WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

ПОРХАНОВА

Наталья Владимировна

РОЛЬ ГЕНЕТИЧЕСКОГО СКРИНИНГА В ПРОФИЛАКТИКЕ,

ДИАГНОСТИКЕ И ЛЕЧЕНИИ РАКА ЯИЧНИКОВ

14.00.14 – онкология

АВТОРЕФЕРАТ

диссертации на соискание учёной степени

доктора медицинских наук

Ростов-на-Дону

2009

РАБОТА ВЫПОЛНЕНА В КУБАНСКОМ ГОСУДАРСТВЕННОМ МЕДИЦИНСКОМ УНИВЕРСИТЕТЕ И В ФЕДЕРАЛЬНОМ ГОСУДАРСТВЕННОМ УЧРЕЖДЕНИИ ЗДРАВООХРАНЕНИЯ

«КРАСНОДАРСКИЙ КРАЕВОЙ КЛИНИЧЕСКИЙ ОНКОЛОГИЧЕСКИЙ ДИСПАНСЕР» ДЕПАРТАМЕНТА ЗДРАВООХРАНЕНИЯ КРАСНОДАРСКОГО КРАЯ

Научный консультант:  - доктор медицинских наук,

профессор Е.Н. Имянитов

Официальные оппоненты: - доктор медицинских наук,

  профессор Л.А. Ашрафян

  - доктор биологических наук,

профессор Н.В.Чердынцева

       

- доктор медицинских наук,

профессор Л.Ю. Голотина

Ведущая организация:   - ГУ Российский онкологический

научный центр им. Н.Н.Блохина РАМН

Защита диссертации состоится  «____» __________ 2009 г. в_____ часов на заседании совета по защите докторских и кандидатских диссертаций Д.208.083.01 при Федеральном государственном учреждении «Ростовский научно-исследовательский онкологический институт Росмедтехнологий» (344037, г. Ростов-на-Дону, 14-я линия, 63).

С диссертацией можно ознакомиться в библиотеке ФГУ «Ростовский  научно-исследовательский онкологический институт Росмедтехнологий»

Автореферат разослан  «____» __________  2009 г.

Ученый секретарь совета по защите

докторских и кандидатских диссертаций,

член-корреспондент РАМН, профессор  Г.А. Неродо

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы исследования. Рак яичников занимает третье место в структуре онкологической заболеваемости органов репродуктивной системы у женщин. По данным Международного агентства по изучению рака (МАИР), ежегодно в мире регистрируется более 165 тысяч новых случаев рака яичников и более 101000 смертей от прогрессирования этой патологии. Индивидуальный риск рака яичников составляет примерно 1,6%. Пик заболеваемости отмечается между 60-70 годами и составляет примерно 65 случаев на 100000 женского населения в год, тогда как до 40 лет этот показатель почти в 5 раз ниже (Ozols R.F. et al., 2005). Усредненные показатели заболеваемости, учитывающие женщин всех возрастов, несколько превышают 10 случаев рака яичников на 100000 женщин в год (в странах Северной Европы – 12,7; в Западной Европе – 11,6; в Северной Америке – 11,2; в Восточной Европе – 10,0). Наименьшие показатели заболеваемости раком яичников наблюдаются в странах Азии и Северной Африки (Daly M.B., 2003).

В большинстве индустриальных стран мира рак яичников имеет самые высокие показатели смертности среди опухолей женской репродуктивной системы, что связано с поздней диагностикой заболевания. Летальность больных раком яичников в течение года после постановки диагноза составляет около 35%. По сводным данным популяционных раковых регистров стран Европы, трехлетняя выживаемость больных раком яичников лишь немного превышает 40%. За последнее десятилетие 5-летняя выживаемость в Европе увеличилась на 3% (с 32 до 35%), а в США – на 4% (с 36 до 40%). Подобная положительная тенденция объясняется не только улучшением диагностики, но и применением эффективной химиотерапии в лечении диссеминированных форм рака яичников. Возраст больных является не только статистическим, но и прогностическим параметром: 5-летняя выживаемость больных, заболевших в возрасте 15-29 лет, равна 77,8%, 30-39 лет – 71,1%, 40-49 лет – 57,4%, 50-59 лет – 47,5%, в 60-69 лет – 41,5%; в 70-79 лет – 34,1% [Аксель Е.М., Козаченко В.П., 2001; Black R.J. et al., 1997; Heintz A.P.M. et ai., 2000].

Среди всех злокачественных новообразований у женщин России рак яичников по частоте занимает седьмое место и составляет 4-6% от всей онкологической заболеваемости. Каждый год в стране отмечается 11000 новых случаев рака яичников, а количество больных, находящихся под наблюдением, приближается к 80000. Средний возраст заболевших - 59 лет, средний возраст умерших от рака яичников - 64 года. Пик заболеваемости приходится на возраст 65-69 лет, то есть преимущественно неорганизованную, социально незащищенную часть населения, нуждающуюся в реализации доступных, но высокоэффективных программ по раннему выявлению и лечению данного заболевания. Отмечается ежегодный прирост заболеваемости раком яичников, достигающий 4% в год. В структуре смертности от онкогинекологических заболеваний на рак яичников приходится 49-56% (Давыдов М.И., Аксель Е.М., 2006).

Предположения о роли наследственности в патогенезе рака яичников стали появляться много десятилетий назад. Многочисленные клинические наблюдения, а также работы эпидемиологов установили, что рак яичников часто ассоциирован с другим заболеванием женской репродуктивной системы – раком молочной железы (РМЖ). В середине 1990-х гг. были идентифицированы первые гены, мутации в которых ассоциированы с резким увеличением индивидуального риска рака молочной железы и/или рака яичников; эти гены получили название BRCA1 и BRCA2. Интересно, что в некоторых регионах мира, в том числе и в Российской Федерации, значительно выражен так называемый эффект предшественника (“founder” эффект). Это позволяет в значительной мере упростить процедуру ДНК-тестирования упомянутых генов, ограничив лабораторный анализ лишь несколькими ПЦР - тестами (Sokolenko et al., 2007). В начале нынешнего десятилетия была установлена причастность к возникновению РМЖ других генов, участвующих в поддержании стабильности генома – CHEK2 и NBS1. Вклад мутаций этих генов в формирование предрасположенности к РЯ остаётся неизвестным (Имянитов Е.Н., Хансон К.П. 2007; Имянитов Е.Н., 2008).

Имеющиеся на сегодняшний день оригинальные организационные формы для повышения выявляемости рака яичников основаны на принципе самоорганизации групп риска по психологическому признаку (Сидоренко Ю.С., 2002). Разработанные методы успешно применяются в Ростовской области в течение последних 20 лет. Однако, обобщающего исследования, позволяющего определить возможности этих принципов диагностики рака яичников в совокупности с накопленными знаниями в области фундаментальной онкологии, до сих пор проведено не было.

Все вышеизложенное определило цель и задачи нашего исследования.

Цель работы

Проанализировать причастность мутаций в генах BRCA1, BRCA2, CHEK2 и NBS1 в формировании наследственной предрасположенности к раку яичников у жительниц Южных регионов Российской Федерации, а также разработать принципы генетического обследований пациенток с раком яичников и их родственниц.

       Для достижения указанной цели были поставлены следующие задачи:

1. Сформировать репрезентативную выборку пациенток с раком яичников, проживающих на территории южных регионов Российской Федерации.

2. Протестировать ДНК этих пациенток на предмет присутствия «повторяющихся» мутаций в генах BRCA1, BRCA2, CHEK2 и NBS1 (BRCA1 5382insC, BRCA1 4153delA, BRCA1 185delAG, BRCA1 300T>G,  BRCA2 6174delT, CHEK2 1100delC, CHEK2 IVS2+1G>A, NBS1 657del5).

3. Оценить причастность мутаций в перечисленных генах к заболеваемости рака яичников у жительниц юга России.

  1. Проанализировать ассоциации между присутствием мутаций в генах BRCA1, BRCA2, CHEK2 и NBS1 и основными клиническими характеристиками рака яичников (стадия заболевания, гистологический тип опухоли, ответ на лечение, прогноз).
  2. Произвести генетическое обследование родственниц пациенток, у которых выявлена мутация в генах предрасположенности к раку молочной железы и раку яичников.
  3. Сформулировать принципы ранней диагностики и профилактики онкологических заболеваний у женщин, подверженных высокому наследственному риску онкологических заболеваний молочной железы и яичника.

Научная новизна

1. Впервые в данной работе открывается новое  направление в клинической онкологии. В частности, в исследовании продемонстрирована исключительно высокая частота мутаций в гене BRCA1 в случайной выборке больных раком яичников.

2. Впервые установлена нецелесообразность систематического анализа статуса генов CHEK2 и NBS1 у больных раком яичников.

3. Впервые в мире выявлен случай сочетанной гетерозиготности по генам BRCA1 и NBS1, что указывает на жизнеспособность подобных генотипов. В целом, результаты работы указывают на целесообразность включения BRCA1-тестирования в стандарты обследования больных с раком яичников.

4. Впервые предложен генетический скрининг здоровых родственниц пациентов, сформирован генетический канцер-регистр, позволяющий своевременно осуществлять профилактические и лечебные мероприятия в группах повышенного генетического риска.

Практическая значимость работы

В рамках настоящего исследования апробирован и внедрен ДНК-тест, позволяющий выявлять наследственные формы рака яичников. Результаты работы свидетельствуют о целесообразности включения анализа «повторяющихся» мутаций в гене BRCA1 в стандарты обследования пациенток с раком яичников.

Основные положения, выносимые на защиту

  1. Необходимость внесения ДНК тестирования в алгоритм обследования больных спорадическим раком яичников.

2. ДНК-тестирование здоровых родственниц пациенток – эффективная в современных социально-экономических условиях организационная форма генетического скрининга.

Внедрение результатов исследования в практику здравоохранения

Основные результаты работы внедрены в практику ГУЗ Краснодарского краевого клинического онкологического диспансера и медико-генетическую лабораторию Краевой клинической больницы.

Апробация диссертации состоялась 24 сентября 2008 года на совместном заседании кафедры онкологии с курсом торакальной хирургии Кубанского государственного медицинского университета (г. Краснодар), отделения оперативной онкогинекологии и отделения онкомаммологии ГУЗ Краснодарского краевого клинического онкологического диспансера. Материалы исследования представлены на XI Российском онкологическом конгрессе (Москва, 2007) и Международном конгрессе по онкохирургии (Краснодар, 2008).

Публикации. Основные положения диссертации опубликованы в 13 печатных работах.

Объём и структура диссертации. Диссертационная работа изложена на 229 страницах машинописного текста. Она состоит из введения, обзора литературы, характеристики материала, методов исследования и лечения, 4 глав результатов собственных исследований, заключения, выводов, практических рекомендаций, указателя литературы, включающего 336 источников, из которых 79 отечественных и 257 зарубежных авторов. Работа иллюстрирована 39 таблицами и 36 рисунками.

СОДЕРЖАНИЕ РАБОТЫ

Характеристика материала, методов исследования и лечения

Клиническая характеристика больных: В исследование было включено 453 пациентки, проходивших лечение в Краевом клиническом онкологическом диспансере г. Краснодара за период с 2001 по 2008 гг., по поводу рака яичников. У 196 женщин был диагностирован серозный рак яичников, у 152 - муцинозный рак, у 104 - эндометриоидный рак и 1 – светлоклеточный рак яичников. Средний возраст пациенток составил 55 лет (интервал: 25-72 года).

Отягощенный семейный онкологический анамнез I-II степени родства отмечен у 3 (0,66%) больных; органоспецифический синдром рака яичников (Линч I) диагностирован у 3 (0,66 %) пациенток, синдром семейного рака  (Линч II) – у 1 (0,22%) , у 1 (0,22%), больной рак яичников ассоциировался с другими злокачественными опухолями органов женской репродуктивной системы (молочная железа, эндометрий). В дальнейшем эти 8 пациенток были исключены из ДНК-тестирования, так как нами рассматривались только спорадические формы рака яичников.

Оценка непосредственных и отдаленных результатов лечения проводилась в соответствии с критериями ВОЗ, EORTC и RECIST (Горбунова В.А. и соавт., 2001)

В процессе лечения больных раком яичников и последующего их динамического наблюдения проводилось рутинное обследование, а также осуществлялся ультразвуковой мониторинг, определялся уровень опухолевого маркера СА-125.

Сонографическое исследование проводилось на ультразвуковом сканере HDI 1500 (ATL/USA) трансабдоминальным (ТА) и трансвагинальным (ТВ) доступами визуализации с применением триплексного режима цветового допплеровского картирования (ЦДК) и энергетического кодирования (ЭДК) в стандартизованных параметрах настройки аппарата.

Карбогидратный антиген СА-125 определяли в сыворотке крови радиоиммунным методом с помощью тест-наборов фирмы  СIS  BIO International (Франция). Референтный интервал – 0-35 U/ml.

Методики морфологического исследования. Морфологические исследования удаленных раковых опухолей яичников осуществляли по общепринятым методикам.

Ткань фиксировали в 10% нейтральном формалине и заливали в парафин.

Морфологическую оценку площадей паренхимы, стромы, некроза, количества дистрофически измененных клеток и митотической активности проводили на измерительном комплексе «САГА».

Ультраструктуру раковых опухолей яичника изучали на электронном микроскопе ПЭМ-100.

Выделение ДНК. Материалом для исследования служили архивные патоморфологические препараты, полученные из удалённых в ходе операции опухолевых тканей пациенток. Выделение ДНК производилось посредством стандартного протокола [Imyanitov E.N. et al., 2006]. При помощи микротома были получены секции толщиной 20 мкм, которые депарафинизировались посредством инкубации в трех сменах ксилола по 500 мл при температуре 37оС. Длительность инкубации в каждой смене ксилола составляла 20 минут. Частичную, регидратацию тканей осуществляли инкубацией по 10 минут в 3 сменах этанола (96%, затем 80% и 70% - по 500 мкл) при комнатной температуре. После удаления этанола секции подсушивали на воздухе и помещали в 200 мкл лизирующего раствора (10mM Трис-HCl, pH=8,3; 1 mM EDTA; 2% Тритон Х-100, протеиназы К – до 500 мкг/мл). Лизис проводился при 60оС, в течение 12-24 часов, после чего образцы инкубировались 10 минут при 95оС с целью полной инактивации протеиназы К. Полученный лизат, десятикратно разводили бидистиллированной водой.

Детекция повторяющихся мутаций. Для детекции повторяющихся мутаций в генах BRCA1, BRCA2, CHEK2 и NBS1 были отобраны аллели, представленные в работе Sokolenko et al., 2007: BRCA1 5382insC, BRCA1 4153delA, BRCA1 185delAG, BRCA1 300T>C, BRCA2 6174delT, CHEK2 1100delC, CHEK2 IVS2+1G>A и NBS1 657del5. Анализ первых 7 мутаций осуществлялся методом аллель - специфической полимеразной цепной реакции в режиме реального времени (iCycler iQ Real Time Detection System (Bio-Rad)) с использованием красителя SYBR Green I. (рис. 1). Делеции NBS1 657del5 детектировались при помощи обычной ПЦР с последующим электрофоретическим разделением фрагментов в полиакриламидном геле (рис. 2.). Последовательности праймеров, применяемых для ДНК-анализа, указаны в таблице 1.

Таблица 1

Последовательности олигонуклеотидов, использованных в ПЦР

Мутация

Олигонуклеотид

Последовательность

Длина фрагмента

BRCA1 5382insC

common

5’AGAACCTGTGTGAAAGTATCTAGCACTG-3’

168 п.о.

wt

5’-AAGCGAGCAAGAGAATTCCAG-3’

mut

5’-AGCGAGCAAGAGAATTCCCA-3’

BRCA1 4153delA

common

5’–GACTGCAAATACAAACACCCA - 3’

134 п.о.

wt

5’-AGCCCGTTCCTCTTTCTTC – 3’

mut

5’-AGCCCGTTCCTCTTTCTCA – 3’

BRCA1

185delAG

common

5’CAGTTAAGGAAATCAGCAATTACAATAGC -3’

173 п.о.

wt

5’-GCTATGCAGAAAATCTTAGAGTGTCC -3’

mut

5’-ATGCTATGCAGAAAATCTTAGTGTCC -3’

BRCA1

300T>G

common

5’-ATTATCTTTTCATGGCTATTTG-3’

158 п.о.

wt

5’- TATATCATTCTTACATAAAGGAA-3’

mut

5’- TATATCATTCTTACATAAAGGAC -3’

BRCA2 6174delT

common

5’CATAACCAAAATATGTCTGGATTGGAG-3’

wt: 175 п.о.

mut: 168 п.о.

wt

5’-CTGATACCTGGACAGATTTTCCAC-3’

mut

5’-CCTGGACAGATTTTCCCTTGC-3’

CHEK2 1100delC

common

5’-CTGATCTAGCCTACGTGTCT-3’

120 п.о.

wt

5’-TTGGAGTGCCCAAAATCAGT-3’

mut

5’-CTTGGAGTGCCCAAAATCAT-3’

CHEK2 IVS2+1G>A

common

5’-CAGACTTTGAATAGCAGAGA-3’

114 п.о.

wt

5’-ACACTTTCGGATTTTCAGGG-3’

mut

5’-ACACTTTCGGATTTTCAGGA-3’

NBS1 657del5

forward

5’-TGATCTGTCAGGACGGCAG-3'

wt: 82 п.о.

mut: 77 п.о.

reverse

5’-CATAATTACCTGTTTGGCATTC-3'

ПЦР реакции выполнялись в стандартных условиях: 10 мкл ПЦР - смеси включали 1 мкл тканевого лизата (примерно 50 нг геномной ДНК), 1 ед Taq-полимеразы для «горячего старта», однократный ПЦР буфер (pH 8.3), 1.5 мМ MgCl2, 200 мкМ дНТФ, 0.5 мМ каждого олигонуклеотида и 0.5-кратный SYBR Green I. ПЦР начиналась с активации полимеразы посредством инкубирования смеси при 950C в течение 10 минут. Амплификация выполнялась в течение 50 циклов (денатурация – при 950C в течение 35 сек., гибридизация олигонуклеотидов – от 600C до 650C для различных праймеров в течение 1 мин, элонгация – при 720 C в течение 1 мин), после активации полимеразы при 950 C в течение 10 минут. Каждый сет амплификации включал контрольные образцы с гомо- и гетерозиготными образцами, а также негативный контроль. Для контроля специфичности фрагментов использовался анализ кривых плавления.

Рис. 1. Детекция мутации BRCA1 5382insC посредством аллель-специфической ПЦР.

Слева – нормальный генотип; справа – гетерозиготная носительница мутации BRCA1 5382insC. Сверху – результаты анализа ДНК методом аллель - специфической полимеразной цепной реакции в режиме реального времени (iCycler iQ Real Time Detection System (Bio-Rad) с использованием красителя SYBR Green I. Снизу – контроль специфичности реакции посредством гель - электрофореза.

Рис. 2. Анализ мутаций NBS1 657del5 методом гель-электрофореза.

Дорожки 1-3 – нормальная ДНК; дорожка 4 – гетерозиготная носительница мутации NBS1 657del5.

Результаты исследования

Лечение рака яичников (собственные материалы исследования). В настоящее время остается проблематичным вопрос о значении традиционных клинико-морфологических факторов прогноза у больных РЯ. Остается несомненным, что стадия заболевания является ведущим фактором, на основании которого вырабатывается план как диагностических, так и лечебных мероприятий. В нашем исследовании пятилетняя выживаемость при I стадии среди пациенток молодого возраста составила 77,9±8,3%, среднего возраста 71,7±6,9%, и 70,3±8,6% среди больных пожилого возраста. При изучении влияния морфологической структуры опухоли на отдаленные результаты лечения больных с I стадией заболевания, нами были получены следующие результаты: общая пятилетняя выживаемость больных с серозным раком яичников (n=14) составила 63,4 ± 6,9%, что достоверно меньше по сравнению с данными показателями у больных с эндометриоидной аденокарциномой (n=7) – 87,9±4,9% и у больных с муцинозной аденокарциномой (n=9) – 91,8±7,3%, (р=0.01). Таким образом, морфологическое строение опухоли имеет прогностическое значение при начальных стадиях заболевания, в то время как при III-IV стадиях, когда опухолевый процесс диссеменирован с поражением брюшиной, а зачастую и плевральных полостей, этот факт имеет второстепенное значение: общая выживаемость у пациенток с серозной аденкарциномой III стадии 14,9±4,8%, с эндометриоидной 29,5±8,8% и 20,7±7,3%. с муцинозной аденокарциномой. Медиана общей выживаемости III стадии – при серозной аденокарциноме 29,6±3,2мес., при эндометриоидном гистологическом типе опухоли 37,1±9,7мес., при муцинозной аденокарциноме 32,8±9,6 мес.

       Возрастной фактор по нашим наблюдениям при начальных стадиях заболевания не имеет особой прогностической значимости. Данный факт мы объясняем возможностью выполнить радикальный объем хирургического вмешательства при I-II стадиях заболевания. В тоже время хирургическое лечение III-IV стадий заболевания диктует необходимость проведения «агрессивных» вмешательств (комбинированные операции), которые не всегда возможны из-за наличия тяжелых сопутствующих патологий у пациенток пожилого возраста. С другой стороны, наличие массивных остаточных опухолевых образований диктует необходимость проведения большого количества курсов химиотерапии, что также не всегда возможно из-за токсичности последней и наличия сопутствующих экстрагенитальных заболеваний. Показатели общей выживаемости IV стадии  в группе до 45 лет – 28,9±8,3%, медиана выживаемости -23,5±2,9 мес.; у пациенток 45-59 лет данные показатели составили – 22,7±6,4% и 21,7±5,1 мес., а у больных 60-75 лет - 7,1 ±3,5% и 20,3±6,2 мес., соответственно.

       Наше исследование подтвердило факт отсутствия достоверных различий в течении заболевания в зависимости от степени дифференцировки опухоли, у больных с распространенными формами РЯ. Медиана общей выживаемости при III стадии заболевания и низкой степени дифференцировки 31,6±1,9 мес., умеренной дифференцировки 32,3±2,1 мес., высокодифференцированной 35,5±5,3 мес. Медиана общей выживаемости у аналогичных групп больных IV стадии заболевания составила-21,9±6,8 мес., 19,8±7,3 мес. и 20,3 ±5,1 мес. Данный факт объясняется тем, что в больших опухолях существуют клетки с различной степенью дифференцировки: от доброкачественных - до низкодифференцированных злокачественных.

       С другой стороны, при ранних стадиях заболевания основная масса опухолей мономорфна и представлена, в основном, клетками одной из трех степеней дифференцировки. 

       Касаясь вопроса терапии ранних стадий РЯ, необходимо отметить, что оптимальным следует считать тактику, включающую радикальную операцию и последующую послеоперационную полихимиотерапию с применением препаратов платины.

       Значительно больше проблем возникает перед клиницистами при лечении больных с распространенными стадиями заболевания. Не вызывает никаких сомнений, необходимость применения комбинированных или комплексных лечебных мероприятий при первичном лечении этих больных. Эпителиальные опухоли яичников относятся к умеренно - чувствительным к лекарственному лечению и для повышения эффективности их терапии, необходимо сочетание различных лечебных мероприятий.

       В нашей работе показано, что ведущая роль по прежнему принадлежит хирургическому лечению и в первую очередь циторедуктивной операции. Наше стремление к «агрессивной хирургии» распространенного РЯ объясняется следующим образом:

       1) неэффективность фармакологических препаратов снимается удалением основной массы опухоли со слабым кровотоком;

       2) эффективность химиопрепаратов связана с высокой митотической активностью малых опухолей;

       3) наименьшие остаточные опухоли требуют меньшего количества курсов химиотерапии, в то время как при больших массивах повышается вероятность резистентных форм;

       4) удаление основных масс опухоли приводит к относительной нормализации иммунной системы пациентки;

       5) удаляются по возможности фенотипически резистентные опухолевые клетки.

       Наша работа еще раз подтвердила, что достоверным фактором прогноза заболевания является размер остаточной опухоли после выполнения хирургического вмешательства. Так при III стадии заболевания медиана выживаемости при размере остаточной опухоли менее 2 см -19,4±1,5 мес., а при размере > 2 см - 10,9±2,4 мес. (р<0.05). Аналогичным образом выглядела медиана выживаемости при IV стадии заболевания – остаточная опухоль до 2 см – 20,1 ±3,6 мес., а у пациентов с остаточной опухолью более 2см -12,4±4,1 мес.

       На втором этапе лечения всем больным проводилась адьювантная химиотерапия. В нашем исследовании мы целенаправленно включили группу из 29 пациенток, которым проводилось лекарственное лечение без  применения препаратов платины.

       У больных при начальных стадиях заболевания отмечен полный эффект от лечения с применением производных препаратов платины. В тоже время при  III – IV стадии общая эффективность достоверно выше в группе пациенток, получавших лечение по  схеме: платина + таксаны.

       В заключение данного раздела следует отметить, что результаты терапии РЯ, а также клинико-морфологические факторы прогноза течения заболевания у пациенток Южного федерального округа, мало чем отличаются от общероссийских показателей. Невзирая на успехи в ранней диагностике, совершенствование хирургической техники, внедрение в практику новых химиотерапевтических агентов с учетом макро - и микроморфологических характеристик опухоли, отдаленные результаты лечения РЯ за последние двадцать лет остаются крайне неутешительными.

Решению этой проблемы может способствовать самая молодая отрасль онкологии - клиническая онкогинетика. Эта дисциплина, совмещающая две специальности - клиническую онкологию и генетику, уже по своему предназначению призвана интегрировать теоретические и прикладные достижения биологии и медицины, направляя их на профилактику рака.

Клиническое значение ДНК-тестирования больных раком яичников. Нами было подвергнуты ДНК тестированию 188 пациенток Южного федерального округа с диагнозом рак яичников, получавших терапию в гинекологическом отделении КОД в период с 2001 по 2008 год. Материалом исследования служили гистологические препараты больных, получавших комбинированное лечение (оперативное лечение + химиотерапия) в гинекологическом отделении КОД. Все гистологические препараты были пересмотрены в НИИ онкологии им. Н.Н.Петрова г. Санкт-Петербург

  Анализ выполнялся в НИИ онкологи им. Н.Н. Петрова г. Санкт-Петербург методом аллель специфической полимеразной цепной реакции.

Встречаемость мутаций в генах BRCA1, BRCA2, CHEK2 и NBS1 у больных раком яичника. Результаты анализа мутаций BRCA1 5382insC, BRCA1 4153delA, BRCA1 185delAG, BRCA1 300T>C, BRCA2 6174delT, CHEK2 1100delC, CHEK2 IVS2+1G>A и NBS1 657del5 у больных РЯ представлены в табл. 2. Примечательно, что доминирующим наследственным дефектом было присутствие аллеля BRCA1 5382insC: гетерозигтность по данному варианту была выявлена у 36 (19,1%). У одной больной наблюдалась мутация BRCA1 4153delA. Помимо этого, в одном образце ДНК была выявлена мутация NBS1 657del5; примечательно, что у этой же пациентки присутствовала другая мутация в гене наследственного ракового синдрома - BRCA1 5382insC. Сочетанное присутствие мутаций в генах BRCA1 и NBS1 выявлено впервые в мире и указывает на жизнеспособность «двойных» гетерозигот по данным аллелям. В исследованной выборке отсутствовали «повторяющиеся» мутации в генах BRCA2 (BRCA2 6174delT) и CHEK2 (CHEK2 1100delC и CHEK2 IVS2+1G>A).

Таблица 2

Встречаемость наследственных мутаций у пациенток, страдающих злокачественными новообразованиями яичника

 Мутация

Количество случаев

BRCA1 5382insC

36/188 (19,1%)*

BRCA1 4153delA

1/188 (0,5%)

BRCA1 185delAG

-

BRCA1 300T>G

-

BRCA2 6174delT

-

CHEK2 1100delC

-

CHEK2 IVS2+1G>A

-

NBS1 657del5

1/188 (0,5%)*

Всего

37/188 (19,7%)*

Примечание. * У одной пациентки наблюдалась сочетанная гетерозиготность по мутациям BRCA1 5382insC и NBS1 657del5.

Таблица 3

Морфологическая структура опухоли у пациенток с мутацией в гене BRCA1

Морфологическая структура опухоли

Серозный рак

Эндометриоидный рак

Муцинозный рак

Мутация в гене BRCA1

37

0

0

Распределение больных РЯ с мутацией гена BRCA1 в зависимости от морфологического типа опухоли отражено в таблице 3.

Показателем явился тот факт, что наличие мутации в гене BRCA1 было выявлено при серозном раке яичников.

Распределение больных РЯ с различным статусом гена BRCA1 в зависимости от стадии заболевания отражено в таблице 4. Интересно, что 36 из 37 носительниц мутаций в гене BRCA1 обратились за медицинской помощью на поздних стадиях заболевания; единственный случай первой стадии был представлен именно у той пациентки, у которой наблюдалась сочетанная гетерозиготность по генам BRCA1 и NBS1. У женщин с нормальным статусом BRCA1 наблюдалось обычное для РЯ распределение по стадиям заболевания (табл. 4). Различия между BRCA1-носительницами и пациентками с интактным генотипом достигли высокого уровня статистической достоверности (p = 0.008).

Таблица 4

Статус гена BRCA1 и стадия рака яичников

Мутация в гене BRCA1

Стадия заболевания

I

II

III-IV

Есть (n = 37)

1 (3%)

0

36 (97%)

Нет (n = 151)

12 (8%)

20 (14%)

119 (78%)

Интересно, что у пациенток с РЯ наблюдался увеличенный уровень маркера CA-125, в том числе и при сравнении больных с сопоставимыми стадиями заболевания (табл. 5).

Таблица 5

Статус гена BRCA1 и уровень маркера CA-125 в зависимости от стадии заболевания

Мутация в гене BRCA1

Стадия заболевания

I

II

III-IV

Есть (n = 37)

194 Ед/мл

-

1350-3200 Ед/мл

Нет (n = 151)

58-67 Ед/мл

92-135 Ед/мл

230-510 Ед/мл

Считается, что семейные разновидности опухолей ассоциированы с ранним возрастом начала заболевания. В нашей выборке больных подобной тенденции не наблюдалось, что отражает особенности течения наследственного рака яичника по сравнению с другими опухолями наследственной этиологии (табл.6).

Таблица 6

Статус гена BRCA1 и возраст больных

Мутация в гене BRCA1

Возраст пациенток

<45 лет

45-59 лет

60-75 лет

Есть (n = 37)

2 (5%)

18 (49 %)

17 (46%)

Нет (n = 151)

19 (13%)

62 (41%)

70 (46%)

На первом этапе лечения всем больным было проведено оперативное вмешательство различного объема (табл.7).

У больных с I стадией заболевания в 100% удалось выполнить радикальную операцию (n=13).

Из 24 пациенток со II стадией радикальная операция выполнена у 24 (100%).

Таблица 7

Размер остаточной опухоли

нет

< 2 см

> 2 см

I (n=13)

13 (100%)

0

0

II (n=24)

24 (100%)

0

0

III (n=121)

11 (9%)

18 (15%)

92 (76%)

IV (n=30)

0

3 (10%)

27 (90%)

Объем хирургических вмешательств у больных раком яичников в зависимости от стадии заболевания

При III стадии заболевания (n=121) оптимальная циторедуктивная операция выполнена у 11 (9%) пациенток, субоптимальная циторедуктивная операция выполнена у 18 (15%) женщин, у 92 (76%) пациенток была выполнена неоптимальная циторедуктивная операция. Остаточная опухоль локализовалась по париетальной и висцеральной брюшине малого таза и брюшной полости, в культе большого сальника.

У пациенток с IV стадией оптимальное хирургическое лечение не удалось выполнить, субоптимальное у 3 (10%), неоптимальное хирургическое лечение у 27 (90%) пациенток.

Анализируя полученные данные можно сделать вывод, что количество неоптимальных циторедуктивных операций увеличивается при распространенных стадиях заболевания, что логически диктует проведение на первом этапе лечения химиотерапии с неоадьювантной целью, особенно на поздних стадиях заболевания.

На втором этапе лечения всем пациенткам проводилось химиотерапевтическое лечение. В качестве первой линии была выбрана схема лекарственного лечения – цисплатин 75 мг/м + таксотер 75 мг/м.

Таблица 8

Статус гена BRCA 1 и лечебный эффект

Мутации в гене BRCA1

Эффективность лечения

Полная ремиссия

Частичная ремиссия

Стабилизация

Прогрессирование

Общая эффектвно-

сть

Мутация есть (n=36)

0 (0%)

0(0%)

0(0%)

36 (100%)

0(0%)

Мутации нет (n=151)

98 (65%)

8 (5.3%)

1 (0.7%)

44 (29%)

107 (71%)

Показательным явился факт отсутствия эффективности лечения у носительниц мутации в гене BRCA1 (табл.8), при использовании схемы химитерапии: цисплатин + таксотер, что мы объясняем отсутствием чувствительности к препаратам таксанового ряда, в то время как дозировка препаратов платинового ряда оказывается заниженной.

Одна BRCA1 носительница получала монохимиотерапию - карбоплатин AUC-7. В течение двух лет данных за рецидив заболевания нет.

Эффективность химиотерапии препаратами цисплатин + таксотер была достоверно выше у пациенток с интактным генотипом, в то время как у BRCA1 носительниц лучше эффект наблюдается при использовании монохимиотерапии препаратами платины.

Случай сочетанного носительства мутаций в генах BRCA1 и NBS1. Одним из наиболее интересных итогов настоящей работы является демонстрация жизнеспособности сочетанных гетерозигот по генам BRCA1 и NBS1, у пациентки пролеченной по поводу рака яичников в 2006 году и находящейся в состоянии объективной клинической ремиссии с 2006 по 2008 год.

В ходе морфологического исследования препарата поставлен диагноз низкодифференцированной серозной аденокарциномы яичника (рис. 3).

Рис. 3. Распределение мутаций в генах BRCA1 и NBS1 у больной низкодифференцированной аденокарциномы яичников.

ДНК-тестирование пациентки выявило одновременное присутствие двух мутаций – BRCA1 5382insC и NBS1 657del5. Достоверность данного наблюдения была подтверждена в ходе повторного забора материала (кровь больной) и последующего ДНК-анализа. Морфологический препарат рака яичника был подвергнуть молекулярному исследованию. Для этого опухолевые участки были отделены от контаминирующих нормальных тканей посредством микродиссекции, а полученная ДНК использовалась в качестве матрицы для BRCA1- и NBS1-специфической амплификации в режиме реального времени. Результаты анализа соматических мутаций в генах BRCA1- и NBS1 представлены на рисунке 3. Характер кривых накопления ПЦР - продуктов указывает на утрату интактного аллеля гена NBS1 в опухолевой ткани, в то время как данных за соматическую инактивацию гена BRCA1 не обнаруживается.

ДНК-тестирование здоровых родственниц пациенток, больных BRCA 1 ассоциированным раком яичников, как первый этап генетического скрининга и профилактики злокачественных новообразований органов женской репродуктивной системы. За период 1990-2000 г.г. в Краснодарском крае  из 5124 женщин с впервые установленным диагнозом рак яичников заболевание выявлено на профосмотрах у 317, то есть в 6,2% случаев. Процент выявления рака яичников  в I-II стадиях в целом, практически не изменился: 24,6% в 1990 г.; 24,3% в 2000 г.

За период 1985-1990 гг., когда реально проводились массовые осмотры и была предпринята попытка всеобщей диспансеризации населения, выявляемость рака яичников на 1000 осмотренных при комплексных профосмотрах составила 0,03, при осмотрах в женских консультациях и смотровых кабинетах – 0,27, процент выявления заболевания в I-II стадиях не превышал 25% (Сидоренко Ю.С.,  Голотина Л.Ю., 2002)

Главным вопросом для близких родственников онкобольных и особенно больных злокачественными новообразованиями женской половой сферы является их личная судьба – риск возникновения у них злокачественных образований и прогноз. 

При злокачественных новообразованиях яичников до сегодняшнего дня нет четких рекомендаций и разработок по мониторингу, скринингу и профилактике опухолевых заболеваний, а также их генетического прогнозирования. Первостепенным звеном при проведении профилактических мероприятий, в борьбе с наследственными заболеваниями, является генетический скрининг.

Генетический скрининг или просеивание, как правило, не выявляет болезнь, а лишь обеспечивает выборку предположительно больных, нуждающихся в повторных обследованиях для подтверждения или предупреждение диагноза. Основная цель генетического скрининга – своевременная диагностика и профилактика заболеваний. В тоже время на развитие генетически обусловленных заболеваний влияют и такие факторы как: эндокринно-обменные и конституциональные особенности женщины, образ жизни, профессиональные, бытовые вредности, характер питания, клинический анамнез. Все эти факторы важно учитывать при определении индивидуального генетического прогноза и выборе адекватных мер профилактики.

В нашем исследовании показано, что приблизительно 20% случаев спорадического рака яичников обусловлены наличием мутации в гене BRCA1. Нам представлялось целесообразным исследование всех родственниц по женской линии больных спорадическим раком яичников, ассоциированным с мутациями в гене BRCA 1. Приглашение женщин для выполнения генетического обследования было осуществлено в течение 5-6 недель. Родственницы были оповещены телеграммами, все приглашенные согласились на обследование. Был осуществлен забор крови с последующим проведением ДНК анализа. Мы считали прогностически важным  определением уровня СА-125 в сыворотке крови, так как все выявленные нами пациентки с BRCA 1 ассоциированным раком характеризовались изначально высоким уровнем СА-125, независимо от стадии заболевания. Забор крови производился в онкогинекологическом отделении КОД г. Краснодара, затем осуществлялась пересылка образцов крови в термоконтейнерах в НИИ онкологии им. Н.Н.Петрова г.Санкт-Петербург, где выполнялось ДНК-тестирование, определение уровня СА-125 выполнялось в лаборатории КОД г.Краснодара.

В нашем исследовании участвовало 54 женщины, родственницы по женской линии (сестры, дочери, племянницы пробандов). С целью выявления факторов, позволяющих оценить индивидуальный прогноз возникновения рака яичников у женщин с отягощенным семейным анамнезом, нами был проведен анализ данных клинического и семейного анамнеза (ретроспективные данные) в сравнении с углубленным клиническим обследованием этих женщин (проспективные данные). Всех женщин мы подразделили по следующим категориям:

В исследованной группе выявлено, что одна - 1 женщина (1,9%) не беременела и не рожала; у 50 (92.6%) исследуемых было 1-3 родов; ни одного аборта не сделала всего 1 (1,9%) женщина; от 1 до 5 абортов имели в анамнезе 48 женщин (88.8%), остальные 5 (9,3%) – свыше 5-ти абортов. Из числа рожавших женщин (53 человека) - родственниц больных раком яичников - не кормили грудью 1 (1,9%). Среди кормивших грудью грудное вскармливание сохранялось к 6-ти месячному возрасту ребенка у 40 (75,5%), свыше 6 месяцев до 12 мес. кормили – 2 (3,7%). Больше года кормили грудью 10 (18,9%) опрошенных.

При подробном сборе анамнеза у родственниц пациенток серозным раком яичников соматические заболевания были выявлены у 13 человек (24,1%). В структуру данной патологии вошли следующие заболевания: сахарный диабет II типа был обнаружен у 1(1,9%) исследуемой, ожирение III ст. выявлено также у 1 (1,9%) женщины, синдром Иценко-Кушинга - у 1 (1,9%) родственницы, у 2-х (3,7%) - симптоматическая артериальная гипертензия, эпидемический паротит - у 4-х (7,4%) женщин и у 3-х (5,5%) – тиреотоксикоз. Основная часть женщин, родственниц больных серозным раком яичников с выявленной мутацией в гене BRCA 1, на момент обследования находилась в возрасте 50-59 лет 23 (42.6%), 16 (29,7%) были в возрасте 40-49 лет, до 40 лет 8 (14,8%) исследуемых и 7 (12,9%) в возрасте >60 лет. Беседа с родственницами пациенток выявила интересные данные, касающиеся патологии женской репродуктивной системы в анамнезе: дисфункция яичников у 8 (10,8%), доброкачественные опухолевые образования матки у 10 (13., %), доброкачественные новообразования яичников воспалительной этиологии у 16 (21,7%), патология шейки матки у 1 (1,3%), фиброзно-кистозная мастопатия у 20 (27%), у одной (1,3%) исследуемой в анамнезе было оперативное лечение по поводу пограничной опухоли яичника - пограничная цистаденома яичника, рак молочной железы у 2 (2,7%).

Все заболевания и патологические состояния можно условно разделить на 3 группы:

  1. Злокачественные новообразования -2 (4,8%) от всех женщин, у которых выявлена патология.
  2. Фоновые и предраковые заболевания женской репродуктивной системы-20 (47,6%)
  3. Фоновые и предраковые заболевания молочной железы-20 (47,6%).

При оценке результатов ДНК тестирования в изучаемой группы из 54 человек выявлены  мутации BRCA1 у 6 человек (11,1%).

Все женщины независимо от наличия или отсутствия данной мутации  находились под тщательным наблюдением в течение 34 месяцев. В ходе постоянного мониторинга и наблюдения смежными специалистами у 6 (11,1%) исследуемых была диагностирована миома матки из них - 2 женщины с обнаруженной мутацией в гене BRCA 1; у 9 (16,6%) опухолевые образования придаткового происхождения, 1(1,9%) выявлена серозная цистаденома правого яичника, у 1 (1,9%) микрокарцинома яичников, выявлена у женщины с обнаруженной мутацией в гене BRCA 1; у 3 (5,6%) узловая мастопатия, одна из которых была с диагностированной мутацией в гене BRCA; у 1(1,9%), с наличием мутации в гене BRCA1, женщины за период наблюдения был диагностирован рак молочной железы.

Таким образом, за период мониторинга у 21 женщины здоровой на момент первой генетической консультации, в различные сроки были выявлены:

-фоновые и предраковые заболевания-19 человек

-рак яичников- 1

-рак молочной железы -1

Сопоставляя обнаруженные патологические состояния с наличием мутации в гене BRCA 1, мы обнаружили, что у 5 человек (62,5%) из группы повышенного генетического риска рак яичников возник в одном случае, рак молочной железы-1, предраковые процессы были обнаружены у 3 пациентов (табл. 9).

Одна женщина BRCA1 носительница в возрасте 69 лет была прооперирована 15 лет назад в объеме - экстирпация матки с придатками, по поводу миомы матки. Данная больная подверглась более детальному обследованию - компьютерная томография органов малого таза и брюшной полости. В ходе обследования у больной диагностирован острый калькулезный холецистит, по поводу которого выполнена лапароскопия холецистэктомия, с множественными биопсиями брюшины, большого сальника. Признаков опухолевого поражения не выявлено.

Наше исследование показало, что у 2-х здоровых на момент первичного тестирования женщин (BRCA1 носители) в ходе наблюдения выявлены злокачественные опухоли 2/54 (3,7%) от всех включенных в исследование и 2/6 (33,3%) в группе носителей мутаций в гене BRCA1.

Таблица 9

Статуc гена BRCA1 и результаты мониторинга

Патология

Родственницы с мутацией в гене BRCA1

Родственницы без мутации в гене BRCA1

Рак яичников

1

0

Рак молочной железы

1

0

Фоновые и предраковые состояния

3

16

Крайне важным является тот факт, что наблюдение за женщинами, не имеющими «генетической поломки» привело к выявлению фоновых и предраковых заболеваний женской репродуктивной системы 16/54 (29,6%) и своевременному оказанию медицинской помощи.

Мы провели тщательный анализ признаков, ведущих к повышенному риску развития опухолевых заболеваний яичников. В результате анализа из всей совокупности изучаемых факторов были выявлены «определяющие» - возраст женщины к моменту генетического консультирования, особенности детородного анамнеза, преморбидный фон, наличие мутации в гене BRCA 1. Эти женщины составили группу риска, все они жители Южного федерального округа, представители славянской расы.

В результате тщательного анализа множества факторов, нами были выделены пять наиболее значимых из них. На основе этих признаков нами разработаны критерии (т.н. «главенствующее правило») для уточнения индивидуального генетического прогноза развития рака органов репродуктивной системы у женщин, являющихся родственницами больных спорадическим серозным раком яичников, обусловленным обнаруженными в ходе исследования мутациями.

«Главенствующее правило» мы представили в виде таблицы (табл. 10), с перечисленными прогностическими признаками и их «баллы» (коэффициент главенствующего правила).

В нашем «главенствующем правиле» каждый прогностический признак имеет свой «балл». Суммируя «баллы» прогностических признаков женщины в течение первого года с момента ее тестирования, можно рассчитать степень риска развития несемейного рака яичников. Пороговым значением, определяющим наличие риска, является значение «0». Суммируя «баллы» каждого признака, мы получаем определенные значения: 1-5 единиц, свидетельствует о наличии благоприятного фона для развития опухоли в момент тестирования женщины. Сумма «баллов» 6 и > единиц, соответствует максимальной вероятности развития рака у женщины и возрастает прямо пропорционально ее увеличивающемуся возрасту.

  Таблица 10

«Главенствующее правило» для уточнения индивидуального генетического прогноза, возникновения рака органов женской репродуктивной системы

Признаки

Градации признаков

Баллы 

Возраст обследуемой к моменту первой генетической консультации

<40 лет

40-49 лет

50-59 лет

>60 лет

-1

+1

+2

+3

Обнаружение мутации в гене BRCA 1

Мутация есть

Мутации нет

+2

0

Особенности репродуктивного анамнеза

Без особенностей

Беременностей не было

Были беременности, родов не было

Роды и более 3-х абортов

-1

0

0

+1

Ранее перенесенные заболевания женской репродуктивной системы

Не было

Фоновые заболевания (для одной локализации)

Фоновые заболевания (для разных локализаций)

Предраковые заболевания (для одной локализации)

-1

0

0

+2

На каждую обследуемую представительницу группы риска заполнялась особая учетная форма. С самого начала выявления и отбора группы риска мы отказались от выжидательной тактики, была определена система «жесткого» мониторинга, который включал в себя ряд параметров (табл. 11).

Таблица 11

Профилактическое обследование носительниц мутаций в гене BRCA1

Процедура

Интервал

Самообследование молочных желёз

1 мес.

Осмотр маммолога

6-12 мес.

Маммография, УЗИ молочных желёз, магнитно-резонанснная томография

6-12 мес.

Осмотр гинеколога

6-12 мес.

Трансвагиналное УЗИ яичников

6-12 мес.

Анализ уровня антигена CA-125

6-12 мес.

Не вызывает сомнений, что здоровые носительницы мутаций в гене BRCA1 должны подвергаться регулярному обследованию на предмет ранней диагностики злокачественных заболеваний молочной железы и яичника. Интервал подобных обследований может варьировать в пределах 6-12 месяцев. Исключение составляет самообследование молочных желёз, которое должно осуществляться 1 раз в месяц. Возраст начала профилактических осмотров является предметом для дискуссий; большинство специалистов склоняются к тому, что самообследование молочных желёз следует проводить с 18 лет, а другие исследования – с 25 лет. Другой важной особенностью таких женщин является невысокая эффективность маммографии; инструментальное обследование молочных желёз рекомендуется дополнять магнитно-резонансной томографией.

Тем не менее, даже исключительно тщательный мониторинг носительниц мутаций в гене BRCA1 не гарантирует ранней диагностики и лечения от онкологического заболевания. Поэтому в развитых странах мира стандарты медицинской помощи подобным женщинам включают профилактически операции.

Экономические аспекты ДНК-тестирования больных раком яичников. Экономика здравоохранения – наука, задачей которой является определение наиболее эффективного использования «ресурсов» и средств здравоохранения. В идеологической основе экономических аспектов современной медицины лежит понятие экономической целесообразности, основными показателями которой являются: польза, риск, затраты.

В данном исследовании мы попытались оценить экономические затраты государства на лечение больных раком яичников и затраты на проведение ДНК тестирования.

Эта стоимость рассчитывалась  на одного человека, получившего терапию по поводу рака яичников, которая включала оперативное лечение и химиотерапию в послеоперационном периоде по схеме: таксотер 75 мг\м + цисплатин 75 мг\м .

Стоимость первичного лечения складывались из прямых первичных затрат  и медицинских затрат на проведение первой линии химиотерапии. Нами было просчитано, что основные затраты в лечении пациентов  связаны с расходами на их лекарственное (химиотерапевтическое) обеспечение.

Общая стоимость лекарственного лечения по схеме: таксотер 75 мг\м + цисплатин 75 мг\м приблизительно 383040 рублей (на одну пациентку).

Медицинские затраты включали: затраты на госпитализацию + стоимость лекарственного обеспечения.

План обследования пациенток включал:

  1. Клинический анализ крови – еженедельно.
  2. Биохимический анализ крови, определение клиренса креатинина – каждые 3 недели и за 1 день до лечения.
  3. Осмотр гинеколога – каждые 2 курса.
  4. СА-125 – каждые 2 курса.
  5. ЭКГ – перед началом лечения и дальше по показаниям.
  6. УЗИ / КТ – каждые 2 цикла.
  7. Рентгенография легких – каждые 2 цикла.
  8. Общий анализ мочи – до начала лечения.
  9. Консультация невропатолога – каждые 2 курса.
  10. Лапароцентез (по показаниям).
  11. Лапароскопия (по показаниям)

В нашем исследовании было 37 пациенток с диагностированной мутацией в гене BRCA1, 36 из которых были с III –IV стадией заболевания и погибли от прогрессирования заболевания в течение одного года. Нам стало интересным рассчитать затраты (для 36 человек), пришедшиеся на данных пациентов. Стоимость химиотерапии по схеме: цисплатин 75 мг\м + таксотер 75 мг\м - 1209600 рублей. Несмотря, на проведенное лечение у всех этих больных в течение года отмечено прогрессирование заболевание, приведшее к смерти.

Учитывая низкую эффективность лечения, эти пациентки в дальнейшем были подвергнуты различным схемам химиотерапии 2 линии, которая существенно не повлияла на результаты терапии, но привела к значительным дополнительным расходам.

Примечательным явился тот факт, что затраты на оснащение молекулярно-генетической лаборатории составляют около 2000000 рублей, реактивы - на проведение 100 исследований - 21 тыс. рублей, стоимость одного проведенного анализа на наличие мутации приблизительно 300 рублей.

       Как показало исследование в Южном федеральном округе целесообразно проводить тестирование только на наличие одной мутации в гене ВRCA1, ДНК-тестирование других мутаций не целесообразно. Данное исследование стоит 300 рублей, для примера одно УЗИ 500-600 рублей по фонду ОМС.

       При необходимости выполнения профилактических мероприятий  (лапароскопическая операция) затраты на одну пациентку составили 1200 рублей x 3 койко дня = 3600 рублей. Для группы из 36 человек эта сумма составила-129600 рублей.

       Итак, оборудование для оснащения лаборатории ДНК-тестирования стоит около 2 млн. рублей. Для сравнения аппарат УЗИ от 3500000 рублей и выше.

       Таким образом, неожиданным явился тот факт, что проведение высокотехнологического ДНК тестирования и последующие профилактические мероприятия по своей себестоимости могут быть осуществлены в любой ЦРБ на территории РФ, а экономическая и социальная выгода проведения таких мероприятий не сопоставима с затратами и результатами лечения больных РЯ.

Обсуждение результатов.

Сегодня во всех развитых странах мира затрачиваются огромные средства на лечение больных злокачественными новообразованиями.

Однако с позиции стратегии противораковой борьбы в перспективе нельзя ожидать существенных сдвигов в снижении смертности населения от рака за счет совершенствования методов лечения. Неудачи в попытках улучшить выживаемость онкологических больных  связаны с отсутствием надежных скрининговых программ, позволяющих выявить злокачественные опухоли на ранних стадиях.

Вместе с тем современные достижения в области фундаментальных и прикладных исследований уже предоставили достаточно фактов, позволяющих составить четкое представление об этиологии и патогенезе большинства злокачественных опухолей и предупредить возникновение многих из них. К сожалению слишком мало этих достижений нашли свое применение в практическом  здравоохранении.

Как это не странно проблема ранней диагностики и профилактики рака сегодня упирается в отсутствие организованной системы, способной контролировать заболеваемость населения с помощью весьма специфических профилактических мероприятий, доступных уже на современном этапе развития науки.

Решению этой проблемы может способствовать самая молодая отрасль онкологии - клиническая онкогенетика. Эта дисциплина, совмещающая две специальности - клиническую онкологию и генетику, уже по своему предназначению призвана интегрировать теоретические и прикладные достижения биологии и медицины, направляя их на профилактику рака.

Как известно, рак яичников является сложнейшей проблемой современной онкогинекологии, занимая ведущее место среди причин смертности от онкогинекологических заболеваний.

Рак яичников характеризуется быстрым и агрессивным, но при этом бессимптомным течением, что приводит первичную его выявляемость в 70% случаев несвоевременной (III-IV стадия).

Отсутствие патогномичных симптомов и скрининга, а так же четко разработанных алгоритмов ранней диагностики и профилактики привели к неудовлетворительным результатам терапии рака яичников в целом.

В настоящее время уже нет сомнений в том, что злокачественные опухоли являются болезнями генома. Как известно процесс канцероматоза многофакторный и многостадийный. В основе его лежат повреждения генетического аппарата половой или соматической клетки (геномные мутации), делающие эту клетку чувствительной к воздействию внешнесредовых канцерогенных факторов, способных запустить процесс малигнизации. Именно это положение позволяет рассматривать изначальные геномные мутации не как фатальную неизбежность возникновения опухоли, а как определенное состояние клетки (предрасположенность), которое, в принципе можно контролировать путем профилактических мероприятий.

Рак яичников мультифакториальное заболевание, одной из главных причин которого является наличие генов предрасположения - онкогенов BRCA- 1 и 2. Эти гены вовлечены в поддержание стабильности генома.

Мутации в генах BRCA1 и 2 по данным мировой литературы могут являться причиной от 10 до 30 % случаев возникновения рака яичников.

Благодаря выявлению этих мутаций в ДНК - праймерах мы можем оценить частоту и, собственно вклад мутантных аллелей во встречаемости рака яичников в нашей стране, тем более что во всех развитых странах диагностика мутаций является обязательным компонентом в клинической онкологии.

Полученные данные представляют интерес в первую очередь с точки зрения распределения мутаций у больных РЯ, проживающих в Южном федеральном округе и проходивших лечение в краевом онкологическом диспансере. Как и в других регионах Российской Федерации, а также у жителей Польши, обнаруживается заметное преобладание аллеля BRCA1 5382insС. Подобное наблюдение представляется несколько неожиданным: удивительно, что на огромной территории, расположенной между Балтийским морем и Дальним Востоком, значительное число случаем рака молочной железы и рака яичников вызвано так называемым эффектом «основателя» (founder effect). Подобная генетическая гомогенность славянской популяции противоречит распространённым представлениям о высокой степени межэтнического смешивания на протяжении истории Российского государства.

Другим важным фактом, установленным в ходе исследования, является  низкая частота мутаций BRCA1 4153delA, BRCA1 185delAG, BRCA1 300T>G,  BRCA2 6174delT, CHEK2 1100delC, CHEK2 IVS2+1G>A и NBS1 657del5. В частности, в литературе высказывались предположения о предпочтительно ассоциации мутации BRCA1 4153delA с риском рака яичника, но не рака молочной железы. Полученные данные не подтверждают это предположение, так как в нашей выборке, отражающей популяцию с относительно высокой частотой аллеля  BRCA1 4153delA, был обнаружен всего один случай носительства данного варианта. Другим аллелем для которого предполагается вклад в заболеваемость РМЖ и РЯ в России, является мутация BRCA1 300T>G. В нашем исследовании, как и в предыдущих выполненных в России работах, подобной мутации не обнаружено, что указывает на целесообразность исключения варианта BRCA1 300T>G из диагностических панелей.

Ещё одной спорной проблемой, затронутой в ходе  настоящей работы, является вопрос о причастности мутаций в гене CHEK2 к формированию предрасположенности к РЯ. Для «классических» генов наследственного РМЖ – BRCA1 и BRCA2 – характерно формирование предрасположенности, как к опухолям молочной железы, так и новообразованиям яичника. Роль мутаций гена CHEK2 в формировании риска РМЖ считается доказанной, в то время как вопрос о причастности этих же генетических повреждений к патогенезу РЯ остаётся открытым. Результаты нашего исследования свидетельствуют о непричастности аллелей CHEK2 1100delC и CHEK2 IVS2+1G>A к заболеваемости раком яичника.

В целом, данное исследование продемонстрировало, что примерно каждый пятый случай РЯ связан с наследованием повторяющейся мутации в генах наследственных раковых синдромов. Таким образом, представляется целесообразным включить ДНК-тестирование в стандарты клинического обследования больных РЯ. Примечательно, что высокая встречаемость BRCA1-мутаций у больных РЯ, в сочетании с отсутствием особенностей возрастного распределения пациенток в зависимости от ДНК-статуса, делает нецелесообразным предварительный отбор пациенток на генетический анализ. Существенным ограничением исследования является отсутствие сведений о наличии онкологических заболеваний среди родственников пациенток. Представленные данные подтверждают необходимость сбора наследственного онкологического анамнеза при обращении женщин за медицинской помощью.

При детальном обследовании пациенток с выявленными мутациями в гене BRCA1 были получены следующие данные: BRCA1 5382insC: 36/ 188 (19,1%);

BRCA1 4153delA: 1/188 (0,5%)

Таким образом, BRCA1 5382insC имеет большую значимость в возникновении спорадического РЯ, чем BRCA1 4153delA.

Нам представилось интересным изучить течение болезни у больных РЯ с наличием мутаций в гене BRCA1 в сравнении с больными, не имеющими данные мутации. В нашем исследовании у больных раком яичников без мутаций в гене BRCA1 ( n=151) I стадия диагностирована у 12 (7,9%), из них Ia –у 2, Ib –у 4, Ic –у 6 пациенток; II стадия – у 20 (13,2 %) больных, из них IIа – у 3, IIb –у 12,  IIс – у 8 пациенток. III и IV стадии были диагностированы у 119 (78,8%) больных, из которых III стадия – у 87 (73,1%) и IV – у 32 (26,9%). В тоже время среди пациенток, у которых была обнаружена мутация в гене BRCA1 (n=37) распределение по стадиям заболевания имело следующий вид- I стадия диагностирована только 1 (2,7%) пациентки, II стадии среди женщин с выявленными мутациями в гене не было диагностировано совсем, III – IV стадия выявлены у 36 (97,3%), из которых III стадия диагностирована у 29 (80,5%) пациенток, IV стадия у 7 (19,5%) пациенток.

Проанализировав данную картину, обращает на себя внимание тот факт, что у пациентов с обнаруженной мутацией в гене BRCA1 к моменту обращения диагностируется в более чем 90% случаев III-IV стадия заболевания. В то время как у больных без мутации в гене BRCA1 этот показатель составил 78,8%.

Учитывая наибольшее накопление мутаций с III- IV стадией, можно сделать вывод о прогностически неблагоприятном течении заболевания при наличии мутации в гене BRCA1.

Распределение пациентов по возрастному составу выявило следующее - среди исследованных пациенток раком яичников без мутации в гене BRCA1 выделены следующие возрастные группы: пациентки молодого возраста (до 45 лет) – 19 (12,5%), среднего возраста (45-59 лет) – 62 (41,1 %), пожилого возраста (60-74 года) -70  (46,4%). Среди данной группы исследованных, основная часть приходилась на средний и пожилой возраст.

При изучении возрастного состава пациентов с мутацией в гене BRCA1 нами были получены следующие данные - пациентки молодого возраста (до 45 лет) – 2 (5,5%), среднего возраста (45-59 лет) – 18 (48,6 %), пожилого возраста (60-74 года) -17  (45,9%).

Среди данных групп исследованных пациенток по возрастному составу была обнаружена примерно одинаковая картина, основная часть пациенток как с мутацией в гене BRCA1, так и без мутации в данном гене приходилась на группу среднего и пожилого возраста.

Интересным явился тот факт, что по морфологическому строению у всех пациенток с мутацией в гене BRCA1, гистологически определялась серозная аденокарцинома различных степеней дифференцировки.

       Изучение степени дифференцировки опухолевой ткани в данных группах пациенток, нами выявило: у 3 (8%) пациенток раком яичников с мутацией в гене BRCA1 диагностирована высокая степень дифференцировки опухоли, у 15 (41%) умереннодифференцированный тип опухоли и у 19 (51%) низкодифференцированная аденокарцинома.

Распределение по степени дифференцировки больных раком яичников без мутации в гене BRCA1 имело следующий вид - высокодифференцированный тип опухоли диагностирован у 21 (14%) пациентки, умереннодифференцированный у 69 (45,6%) и низкодифференцированная аденокарцинома обнаружена у 61 (40,4%) женщины.

Пациентки обеих групп получали комбинированное лечение (первый этап - оперативное лечение, на втором этапе химиотерапия.)

Исследование данных пациентов по  объему выполненной операции, показало, что среди группы пациентов с выявленной мутацией в гене BRCA1 радикальное оперативное лечение в объеме - экстирпация матки с придатками или надвлагалищная ампутация матки с придатками + резекция большого сальника удалось выполнить 1 (8,1%) пациентки,  субоптимальную операцию (остаточная опухоль до 2 см) выполнили 2 (5,4%) женщинам,  неоптимальная  циотредуктивная операция выполнена 32 (86,5%) пациенткам.

В группе пациенток без мутации в гене BRCA 1 радикальная операция выполнена у 25 (16,5%) пациенток, субоптимальная циторедективная операция выполнена 31 (20,5 %) пациенток, неоптимальная циторедуктивная операция выполнена 95 (62%) пациенткам.

Учитывая полученные результаты, можно сделать вывод, что объем остаточной опухоли малого таза и брюшной полости после оперативного лечения и нерадикально выполненные операции превалируют среди пациенток с обнаруженной мутацией в гене BRCA1, над пациентками без мутации в данном гене. Вследствие чего прогноз течения заболевания и дальнейшего лечения у данной группы пациенток хуже.

Анализируя полученные данные можно сделать вывод, что количество неоптимальных циторедуктивных операций увеличивается при распространенных стадиях заболевания как в группе больных с нестабильностью генетического аппарата, так и в группе больных без выявленной раковой мутации.

Данное положение диктует необходимость проведения на первом этапе лечения химиотерапии с неоадъювантной целью, особенно на поздних стадиях заболевания.

Всем больным на первом этапе выполнялось оперативное лечение,  второй этап химиотерапия  по стандартным схемам - производные платины + таксаны.

В группе больных без мутаций, получающих на первом этапе стандартные схемы химиотерапии, включающие производные платины + таксаны общая эффективность составила 71%, полная ремиссия 65%, частичная ремиссия 5,3%, медиана времени до прогрессирования 12 месяцев.

В группе пациенток с ВRСА1 ассоциированным раком яичников, получавших химиотерапию по схеме - производные препаратов платины + таксаны, полная ремиссия не наблюдалась ни у одной пациентки, общая эффективность 0%

       При анализе общей пятилетней выживаемости пациенток раком яичников без мутации в гене BRCA 1, были получены следующие данные: при I стадии заболевания выживаемость  составила 79,5 ± 5,4%, II стадия-53,1 ± 9,6%, III стадия 22,8 ± 3,1%, IV стадия 5,9 ± 5,3%.

       При анализе общей пятилетней выживаемости пациенток раком яичников с мутациями в гене BRCA 1, были получены следующие данные: I стадия заболевания обнаружена у одной пациентки, которая болеет с 2006 года, получала комбинированное лечение (оперативное лечение + химиотерапия) в 2006 году в условиях онкогинекологического отделения КОД, жива до настоящего времени, пациенток со II стадией в нашем исследовании не было,  при III стадии - выживаемость 0%, IV стадии выживаемость 0%.

       Примечание: только одна из пациенток ВRСА1 носительница получала монохимиотерапию - карбоплатин AUC-7. В течение 2 лет данных за рецидив заболевания нет.

       Эффективность химиотерапии препаратами платина + таксаны достоверно выше у больных раком яичников с интактным генотипом, в то время как у ВRСА1 носительниц лучший эффект наблюдается при использовании монохимиотерапии препаратами платины.

       ДНК тестирование имеет колоссальное значение в плане планирования лекарственной терапии. В нашем исследовании около 97% пациентов с наличием мутации в гене BRCA1 резистентны к препаратам таксанового ряда. И, мы предполагаем, что BRCA1 5382insC  является причиной неутешительных результатов терапии серозного рака яичников III-IV стадий к стандартным схемам, включающим препараты платины + таксаны.

Больные с III-IV стадией заболевания и наличием мутаций в гене BRCA1 должны подвергаться другим схемам лечения.

Таким образом, мы считаем, что ДНК тестирование является обязательным компонентом в алгоритме обследования и дальнейшего планирования лечения у больных серозным раком яичников.

Существенный академический интерес представляет случай сочетанного присутствия мутаций в генах BRCA1 и NBS1 у одной из пациенток. Примечательно, что анализ опухолевой ткани, полученной в ходе хирургического вмешательства, выявил соматическую инактивацию гена NBS1, но не BRCA1. Таким образом, данный результат может являться свидетельством причастности гена NBS1 к формированию предрасположенности к РЯ. Данная гипотеза нуждается в проверке, так как на территории Российской Федерации примерно 0,5% людей являются носителями аллеля NBS1 657del5. Другой неожиданный результат данного наблюдения – относительно заурядный онкологический анамнез у пациентки, несущей в своей зародышевой ДНК сразу 2 инактивирующих мутаций в раковых генах. Действительно, данная женщина оставалась здоровой до возраста 52 лет, что не всегда достижимо даже для носительниц единичных генных дефектов.

Не вызывает сомнений, что здоровые носительницы мутаций в гене BRCA1 должны подвергаться регулярному обследованию на предмет ранней диагностики злокачественных заболеваний молочной железы и яичника. В нашем исследовании участвовало 54 женщины, родственницы по женской линии (сестры, дочери, племянницы пробандов). С целью выявления факторов, позволяющих оценить индивидуальный прогноз возникновения рака яичников у женщин с отягощенным семейным анамнезом, нами был проведен анализ данных клинического и семейного анамнеза (ретроспективные данные) в сравнении с углубленным клиническим обследованием этих женщин (проспективные данные).

Известно, что наиболее аргументированным и доказательным фактором риска возникновения злокачественных опухолей человека является возраст. Учитывая отмеченное, в первую очередь, мы решили остановиться на роли возраста в генезе изучаемых нами опухолей. При этом мы учитывали, что с постарением повышается гипоталамическая активность, которая обуславливает возрастание риска ожирения, гипертонической болезни, атеросклероза и в определенной степени заболеваемости раком гормонозависимых опухолей.

Известно, также, что заболеваемость злокачественными опухолями в целом с возрастом возрастает. По выражению ряда исследователей, некоторые лица не доживают до своего рака и, по их мнению, возникновение злокачественных опухолей неминуемо.

Анализ возрастной структуры опрошенных респондентов свидетельствует о том, что наибольшее число анкетированных родственниц женщин - больных серозным раком яичников с выявленной мутацией в гене BRCA 1, на момент обследования относились к шестому десятилетию жизни (42,6%). Наименьший процент – в возрасте старше 60 лет (12,9%).

По данным нашего исследования, в детородном периоде находились 36 опрошенных женщин (66,8%), в менопаузальном – 14 (25,8%) и климактерическом – 4 женщины (7,4%).

Среди опрошенных нами женщин – родственниц больных большую часть составили лица славянской национальности (48 человек) – 88,8%, среди которых 75,0% были украинками, а 25,0% - русскими. Среди метисов 66,7% женщин были рождены от браков с закавказскими народами, 33,3% - от браков с евреями.

По литературным данным, в части исследований установлено, что семейные формы рака органов женской репродуктивной системы, в частности рак яичников и рак молочной железы, имеют клинические особенности, отличающие их от спорадических форм этих новообразований. Конституциональной особенностью женщин, наследственно предрасположенных к развитию рака яичников и рака молочной железы, является более раннее половое созревание (наступление менархе до 11 лет).

Если оптимальным периодом появления первых месячных считать возраст от 11 до 14 лет, у 37 анкетированных нами родственниц в этом возрасте наступили первые месячные (68,5%). Появление первых месячных в возрасте 14 лет и старше наблюдалось у 8 женщин (14,8%). У 9 опрошенных возраст наступления менархе составил ниже 11 лет (16,7%).

В нашем исследовании при подробном сборе анамнеза у родственниц пациенток серозным раком яичников соматические заболевания были выявлены у 13 человек (24,1%). В структуру данной патологии вошли следующие заболевания:  сахарный диабет II типа был обнаружен у 1 (1,9%) исследуемой, ожирение III стадии выявлено также у 1 (1,9%) женщины, синдром Иценко-Кушинга – у 1 (1,9%) родственницы, у 2-х (3,7%) - симптоматическая артериальная гипертензия, эпидемический паротит - у 4-х (7,4%) женщин и у 3-х (5,5%) – тиреотоксикоз.

Установлено, что в анамнезе у родственниц пациенток онкогинекологического отделения КОД встречались следующие заболевания: дисфункции яичников у 8 (10,8% от всех выявленных заболеваний), доброкачественные опухолевые образования матки у 10 (13,5%), доброкачественные новообразования яичников воспалительной этиологии у 16 (21,7%), патология шейки матки у 1 (1,3%), фиброзно-кистозная мастопатия у 20 (27,0%). У одной (1,3%) исследуемой женщины в анамнезе было оперативное лечение по поводу пограничной опухоли яичника - пограничная цистаденома яичника, рак молочной железы был в анамнезе у 2-х опрошенных (2,7%).

  Все заболевания и патологические состояния, выявленные у 42-х родственниц обследуемых женщин (что составило 77,8% от всех анкетируемых женщин), можно условно разделить на 3 группы:

  1. Злокачественные новообразования – у 2 женщин (4,8% от всех женщин, у которых выявлена патология).
  2. Фоновые и предраковые заболевания женской репродуктивной системы – у 20 человек (47,6%).
  3. Фоновые и предраковые заболевания молочной железы – у 20 опрошенных женщин (47,6%).

При оценке результатов ДНК тестирования в изучаемой группе из 54 человек выявлены мутации BRCA1 inc у 6 человек (11,1%).

  Все женщины, независимо от наличия или отсутствия данной мутации,  находились под тщательным наблюдением в течение 34 месяцев. В ходе постоянного мониторинга и наблюдения смежными специалистами у 6-ти (11,1% от всех обследуемых женщин) исследуемых была диагностирована миома матки, из них 2-е женщины с обнаруженной мутацией в гене BRCA 1; у 9-ти (16,6%) опухолевые образования придаткового происхождения, у 1 (1,9%) выявлена серозная цистаденома правого яичника, у 1-й (1,9%) женщины с обнаруженной  мутацией в гене BRCA - микрокарцинома яичников; у 3-х (5,6%) узловая мастопатия, одна из которых была с диагностированной мутацией в гене BRCA; у 1-й (1,9%) женщины за период наблюдения был диагностирован рак молочной железы.

  Таким образом, за период мониторинга у 21 женщины, которые были здоровы на момент первой генетической консультации, в различные сроки были выявлены вышеуказанные заболевания.

      Сопоставляя обнаруженные патологические состояния с наличием мутации в гене BRCA 1, мы обнаружили, что у 5 человек из группы повышенного генетического риска рак яичников возник в одном случае, рак молочной железы – также в одном случае, предраковые процессы были обнаружены у 3-х пациенток.

Наше исследование показало, что у 2-х здоровых на момент первичного тестирования женщин (BRCA1 носители) в ходе наблюдения выявлены злокачественные опухоли 2/54 (3,7% от всех включенных в исследование) и  2/6 (33,3%) в группе носителей мутаций в гене BRCA1.

С нашей точки зрения, крайне важным является тот факт, что наблюдение за женщинами, не имеющими «генетической поломки», привело к выявлению фоновых и предраковых заболеваний женской репродуктивной системы у 16 из 54-х обследованных родственниц (29,6%) и своевременному оказанию медицинской помощи.

  Мы провели анализ признаков, ведущих к повышенному риску развития опухолевых заболеваний яичников. В результате анализа из всей совокупности изучаемых факторов были выявлены «определяющие»: возраст женщины к моменту генетического консультирования, особенности детородного анамнеза, преморбидный фон, наличие мутации в гене BRCA 1.

  Эти женщины составили группу риска, все они жители Краснодарского края, представители славянской расы.

  В результате анализа различных факторов, нами были выделены пять наиболее значимых из них. На основе этих признаков нами разработаны критерии (т.н. «главенствующее правило») для уточнения индивидуального генетического прогноза развития рака органов репродуктивной системы у женщин, родственниц больных спорадическим серозным раком яичников, обусловленным обнаруженными в ходе исследования мутациями.

  В главенствующем правиле каждый прогностический признак имеет свой балл. Суммируя «баллы» прогностических признаков женщины в течение первого года с момента ее тестирования, можно рассчитать степень риска развития несемейного рака яичников.

Пороговым значением, определяющим наличие риска, является значение «0». Суммируя баллы каждого признака, мы получаем определенные значения:

- 1-5 единиц - свидетельствует о наличии благоприятного фона для развития опухоли в момент тестирования женщины;

- сумма «баллов» 6  и более единиц - соответствует максимальной вероятности развития рака у женщины и возрастает прямо пропорционально ее увеличивающемуся возрасту.

На каждую обследуемую представительницу группы риска заполнялась особая учетная форма, используемая и разработанная в онкогинекологическом отделении КОД г. Краснодара. Она содержала паспортные данные, общий статус и жалобы на момент первого консультирования, акушерско-гинекологический анамнез, анамнез жизни, наследственный анамнез.

В процессе исследования была создана компьютерная информационная база данных этих женщин. Наблюдение осуществляли врачи онкогинекологического и маммологического отделений и врачи отдела лучевой диагностики КОД г. Краснодара. С самого начала выявления и отбора группы риска мы отказались от выжидательной тактики. Нами была определена система «жесткого» мониторинга, который включал в себя:

  1. Исследования уровня СА 125 в сыворотке крови 1 раз в 6-12 месяца
  2. Осмотр гинеколога 1 раз в 6-12 месяца
  3. Осмотр маммолога 1 раз в 6-12 месяца
  4. УЗИ малого таза 1 раз в 6-12 месяца
  5. УЗИ молочных желез, маммография 1 раз в 6-12 месяца
  6. Самообследование молочных желез 1 раз в месяц

Интервал подобных обследований может варьировать в пределах 6-12 месяцев. Исключение составляет самообследование молочных желёз, которое должно осуществляться 1 раз в месяц. Возраст начала профилактических осмотров является предметом для дискуссий; большинство специалистов склоняются на том, что самообследование молочных желёз следует проводить с 18 лет, а другие исследования – с 25 лет. Другой важной особенностью таких женщин является невысокая эффективность маммографии; инструментальное обследование молочных желёз рекомендуется дополнять магнитно-резонансной томографией.

Таким образом, на базе нашего отделения впервые создан генетический канцер-регистр, который послужил отправной точкой отсчета формирования скрининговых программ и мер профилактики спорадического рака яичников.

Проведение массовых скрининговых исследований в современных условиях невозможно без соответствующей информационной поддержки. Основу информационного обеспечения программы снижения смертности от онкологических заболеваний составляют программные комплексы. Для обработки материалов скрининговых исследований и определения его эффективности обязательно необходимо организовывать взаимодействие между районными лабораториями и ведение централизованной базы данных медико-генетических обследований. 

Для групп риска, которые сформированы по результатам предлагаемого нами скрининга, должно обеспечиваться углубленное обследование с предварительной консультацией онколога. Все данные о проведенных обследованиях, включая и результаты углубленных исследований, должны передаваться в информационный центр (который необходимо создать на базе нашего краевого учреждения), где они обрабатываются и архивируются на специальном оптическом носителе.

В информационном центре должна производиться статистическая обработка результатов скрининга, формирование списков пациентов для повторных исследований, рассылка приглашений и т.д. В качестве каналов связи между районными лабораториями и центром скрининга должна использоваться сеть Internet.

Мониторинг групп высокого риска позволяет осуществить профилактику злокачественных опухолей яичников путем своевременного лечения фоновых процессов и предраковых заболеваний, ранних форм рака. Следует также отметить, что в пределах сформированных групп высокого риска по раку яичников возможно применение всего комплекса необходимых диагностических методик, что немыслимо при обследовании всех женщин, обращающихся за гинекологической помощью. Даже при отсутствии классической симптоматики внимательное обследование, применение диагностических методик последовательно, по принципу "от простого к сложному", помогает диагностике.

Таким образом, при обнаружении мутации гена BRCA1 у здорового члена семьи могут быть даны следующие рекомендации: программа скрининга и обсуждаемое сегодня профилактическое оперативное вмешательство. После первичной консультации и обдумывания необходима повторная консультация, которую проводит специалист, специализирующийся в области генетики рака. В процессе этой консультации выясняется, что ожидает женщина от планируемого генетического тестирования, как она интерпретирует возможные результаты и относится к процедуре скрининга и профилактике. Если здоровая женщина имеет четкие намерения пройти генетическое тестирование, она подписывает информационное согласие, и у нее производится взятие крови. Через 3-4 недели женщину приглашают для ознакомления с результатами тестирования. Результаты тестирования не могут быть сообщены по телефону.

Тем не менее, даже исключительно тщательный мониторинг носительниц мутаций в гене BRCA1 не гарантирует ранней диагностики и лечения от онкологического заболевания. Поэтому в развитых странах мира стандарты медицинской помощи подобным женщинам включают профилактически операции.

ВЫВОДЫ

  1. Наличие мутации в гене BRCA-1 обнаружена в 19% (37/188) случаев рака яичников у жительниц Российской Федерации: BRCA1 5382insC – обнаружена в 19,1% (36/188) случаев рака яичников; BRCA1 4153delA выявлена в 0,5% (1/188) наблюдений; наследственные мутации в генах BRCA1 185delAG, BRCA1 300T>G, BRCA2 6174delT, CHEK2 1100delC, CHEK2 IVS2+1G>A не оказывают влияния на индивидуальный риск рака яичников в Российской Федерации.
  2. Сочетанная гетерозиготность по генам BRCA-1 и NBS-1 совместима с жизнеспособностью индивидуумов. Ген NBS-1 участвует в патогенезе рака яичников, что подтверждается его соматической инактивацией опухолевой ткани.
  3. Наличие мутации в гене BRCA-1 у больных раком яичников ассоциируется с прогностически неблагоприятным течением заболевания: наличие мутации в гене BRCA-1 ассоциирован в 100% наблюдений с серозным гистологическим строением опухоли; у 97,3% больных (36/37) диагностирована III-IV стадия заболевания; низкодифференцированное строение опухоли выявлено в 51% (19/37) случаев; неоптимальные и субоптимальные циторедуктивные операции, при которых остаточная опухоль составила 2  и более см. выполнены в 97, 3% (36/37) случаев.

4. Наличие мутации в гене BRCA-1 у больных серозным раком яичников предсказывает эффективность химиотерапии. Эффективность лечения с использованием схемы: цисплатин 75 мг\м + таксотер 75 мг\ м, составила 0%.

5. ДНК-тестирование должен быть включен в алгоритм обследования больных серозным раком яичников с целью выявления BRCA-1 ассоциированных пробандов.

6. Метод аллель специфической полимеразной цепной реакции может использоваться в качестве скрининга у родственниц изучаемых пробандов: у 11,1% (6/54) здоровых на момент обследования родственниц обнаружено наличие мутации BRCA1 5382insC; у 33,3% (2/6) здоровых носительниц мутации в результате 34 месячного мониторинга выявлены злокачественные новообразования органов женской репродуктивной системы; мониторинг здоровых родственниц - носительниц мутации гена BRCA-1 в 50% случаев (3/6) выявил фоновые и предраковые заболевания.

7. ДНК-тестирование, проведенное методом аллель специфической полимеразной цепной реакцией является высокотехнологичным., нетрудоемким и экономически выгодным методом диагностики и  скрининга рака яичников.

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ

1. Внедрить ДНК-тестирование в обязательный алгоритм обследования всех больных серозным раком яичников.

2. Производить ДНК-тестирование только на наличии BRCA1 5382insC, так как в работе показана не причастность мутации в других генах на возникновения рака яичников.

3. Подвергнуть ДНК-тестированию ближайших родственниц пациенток, с целью раннего выявления и предупреждения рака яичников.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

1. Порханова Н.В. Значение определения СА-125 в диагностике и прогнозировании рецидивов серозного рака яичников / Н.В. Порханова, В.М. Шелепова, А.В. Соколов, К.И. Жордания // Вестник Онкологического Научного Центра АМН России. – 1997 – №1. – С. 21-26.

2 Порханова Н.В. Опухолево-ассоциированные маркеры СА-125 в диагностике рецидивов серозного рака яичников / Н.В. Порханова, В.В. Шматкова, В.А. Порханов, Ю.Е. Дудик // Успехи современного естествознания. – Москва, 2004. – №2. – С. 261-265.

3. Порханова Н.В. Совершенствование методов ранней диагностики и прогноза рецидивов неэпитеальных опухолей яичников / В.В. Шматкова, Н.В. Порханова, Н.С. Кержковская и соавт. // Успехи современного естествознания. – Москва, 2004. – №2. – С. 258-260.

4. Порханова Н.В. Ультразвуковая диагностика и определение опухоле-ассоциированного маркера СА-125 при рецидивах злокачественных опухолей яичников / Н.В. Порханова, В.В. Шматкова, В.А. Порханов, Ю.Е. и соавт. // Успехи современного естествознания. – Москва, 2004. – №2. – С. 260-261.

5. Порханова Н.В. Высокая частота мутаций в гене BRCA1 в спорадических раках яичника / Н.В. Порханова, Н.Ю. Крылова, Д.Н. Пономарёва и соавт. // Материалы ХI российского съезда онкологов, ноябрь 2007. – С. 59.

6. Порханова Н.В. Ассоциация между полиморфизмом I157T гена СНЕК2 и риском пограничных серозных опухолей яичника у жительниц России / А.П. Соколенко, О.С. Лобейко, Н.Ю. Крылова, С.Я. Максимов, А.Ф. Урманчеева, Д.Е. Мацко, А.А. Никонов, Е.Н. Суспицын, Е.Ш. Кулигина, А.Г. Иевлева, Ю.М. Улыбина, Н.В. Митюшкина, М.Е. Розанов, Н.В. Порханова и соавт. // Сибирский онкологический журнал – 2006. – № 4. – С. 12-15.

7. Порханова Н.В. Клиническая оценка применения препарата «Климадинон®» у онкологических больных (анализ результатов эксперементального наблюдения) / Л.В. Покуль, Н.В. Порханова. – Врач. – 2007. – №8. – С. 67.

8. Порханова Н.В. Мутации в гене BRCA-1 как причина развития спорадического рака яичников / Н.В. Порханова // Кубанский научный медицинский вестник. – 2008 – № 5. – С. 115-117.

9. Порханова Н.В. Сочетанная мутация BRCA1 и NBS1 (NBN) при раке яичников – первое наблюдение в мире / Н.В. Порханова // Кубанский научный медицинский вестник. – 2008 – № 5. – С. 112-115.

10. Порханова Н.В. Методические рекомендации по проведению профилактических осмотров и работе смотровых кабинетов с целью ранней диагностики злокачественных новообразований / Л.Г. Тесленко, Л.Д. Сирота, Н.В. Порханова, С.В. Шаров // Краснодар, 2008. – С. 5-42.

11. Porhanova N.V. Ovarian cancer patient with germ-line mutation in both BRCA1 and NBS1 (NBN) genes / N.V. Porhanova, A.P. Sokolenko, N.Yu.. Sherina, D.N. Ponomariova et al. // Cancer Genetics and Cytogenetics. – 2008. – № 186. – Р.122-124.

12. Porhanova N.V. CHEK2 1100delC mutation in Russian ovarian cancer patients / N.Yu. Krylova, D.N Ponomariova., N.Yu. Sherina et al. .// Heredity Cancer in Clinical Practtice. – 2007. – V. 5. – Р. 153-156.

13. Porhanova N.V. BRCA1 4153delA founder mutation in Russian ovarian cancer patients / N.Yu. Krylova, O.S. Lobeiko, A.P. Sokolenko, A.G. Iyevleva, M.E. Rozanov, N.V. Mitiushkina, M.M. Gergova, N.V. Porhanova et al. // Heredity Cancer in Clinical Practtice. – 2006. – Vol. 4. – P. 193-196.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.