементов могут быть выведены только из организации целого [Капра Ф., 2002]. Таким образом, для адекватной интерпретации выявленных отличий на уровне отдельных показателей необходима их интегрированность в контекст функционирования целой системы, а, в идеале, всего живого организма [Гольдберг Е. Д. и др., 1996].

Возможность и необходимость системного подхода в изучении иммунной системы  высказывается в работах [Чередеев А.Н., Ковальчук Л.В., 1997, Гельфгат Е.Л. и др., 2002, 2003, Li Y.et al., 2008., Genser B., 2007]. В нашей работе для решения данной проблемы – исследования состояния иммунной системы как единого комплекса взаимосвязанных одновременно протекающих событий – был применен разработанный компанией NovoSpark (Канада) метод визуализации многомерных данных [Eidenzon D.V., Volovodenko V.A., 2009].

Состояние иммунной системы, охарактеризованное путем оценки 55 показателей, было принято за многомерное измерение и представлено в виде двумерной кривой. Основой выявления сходства или различия в оригинальных данных является близость соответствующих этим данным образов, измеряемая расстоянием Махаланобиса, а также схожесть кривых по форме. Если два наблюдения характеризуются близкими по значениям наборами иммунологических показателей, то отражающие эти состояния кривые по форме похожи друг на друга и располагаются в близких областях условного пространства многомерных признаков. Если наблюдения отличаются, то и кривые будут различны [Кистенев Ю.А. и др., 2011].

Для оценки взаимосвязи состояния иммунной системы, как интегрированного целого, с характером течения РМЖ, из 198 пациенток в зависимости от наступившего исхода были сформированы следующие подгруппы: больные РМЖ, пережившие 3 года и более от момента установления диагноза без признаков прогрессирования заболевания (n=31), пациентки с развившимися в эти сроки гематогенными метастазами (n=35), с местными рецидивами (n=5) и одновременным метастазированием и рецидивированием (n=4). Выделенные подгруппы были равноценны по частоте встречаемости основных клинико-морфологических факторов прогноза, объему и схемам проведенного противоопухолевого лечения, т.е. тех параметров, которые патогенетически значимы для опухолевой прогрессии и вносят существенный вклад в исход заболевания (критерии сравнения Фишера и 2). Равноценное присутствие, обеспечивающее, следовательно, и одинаковое влияние данных факторов в группах пациенток с различным исходом, предоставило нам возможность оценить взаимосвязь течения РМЖ именно с особенностями состояния иммунной системы.

  Оценка состояния иммунной системы как целостной системы выявила статистически значимые различия у больных РМЖ без прогрессирования  заболевания в течение 3-х лет с момента установления диагноза по сравнению с пациентками, у которых в эти сроки отмечено развитие гематогенных метастазов (рисунок 1). Указанные различия представлены расположением визуальных образов состояния иммунной системы, характерных для данных групп, в непересекающихся областях условного пространства многомерных признаков. Оказалось, что различия в состоянии иммунной системы в группах с разным течением РМЖ наблюдались также на этапах его проведения и последующего динамического наблюдения (рисунок 1).

Следует отметить, что у больных с развившимися местными рецидивами и одновременным рецидивированием и метастазированием в отдаленные органы, несмотря на малую численность выборки, состояние иммунной системы также имело отличия, нашедшие выражение в различной форме кривых визуализации.

Таким образом, выявленные различия в расположении визуальных образов, отражающих системный уровень функционирования иммунной системы у больных РМЖ с признаками прогрессирования заболевания и без таковых, свидетельствует о важном вкладе иммунной системы в определение исхода РМЖ и о вовлечении иммунологических механизмов в патогенез данного заболевания.

Механизмы, лежащие в основе про- и противоопухолевой стратегии иммунной системы у больных РМЖ. Применение метода визуализации, помимо констатации качественных различий в состоянии иммунной системы у больных РМЖ, ассоциированных с характером клинического течения заболевания, позволило выявить параметры и связанные с ними механизмы, определяющие отмеченную дискриминацию стратегии иммунной системы (таблица 3). Этот комплекс показателей послужил основой для построения классификационных дискриминантных уравнений, описывающих состояние иммунной системы у больных РМЖ на каждом из этапов противоопухолевого лечения в двух вариантах: как ассоциированного с длительной клинической ремиссией или как сопряженного с прогрессированием – гематогенным метастазированием – в течение 3-х лет с момента установления диагноза.

По величине коэффициента, стоящего перед переменной в дискриминантных уравнениях, возможно судить, насколько значим данный иммунологический показатель и связанный  с ним механизм для  различения состояния  иммунной  системы, как

АБВГ

Д

Рисунок 1 - Области расположения визуальных образов, соответствующих состоянию иммунной системы,  как интегрированного целого,  у больных РМЖ без прогрессирования заболевания более 3-х лет (темно-серый цвет) и у пациенток с развившимся гематогенным метастазированием (светло-серый цвет); А – до начала противоопухолевого лечения, Б – 2 курса НАХТ, В – 3-4 курса НАХТ, Г – после операции, Д – через 1 год после специфического лечения

Таблица 3 – Параметры, определяющие статистически значимые различия в состоянии иммунной системы у больных РМЖ без прогрессирования и с развившимися гематогенными метастазами в течение 3-х лет

До начала лечения

После 2 курсов НАХТ

После 3-4 курсов НАХТ

После операции

1 год после лечения

CD4/ CD8

CD4/ CD8

CD4/ CD8

активность нейтрофилов, %

CD4/ CD8

Ig M, г/л

активность нейтрофилов, %

Ig A, г/л

Ig A, г/л

активность нейтрофилов, %

CD8+клетки,%

Ig M, г/л

CD8+клетки,%

активность нейтрофилов, у.е.

активность нейтрофилов, у.е.

Ig A, г/л

активность нейтрофилов, у.е.

активность нейтрофилов, у.е.

CD4/ CD8

CD8+клетки,%

Ig G, г/л

Ig A, г/л

CD25+клетки,%

Ig M, г/л

Ig M, г/л

CD4+клетки,%

CD4+клетки,%

CD56+клетки,%

CD3+клетки,%

CD4+клетки,%

CD22+клетки,%

CD56+клетки,%

CD22+клетки,%

Ig G, г/л

CD25+клетки,%

резерв нейтрофилов, %

резерв нейтрофилов, %

CD4+клетки,%

резерв нейтрофилов, %

Ig A, г/л

CD56+клетки,%

CD3+клетки,%

апоптоз, %

CD4+клетки,%

CD3+клетки,%

CD95+клетки,%

Ig G, г/л

CD95+клетки,%

CD22+клетки,%

CD95+клетки,%

ЦИК

CD22+клетки,%

ЦИК

CD8+клетки,%

Ig G, г/л

резерв нейтрофилов, у.е.

CD95+клетки,%

резерв нейтрофилов, у.е.

резерв нейтрофилов, %

активность нейтрофилов, %

ИС ФГА

CD22+клетки,%

IL1-lps, пг/мл

резерв нейтрофилов, у.е.

ЦИК

IL1-, пг/мл

CD25+клетки,%

резерв нейтрофилов, у.е.

активность нейтрофилов, у.е.

апоптоз, %

CD56+клетки,%

TNF-, пг/мл

CD8+клетки,%

РБТЛ с ФГА

Комплемент,у.е

ЦИК

РБТЛ

РБТЛ с ФГА

Примечание:

Параметры иммунной системы представлены в  убывающем порядке, соответствующем величине связанных с ними коэффициентов дискриминантных уравнений

интегрированного целого, на определенном этапе исследования [Боровиков В.П., 1998]. Так, до начала противоопухолевого лечения статистическую значимость различий определяло вовлечение практически всех звеньев адаптивного и врожденного иммунитета (таблица 3). Наиболее важное значение имело состояние Т-клеточного звена, с которым связывают реализацию противоопухолевой активности [Hornychova H. et al., 2008, Schirrmacher V. et al., 2002]. Об этом свидетельствовал максимальный коэффициент, стоящий перед показателем иммунорегуляторного индекса CD4/CD8.

После проведения 2 курсов НАХТ состояние Т-клеточного иммунитета сохраняло ведущее значение для дискриминации про- и противоопухолевой стратегии иммунной системы. Об этом говорили высокие значения коэффициентов  перед показателями иммунорегуляторного индекса CD4/CD8 и процентным количеством CD4+клеток (таблица 3). Однако возрос вклад функциональной активности нейтрофилов, а также гуморального иммунитета (IgA, IgM). Поскольку известно, что форменные элементы системы кроветворения оказываются мишенями цитостатического лечения, то закономерно, что после 2 курсов НАХТ значение для дискриминации в стратегическом направлении функционирования иммунной системы у больных РМЖ приобрела пролиферативная активность лимфоцитов периферической крови, связанная, вероятно, с механизмом компенсации клеточных потерь (таблица 3). Очевидно, что наличие пролиферативного ресурса у клеток периферической крови может создать преимущество при апоптоз-индуцирующих воздействиях со стороны опухоли и противоопухолевого лечения, обеспечивать более полноценный режим функционирования иммунной системы, который, в свою очередь, способствует увеличению длительности периода без прогрессирования РМЖ.

После завершения НАХТ (3-4 курса) важной чертой, отличающей состояние иммунной системы у больных с различным клиническим течением РМЖ, выступает появление такого показателя, как количество клеток периферической крови с морфологическими признаками апоптоза (таблица 3). Если на этапе 2 курсов НАХТ одним из критических механизмов, определяющих стратегию иммунной системы, был пролиферативный потенциал лимфоцитов, то при продолжении цитостатического лечения

(более 2 курсов) значение приобрела непосредственно клеточная гибель.

Данные дискриминатного анализа, касающиеся особенностей состояния иммунной системы у больных РМЖ при проведении НАХТ, нашли подтверждение в экспериментах in vitro по изучению чувствительности мононуклеарных клеток крови у больных РМЖ к апоптоз-индуцирующим воздействиям различной природы. В качестве индукторов апоптоза использовали моноклональные антитела к CD95 (Fas-зависимый апоптоз), CD3 (активационный апоптоз), цитостатик вепезид (апоптоз, связанный с клеточным стрессом). Уровень апоптоза в 24-часовой культуре клеток зависел от этапа противоопухолевого лечения. Для больных, состояние которых характеризовалось длительной клинической ремиссией, максимальные значения клеточной гибели отмечены на этапе НАХТ, для пациенток с развившимся впоследствии прогрессированием РМЖ – после завершения лечения. Однако наиболее выраженным отличием группы больных без прогрессирования заболевания являлось высокое количество клеток после инкубации in vitro в течение 24 часов. Данный показатель в большинстве случаев находился на уровне пассажа (1х106 клеток/мл) и выше, в то время как у пациенток с неблагоприятным исходом количество клеток в культуре после инкубации снижалось. Отмеченный факт, на наш взгляд, связан с достаточной пролиферативной активностью лимфоцитов и моноцитов, восполнявшей количественные потери в результате клеточной гибели.

После оперативного удаления первичного опухолевого узла в формирование генеральной стратегии, реализуемой иммунной системой, максимальный вклад вносили показатели спонтанной активности нейтрофилов и уровень иммуноглобулина А в сыворотке крови больных (таблица 3). У пациенток, чье состояние иммунной системы было классифицировано как неблагоприятное, выраженное значение для дискриминации имели показатели иммунорегуляторного индекса.

После завершения противоопухолевого лечения (через 1 год) генеральная стратегия иммунной системы  вновь была связана с показателями основных звеньев: Т-клеточного ответа (CD4+, CD8+, CD4/CD8), гуморального ответа (IgM), спонтанной активности нейтрофилов (таблица 3). Одним из важных параметров, вносящих вклад в дискриминацию про- и противоопухолевой стратегии иммунной системы на этапе динамического наблюдения, является количество CD25+клеток периферической крови (таблица 3). С одной стороны, этот показатель отражает уровень активации иммунной системы и может указывать на продолжающийся, но клинически не манифестируемый опухолевый рост или метастазирование. С другой стороны, увеличение CD25+клеток может свидетельствовать о циркуляции Т-регуляторных клеток – эффекторов одного из наиболее значимых механизмов иммуносупрессии, способствующих опухолевой прогрессии [Кадагидзе З.Г. и др., 2006, Ярилин А.А., Донецкова А.Д., 2006, Свиридова В.С. и др., 2010, Gobert M. et al., 2009].

Таким образом, несмотря на то, что в реализацию противоопухолевой или опухолестимулирующей стратегии иммунной системы вовлечены фактически все ее звенья, в зависимости от этапа лечения комплекс данных параметров и ведущие механизмы реализации функциональной направленности претерпевали изменения.

Одним из ведущих принципов организации системы, в том числе и иммунной, является взаимосвязь отдельных морфологических и функциональных элементов, создающая обладающее новыми свойствами целое [Капра Ф., 2002]. Методом исследования внутренних взаимосвязей, организующих систему, был выбран факторный анализ [Боровиков В.П., 1998]. Основная цель факторного анализа заключается в том, чтобы обнаружить скрытые общие факторы, объясняющие связи между наблюдаемыми признаками (параметрами) объекта. Выделяемые факторы являются гипотетическими, однако их смысл связан с определенным вектором функционирования иммунной системы.

До начала противоопухолевого лечения наиболее значимые векторы в структуре морфофункциональной организации иммунной системы у больных РМЖ отражали состояние Т-клеточного звена, его функциональную активность, уровень активации, механизмы обеспечения количественного гомеостаза (таблица 4). Функциональная активность нейтрофилов также была представлена в структуре иммунных процессов у пациенток с РМЖ на этапе установления диагноза.

Для пациенток из группы длительной клинической ремиссии после 2 курсов НАХТ функциональная активность нейтрофилов была тесно связана с показателями гуморального иммунитета (ЦИК, IgM, IgA) и механизмами индукции апоптоза (число клеток, несущих на своей мембране Fas-лиганд). Вероятно, наличие подобной функциональной взаимосвязи обусловлено вовлечением цитотоксических механизмов иммунной системы в деструкцию злокачественных клеток после цитостатического воздействия химиотерапевтических агентов [Zitvogel L. et al., 2008] и последующей необходимостью их утилизации (фагоцитозом, опсонизацией, агглютинацией, преципитацией). У больных с прогрессированием РМЖ такого вектора отмечено не было. Специфические особенности структуры иммунологических параметров у пациенток этой группы проявились в присутствии особой функциональной единицы, связывающей показатели содержания иммуноглобулинов классов G, M, A, что является подтверждением литературных сведений о содействии гуморального ответа опухолевой прогрессии [Бережной А.Е. и др., 2008, Tan T. T., Coussens L. M., 2007]. Подобная структура организации внутренних процессов функционирования иммунной системы у больных РМЖ с различным характером клинического течения сохранялась и при продолжении НАХТ – 3-4 курса (таблица 4).

На этапе хирургического лечения у больных РМЖ с благоприятным клиническим течением наиболее значимое место  в  структуре внутренних  взаимосвязей  занимали

Таблица 4 – Структура морфофункциональной организации иммунной системы у больных РМЖ на этапах противоопухолевого лечения

этап лечения

Вектор I

Вектор II

Вектор III

без прогрессирования

метастазы

без прогрессирования

метастазы

без прогрессирования

метастазы

до лечения

CD 95+

CD8+

CD4+

CD4+

CD22+

CD8+

CD25+

CD56+

Уровень пролиферации лимфоцитов

CD56+

CD22+

Резерв нейтрофилов

Уровень пролиферации лимфоцитов

ЦИК

Резерв нейтрофилов

ИС ФГА

CD95+

Ig G

CD56+

НАХТ

Спонтанная

активность нейтрофилов

ЦИК

Ig M

Спонтанная активность нейтрофилов

CD4+

CD4/CD8

CD4/CD8

CD4+

Ig A

Fas-L+

Спонтанная

активность нейтрофилов

Ig A

Ig G

Ig M

операция

Уровень пролиферации лимфоцитов

HLA-DR+

HLA-DR+

Уровень пролиферации лимфоцитов

Резерв нейтрофилов

Fas-L+

ЦИК

Fas-L+

Уровень пролиферации лимфоцитов

с ФГА

Уровень пролиферации лимфоцитов

с ЛПС

Резерв нейтрофилов

1 год после

лечения

Спонтанная

активность нейтрофилов

Резерв нейтрофилов

Спонтанная

активность нейтрофилов

Ig A

Ig G

Ig M

Апоптоз

Резерв нейтрофилов

CD4/CD8

Апоптоз

Резерв нейтрофилов

Ig A

Ig G

механизмы, ассоциированные с пролиферативной активностью лимфоцитов периферической крови (таблица 4). Отдельный фактор у больных РМЖ характеризовал клеточную цитотоксичность: количество клеток крови, несущих Fas-лиганд на поверхности и способных индуцировать апоптоз иммунокомпетентных клеток, и функциональный резерв нейтрофилов, также обладающих выраженным цитотоксическим потенциалом [Di Carlo E., 2001]. У пациенток с неблагоприятным течением РМЖ отмечена отрицательная взаимосвязь количества Fas-L+ мононуклеарных клеток периферической  крови  с  их  пролиферативной  активностью, которая может  отражать проявление иммуносупрессии, индуцированной операционным стрессом, что в последующем находит реализацию в прогрессировании заболевания [Baltrush H.J. et al., 1991, Pant S., Ramaswamy B., 2009].

Для пациенток с благоприятным течением заболевания через 1 год после завершения противоопухолевого лечения была характерна обособленность различных звеньев системы иммунитета в отдельные функциональные векторы (нейтрофилы в I вектор, гуморальный ответ во II, апоптоз в III). Для больных РМЖ с последующим прогрессированием было отмечено объединение в один фактор параметров, характеризующих различные морфофункциональные звенья (таблица 4).

Обобщая результаты факторного анализа,  следует заключить, что при исследовании механизмов, организующих функционирование иммунной системы у больных РМЖ, как до начала лечения, так и при его проведении и спустя год после завершения, ведущее место занимает активность Т-клеточного звена. Проведение НАХТ ассоциировано с увеличением влияния процессов пролиферации, апоптоза и утилизации циркулирующих антигенов в структуре внутрисистемной организации. Основным отличием организации функционирования иммунной системы у больных РМЖ, характеризующихся благоприятным течением заболевания, является выраженный вектор цитотоксических эффекторных реакций. Неблагоприятное течение РМЖ связано с активностью гуморального звена при проведении противоопухолевого лечения.

  Таким образом, мы показали, что состояние иммунной системы у больных РМЖ характеризуется вариативностью, которая связана с различным характером клинического течения заболевания, определяющим сроки наступления прогрессирования. Отмеченные различия наблюдаются на системном уровне функционирования иммунной системы, реализуются через определенные взаимосвязи морфофункциональных звеньев системы, могут быть связаны с конкретными молекулярно-клеточными механизмами, создающими преимущество или дефицит жизнеобеспечения организма больной в условиях злокачественного роста и противоопухолевого лечения. Очевиден вопрос: в результате чего формируется та или иная стратегия иммунной системы, ассоциированная с клиническим течением заболевания и его исходом?

Механизмы, формирующие стратегическую направленность функционирования иммунной системы у больных РМЖ при проведении противоопухолевого лечения. Для решения поставленного вопроса нами было предпринято исследование влияния значительного числа факторов, отражающих индивидуальные особенности организма, клинико-морфологические и молекулярные характеристики опухолевого процесса, объем и схему проведенного противоопухолевого лечения (таблица 5) на дисперсию иммунологических показателей, важных для дискриминации состояния иммунной системы. По сути, необходимо выявить, какие факторы значимо определяют изменения иммунологических показателей в группах с различным исходом.

Нами было отмечено, что вариабельность состояния иммунной системы у больных РМЖ обеспечивается влиянием как организма, так и опухоли. До начала лечения и через 1 год после его завершения доминирует влияние особенностей организма (доля иммунологических показателей, зависевших от параметров организма 71 % и 65 % соответственно), в процессе лечения – характеристики опухолевого процесса (55 % после завершения  НАХТ).  Влияние  проведенного  лечения  на состояние иммунной системы у

Таблица 5 –  Факторы, включенные в исследование дисперсии показателей иммунной системы у больных РМЖ

Факторы, отражающие опухолевый процесс

Факторы, отражающие особенности организма

Факторы, отражающие параметры лечения

- стадия

- размер первичного узла

- распространенность процесса 

- клиническая форма

- гистологический тип

- фоновая патология

- степень злокачественности

- чувствительность к цитостатикам

- рецепторы прогестерона

- рецепторы эстрогенов

- HER2/neu

- Ki67+клетки опухоли

- ТР53+клетки опухоли

- возраст

- менструальный статус

- адаптационный статус  до лечения

- адаптационный статус на этапе лечения

- сторона поражения

- локализация

- наличие ИПС

- аутоиммунный ИПС

- аллергический ИПС

- инфекционный  комбинированный ИПС

- инфекционно-

- гуморальный ИПС

- инфекционно-клеточный ИПС

- онкологическая наследственная  отягощенность

- наследственная отягощенность РМЖ

- полиморфизм генов:

р53

CCR5del32

IL-1 (-31)C/T

IL-1(+3954)C/T

TNF 308G/A

TNF 238G/A

TNF 863G/A

IL-10 592 C/A

IL-4 590 C/T

TGF 509 C/T

TGF 29 C/T

- проведение НАХТ

- эффективность НАХТ

- схема НАХТ

- количество курсов НАХТ 

- предоперационная ЛТ

- вид операции

- проведение ИОЛТ

- проведение АЛТ

- проведение АХТ

- схема АХТ

- количество курсов АХТ

- проведение ГТ

пациенток сохраняется после его завершения (65 % показателей иммунной системы).

Исследование комплекса иммунологических параметров-откликов при воздействии факторов дисперсии показало их структурную схожесть с векторами внутренней организации функционирования иммунной системы, выявленную при помощи факторного анализа. Формирование той или иной взаимосвязи различных звеньев и эффекторов иммунной системы в единый функциональный механизм  может  быть

обусловлено конкретными особенностями организма, опухолевого процесса или проведенного лечения, составляющими фактическую природу гипотетических векторов внутренней организации иммунной системы (таблица 6).

Сторона поражения опухолью являлась наиболее часто встречаемым фактором при исследовании  дисперсии  иммунологических  показателей  до начала противоопухолевого

Таблица 6 – Соответствие факторов, влияющих на вариабельность состояния иммунной системы, с векторами ее морфофункциональной организации

Этап наблюдения

Факторы вариабельности состояния (дисперсионный анализ)

Векторы внутрисистемной организации (факторный анализ)

до лечения

сторона поражения: CD4+, CD8+ клетки, активность нейтрофилов, продукция IL-1

I вектор: функциональная активность МНПК CD4+, CD8+, CD25+, CD56+, CD95+, CD22+, HLA-DR+ клетки

2 курса НАХТ

биологические свойства опухоли (рецепторный статус, Ki67, TP53, степень злокачественности): IgG, IgA, IgM

III вектор: гуморальный ответ IgG, IgA, IgM

3-4 курса НАХТ

НАХТ (эффективность, лекарственный патоморфоз опухоли): IgG, IgA, ЦИК

III вектор: гуморальный ответ IgG, IgA, ЦИК

клинические параметры опухолевого процесса (стадия, размер первичного узла, клиническая форма):CD4/CD8, ЦИК

III вектор: CD4/CD8 + ЦИК

операция

НАХТ (эффективность, лекарственный патоморфоз опухоли): функциональный резерв нейтрофилов, ЦИК

II вектор: функциональный резерв нейтрофилов + FAS-L+

1 год после лечения

наличие ИПС: активность нейтрофилов, ЦИК

I вектор: активность нейтрофилов + ЦИК

генетический полиморфизм (IL-1(-31)CT, CCR5del32): функциональный резерв нейтрофилов, CD4/CD8

II вектор: функциональный резерв нейтрофилов, CD4/CD8, апоптоз

предоперационная ЛТ: функциональный резерв нейтрофилов, IgA

III вектор: функциональный резерв нейтрофилов + IgA

цитостатическое лечение (АХТ, ЛТ): активность нейтрофилов

I вектор: активность нейтрофилов

биологические свойства опухоли (рецепторный статус, Ki67, TP53, степень злокачественности): IgA, IgG

II вектор: гуморальный ответ IgA, IgG, IgM, ЦИК

Примечание - жирным шрифтом выделены иммунологические показатели у больных РМЖ, общие для структуры факторов дисперсионного анализа и векторов внутрисистемной организации

лечения. Совокупность иммунологических показателей, для которых отмечена дисперсия значений в сочетании с параметром «сторона поражения», в определенной мере (CD8+клетки, CD4+клетки) совпадает со структурой I вектора, связанного с функциональной активностью иммунной системы (таблицы 4, 6). Можно предположить, что уровень функциональности иммунной системы связан со стороной расположения опухоли и подчеркивает важность регуляторной асимметрии организма [Абрамов В.В., 1998].

Проведение 2 курсов НАХТ вызвало значительное увеличение как числа факторов, вызывающих дисперсию, так и количества самих иммунологических показателей, демонстрировавших вариативность своих значений. Наибольшим влиянием обладали параметры, отражавшие биологические свойства злокачественных клеток,  такие как экспрессия рецепторов половых гормонов, факторов роста HER2/neu, пролиферативный потенциал (экспрессия Ki67), экспрессия мутантного белка р53, степень злокачественности опухоли. Комплекс иммунологических показателей, значения которых варьировали под влиянием биологических свойств опухоли, близок к вектору, ассоциированному с гуморальным ответом у больных с неблагоприятным течением РМЖ (таблицы 4, 6). Следовательно, вектор действия гуморального ответа определяется биологическими свойствами злокачественных клеток.

На этапе завершения НАХТ выделялись три группы факторов, значимо влияющие на вариативность состояния системы иммунитета. Наиболее выраженное воздействие оказывали факторы нормальной генетической изменчивости: полиморфизм генов цитокинов IL-1 (-31)CT, TGF-  509СТ, TNF- 863СA и факт наличия среди кровных родственников больных со злокачественными новообразованиями. Вторая группа связана с эффективностью НАХТ, оцененной как клинически, по уменьшению размера опухолевого узла, так и морфологически – по степени лекарственного патоморфоза опухолевых клеток. Третья группа параметров, влияющая на вариабельность иммунного статуса, отражала клинические характеристики опухолевого процесса – стадию, размер первичного узла, клиническую форму заболевания. Состав показателей, ассоциированный со второй и третьей группой параметров, имеет сходство с III вектором, организующим функционирование иммунной  системы у больных с неблагоприятным и благоприятным течением РМЖ соответственно после 3-4 курсов НАХТ (таблица 6).

Параметры эффективности НАХТ оказывали преобладающее влияние на вариабельность состояния иммунной системы у больных РМЖ после оперативного удаления злокачественного узла. Показатели, подвергавшиеся дисперсии при воздействии НАХТ (активность нейтрофилов в НСТ-тесте), соотносимы со II вектором морфофункциональной организации иммунной системы у больных с благоприятным течением РМЖ, отмеченным на послеоперационном этапе. Данный вектор был связан нами с механизмами цитотоксичности, к проявлению которой наряду с молекулой Fas-L+ способны нейтрофилы (таблицы 4, 6).

Через 1 год после завершения противоопухолевого лечения наследственные особенности организма оказались ведущим комплексом параметров, влияющих на разнообразие статуса иммунной системы. Определяемая ими функциональная взаимосвязь эффекторов иммунной системы имеет сходство с такими векторами, как «активность нейтрофилов» и «апоптоз» (таблицы 4, 6). Кроме этого, функциональная активность нейтрофилов связана с влиянием цитостатического лечения (НАХТ, лучевая терапия) и наличием ИПС. Биологические свойства опухолевых клеток определяли гуморальный ответ больных РМЖ (таблица 6).

Выявление причины формирования патогенетически неблагоприятного вектора реагирования иммунной системы, с одной стороны, позволит формировать группы повышенного риска  раннего прогрессирования. С другой стороны, при возможной коррекции неблагоприятного варианта действующего фактора предоставляется возможность манипулировать иммунной системой и влиять на клиническое течение заболевания.

Влияние генетических факторов на состояние иммунной системы у больных РМЖ в динамике противоопухолевого лечения. В последнее время большое внимание в качестве перспективных критериев для формирования групп повышенного онкологического риска, прогнозирования клинического течения и эффективности лечения злокачественных новообразований привлекают генетические маркеры [Имянитов Е.Н., 2009]. Генетические нарушения играют важную роль в этиологии и патогенезе РМЖ. Известны наследственные формы РМЖ, связанные с мутациями высокопенетрантных генов BRCA [Харченко В.П. и др., 2007, Ford D. et al., 1998]. Особое место в картине нарушений при РМЖ занимают повреждения гена белка-онкосупрессора p53, который играет ключевую роль в ответе клетки на различные повреждения [Vogelstein B. et al., 2000]. Одним из возможных механизмов реализации генетической предрасположенности к злокачественным новообразованиям могут служить морфологические и функциональные особенности иммунной системы. При этом регуляторы иммунных процессов – цитокины – занимают важное место в модуляции состояния иммунной системы. В свою очередь, биологический эффект конкретного цитокина определяется уровнем его продукции и взаимодействия с рецептором-мишенью. Концентрация регуляторного белка зависит от аллельных вариантов гена, которые определяют высокую или низкую экспрессию.

С целью исследования патогенетически значимых генов в прогрессии РМЖ нами был предпринят анализ 3-летней безрецидивной выживаемости  у 382 больных РМЖ  (T1-4N0-3M0) в зависимости от аллельных вариантов генов цитокинов, а также гена р53. Исследованы следующие полиморфизмы IL-1β(-31)C/T, IL-1(+3954)C/T, IL-4 590 C/T, IL-10 592CA, TGF-β 509 C/T, TGF-β 29 T/С, TNF 308 G/A, TNF 308 G/A, TNF863CA, CCR5del32, p53Arg72Pro. Полиморфизм 2 генов цитокинов IL-10  и TGF- оказывал влияние на длительность безрецидивной выживаемости пациенток с РМЖ на уровне тенденции (p=0,09 и р=0,08 соответственно). Лучшие показатели безрецидивной выживаемости  отмечены у носительниц гомозиготных вариантов TGF 509 CC (низкая экспрессия и менее выраженная иммуносупрессия) и IL-10 592 AA (высокая экспрессия). Генотип TGF 509 CC характеризуется низкой экспрессией цитокина, обладающего выраженным иммуносупрессивным эффектом [Nakamura K. et al., 2001]. Возможно, увеличение периода безрецидивной выживаемости связано с меньшим угнетением противоопухолевых механизмов иммунной системы. Кроме того, известна ключевая роль TGF- в реализации эпителиально-мезенхимального перехода, который обеспечивает диссеминацию опухоли [Thiery J.P 1999, Petersen O.W. et al., 2001, Huber M.A. et al., 2004]. Есть сведения о связи up-регуляторных аллелей TGF- с неблагоприятным исходом РМЖ [Gorelik L. et al.,2002]. Влияние IL-10 на опухолевую прогрессию неоднозначно. С одной стороны, он также обладает иммуносупрессивным действием, но, с другой стороны, способен сдерживать неоангиогенез, как один из факторов прогрессии [Brower V., 2005].

Далее мы провели исследование взаимосвязи полиморфизма генов цитокинов и белка-онкосупрессора р53 с изменениями в состоянии иммунной системы. Из исследованных факторов, связанных с генетическими особенностями организма, наибольшим влиянием на вариабельность показателей иммунной системы у больных РМЖ оказывал полиморфизм гена IL-4 590 СТ. Его влияние отмечено на всех этапах лечения, а также динамического наблюдения. Полиморфизм гена IL-10 вызывал дисперсию таких показателей, как количество цитотоксических Т-клеток (CD8+) и  уровень пролиферации лимфоцитов периферической крови при стимуляции ФГА после завершения противоопухолевых мероприятий. Носительство высокоактивных полиморфных вариантов гена TNF- -308A, -238AG и -863AC при проведении НАХТ было ассоциировано с низкими значениями уровня клеточных субпопуляций – CD3+, CD4+ и CD25+ клеток соответственно. Можно предположить, что сниженные значения количества клеток на фоне химиотерапии являются следствием их предшествующей активации под воздействием TNF-, в результате чего они стали мишенями цитостатического воздействия. С-аллель IL-1(-31)CT, для которого мы отметили более высокую продукцию  IL-1, связан с повышенным  уровнем активности иммунной системы у пациенток с РМЖ. Поскольку TGF- обладает выраженным иммуносупрессивным действием, то закономерно, что у носительниц генотипа TGF-1 509 ТТ, ассоциированного с высоким уровнем цитокина в сыворотке крови, были снижены количественные показатели субпопуляций лимфоцитов и функциональная активность нейтрофилов после завершения лечения. Влияние делеции в 32 позиции гена CCR5 у больных РМЖ выражалось в более низком количестве CD4+клеток, но высоком уровне функционального резерва нейтрофилов через 1 год после лечения.

Ключевое значение гена р53 в регуляции апоптоза и ответа на генотоксический стресс как механизма поддержания генетической стабильности, распространяется и на иммунную систему. В проведенном нами исследовании полиморфизм 4 экзона гена р53 оказывал влияние на дисперсию показателей иммунной системы только на фоне цитостатического лечения (2 курса НАХТ). У больных РМЖ с генотипом Pro/Pro отмечены значительно более низкий уровень пролиферации лимфоцитов при стимуляции ФГА и высокая спонтанная активность нейтрофилов.

Полученные результаты позволяют говорить, что в ряде случаев иммунологические механизмы в качестве посредников включены в патогенетическую связь между наследственной предрасположенностью к злокачественным новообразованиям и их клинической манифестацией. Однако изменения иммунологических показателей, связанные с полиморфизмами того или иного гена, не всегда напрямую определяются биологическими эффектами кодируемого им цитокина. Более того, проведенное нами исследование взаимосвязи полиморфных вариантов генов и уровня продукции цитокинов у больных РМЖ на этапах противоопухолевого лечения выявило, что лишь продукция TNF- зависела от полиморфизмов гена, кодирующего этот цитокин: TNF-308 GA и TNF-238 GA (р=0,08 и р=0,03 соответственно). Для полиморфизмов прочих генов у больных РМЖ не выявлено статистически значимого влияния на продукцию «собственных» цитокинов.

В проведенном исследовании уровень продукции цитокинов у больных РМЖ находился под влиянием не только своего гена, но комплекса генов цитокинов близкой или противоположной функциональной направленности, что является отражением существования цитокиновой сети [Симбирцев А.С., 2003, Козлов В.А., 2003]. До начала противоопухолевого лечения с генетическими факторами была связана дисперсия лишь противовоспалительного цитокина IL-10 (рисунок 2). При проведении противоопухолевого лечения число цитокинов, вариабельность продукции которых определялась генетическими особенностями организма, возрастало. На фоне НАХТ генотип определял дисперсию факторов роста лимфоцитов, что может являться критическим механизмом для иммунотоксических эффектов цитостатического лечения.

После операции отмечена генетическая детерминированность уровня продукции провоспалительных цитокинов. После завершения специфического лечения уровень продукции практически всех исследованных цитокинов зависел от генетических особенностей организма (рисунок 2).

Комплекс генов, влияющих на экспрессию цитокинов, также претерпевал изменения в зависимости от этапа лечения.  До начала лечения преобладает влияние генов провоспалительных цитокинов. На этапе НАХТ включаются гены хемокинов (CCR5),  ген-онкосупрессор р53. Возрастает влияние гена TGF-. После завершения лечения наибольшее значение для модуляции продукции цитокинов из всех исследованных генетических факторов имел ген противовоспалительного цитокина IL-10 (рисунок 2).

Таким образом, полиморфизм генов цитокинов влияет не только на продукцию своего цитокина, но и на индукцию других, функционально с ним связанных цитокинов, что обеспечивает многосторонний и многоэтапный уровень контроля подчиненных механизмов, в том числе, состояния иммунной системы в условиях злокачественного роста.

  Помимо генетических факторов наблюдалась выраженная взаимосвязь вариабельности иммунологических показателей с адаптационным статусом у больных РМЖ на этапах противоопухолевого лечения.

Рисунок 2 – Генетическая регуляция продукции цитокинов клетками периферической крови у больных РМЖ на этапах противоопухолевого лечения

 

Механизмы действия препарата рекомбинантного IL-1 беталейкина при применении у больных РМЖ. В проведенном нами исследовании было показано, что адаптационный статус пациентки до начала противоопухолевого лечения является параметром, статистически значимо влияющим на безрецидивнную и безметастатическую выживаемость у больных РМЖ (р=0,001). На протяжении нескольких десятилетий направленная модуляция адаптационной реакции организма рассматривалась как один из перспективных методов неспецифической терапии и реабилитации онкологических больных [Гаркави Л.Х. и др., 1998, Лазарев Н.В., 1962, Пашинский В.Г., Яременко К.В., 1983].  В  основе  процесса  адаптации  организма  к  меняющимся  условиям  внешней  и внутренней среды лежит функционирование трех основных регуляторных систем организма – нервной, эндокринной и иммунной [Абрамов В.В., 1998, Корнева Е.А., 2003]. Поскольку показано наличие рецепторов на клетках одной системы к медиаторам других систем [Dantzer R., Wollman E., 1998, Lacosta S. et al., 2000], то в настоящее время не вызывает сомнений возможность их взаиморегуляции. Вышесказанное свидетельствует о том, что механизмы иммунной системы являются важным посредником осуществления того или иного типа адаптации организма к разнообразным воздействиям, включая патологические состояния.

Нами было проведено исследование применения рекомбинантного IL-1 беталейкина (НИИ особо чистых биопрепаратов, г. Санкт-Петербург) с целью увеличения резервов системы естественной резистентности организма (приобретения состояния неспецифически повышенной сопротивляемости) у больных РМЖ при проведении противоопухолевого лечения. Выявлено, что  беталейкин обладает свойствами адаптогена, которые выражались в улучшении типа адаптационной реакции при проведении НАХТ у пациенток, получавших препарат, по сравнению с группой без биотерапии.

Отмеченные свойства беталейкина резонно связать с наличием у IL-1 центральных эффектов на  ось гипоталамус-гипофиз-надпочечники и влиянием на состояние вегетативной нервной системы [Ковальчук Л.В. и др., 2001]. С другой стороны, беталейкин обладает выраженным иммуномодулирующим влиянием [Гершанович М.Л. и др., 1996, 1998]. Учитывая, что иммунная система является одной из трех регуляторных систем, то воздействие на нее может привести к модуляции функционального потенциала других регуляторных систем и изменить характер адаптации. Таким образом, именно модуляция состояния иммунной системы может быть одним из основных механизмов действия беталейкина как адаптогена. Подтверждение этому было получено в нашем исследовании. Использование в предоперационном периоде беталейкина практически не оказало влияния на иммунологические показатели у пациенток с более благоприятным клиническим течением (распространенность опухолевого процесса менее 4-х регионарных лимфатических узлов N0-1), которые исходно были близки к показателям нормы. Для этой группы не отмечено какого-либо влияния беталейкина на длительность безрецидивного периода по сравнению с контролем.

У пациенток с более агрессивным опухолевым процессом (N2, вовлечение в процесс более 4 регионарных лимфоузлов) исходно измененные по сравнению с практически здоровыми лицами значения иммунного статуса после биотерапии нормализовались. Более того, применение беталейкина у таких больных РМЖ сопровождалось тенденцией к улучшению показателей безрецидивной выживаемости в отличие от группы без применения беталейкина (р=0,09). 60% пациенток в группе применения беталейкина пережили 55 месяцев без признаков прогрессирования заболевания. В группе контроля соответствующий показатель составил 32 месяца.

Интересным оказался тот факт, что при вовлечении  в патологический процесс более 4-х регионарных лимфатических узлов, адаптогенный эффект рекомбинантного цитокина проявлялся лишь у тех пациенток, у которых был  отмечен ответ иммунной системы. Длительное наблюдение выявило следующую взаимосвязь: в группе длительной клинической ремиссией (более 6 лет) оказались пациентки, у которых при проведении лечения беталейкином иммунная система отвечала изменением большинства исследованных показателей (33 из 34). Для больных с прогрессированием заболевания после применения беталейкина без статистически значимой динамики по сравнению с исходными значениями остался 21 показатель (2=26,48, р=0,00). Иными словами, если беталейкин не оказывал влияния на состояние иммунной системы, то его применение было неэффективным для улучшения показателей безрецидивной выживаемости, которую следует рассматривать как показатель адаптации организма к опухолевому росту и проводимому лечению.

  Иммунологические механизмы противоопухолевого лечения. В настоящее время на основании клинических и экспериментальных наблюдений высказывается мнение, что механизмы иммунной системы вносят существенный вклад в обеспечение эффективности противоопухолевого лечения [Zitvogel L. et al., 2008]. Механизмы адаптивного и врожденного иммунного ответа являются эффекторным звеном опухолевой циторедукции на фоне цитостатического лечения. Значимым  является тот факт, что конвенциональное лечение оказывается тем инструментом, который возвращает иммунной системе противоопухолевую стратегию [Ehrke M.J., 2003]. На фоне специфического лечения происходит суммация циторедуктивного действия конвенциональных методов с восстановленными цитотоксическими эффектами собственной иммунной системы, что выражается в увеличении эффективности лечебных мероприятий и улучшении показателей выживаемости [MacLean G.D. et al., 1996, Dudley M.E. et al., 2005, Wrzesinski C. et al, 2007].

  Нами показано, что на фоне проводимого противоопухолевого лечения состояние иммунной системы у определенной доли пациенток с РМЖ изменяется в сторону ассоциированного с благоприятным клиническим течением заболевания. Более 30 % пациенток характеризовались расположением визуальных образов в области длительного клинического благополучия (рисунок 3 Б, В, Г), и соответственно благоприятного состояния иммунной системы по сравнению с 5% до начала противоопухолевого лечения (рисунок 3 А). Именно при проведении цитостатического лечения вовлечение механизмов иммунной системы имело наибольшее значение для того, как будет дальше развиваться злокачественный процесс. Об этом свидетельствовало число переменных, входящих в дискриминантные уравнения, описывающие состояние иммунной системы на этапах проведения НАХТ (таблица 3). Ответ на вопрос, почему именно на фоне цитостатического лечения возрастает значимость состояния иммунной системы в детерминации различных вариантов клинического течения РМЖ, очевидно, связан с участием иммунологических механизмов в реализации эффектов химиотерапии.

Помимо увеличения количества параметров, определяющих различие в состоянии иммунной системы у больных РМЖ, связанного с клиническим течением, при проведении НАХТ возрастала вариабельность иммунологических показателей. Причем основную роль факторов дисперсии играли биологические особенности злокачественных клеток и клинические параметры опухолевого процесса. По-видимому, проведение цитостатического лечения модифицирует биологические свойства опухолевых клеток, что приводит к увеличению и разнообразию реакций со стороны иммунной системы.

  Таким образом, на фоне противоопухолевого лечения состояние иммунной системы способно обрести статус ассоциированного с благоприятным клиническим течением РМЖ. Изменения в иммунном статусе связаны с увеличением вариабельности иммунных реакций в ответ на биологические свойства опухоли, модифицированные цитостатическим воздействием. Максимальное вовлечение иммунологических механизмов в дискриминацию дальнейшего клинического течения РМЖ на этапе НАХТ указывает на значение этих механизмов для эффективности проводимой химиотерапии и возможный синергизм противоопухолевых эффектов лечения и иммунной системы.

А

  Б

В

Г

Д

Рисунок 3 – Расположение визуальных образов, соответствующих состоянию иммунной системы у больных РМЖ с неизвестным исходом (черный штрих) на этапах противоопухолевого лечения, относительно группы больных без прогрессирования более 3-х лет (темно-серый цвет) и с развившимся метастазированием (светло-серый цвет); А – до начала противоопухолевого лечения, Б – 2 курса НАХТ, В – 3-4 курса НАХТ, Г – после операции, Д – через 1 год после специфического лечения

Оценка состояния иммунной системы как критерий прогноза клинического течения РМЖ. Наиболее сильным аргументом, подтверждающим, что механизмы иммунной системы имеют значение для характера течения РМЖ и эффективности его лечения, является возможность прогнозировать исход заболевания на основании оценки

состояния иммунной системы. В опубликованной в 2008 г. работе О.Е.Молчанова и А.М.Гранова представлен подход для оценки прогноза метастатического почечноклеточного рака на основе комплекса иммунологических показателей (субпопуляционный состав лимфоцитов периферической крови и концентрация цитокинов в сыворотке и плазме) [Молчанов О. Е., 2008]. При этом выделялись группы с благоприятным, относительно благоприятным и неблагоприятным прогнозом. Авторы показали, что прогноз, основанный на имеющихся сдвигах в иммунной системе, не всегда соответствует  общепризнанным прогностическим критериям. Так, в группу с относительно благоприятным прогнозом иногда попадают больные с множественными метастазами, а в группу с неблагоприятным прогнозом - с единичными метастатическими очагами. Тем не менее, у первых часто удается достичь длительной стабилизации процесса, а у вторых болезнь неуклонно прогрессирует, несмотря на проводимое лечение.

  На основании оценки системного уровня функционирования иммунной системы до начала, во время проведения и через 1 год после завершения противоопухолевого лечения, мы осуществили процедуру прогноза развития метастазов РМЖ в отдаленные органы. Полученные результаты прогнозирования были сопоставлены с документированным впоследствии исходом больных по данным объективного клинико-инструментального исследования. Чувствительность подхода (случаи с реально развившимися метастазами были предсказаны на основании показателей иммунной системы у больных РМЖ) в зависимости от этапов исследования составляла от 80% до 100 %. Отмечен высокий уровень прогностической значимости отрицательного результата (отсутствия риска развития метастазов в ближайшие 3 года от момента установления  диагноза) от 89 % до 100 %.

Таким образом, полученные данные свидетельствуют о существенной патогенетической роли иммунной системы в прогрессии РМЖ и определении исхода заболевания. При этом длительная клиническая ремиссия или прогрессирование заболевания (гематогенное метастазирование) в течение 3-х лет с момента установления диагноза ассоциированы с различной стратегией функционирования иммунной системы (рисунок 4). Статус иммунной системы и реализуемая ею стратегия формируются как результат интеграции свойств опухоли и особенностей организма и могут быть изменены в процессе проводимого противоопухолевого лечения.  Иммунологические механизмы оказывают влияние на эффективность лечебных мероприятий, таких как специфическая противоопухолевая терапия и воздействия, направленные на увеличение резервов системы общей неспецифической резистентности организма. Оценка состояния иммунной системы до начала, при проведении и после завершения противоопухолевого лечения может быть использована в качестве дополнительного критерия прогноза РМЖ.

Рисунок 4 – Основные механизмы, определяющие различия про- и противоопухолевой стратегии иммунной системы у больных РМЖ на этапах комбинированного лечения

ВЫВОДЫ:

  1. Обоснованием для исследования роли иммунной системы в патогенезе РМЖ является оценка системного уровня ее функционирования у больных с различным исходом заболевания и равноценность групп сравнения по частоте присутствия основных факторов, определяющих характер клинического течения заболевания. 
  2. Оценка системного уровня функционирования иммунной системы позволила выявить существенные различия, ассоциированные с благоприятным (состояние без признаков прогрессирования более 3-х лет с момента установления диагноза) и неблагоприятным (развитие гематогенного метастазирования в эти же сроки) течением заболевания. Различия в состоянии иммунной системы наблюдались до начала противоопухолевого лечения, на этапах его проведения (НАХТ, оперативное вмешательство) и через 1 год после завершения лечебных мероприятий.
  3. При исследовании внутрисистемной организации иммунной системы у больных РМЖ показано ведущее значение активности Т-клеточного звена на всех этапах исследования. Проведение НАХТ ассоциировано с увеличением влияния процессов пролиферации, апоптоза и утилизации циркулирующих антигенов в структуре внутрисистемной организации. Основным отличием организации функционирования иммунной системы у больных РМЖ, характеризующихся благоприятным течением заболевания, является выраженный вектор цитотоксических эффекторных реакций. Неблагоприятное течение РМЖ связано с обособлением в отдельный функциональный вектор гуморального звена системы иммунитета при проведении противоопухолевого лечения. 
  4. В условиях моделирования in vitro индукции апоптоза моноклональными антителами к CD3, CD95 и цитостатиком вепезидом  было показано, что у больных с длительным периодом без прогрессирования заболевания максимальные значения клеточной гибели отмечены на этапе НАХТ, для пациенток с развившимся впоследствии прогрессированием РМЖ – после завершения лечения. Обеспечение длительного периода без прогрессирования заболевания связано с более высоким пролиферативным потенциалом мононуклеарных клеток периферической крови, а не их чувствительностью к апоптоз-индуцирующим воздействиям со стороны опухоли  и  противоопухолевого лечения.
  5. Преобладающее влияние опухоли, организма или мероприятий лечения на вариабельность показателей иммунной системы у больных РМЖ зависит от этапа наблюдения. До начала лечения и через 1 год после его завершения доминировало влияние особенностей организма (морфофункциональная асимметрия, генотип, адаптационный статус, наличие иммунопатологического синдрома): доля иммунологических показателей, дисперсия которых зависела от параметров организма, составляла 71 % и 65 % соответственно. В процессе лечения наибольшее воздействие оказывали характеристики опухолевого процесса (влияние на 55 %  показателей после завершения НАХТ). Эффект проведенного лечения на состояние иммунной системы пациенток был наиболее выражен после его завершения (65 % показателей иммунной системы).
  6. Полиморфизм генов цитокинов IL-10592СА и TGF-509СТ оказывает влияние на длительность безрецидивной выживаемости у пациенток с РМЖ на уровне тенденции (р=0,09 и р=0,08 соответственно). Более высокие показатели безрецидивной выживаемости  отмечены у носительниц гомозиготных вариантов TGF 509 CC и IL-10 592 AA.
  7. Регуляция продукции цитокинов у больных РМЖ осуществляется как на уровне аллельных вариантов кодирующих генов, так и комплекса патогенетически значимых для РМЖ генов цитокинов  близкой или противоположной  функциональной направленности. До лечения преобладает влияние гена провоспалительного цитокина IL-1. На этапе НАХТ уровень продукции цитокинов зависит от аллельного полиморфизма генов CCR5, р53 и TGF-. После завершения лечения доминирует регуляторное влияние гена противоспалительного цитокина IL-10.
  8. Наибольшая вариабельность показателей иммунной системы у больных РМЖ на всех этапах лечения и в период динамического наблюдения связана с полиморфизмом генов IL-4 590СТ и TGFB1 509CT. У носительниц генотипа TGF- ТТ, ассоциированного с высоким уровнем экспрессии данного иммуносупрессорного  цитокина, снижены количественные показатели субпопуляций лимфоцитов (CD22+ до лечения, CD56+ после 2 курсов НАХТ, CD8+ после операции) и функциональная активность нейтрофилов после завершения лечения.
  9. Проведение специфической терапии способствует изменению проопухолевой стратегии иммунной системы на противоопухолевую. Наибольшая доля пациенток, характеризовавшихся благоприятным для длительной клинической ремиссии состоянием иммунной системы, отмечена при проведении НАХТ (38% после 2 курсов и 29% после 3-4 курсов) и удалении первичного опухолевого узла (32%). Изменение стратегии иммунной системы связано с увеличением вариативных возможностей механизмов, связанных с эффекторами иммунной системы (CD4/CD8, CD4, CD56, CD25, пролиферативная активность, IgA, IgM) в ответ на модификацию биологических свойств опухоли (экспрессия рецепторов, степень злокачественности, чувствительность к цитостатическим воздействиям) под влиянием  цитостатических воздействий.
  10. Через 1 год после окончания противоопухолевого лечения у большинства (81%) больных РМЖ состояние иммунной системы вновь обретает статус  ассоциированного с риском развития гематогенного метастазирования.
  11. Включение в схему противоопухолевого лечения препарата рекомбинантного цитокина IL-1 беталейкина способствует улучшению адаптационного статуса у больных РМЖ: по окончании НАХТ доля неблагоприятных реакций переактивации и стресса у пациенток, получавших беталейкин, составила 18% по сравнению с 50% в контрольной группе (p<0,01). Применение препарата у больных РМЖ с неблагоприятным прогнозом (вовлечение в опухолевый процесс более 4-х регионарных лимфатических узлов) приводило к увеличению периода безрецидивной выживаемости в отличие от контрольной группы: 60%-ная  безрецидивная выживаемость в группе применения беталейкина составила  55 месяцев по сравнению с 32 месяцами в группе контроля. Данный эффект препарата был связан с его влиянием на состояние иммунной системы.
  12. На основании оценки состояния иммунной системы возможен индивидуальный прогноз развития гематогенного метастазирования у больных РМЖ в течение 3-х лет с момента установления диагноза и его коррекция на этапах противоопухолевого лечения. Чувствительность модели прогноза составляет 67 - 100 % в зависимости от этапа, уровень прогностической значимости отрицательного результата - отсутствия риска развития метастазов в ближайшие 3 года от момента установления  диагноза - от 89 % до 100%.

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ:

  1. При определении варианта клинического течения и вероятного исхода РМЖ необходимо принимать во внимание особенности функционирования иммунной системы у больных данным заболеванием.
  2. При проведении комбинированного противоопухолевого лечения прогноз РМЖ необходимо корректировать с целью обеспечения адекватного индивидуализированного курса лечебных мероприятий, используя для этого оценку состояния иммунной системы у больных на этапах лечения. При этом особое значение имеют следующие показатели:
  • до начала лечения: CD4/CD8, Ig M, CD8, Ig A; 

-        после завершения 2 курсов НАХТ: CD4/CD8, спонтанная активность нейтрофилов,  Ig M, Ig A;

-        после завершения 3-4 курсов НАХТ: CD4/CD8, Ig A, CD8;

-        после оперативного удаления первичного опухолевого узла:  спонтанная активность нейтрофилов, Ig A, CD4/CD8.

  1. Процедуру оценки стратегической направленности функционирования иммунной системы следует включить в комплекс мероприятий динамического наблюдения у больных РМЖ с целью своевременного выявления признаков прогрессирования заболевания.

ПЕРЕЧЕНЬ РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

  1. Стахеева М.Н. Показатели клеточного иммунитета у больных раком легкого с различными типами адаптационных реакций в процессе проведения полихимиотерапии [текст] / М.Н. Стахеева, И.А. Дизер, Е.С. Смольянинов, В.Е. Гольдберг, Е.В. Новицкий, Е.Ю. Шерстобоев, М.Ю. Хлусова // Вопросы онкологии. 1998. № 2. С. 164-167.
  2. Слонимская Е.М. Сравнительная продукция цитокинов мононуклеарными клетками крови у больных с пролиферативными заболеваниями молочной железы [текст] / Е.М. Слонимская, Н.В. Чердынцева, Н.Н. Бабышкина, Е.Ю. Гарбуков, Е.А. Афримзон, М.Н. Стахеева // Материалы 8-й Международной конференции «СПИД, рак и родственные проблемы». Русский журнал ВИЧ/СПИД и родственные проблемы. – 2000. – Том 4, № 1. – С. 118.
  3. Стахеева М. Н. Структура адаптационных реакций и показателей системы иммунитета у больных предопухолевыми заболеваниями и раком молочной железы [текст] / М. Н. Стахеева, Е. Ю. Гарбуков, Е. М. Слонимская, Н.В. Чердынцева, Н. Н. Бабышкина, Е. А. Афримзон // Физиология организмов в нормальном и экстремальном состояниях: материалы Всероссийской конференции, посвященной памяти и 95-летию В. А. Пегеля. – Томск. – 2001. – С. 116 – 118.
  4. Слонимская Е.М. Функциональная активность иммунокомпетентных клеток у больных с мастопатией, фиброаденомой и раком молочной железы [текст] / Е.М. Слонимская, Н.В. Чердынцева, Н.Н. Бабышкина, Е.Ю. Гарбуков, Е.А. Афримзон, М.Н. Стахеева // Бюллетень экспериментальной биологии и медицины. 2000. Том 129, Прил. 1. С. 71-74.
  5. Стахеева М.Н. Структура адаптационных реакций у больных раком молочной железы при включении в схему лечения беталейкина [текст] / М.Н. Стахеева, Е.М. Слонимская, Н.В. Чердынцева, А.С. Симбирцев, А.А. Кладиев, Н.Н. Бабышкина // Тезисы докладов 4-го съезда физиологов Сибири. – Новосибирск. – 2002. – С. 268.
  6. Бабышкина Н.Н. Продукция цитокинов иммунокомпетентными клетками у больных раком молочной железы [текст] / Н.Н. Бабышкина, Е.М. Слонимская, Н.В. Чердынцева, Е.Ю. Гарбуков, М.Н. Стахеева, Е.А. Афримзон // Материалы региональной научно-практической конференции «Рак репродуктивных органов: профилактика, диагностика, лечение». – Томск. – 2002. – С. 20.
  7. Стахеева М.Н. Структура адаптационных реакций у больных с опухолевой патологией молочной железы [текст] / М.Н. Стахеева, Е.Ю. Гарбуков,  Е.М. Слонимская, Н.В. Чердынцева, Н.Н. Бабышкина // Материалы региональной научно-практической конференции «Рак репродуктивных органов: профилактика, диагностика, лечение». – Томск. – 2002. – С. 125.
  8. Шишкин Д.А. Иммунологические аспекты первично-множественных опухолей [текст] / Д.А. Шишкин, Л.В. Гердт, М.Н. Стахеева, Я.В. Кухарев, С.К. Заподовников // Иммунология Урала: Материалы ІІ конференции иммунологов Урала. – 2002. – №. 1. – С. 105-106.
  9. Бабышкина Н.Н. Функциональная активность иммунокомпетентных клеток у больных с патологией молочной железы с редким аллелем гена рецептора хемокина CCR5 del32 [текст] / Н.Н. Бабышкина, Н.В. Чердынцева, Е.М. Слонимская, М.Н. Стахеева // Материалы VІ ежегодной Российской онкологической конференции – Москва. – 2002. – С. 176.
  10. Бабышкина Н.Н. Показатели системы иммунитета у больных с пролиферативными заболеваниями молочной железы в зависимости от выраженности патологического процесса [текст] / Н.Н. Бабышкина, М.Н. Стахеева, Е.Ю. Гарбуков, Е.М. Слонимская, Н.В. Чердынцева, Е.А. Афримзон // Актуальные проблемы рака молочной железы. – Кемерово. – 2003. – Выпуск VІІ. – С. 8-10.
  11. Чердынцева Н.В. Роль цитокинов в патогенезе рака молочной железы [текст] / Н.В. Чердынцева, М.Н. Стахеева, Н.Н. Бабышкина, Н.С. Юдин, В.А. Белявская, Е.М. Слонимская, Т.М. Исаева, Н.В. Севостьянова, Л.Н. Уразова, А.Г. Ромащенко, М.И. Воевода // Медицинская иммунология: материалы VІ Всероссийского научного форума.  – Санкт-Петербург. – 2003. – Том 5, № 3-4. – С. 445.
  12. Бабышкина Н.Н. Продукция цитокинов иммунокомпетентными клетками у больных раком молочной железы [текст] / Н.Н. Бабышкина, Е.М. Слонимская, Н.В. Чердынцева, Е.Ю. Гарбуков, М.Н. Стахеева, Е.А. Афримзон // Актуальные проблемы экспериментальной и клинической онкологии: Тезисы докладов VI конференции молодых онкологов Украины. – Киев, 2003. – С. 4.
  13. Бабышкина Н.Н. Параметры системы иммунитета у больных раком молочной железы с благоприятным и неблагоприятным исходом [текст] / Н.Н. Бабышкина, Н.В. Чердынцева, Е.М. Слонимская, М.Н. Стахеева // Материалы VII Российского онкологического конгресса. – Москва. – 2003. – С. 248.
  14. Чердынцева Н.В. Иммунологические показатели у больных раком молочной железы при включении беталейкина в схему комбинированного противоопухолевого лечения [текст] / Н.В. Чердынцева, М.Н. Стахеева, Е.М. Слонимская, Н.Н. Бабышкина,  А.С. Симбирцев, А.А. Кладиев // Russian Journal of Immunology. – Екатеринбург. – 2004. – Vol. 9, Spl. 1. – С. 291.
  15. Бабышкина Н.Н. Уровень продукции цитокинов у больных с пролиферативными заболеваниями молочной железы в зависимости от выраженности патологического процесса [текст] / Н.Н. Бабышкина, М.Н. Стахеева, Е.М. Слонимская, Н.В. Чердынцева, Е.Ю.Гарбуков, Е.А. Афримзон // Современное состояние и перспективы развития экспериментальной и клинической онкологии: материалы научно-практической  конференции, посвященной 25-летию НИИ онкологии ТНЦ СО РАМН. – Томск. – 2004. – С. 44.
  16. Стахеева М.Н. Влияние беталейкина на адаптационный и иммунологический статус больных РМЖ при включении его в схему противоопухолевого лечения [текст] / М.Н. Стахеева, Е.М. Слонимская, Н.Н. Бабышкина, Н.В. Чердынцева А.С. Симбирцев, А.А. Кладиев // Современное состояние и перспективы развития экспериментальной и клинической онкологии: материалы научно-практической  конференции, посвященной 25-летию НИИ онкологии ТНЦ СО РАМН. – Томск. – 2004. – С. 244.
  17. Стахеева М.Н. Влияние беталейкина на иммунологические показатели и эффективность противоопухолевого лечения у больных РМЖ в зависимости от распространенности метастатического процесса [текст] / М.Н. Стахеева, Е.М. Слонимская, Н.Н. Бабышкина, Н.В. Чердынцева, А.С. Симбирцев, А.А. Кладиев // Медицинская иммунология: материалы VІII Всероссийского научного форума «Дни иммунологии в Санкт-Петербурге». – Санкт-Петербург. – 2004. –  Том 6, № 3-5. – С. 465.
  18. Стахеева М.Н. Иммунологические показатели у больных раком молочной железы при включении в схему комбинированного лечения беталейкина [текст] / М.Н. Стахеева, Е.М. Слонимская, Н.Н. Бабышкина, Н.В. Чердынцева, А.С. Симбирцев, А.А. Кладиев // Медицинская иммунология. 2005. Том 7, № 1. С. 63 -72.
  19. Кологривова Е.Н. Анализ корреляционных связей показателей иммунограммы и адаптационного индекса у больных раком различной локализации и здоровых доноров [текст] / Е.Н. Кологривова, Я.В. Кухарев, Д.А. Шишкин, М.Н. Стахеева, С.К. Заподовников // Сибирский онкологический журнал. 2005. - № 2. С. 30-33.
  20. Стахеева М.Н. Уровень апоптоза мононуклеарных клеток периферической крови у больных РМЖ при проведении НХТ в зависимости от степени регионарного метастазирования [текст] / М.Н. Стахеева, Е.М. Слонимская, Н.В. Чердынцева, Н.Н. Бабышкина // Материалы Второй Международной ежегодной онкологической конференции «Проблемы лечения и диагностики рака молочной железы». – Санкт-Петербург. – 2005. – С. 138.
  21. Стахеева М.Н. Уровень апоптоза мононуклеарных клеток периферической крови у больных раком молочной железы при проведении неоадъювантной химиотерапии [текст] / М.Н. Стахеева, Н.В. Чердынцева, Е.М. Слонимская, Н.Н. Бабышкина // Материалы IX Всероссийского научного форума с международным участием имени акад. В.И.Иоффе «Дни иммунологии в Санкт-Петербурге «Молекулярные основы иммунорегуляции, иммунодиагностики и иммунотерапии». Медицинская иммунология. – 2005. – Том 7, №  2-3. - С. 210.
  22. Стахеева М.Н. Чувствительность мононуклеарных клеток  периферической крови у больных РМЖ к апоптоз-индуцирующему действию [текст] / М.Н. Стахеева, Н.В. Чердынцева, Е.М. Слонимская, Н.Н. Бабышкина // Материалы II Международной конференции «Молекулярная медицина и биобезопасность». – Москва. – 2005. – С. 58.
  23. Бабышкина Н.Н. Функциональная активность лимфоцитов и продукция цитокинов у больных с предопухолевой и опухолевой патологией молочной железы в зависимости от аллельного полиморфизма гена хемокинового рецептора CCR5 [текст] / Н.Н. Бабышкина, П.А. Гервас, Е.В. Денисов, М.Н. Стахеева, Е.М. Слонимская, Н.В. Чердынцева // Цитокины и воспаление. – 2005. – Том 4., № 2. – С. 78.
  24. Н.Н. Бабышкина Распределение генотипов хемокинового рецептора CCR5 и уровень экспрессии CCR5 у больных раком молочной железы [текст] / Н.Н. Бабышкина, П.А. Гервас, Е.В. Денисов, М.Н. Стахеева, Е.М. Слонимская, Н.В. Чердынцева // Материалы Всероссийской научно-практической конференции, посвященной 15-летнему юбилею Красноярского краевого центра по профилактике и борьбе со СПИД и др. инфекционными заболеваниями. – Красноярск. – 2005. – С. 76-77.
  25. Чердынцева Н.В. Полиморфизм генов цитокинов и особенности иммунологического статуса у больных раком молочной железы [текст] / Н.В. Чердынцева, Е.М. Слонимская, В.А. Белявская, Н.Н. Бабышкина, П.А. Гервас, М.Н. Стахеева, Н.В. Литвяков, Е.А. Денисов, М.И. Воевода // Материалы Всероссийской научно-практической конференции, посвященной 15-летнему юбилею Красноярского краевого центра по профилактике и борьбе со СПИД и др. инфекционными заболеваниями. – Красноярск. – 2005. – С. 97-98.
  26. Гервас П.А. Исследование полиморфизма 72 кодона гена р53 у больных раком молочной железы [текст] / П.А. Гервас, Н.Н. Бабышкина, Е.М. Слонимская, Е.В. Денисов, М.Н. Стахеева, Н.В. Чердынцева // Материалы конференции «Актуальные вопросы здравоохранения регионов Сибири». – Красноярск. – 2005. – С. 299.
  27. Авдеев С.В. Ксеноновая анестезия в комплексе комбинированного лечения больных раком молочной железы [текст] / С.В. Авдеев, Е.М. Слонимская, В.М. Одышев, М.Н. Стахеева, С.Л. Стуканов // Материалы IV съезда онкологов и радиологов СНГ. – Баку. – 2006. – С. 277.
  28. Стахеева М.Н. Показатели апоптоза мононуклеарных клеток периферической крови у больных раком молочной железы при проведении НХТ в зависимости от степени регионарного метастазирования [текст] / М.Н. Стахеева, Н.В. Чердынцева, Е.М. Слонимская, Н.Н. Бабышкина, Я.В. Кухарев // Медицинская иммунология: материалы X Всероссийского научного форума «Дни иммунологии в Санкт-Петербурге». – 2006. – Том 8, № 2-3. – С. 351-352.
  29. Литвяков Н.В. Экспрессия гена хемокинового рецептора CCR5 в лимфоцитах периферической крови больных раком молочной железы в процессе лечения [текст] / Н.В. Литвяков, А.А. Пономарева, М.Н. Стахеева, П.А. Гервас, Н.В. Чердынцева, Е.М. Слонимская, Е.Ю. Гарбуков, Н.Н. Бабышкина, Е.В. Денисов // Медицинская иммунология: материалы X Всероссийского научного форума «Дни иммунологии в Санкт-Петербурге». – 2006. – Том. 8, № 2-3. – С. 354-355.
  30. Чердынцева Н.В. Хемокины и прогрессия злокачественных новообразований [текст] / Н.В. Чердынцева, П.А. Гервас, Н.В. Литвяков, М.Н. Стахеева, В.А. Белявская,  Е.В. Денисов, Н.Н. Бабышкина, Е.М. Слонимская,  Я.В. Кухарев, С.А. Тузиков, Н.В. Севостьянова, М.И. Воевода // Медицинская иммунология: материалы X Всероссийского научного форума «Дни иммунологии в Санкт-Петербурге». – 2006. -  Том 8, № 2-3. – С. 355-356.
  31. Бабышкина Н.Н. Иммунологические параметры и уровень продукции цитокинов у больных с пролиферативными заболеваниями и раком молочной железы [текст]/ Н.Н. Бабышкина, М.Н. Стахеева, Е.М. Слонимская, Н.В. Чердынцева, Е.Ю. Гарбуков // Цитокины и воспаление. 2006. Том 5, № 1. С. 37-43.
  32. Стахеева М.Н. Показатели пролиферации и  апоптоза мононуклеарных клеток периферической крови у больных раком молочной железы при проведении неоадъювантной химиотерапии [текст] / М.Н. Стахеева, Н.В. Чердынцева, Е.М. Слонимская, Е.Ю. Гарбуков, Н.Н. Бабышкина, М.Р. Галимуллина // Материалы Всероссийской научно-практической конференции «Дни иммунологии в Сибири» - Красноярск. – 2006. – С. 148-149.
  33. Литвяков Н.В. Экспрессия рецептора хемокинов в лимфоцитах крови больных раком молочной железы: взаимосвязь с показателями иммунитета и клинико-морфологическими параметрами [текст] / Н.В. Литвяков, М.Н. Стахеева, А.А. Пономарева, Е.Ю. Гарбуков, Н.В. Чердынцева // «Вестник ТГУ»: материалы Всероссийской научной конференции «Механизмы индивидуальной адаптации». – Томск. – 2006. – С. 35.
  34. Кухарев Я.В. Особенности иммунологических показателей у больных раком молочной железы с различными адаптационными реакциями [текст] / Я.В. Кухарев, М.Н. Стахеева, Е.Н. Кологривова, А.В. Сорокина // «Вестник ТГУ»: материалы Всероссийской научной конференции «Механизмы индивидуальной адаптации». – Томск. – 2006. – С. 32.
  35. Чердынцева Н.В. Исследование связи полиморфизма генов онкосупрессора р53, гена хемокинового рецептора CCR5 и  их сочетаний с риском развития и прогрессированием рака молочной железы [текст] / Н.В. Чердынцева, Е.М. Слонимская, В.А. Белявская, Н.Н. Бабышкина, Н.А. Сметанникова, П.А. Гервас, Е.В. Денисов,  М.Н. Стахеева, Е.Ю. Гарбуков, Е.А. Малиновская, Н.В. Литвяков, М.И. Воевода // Молекулярная медицина. - 2007. № 1. С. 23-31.
  36. Чердынцева Н.В. Механизмы опухолевой прогрессии: роль генов апоптоза и цитокинов [текст] / Н.В. Чердынцева, Е.М. Слонимская, Н.В. Литвяков, М.Н. Стахеева, Н.Н. Бабышкина, Е.Ю. Гарбуков,  Е.А. Малиновская, Е.В. Денисов,  А.В. Дорошенко, Н.А. Красулина // Молекулярно-биологические технологии в медицинской практике/ Ред. А. Б.Масленникова. – Новосибирск. – 2007. – Выпуск 11. – C. 28-39.
  37. Литвяков Н.В. Взаимосвязь уровня экспрессии рецептора хемокинов CCR5 в лейкоцитах крови с показателями иммунитета при раке молочной железы [текст] / Н.В. Литвяков, М.Н. Стахеева, Е.Ю. Гарбуков, А.А. Пономарева, Е.М. Слонимская, Н.В. Чердынцева // Медицинская иммунология: материалы XI Всероссийского научного Форума с международным участием им. академика В. И. Иоффе "Дни иммунологии в Санкт-Петербурге". – 2007. – Том 9, № 2/3. – С. 279-280.
  38. Стахеева М.Н. Влияние степени регионарного метастазирования на показатели количественного гомеостаза клеток иммунной системы у больных раком молочной железы [текст] / М.Н. Стахеева, Н.В. Чердынцева, Е.М. Слонимская, Н.Н. Бабышкина, Е.Ю. Гарбуков, Я.В. Кухарев, М.Р. Галимуллина // Профилактика и лечение злокачественных новообразований в современных условиях: материалы Российской научно-практической конференции с международным участием.-  Барнаул. – 2007. – С. 256-257.
  39. Чердынцева Н.В. Подходы генетической эпидемиологии: от оценки риска до прогнозирования исхода злокачественных новообразований [текст] / Н.В. Чердынцева, П.А. Гервас, Е.А. Малиновская,  Н.Н. Бабышкина,  Н.В. Литвяков, Е.В. Денисов, Е.М. Слонимская, М.Н. Стахеева,  С.А. Тузиков,  В.А. Белявская, М.И. Воевода, В.М. Перельмутер // Basic Science for medicine: 3rd international conference. – Novosibirsk. – 2007. – С. 81.
  40. Стахеева М.Н. Влияние беталейкина на состояние адаптационного статуса и системы иммунитета у больных местно-распространенным раком молочной железы [текст] / М.Н. Стахеева, Я.В. Кухарев, Е.М. Слонимская, Е.Ю. Гарбуков, Н.Н. Бабышкина, А.В. Дорошенко, Н.В. Чердынцева // Создание новых лекарственных препаратов: материалы республиканской научной конференции. – Томск. – 2007. – С. 59-61.
  41. Стахеева М.Н. Показатели апоптоза, пролиферации и продукции цитокинов мононуклеарными клетками периферической крови у больных РМЖ [текст] / М.Н. Стахеева, Н.В. Чердынцева, Е.М. Слонимская, Е.Ю. Гарбуков, Н.Н. Бабышкина, Я.В. Кухарев, М.Р. Галимуллина // Медицинская иммунология: материалы XI Всероссийского научного Форума с международным участием им. академика В. И. Иоффе "Дни иммунологии в Санкт-Петербурге". – 2007. – Том 9, № 2/3. – С. 289.
  42. Стахеева М.Н. Эффективность неоадъювантной химиотерапии и показатели иммунного статуса у больных раком молочной железы [текст] / Я.В. Кухарев, М.Н. Стахеева, Е.Н. Кологривова, А.В. Черников, А.В. Сорокина, Ч.К. Серенот, Е.Ю. Гарбуков, А.В. Дорошенко, Н.А. Красулина, Ю.Л. Кокорина, Н.В. Чердынцева, Е.М. Слонимская // Материалы четвертой международной ежегодной онкологической конференции «Проблемы лечения и диагностики рака молочной железы». – Санкт-Петербург. – 2007. – С. 75-76.
  43. Стахеева М.Н. Исследование связи параметров иммунной системы с эффективностью неоадъвантной химиотерапии у больных раком молочной железы [текст] / М.Н. Стахеева, Я.В. Кухарев, Е.Ю. Гарбуков, Н.В. Литвяков, Н.Н. Бабышкина, А.А. Медюхина, А.В. Дорошенко, Ю.А. Кокорина, Е.М. Слонимская, Е.Н. Кологривова, Н.В. Чердынцева // Сибирский медицинский журнал. 2008.   №3 (выпуск 1). С. 39 43.
  44. Одышев В.М. Влияние анестезии ксеноном и закисью азота на адаптационный статус больных раком молочной железы [текст]/ В.М. Одышев, С.В. Авдеев, Е.М. Слонимская, М.Н. Стахеева, А.В. Стреж // Сибирский онкологический журнал. 2008. № 4 (28). С. 32 35.
  45. Стахеева М.Н. Особенности состояния иммунной системы до начала лечения у больных РМЖ с прогрессированием заболевания [текст] / М.Н. Стахеева, Я.В. Кухарев, Н.В. Чердынцева, Е.М. Слонимская, Е.Ю. Гарбуков, Н.Н. Бабышкина,  Ю.А. Кокорина, А.В. Дорошенко // Сибирский медицинский журнал: материалы научной конференции с международным участием “Дни иммунологии в Сибири - 2008”. – Томск. – 2008. – № 3. – С. 116 – 117.
  46. Денисов Е.В. Мутации в гене-супрессоре ТР53 и их связь с особенностями клинического течения рака молочной железы [текст]/ Е.В. Денисов, Н.В. Литвяков, М.Н. Стахеева, Е.Ю. Гарбуков, Е.М. Слонимская, Е.А. Малиновская, Н.Н. Бабышкина, В.Н. Стегний, Н.В. Чердынцева // Сибирский онкологический журнал. 2008. -  № 2 (26). С. 33-36.
  47. Кухарев Я.В. Связь параметров иммунной системы с клинико-морфологическими характеристиками опухоли у больных раком молочной железы [текст] / Я.В. Кухарев, М.Н. Стахеева, Е.Н. Кологривова, Н.В. Литвяков, Н.Н. Бабышкина,  Е.Ю. Гарбуков, А.В. Дорошенко, Ю.А. Кокорина, А.А. Медюхина // Сибирский медицинский  журнал: материалы научной конференции с международным участием “Дни иммунологии в Сибири - 2008”. – Томск. – 2008. –  № 3. – С. 106.
  48. Литвяков Н.В. Экспрессия генов CCR5 и RANTES  в лейкоцитах крови и опухоли больных раком молочной железы [текст] / Н.В. Литвяков, Е.Ю. Гарбуков, А.А. Пономарева, М.Н. Стахеева, Е.М. Слонимская, Н.В. Чердынцева // Сибирский медицинский  журнал: материалы научной конференции с международным участием “Дни иммунологии в Сибири - 2008”. – Томск. – 2008. – № 3. – С. 102 – 103.
  49. Чердынцева Н.В. Иммунная система у больных раком молочной железы: связь с прогрессией и эффективностью цитостатической терапии [текст] / Н.В. Чердынцева, М.Н. Стахеева, Н.В. Литвяков, Н.Н. Бабышкина, Е.А. Малиновская, Я.В. Кухарев, Е.Ю. Гарбуков, Е.М. Слонимская // Сибирский медицинский журнал: материалы научной конференции с международным участием “Дни иммунологии в Сибири - 2008”. – Томск. – 2008. – № 3. – С. 123 – 124.
  50. Бабышкина Н.Н. Изучение связи полиморфных вариантов генов CCR5 и P53 с лимфогенным метастазированием у больных раком молочной железы [текст] / Н.Н. Бабышкина, Е.А. Малиновская,  Е.В. Денисов,  М.Н. Стахеева, Е.М. Слонимская, Н.В. Чердынцева // Сибирский онкологический журнал. – 2008. – Прил. 2. –  С. 25-26.
  51. Стахеева М.Н. Неадъювантная химиотерапия как фактор модуляции активности иммунной системы у больных раком молочной железы или прогрессировании заболевания [текст] / М.Н. Стахеева, Я.В. Кухарев, Е.Ю. Гарбуков, Е.М. Слонимская, Н.Н. Бабышкина, Ю.Л. Кокорина, А.В. Дорошенко, Н.В. Чердынцева // Сибирский онкологический журнал. – 2008. – Прил. 2. – С. 82-83.
  52. Бабышкина Н.Н. Взаимосвязь полиморфных вариантов гена-онкосупрессора Р53 и гена хемокинового рецептора CCR5 с риском возникновения и прогрессированием рака молочной железы [текст] / Н.Н. Бабышкина, Е.А. Малиновская, Е.В. Денисов, М.Н. Стахеева, Н.В. Чердынцева, Е.М. Слонимская // Материалы Всероссийской конференции с международным участием «Молекулярная онкология». – Новосибирск. – 2008. – С. 77-78.
  53. Кухарев Я.В. Особенности иммунного статуса у больных раком молочной железы с клиническими проявлениями иммунной недостаточности [текст] / Я.В. Кухарев, М.Н. Стахеева, Е.Н. Кологривова, А.В. Черников, А.В. Сорокина, Е.М. Слонимская, Е.Ю. Гарбуков, А.В. Дорошенко, Н.А. Красулина, Ю.Л. Кокорина // Российский аллергологический журнал: материалы VIII Конгресса РААКИ. – Москва. – 2008. – № 1, Прил. 1. – С. 149-150.
  54. Кухарев Я.В. Взаимосвязь эффективности неоадъювантной химиотерапии и параметров иммунного статуса у больных раком молочной железы [текст] / Я.В. Кухарев, М.Н. Стахеева, Е.Н. Кологривова, Е.М. Слонимская, А.А. Медюхина, Е.Ю. Гарбуков, А.В. Дорошенко, Н.А. Красулина, Ю.Л. Кокорина, Н.В. Чердынцева // Российский иммунологический журнал: материалы Объединенного иммунологического форума. – Санкт-Петербург. – 2008. – Том 2(11), № 2-3. – С. 310.
  55. Чердынцева Н.В. Иммунная система вносит вклад в эффективность цитостатической терапии рака [текст] / Н.В. Чердынцева, М.Н. Стахеева, Н.В. Литвяков, Н.Н. Бабышкина, Е.М. Слонимская, Е.А. Малиновская, Е.В. Денисов, Я.В. Кухарев, Е.Ю. Гарбуков, Н.Н. Бабышкина // Российский иммунологический журнал: материалы Объединенного иммунологического форума. – Санкт-Петербург. – 2008. – Том 2(11), № 2-3. – С. 316.
  56. Odyshev V. On the influence of xenon anesthesia and nitrous oxide on immune status on patients with cancer of the breast  [text] / V. Odyshev, M. Staheeva, S. Avdeev, E. Slonimskaya // 21st Internatinal Congress of Israel Society of Anesthesiologists. – Tel Aviv. – 2008. – P. 180.
  57. Перельмутер В.М. Генетические и клинико-патологические особенности рака молочной железы у больных с сохраненной менструальной функцией и в менопаузе [текст] / В.М. Перельмутер, М.В. Завьялова, С.В. Вторушин, Е.М. Слонимская, Н.Г. Крицкая, Е.Ю. Гарбуков, Н.В. Литвяков, М.Н. Стахеева, Н.Н. Бабышкина, Е.А. Малиновская, Е.В. Денисов, Е.С. Григорьева, М.С. Назаренко, С.В. Сенников, Е.П. Горева, В.А. Козлов, М.И. Воевода, В.Н. Максимов, В.А. Белявская, Н.В. Чердынцева // Успехи геронтологии. 2008. Том 21, № 4. С. 643-653.
  58. Завьялова М.В. Взаимосвязь чувствительности опухоли к неоадъювантной химиотерапии с морфологическим строением первичного опухолевого узла при уницентрическом инфильтрирующем протоковом раке молочной железы [текст] / М.В. Завьялова, Н.В. Литвяков, Е.Ю. Гарбуков, С.В. Вторушин, М.Н. Стахеева, О.В. Савенкова, Н.В. Крицкая, В.М. Перельмутер, Е.М. Слонимская, Н.В. Чердынцева // Сибирский онкологический журнал. 2008. № 5.  С. 30-35.
  59. Шевченко А.В. Полиморфизм промоторного региона генов IL-4, Il-6 и IL-10 у пациенток с раком молочной железы [текст] / А.В. Шевченко, О.В. Голованова, М.Ю. Коломейчук, В.И. Коненков, Е.Ю. Гарбуков, М.Н. Стахеева // Медицинская иммунология. 2009. Том 11, № 1. С. 21-28.
  60. Гервас П.А. Влияние полиморфизма генов апоптоза и репарации на эффективность неоадъювантной химиотерапии злокачественных новообразований [текст] / П.А. Гервас, Н.В. Литвяков, М.Н. Стахеева, С.В. Миллер, А.Ю. Добродеев, Е.Ю. Гарбуков, Н.Н. Бабышкина, Я.В. Кухарев, М.В. Васильева, Е.М. Слонимская, В.А. Белявская, С.А. Тузиков, Н.В. Чердынцева //Сибирский онкологический журнал. 2009. № 4. С. 41-47.
  61. Чердынцева Н.В. Генетические полиморфизмы в риске формирования и прогрессии рака молочной железы в Сибирском регионе России [текст] / Н.В. Чердынцева, Е.М. Слонимская, В.М. Перельмутер, М.В. Завьялова, С.В. Вторушин, Л.Ф. Гуляева, В.О. Пустыльняк, Е.Ю. Гарбуков, Н.В. Литвяков, М.Н. Стахеева, Н.Н. Бабышкина, Е.А. Малиновская, Е.В. Денисов, Е.С. Григорьева, И.Н. Лебедев, М.С. Назаренко, С.В. Сенников, А.Н. Силков, А.С. Жовмер, Е.П. Горева, А.Ю. Гришанова, О.Б. Горева, Т.А. Середина, В.О. Талабан, В.В. Ляхович, О.В. Голованова, А.В. Шевченко, М.Ю. Салахутдинова, В.Н. Максимов, М.И. Воевода, В.И. Коненков, В.П. Пузырев, В.А. Козлов // Опыт научно-технического и инновационного сотрудничества Томской области и Тайваня: материалы Сибирско-Тайваньского форума – Томск. – 2009. – Том 2. – С. 19-25.
  62. Бабышкина Н.Н. Взаимосвязь полиморфных вариантов генов ангиогенеза с инфильтрирующим протоковым раком молочной железы [текст] / Н.Н. Бабышкина, В.Н. Максимов, М.И. Воевода, М.Ю. Салахутдинова, А.В. Шевченко, В.И. Коненков, Е.А. Малиновская, М.Н. Стахеева, Н.В. Чердынцева, Е.М. Слонимская // Опыт научно-технического и инновационного сотрудничества Томской области и Тайваня: материалы Сибирско-Тайваньского форума – Томск. – 2009. – Том 2. – С. 97-99.
  63. Стахеева М.Н. Состояние иммунной системы у больных РМЖ и его взаимосвязь с эффективностью НАХТ и исходом заболевания [текст] / М.Н. Стахеева, Я.В. Кухарев,  Е.М. Слонимская, Е.Ю. Гарбуков, Н.Н. Бабышкина, Ю.Л. Кокорина, А.В. Дорошенко, М.Р. Патышева, Н.В. Чердынцева // Проблемы современной онкологии: материалы Российской научно-практической конференции с международным участием. – Барнаул. – 2009.  – С. 138.
  64. Стахеева М.Н. Динамика состояния иммунной системы у больных раком молочной железы при проведении противоопухолевого лечения как показатель его эффективности [текст] / М.Н. Стахеева, Я.В. Кухарев, Н.В. Чердынцева, Е.М. Слонимская, Е.Ю. Гарбуков, Н.Н. Бабышкина, Ю.Л. Кокорина, А.В. Дорошенко, Н.А. Тарабановская, М.Р. Патышева // Сибирский онкологический журнал. – 2009, Прил. № 2. – С. 184-185.
  65. Стахеева М.Н. Функциональные резервы цитокин-продуцирующей и пролиферативной активности иммунной системы у больных РМЖ с различным исходом [текст] / М.Н. Стахеева, Я.В. Кухарев, Н.В. Чердынцева, Е.М. Слонимская, Н.Н. Бабышкина, Е.Ю. Гарбуков, М.Р. Патышева, А.В. Дорошенко, Ю.Л. Кокорина, Н.А. Тарабановская // Фундаментальные аспекты компенсаторно-приспособительных процессов: материалы четвертой Всероссийской научно-практической конференции с международным участием. – Новосибирск. – 2009 - С. 247.
  66. Свиридова В.С. Иммунорегуляторные субпопуляции Т-клеток при опухолевом росте и аллергических заболеваниях [текст] / В.С. Свиридова, В.В. Климов, А.А. Денисов, М.Н. Стахеева, М.В. Васильева, Н.В. Чердынцева //Сибирский онкологический журнал. 2010. Том 39, № 3. С. 38-48.
  67. Cherdyntseva N.V. Age-related function of tumor suppressor gene TP53: contribution to cancer risk and progression [text] / N.V. Cherdyntseva, P.A. Gervas, N.V. Litvyakov, M.N. Stakcheeva, A.A. Ponomareva, A.Yu. Dobrodeev, E.V. Denisov, V.A. Belyavskaya, E.L. Choinzonov // Experimental oncology. 2010. Vol. 32, Spl. P. 205 208.
  68. Бабышкина Н.Н. Роль трансформирующего ростового фактора TGF-1 в патогенезе рака молочной железы [текст] / Н.Н. Бабышкина, Е.А. Малиновская, М.Н. Стахеева, В.В. Волкоморов, А.А. Уфандеев, Е.М. Слонимская //Сибирский онкологический журнал. 2010. - № 6. С. 63-70.
  69. Stakheyeva M.N. Immune system factor organization with respect to breast cancer outcome [text] / M.N. Stakheyeva, D. Eidenzon, E.M. Slonimskaya, J.V. Kukharev, E.J. Garbukov, N.V. Cherdyntseva // International conference “Tumor and host: novel aspects of old problem”. – Kyiv. – 2010. – Experimental oncology. – 2010. – Vol. 32, Spl. – P. 101-102.
  70. Стахеева М.Н. Взаимосвязь уровня продукции IL-1 клетками периферической крови у больных раком молочной железы с различным исходом [текст] / М.Н. Стахеева, Е.М. Слонимская, Я.В. Кухарев, Е.Ю. Гарбуков, Е.П. Горева, С.В. Сенников, В.А. Козлов, Н.В. Чердынцева // Цитокины и воспаление: материалы Всероссийской научной конференции «Молекулярно-генетические основы функционирования цитокиновой сети в норме и при патологии». – Новосибирск. – 2010. – Том 9, № 3. – С. 72 – 73.
  71. Чердынцева Н.В. Цитокины в патогенезе злокачественных новообразований [текст] / Н.В. Чердынцева, М.Н. Стахеева, Н.В. Литвяков, Н.Н. Бабышкина, Е.А. Малиновская, Е.М. Слонимская // Цитокины и воспаление: материалы Всероссийской научной конференции «Молекулярно-генетические основы функционирования цитокиновой сети в норме и при патологии». – Новосибирск. – 2010. – Том 9, № 3. – С. 74.
  72. Babyshkina N. Association of functional 509C>T polymorphism in the TGF-1 gene with infiltrating ductal breast carcinoma risk in a Russian Western Siberian population [text] / N. Babyshkina, E. Malinovskaya, M. Stakheyeva, V. Volkomorov, E. Slonimskaya, V. Maximov, N. Cherdyntseva.// Cancer Epidemiology. DOI: 10.1016/j.canep.2011.02.002.
  73. Стахеева М.Н. Взаимосвязь состояния иммунной системы как интегрированного целого с клиническим течением рака молочной железы / М.Н. Стахеева, Д. Эйдензон, Е.М. Слонимская, Я.В. Кухарев, Е.Ю. Гарбуков, Н.Н. Бабышкина,  Н.В. Чердынцева // Сибирский онкологический журнал. 2011. - № 2. С. 11-19.

ИЗОБРЕТЕНИЯ

  1. Средство, обладающее адаптогенным действием, и Способ подготовки больных раком молочной железы к проведению специфического противоопухолевого лечения  с включением полихимиотерапии [текст] / Н.В. Чердынцева, Е.М. Слонимская, А.С. Симбирцев, М.Н. Стахеева, Н.Н. Бабышкина // Патент № 2304445 Российская Федерация. –  заявл. 20.10.2004, опубл. 20.08.2007, Бюл. № 23.
  2. Способ прогнозирования гематогенного метастазирования у больных раком молочной железы, основанный на оценке состояния иммунной системы при проведении противоопухолевого лечения / М.Н. Стахеева, Д. Эйдензон, Е.М. Слонимская, Н.В. Чердынцева, Е.Ю. Гарбуков, Я.В. Кухарев. – положительное решение о выдаче патента на изобретение от 3.05.2011. –  Заявл. 15. 07. 2010 № 2010129630.

БЛАГОДАРНОСТИ

Автор выражает глубокую признательность и благодарность д.б.н., профессору Н. В. Чердынцевой, д.м.н., профессору Е. М. Слонимской, к.т.н. Д. Эйдензону, академику РАМН В. А. Козлову, академику РАМН В. И. Коненкову, академику РАМН  В. П. Пузыреву, члену-корреспонденту РАМН М. И. Воеводе, д.м.н., профессору А. С. Симбирцеву, д.м.н., профессору В. М. Перельмутеру, д.б.н., профессору Л. Ф. Гуляевой, д.м.н., профессору С. В. Сенникову, д.б.н., профессору В. В. Ляхович, д.б.н. И. Н. Лебедеву, д.м.н. В. Н. Максимову, д.м.н. М. В.Завьяловой, д.б.н.  А. Ю. Гришановой, к.б.н. О. В. Головановой, к.б.н. А. В. Шевченко, к.м.н.  Е. Ю.Гарбукову, к.б.н. О. Б. Горевой, к.м.н. С. В. Вторушину, к.б.н. Н. В. Литвякову, к.м.н. Н. Н. Бабышкиной, к.м.н. П. А. Гервас, к.б.н. Е. А. Малиновской, к.б.н. М. А. Булдакову, к.б.н. Е. В. Денисову, к.б.н. В. О. Пустыльняк, к.б.н. М. С. Назаренко, к.б.н. А. Н. Силкову, Я. В. Кухареву, Ю. Л. Кокориной, А. В. Дорошенко, Н. А. Тарабановской, А. С. Жовмер, Е. П. Горевой, Т. А. Серединой, В. О. Талабан, М. Ю. Салахутдиновой, сотрудникам клинической группы лаборатории иммунологии М. Г. Клебан и О. Г. Ермоленко за помощь, оказанную при проведении исследований и обсуждении результатов.

СПИСОК ИСПОЛЬЗОВАННЫХ СОКРАЩЕНИЙ

АЛТ – адъювантная лучевая терапия

АХТ – адъювантная химиотерапия

ГТ – гормональная терапия

ИРИ – иммунорегуляторный индекс

ИОЛТ – интраоперационная лучевая терапия

ИПС – иммунопатологический синдром

ЛПС- липополисахарид

ЛТ – лучевая терапия

МНПК – мононуклеарные клетки периферической крови

НАХТ – неоадъювантная химиотерапия

НСТ – нитросиний тетразолий

РБТЛ – реакция бласттрансформации лимфоцитов

РМЖ – рак молочной железы

ФГА – фитогемагглютинин

ЦИК – циркулирующие иммунные комплексы

CAF – циклофосфан-адриамицин-5-фторурацил

CCR – рецептор хемокина

CD – кластер дифференцировки

CMF - циклофосфан-метотрексат-5-фторурацил

FAC – 5-фторурацил-адриамицин-циклофосфан

HER – рецептор эпителиального фактора роста человека

IFN – интерферон

Ig – иммуноглобулин

IL – интерлейкин

NK – естественные клетки-киллеры

Th – Т-хелперы

TGF- – трансформирующий фактор роста

TNF- – фактор некроза опухоли альфа






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.