WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

Никитенко Леонид Леонидович

Роль адреномедуллина и его рецепторов

в функционировании эндотелиальной клетки человека

( в норме и при некоторых патологиях)

14.00.16 - патологическая физиология,

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук

ИРКУТСК2007

Работа выполнена в ГУ "Научный центр медицинской экологии" Восточно-Сибирского научного центра Сибирского отделения РАМН, Оксфордском Университете (г.Оксфорд, Великобритания) и Лондонском Университете (г.Лондон, Великобритания)

Научный консультант        Академик РАМН, доктор медицинских наук, профессор

Колесников Сергей Иванович

Официальные оппоненты доктор биологических наук, профессор

Гутник Игорь Нэрисович

доктор медицинских наук, профессор

Семинский Игорь Жанович

доктор биологических наук

Попкова София Марковна

Ведущая организация ГОУ ВПО «Московская медицинская академия

им. И.М.Сеченова»

Защита состоится 26 октября 2007 г. в 14 часов на заседании Диссертационного Совета Д.001.054.01 при ГУ «Восточно-Сибирский научный центр Сибирского Отделения Российской академии медицинских наук» по адресу: 664003, г Иркутск, ул. Тимирязева, 16.

С диссертацией можно ознакомиться в библиотеке ГУ «Восточно-Сибирский научный центр Сибирского Отделения Российской академии медицинских наук»

Автореферат разослан «        »        2007г.

Ученый секретарь диссертационного Совета,

доктор медицинских наук       Шолохов Л.Ф.

Актуальность проблемы.

В настоящее время исследованию процессов развития и функционирования кровеносной и лимфатической сосудистых систем в норме и при патологии уделяется большое внимание. Эндотелиальные клетки микроциркуляторного русла (ЭКМР) играют ключевую роль в развитии и функции кровеносных и лимфатических сосудов. Избыточная пролиферация и трансформация, либо нарушение функции ЭКМР приводит к патологическому ангиогенезу/ лимфангиогенезу или дисфункции сосудистой системы – являющимся показателями злокачественных опухолей и многих других заболеваний [Carmeliet, 2003 и 2005].

Существенный прогресс был достигнут за несколько последних лет в исследовании молекулярных механизмов развития и функционирования сосудистой системы, и в выявлении ключевых ангиогенных и лимфангиогенных факторов, а также в использовании данных знаний для ингибирования ангиогенеза и лимфангиогенеза при опухолевых процессах и неоплазмах/новообразованиях различной этиологии, а также для терапии сердечно-сосудистых заболеваний у экспериментальных животных [Alitalo et al., 2005; Ferrara and Kerbel, 2005].

Одной из современных задач в “транслировании” (применении в практике для терапии человека) данных открытий в области исследования механизмов ангиогенеза и лимфангиогенеза на животных является проверка роли известных и новых факторов в биологии эндотелиальных клеток человека и выявление механизмов регулирующих экспрессию и функцию их рецепторов, а также определение их потенциальной роли в патогенезе опухолевых и сердечно-сосудистых заболеваний [Nikitenko et al., 2006].

В связи с этим разработка методов получения и культивирования эндотелиальных клеток кровеносного и лимфатического микроциркуляторного русла человека, а также исследование роли новых ангиогенных и лимфангиогенных факторов в биологии данного типа клеток представляет собой актуальную задачу в области биомедицины.

Несмотря на то, что эксперименты, проведенные на животных, указывали на роль нового ангиогенного фактора адреномедуллина (АМ) при развитии сосудистой системы у животных в эмбриогенезе и при опухолевых процессах, существовал ощутимый недостаток подобного рода исследований с использованием клеток человека. Кроме того, информация о распределении и функционировании эндогенных адреномедуллиновых рецепторов экспрессированных в клетках и тканях человека также оставалась неизученной до настоящего времени. В связи с этим неизвестными оставались как роль АМ и его рецепторов в тканях человека, так и возможности их использования для лечения раковых и других заболеваний [Nikitenko et al., 2006]. Данная проблема существует и для других ангиогенных факторов. Так, несмотря на несомненную роль одной из ключевых ангиогенных молекул - фактора роста эндотелия (vascular endothelial growth factor, VEGF) в развитии раковых опухолей в экспериментальных исследованиях на животных, применение ингибиторов данного ангиогенного фактора не всегда приводит к положительным результатам [Ferrara and Kerbel, 2005].

Трудности в данной области обусловлены отсутствием системного подхода в анализе экспрессии и функции факторов ангиогенеза и их рецепторов in vitro и in vivo в клетках и тканях человека. Под системным подходом подразумевается проведение исследований не только роли данных факторов на эндотелиальные клетки человека, но и исследование транскрипции и трансляции генов кодирующих данные рецепторы в органах и клетках, изучение механизмов регулирующих экспрессию рецептора на поверхности клетки,

специфичности его взаимодействия с потенциальными лигандами (фармакология рецептора), а также механизмов десенситизации и ресенситизации.

Данный подход позволяет рассматривать не только механизм действия определенного ангиогенного фактора на молекулярном и клеточном уровнях, но и потенциал использования данных знаний в теоретической биологии а также при разработке методов диагностики, интервенции и терапий для прогнозирования эффективности применения ингибиторов и активаторов данных механизмов, выявления типов раковых опухолей (а также индивидуальных пациентов), в которых действие данных препаратов может быть наиболее результативным, и потенциального использования в клинике для лечения широкого спектра сердечно-сосудистых, раковых, инфекционных и других заболеваний связанных с патологическим (лимф)ангиогенезом или дисфункции сосудистой системы

Исходя из этого, целью данного исследования являлось оценка роли пептида адреномедуллина (АМ) в биологии эндотелиальных клеток микроциркуляторного русла человека и механизмов регулирующих экспрессию и функцию его рецепторов в норме и при некоторых патологиях на основе комплексного морфо-функционального и молекулярно-генетического исследования.

Изучение роли адреномедуллина и его рецепторной системы путем комплексно-систематического подхода.

В соответствии с целью исследования были поставлены следующие задачи:

  1. Разработать методы получения и культивирования эндотелиальных клеток микроциркуляторного русла (ЭКМР) из тех тканей человека, в которых происходят процессы физиологического ангиогенеза;
  2. исследовать роль АМ в первичных культурах ЭКМР человека;
  3. исследовать экспрессию адреномедуллинового рецептора - рецептора подобного кальцитониновому рецептору (calcitonin receptor-like receptor, CL, кодируемого CALCRL геном) в клетках и тканях человека;
  4. исследовать механизмы, регулирующие экспрессию CALCRL гена человека в ЭКМР в норме и при патологии путем клонирования и описания промотера, изучения субхромосомной организации данного гена и влияния онкогенных вирусов (на примере вируса саркомы Капоши) на его транскрипцию;
  5. произвести и охарактеризовать антитела против CL рецептора;
  6. исследовать специфичность к различными лигандам, а также механизмы сенситизации и десенситизации, CL рецептора в эндотелии человека;
  7. исследовать роль адреномедуллина и его рецепторов в ангиогенезе при развитии раковых опухолей и патологических заболеваний органов репродукции, путем изучения экспрессии пептида и локализации функциональной формы CL рецептора в тканях человека в норме и при патологии (в опухолях почек и яичников и тканях саркомы Капоши).
  8. исследовать возможность использования разработанных реактивов и методов для диагностики неоплазм, раковых опухолей и других заболеваний;
  9. исследовать возможность модулирования функционирования адреномедуллиновых рецепторов с целью коррекции их функции при патологиях развития и функции сосудистой системы.

Основные положения выносимые на защиту.

  • АМ является новым ангиогенным фактором в тканях человека за счет своей способности активировать пролиферацию и миграцию, а также ингибировать апоптоз эндотелиальных клеток микроциркуляторного русла.
  • Экспрессия CALCRL гена человека зависит прежде всего от клеточно- и ткане-специфического фона. При этом ключевым фактором в транскрипции CALCRL гена является его трехмерная субхромосомная структура, в то время как активность промотера играет вторичную роль.
  • Десенситизация CL рецептора в эндотелиальных клетках человека при избыточной экспрессии лиганда отражается на его функции и может играть роль при развитии сердечно-сосудистых заболеваний различной этиологии.
  • Разработанные реактивы и методы могут применяться для диагностики и коррекции патологий связанных с функцией адреномедуллиновых рецепторов, например патологического ангиогенеза и гиперпроницаемости эндотелия.
  • Разработана и применена концепция системного анализа механизмов комплексной многоуровнево-селективной регуляции экспрессии и функции адреномедуллиновых рецепторов, а также их роли в полноценном функционировании эндотелиальной клетки в норме и при патологии.

Научная новизна работы.

Разработаны и усовершенствованы методы получения и культивирования эндотелиальных клеток микроциркуляторного русла (ЭКМР ) человека.

Впервые продемонстрирована роль пептида АМ в биологии ЭКМР и ангиогенезе в тканях человека.

Впервые описаны механизмы регулирующие экспрессию CALCRL гена человека и функцию CL рецептора в тканях и эндотелии человека. Впервые продемонстрирована роль CL рецептора как рецептора для АМ и пептида относящегося к гену кальцитонина (CGRP) в ЭКМР человека, а также выявлены механизмы его десенситизации.

Впервые разработан метод определения трехмерной субхромосомной структуры генов. Сконструированы плазмидные векторы, позволяющие эффективно оценивать экспрессию CALCRL гена человека, активность его промотера и осуществлять экспрессию CL рецептора в клетках млекопитающих. Впервые клонированы новые, ранее неохарактеризованные транскрипты CALCRL гена человека и лентивирусная «библиотека», включающая 27 генов, кодирующих различные вирусные белки вируса саркомы Капоши.

Впервые получены уникальные реактивы - поликлональные антитела против человеческого CL рецептора и блокирующие моноклональные антитела против гетеродимера CL/RAMP, экспрессированого на поверхности клетки. Показана специфичность данных антител и возможность оценки функционального статуса CL рецептора, а также регуляции его функции в клетках и тканях человека.

Впервые продемонстрирована экспрессия CL рецептора в клетках и тканях человека в норме и при патологиях (на примере опухолевых тканей почек, яичников, лейомиомы и саркомы Капоши).

Разработана и применена концепция системного анализа механизмов комплексной многоуровнево-селективной регуляции экспрессии и функции адреномедуллиновых рецепторов, а также их роли в полноценном функционировании эндотелиальной клетки в норме и при патологии.

Практическая значимость исследования.

Разработанные реактивы и методы могут быть использованы для дальнейших исследований биологии эндотелиальных и стволовых клеток человека, экспрессии и функции CL рецептора в нормальных и опухолевых клетках и тканях человека, а также для диагностики раковых, сердечно-сосудистых и других заболеваний.

Полученные плазмидные векторы могут быть использованы в области биотехнологии, а полученные поликлональные антитела против CL рецептора человека - как для научно-исследовательских работ, так и для применения в области диагностики и практической медицины.

Разработанные моноклональные антитела против гетеродимеров CL/RAMP могут

являться эффективным методом коррекции патологий, связанных с функцией

адреномедуллиновых рецепторов, как  например патологический  ангиогенеза и
гиперпроницаемость эндотелия.

Изученная роль АМ в биологии ЭКМР человека и полученные данные о механизмах регулирующих, экспрессию и функцию адреномедуллиновых рецепторов, представляют собой большой интерес при поиске эффективных методов противоопухолевой терапии и сердечно-сосудистых заболеваний связанных с ангиогенезом и функцией эндотелия в тканях человека.

Полученные результаты расширяют понимание комплексной регуляции адреномедуллиновых рецепторов и позволяют оценить возможность применения ингибиторов/активаторов действия АМ для трансляционных исследований и терапии заболеваний, связанных с избыточной или недостаточной экспрессией самого пептида, либо его рецепторов, а также проводить предварительные исследования по воздействию различных веществ на экспрессию, транспорт и функцию CL в эндотелиальных клетках, как источнике его локализации in vivo в тканях человека.

Полученные данные свидетельствуют о необходимости продолжения исследований фармакологии адреномедуллиновых рецепторов как в эндотелиальных клетках опухолей так и в самих опухолевых клетках, а также выявления различий рецептора, экспрессированного в нормальном и опухолевом эндотелии.

На основе разработанных технологий получения поликлональных и моноклональных антител против CL рецептора человека, определения трехмерной субхромосомной структуры генов и векторных плазмид, содержащих промотер CALCRL гена человека, разработаны методы их использования для диагностики раковых и других заболеваний, а также оформлено и получено два патента на изобретение.

Апробация диссертационной работы. Результаты исследований доложены на конференциях: Xth Hamburg Symposium on Tumor Markers, Hamburg, Germany, 1999; XIth International Congress of Histochemistry and Cytochemistry, York, United Kingdom, 2000; Annual ICRF Colloquium, Warwick, United Kingdom, 2000; Introduction to Molecular and Cellular Research, San-Diego, USA, 2000; 8th IFPA Meeting, Melbourne, Australia, 2002; “Angiogenesis: basic mechanisms and therapeutic implications”, Ascona, Switzerland, 2002; 5th Imperial College School of Medicine Symposium “Vascular endothelium: Role in disease pathogenesis and as a therapeutic target”, London, United Kingdom, 2002; 676th Biochemical Society Meeting, Edinburgh, United Kingdom, 2002; 6th International Engelhardt Conference on Molecular Biology, Mосква и Санкт-Петербург, Российская Федерация, 2003; Special FEBS 2003 Meeting on Signal Transduction, Brussels, Belgium, 2003; The 40th American Association for Cancer Research Annual Meeting, New Orleans, USA, 2003; Joint International Symposium on CGRP, Amylin and Calcitonin 4th Symposium on Adrenomedullin and Proadrenomedullin N-20 Peptide, Zurich, Switzerland, 2004; XXXIV Congress of Nordic Federation of Obstetrics of Obstetrics and Gynaecology, Helsinki, Finland, 2004; XI European Placenta Group Meeting, Glasgow, United Kingdom, 2005; XIth Biennial International Gynecologic cancer Society Meeting, Santa Monica, USA, 2006; The 24th European Conference on Microcirculation. From Vascular Biology to Clinical Microcirculation, Amsterdam, Netherlands, 2006; The 9th International Workshop on Kaposi’s Sarcoma Associated Herpesvirus (KSHV) and Related Agents, Cape Cod, USA, 2006; The Physiological Society 2006 Main Meeting, London, United Kingdom; The 21st Scientific Meeting of the International Society of Hypertension (ISH2006), Fukuoka, Japan, 2006.

Публикации: основные материалы работы изложены в одной монографии, руководстве по эмбриологии, двух главах книг, 13 статьях в международных журналах, 21 материалах международных научных конференций, двух оформленных патентах на изобретение.

Структура и объем диссертации. Диссертация изложена на 198 страницах машинописного текста и содержит следующие разделы: введение, обзор литературы, описание материалов и методов исследования, результаты и их обсуждение, общие выводы и указатель цитируемой литературы (325 источников). Работа иллюстрирована 65 рисунками и 12 таблицами.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

Объекты и методы исследования

Для реализации поставленных задач были использованы следующие методы исследования:

  • клеточно-биологические (выделение и описание первичных культур эндотелиальных клеток микроциркуляторного русла человека, исследование ангиогенной активности пептидов с применением моделей ангиогенеза in vitro);
  • гистологические (иммуногистохимия, иммунофлюоресценция, микрочипы тканей, гибридизация in situ; световая, флуоресцентная и конфокальная микроскопия);
  • молекулярно-биологические (Northern блоттинг, Western блоттинг, метод полуколичественной и количественной полимеразной цепной реакции (ПЦР), ДНК микрочипы, 3’- и 5’-RACE, метод определения субхромосомной структуры генов, клонирование);
  • биотехнологические и биохимические (получение, очистка и характеризация поликлональных и моноклональных антител, дегликозилирование, ELISA);
  • вирусологические (получение препаратов вируса саркомы Капоши, конструкция и использование лентивирусной «библиотеки», кодирующей индивидуальные гены данного онкогенного вируса).

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ И ИХ ОБСУЖДЕНИЕ

Задачей первого этапа исследований являлось определение возможной роли АМ в ангиогенезе в тканях человека. Для практического выполнения поставленной задачи было необходимо получение эндотелиальных клеток микроциркуляторного русла (ЭКМР) органов и тканей, в которых происходят процессы физиологического или патологического ангиогенеза. Нами были выбраны эндометрий и миометрий человека для разработки методов получения ЭКМР и изучения роли адреномедуллина, поскольку физиологический ангиогенез характерен для тканей матки и предварительные данные экспериментов проведенных в нашей лаборатории указывали на возможную роль данного пептида в этих тканях [Hague et al., 2000]. Необходимость получения ЭКМР из органов в которых происходит ангиогенез для изучения роли новых ангиогенных факторов обусловлено тем, что именно пролиферация и миграция эндотелия микроциркуляторного русла, а не основных сосудов, необходимы для возникновения новых сосудов при ангиогенезе в тканях. Кроме того, эндотелий микроциркуляторного русла разных органов гетерогенен, т.е. может отличаться по своим функциональным свойствам, морфологии и экспрессии рецепторов, а потому и различной способностью отвечать на стимуляцию данными факторами.

Разработка  методов  изолирования,  характеризации  и  культивирования эндотелиальных клеток микроциркуляторного русла человека.

Для получения ЭКМР нами были использованы лектин Ulex Europeus Agglutinin 1 (UEA1), связанный с магнитными шариками (Рисунок 2). UEA1 селективно распознает эндотелиальные клетки непосредственно в тканях (Рисунок 2), путем связывания с фукозой на поверхности этих клеток.

Получение и характеристика эндотелиальных клеток микроциркуляторного русла (ЭКМР) из эндометрия человека.

Эндотелиальные клетки были получены из
эндометриальной ткани матки (А) после гистерэктомии.
(А) Радиограмма среза матки (спиральные артерии
эндометрия наполнены суспензией сульфата бария и
желатина). Эндотелиальные клетки микроциркуляторного
русла экспрессируют фукозу, распознаваемую лектином
Ulex Europeus Agglutinin-1 (UEA-1) выявленого путем (Б)
использования метода иммунофлуоресценции (ФИТЦ –
зеленый цвет; белые стрелки; DAPI - окраска ядер).
Магнитные шарики покрытые лектином UEA-1 были
использованы для получения чистых культур ЭКМР,
формирующих (В) характерный монослой в культуре
(магнитные шарики в первом пассаже еще прикреплены к
поверхности клеток; красные стрелки) и (Г) капиллярную
сеть на матриксе Матригель. Иммунофлуоресцентная
характеризация ЭКМР матки с использованием антител
против специфических маркеров (Д) фактора вон
Виллебранда (vWF) и (Е) CD31. ЭКМР активно растут в культуре, что продемонстрировано иммунофлуоресцентной окраской на присутствие (Ж) маркера пролиферирующих клеток Ki67.

Первоначально ткани эндометрия были собраны в среду МакКоя (McCoy’s 5A medium), содержащую 10% телячьей сыворотки (ТС) и антибиотики, и сохранены на 12-16 часов при 40С. На следующий день ткань была разрезана скальпелем на кусочки размерами 1 мм2, которые впоследствии были инкубированы в течении 2 часов в среду МакКоя содержащей 2 мг/мл коллагеназы и 10% телячьей сыворотки при постоянном размешивании. Данная процедура приводит к распаду тканевых структур и получению клеточной суспензии, которая затем фильтруется через стерильное сито с порами размером 100 мкм для удаления нерастворенных тканей. Затем клеточная суспензия центрифугируется и промывается несколько раз средой. Обобщенная схема получения и оценки ЭКМР человека показана на Рисунке 2.

После этого первоначально клеточная суспензия может быть обогащена на содержание ЭКМР может путем центрифугирования полученной клеточной суспензии в “непродолжительном” градиенте “Percoll”. При этом клеточная масса ресуспендируется в 20% растворе “Percoll” в физрастворе с содержанием бычьего сывороточного альбумина (БСА) и помещается на поверхность двух слоев раствора “Percoll” – 40%-ного и 60%-ного. После этого трехслойный “непродолжительный” градиент (20%-40%-60%) “Percoll” центрифугируется при 670 g в течении 30 минут и обогащенная эндотелиальными клетками популяция формируется между слоями 40%-ного и 60%-ного растворов “Percoll”. Клетки собираются с помощью Пастеровской пипетки и ресуспендируются в среде МакКоя содержащей 10% ТС.

Магнитные шарики готовятся предварительно, за день до проведения изолирования эндотелиальных клеток. Лектин Ulex europeus agglutinin был связан ковалентно к тозилактивированным магнитным шарикам “Dynabeads” M-450 в соответствии с предварительно опубликованными работами [Jackson et al., 1990]. Одинаковые объемы лектина (0.2 мг/мл в боратном буфере, рН 9.6) и шариков (2х107 шариков/мл) и проинкубированы в течение 12-16 часов при 40С и постоянном перемешивании. На следующий день шарики были промыты три раза в физиологическом растворе при помощи магнитного концентратора и ресуспендированы в физиологическом растворе с содержанием БСА до концентрации 2х107 шариков/мл, после чего сохранены при 40С до использования.

Селекция эндотелиальных клеток была проведена при помощи магнитных шариков покрытых лектином Ulex europeus agglutinin путем инкубирования при 40С в течении 10 минут и постоянном перемешивании. Клетки были инкубированы с шариками в пропорции 1:3 в общем объеме 0.5 мл. После этого прикрепленные клетки были собраны при помощи концентратора магнитных частиц, с удалением супернатанта, не содержащего магнитных шариков, но содержащего клетки других типов (не-эндотелиальные). Данная процедура  проводится три раза, с промежуточной промывкой частиц в среде МакКоя содержащей 1% телячьей сыворотки в течение 1 минуты.

Очищенные популяции ЭКМР эндометрия, полученные из индивидуальных препаратов (количество клеток варьировало от 5000 до 17000) были посажены в чашки Петри (35мм2; при плотности клеток 6000 на ячейку) предварительно покрытые коллагеном IV типа (5g/см2). Культуры клеток были инкубированы при 370С в инкубаторе во влажной атмосфере с содержанием 5% СО2. Среда менялась через каждые 48 часов. При достижении конфлюенции клетки были пересажены путем использования раствора содержащего трипсин и ЭДТА, с последующим разведением в среде для культивирования в пропорции 1:2.

Полученные данным методом клетки первоначально содержат магнитные шарики прикрепленные к их поверхности (Рисунок 2). Клетки образуют специфические колонии, характерные для данного типа клеток, в течение первых 24 часов. Из проведенного количества экспериментов 80% имели свои результатом успешное изолирование эндотелиальных клеток. Лишь часть из полученных препаратов (<5%) содержала другие типы клеток, количество которых, тем не менее, не превышало 1-5%. ЭКМР эндометрия имели морфологию типичную для клеток данного типа (Рисунок 2) с большим ядром, заметным контактным ингибированием в точках соприкосновения и отсутствием наползания клеток друг на друга при достижении конфлюенции. Магнитные шарики оставались прикрепленными к эндотелиальным клеткам после того как они были посеяны впервые, впоследствии было отмечено их спонтанное освобождение при первой пересадке. Кроме того, эндотелиальные клетки обладали способностью образовывать “капилляроподобные” структуры при пересадке на специфический матрикс Матригель (Рисунок 2). Предыдущими исследованиями было показано, что только эндотелиальные клетки обладают такой способностью. Более подробные детали проведения вышеуказанных экспериментов описаны в наших работах [Nikitenko et al., 2000; Nikitenko et al., 2006].

Полученные из тканей первичные клетки необходимо было охарактеризовать на наличие специфических маркеров того или иного типа клеток. ЭКМР были охарактеризованы с использованием специфических маркеров эндотелия (Рисунок 2, Таблицы 1 и 2). Для проведения анализа специфичности полученной популяции эндотелиальных клеток нами был проведен иммуногистохимический анализ клеток изолированных из эндометрия, миометрия и децидуальной ткани. Для этого нами был использован спектр моноклональных и поликлональных антител, распознающих антигены, которые экспрессированы специфически на определенных типах клеток (Таблица 1). Иммуногистохимия и иммунофлюоресценция были проведены соответственно методам описанных в спектре наших работ [Nikitenko et al., 2000; Nikitenko et al., 2001; Nikitenko et al., 2006].

Таблица 1.

Моноклональные и поликлональные антитела использованнные для характеризации эндотелиальных

клеток микроциркуляторного русла.

Антитело/Клон

Антиген a

Литература

Источник

1А4

Гладкомышечный актин

Skalli et.al., 1986

Dako

F8/86

Фактор вон Виллебранла

Naiem et.al., 1982

Dako

JC/70A

CD31

Parums et.al., 1990

Dako

LP34

Кератины 5,6 and 18

Moll et al., 1982

Dako

MNF 116

Кератины 5,6,8,17,19

Dako

PG-M1

CD68

Falini et al., 1993

Dako

V9

Виментин

Osborn et al., 1984

Dako

MM1

Ki-67

Novocastra

Поликлональные

Фактор вон Виллебранла

Bukh et al., 1986

Dako

Поликлональные

VEGFR II (KDR)

Barleon et al., 1994

Gift from Dr H.Weich

a CD31 – cluster designation 31; CD68 – cluster designation 68; VEGFR II – vascular endothelial growth factor receptor II.

Маркеры CD31, фактор вон Виллебранда и места связывания лектина Ulex europeus agglutinin присутствовали на эндотелии как в тканях так и in vitro в течение 4-5 пассажей (Таблица 2). Интенсивная типичная “точечная” окраска на фактор вон Виллебранда была отмечена в цитоплазме эндотелия микроциркуляторного русла эндометрия и децидуальной ткани в культуре (Рисунок 2). При достижении конфлюенции антиген CD31 присутствует в местах клеточных контактов в данных клетках (Рисунок 2). Кроме того, клетки обладали способностью к эффективной пролиферации как показано с применением маркера Ki-67 (Рисунок 2).

Кроме того, нами были использованы антитела против гладкомышечного актина, кератинов и CD68 (Таблица 1) для определения присутствия мышечных и эпителиальных клеток, а также макрофагов соответственно в культурах эндотелиальных клеток микроциркуляторного русла. Данные эксперименты выявили наличие всего 1-5% неэндотелиальных клеток в менее чем 5 процентах полученных препаратов первичных клеток из исследуемых тканей.

Таким образом, оптимизация метода привела к получению чистых (95-100%) первичных культур ЭКМР из тканей человека (децидуа и эндометрий- рисунок 2).

Применение данного метода с использованием ткани миометрия также привело к успешному получению ЭКМР из данной ткани человека. Происхождение ЭКМР миометрия было охарактеризовано с использованием морфологических, иммуногистохимических и молекулярно-биологических методов .

Исследование роли адреномедуллина

Получение чистых культур ЭКМР позволило впервые изучить влияние АМ на биологию данного типа клеток человека и проверить гипотезу о роли этого пептида в ангиогенезе в тканях и органах человека. Нами были проведены эксперименты по изучению роли АМ в росте, миграции и регуляции монослоя ЭКМР (Рисунок 3).

Митогенные свойства адреномедуллина

Митогенный анализ (влияние на пролиферацию) свойств адреномедуллина был проведен с использованием метода инкорпорации радиоактивно меченного тимидина (метил-3Н) [Nikitenko et al., 2000]. Первичные эндотелиальные клетки четвертого пассажа были посажены в 96-луночные тарелки (5000 клеток на лунку). На следующий день среда была заменена на среду с низким содержанием человеческой сыворотки (20%). На третий день клетки были простимулированы факторами роста: эндотелия (VEGF), фибробластов (bFGF), эпидермиса (EGF) или адреномедуллином (AM) в среде содержащей 10% сыворотки человека и с добавлением радиоактивно меченного тимидина (1 Ci). После 24-часловой инкубации

клетки были трипсинизированы и собраны на фильтры для измерения радиоактивности с помощью сцинтилляционного бета-счетчика.

АМ индуцировал инкорпорацию тимидина в культурах ЭКМР эндометрия и миометрия (Рисунок 3) человека. Интенсивность стимуляции была сравнима с таковой полученной при использовании известных ангиогенных факторов – VEGF и bFGF, экспрессия которых была ранее выявлена в матке человека [Bicknell and Rees, 1995].

Адреномедуллин стимулирует миграцию эндотелиальных клеток

Для исследования влияния АМ на миграцию эндотелиальных клеток нами были использованы аппараты Transwell (Рисунок 3) [Nikitenko et al., 2006]. Эндотелиальные клетки были посажены в верхнюю камеру вкладки Transwell. Пептиды (адреномедуллин, CGRP или амилин, принадлежащие к одному и тому же семейству пептидов) [Poyner et al., 2002] были добавлены в нижнюю камеру. Полная среда для культивирования эндотелиальных клеток (содержащая несколько факторов роста для эндотелиальных клеток) или VEGF были использованы в качестве положительных контролей. Среда без факторов роста (0.5% ТС) была использована в качестве отрицательного контроля. После 24-часовой инкубайии клетки были помечены флуоресцентным красителем (calcein-AM), и количество мигрировавших клеток определено путем измерения флуоресценции клеток с использованием счетчика Elx 800 с возможностями чтения нижней части вкладыша. Данные были проанализированы и

статистически обработаны, и фотографии получены с использованием Программ RC4v30 PowerReports и Nicon CoolPix 990 Camera соответственно. Только мигрировавшие сквозь поры светонепроницаемой мембраны клетки могут быть детектированы счетчиком.

Проведенные эксперименты показали что АМ и CGRP, но не амилин, являются факторами миграции эндотелиальных клеток (Рисунок 3). Полученный при использовании данных пептидов миграционный эффект был сравним по интенсивности с таковым полученным при использовании ангиогенного фактора VEGF. Значительный интерес при этом представляет сходство ангиогенных эффектов (пролиферации и миграции) полученных при использовании эндотелиальных клеток микроциркуляторного русла человека и in vivo моделей с использованием тканей цыпленка (Рисунок 3) и ксенотрансплантированных клеточных линий сверхэкспрессирующих АМ в мышиных моделях (Рисунок 3).

+++

+++

++

++

++ или-

НО

Антиген

Криостатные срезы  Парафиновые срезы  Культура 4-го пассажа

Фактор вон

+++

Виллебранда

CD31

+++

Виментин

++

Места связывающие

НО

лектин UEA1

Ki-67

НО

VEGFR II (KDR)

++

Гладкомышечный

-

актин

Кератины

-

5,6,8,17,18,19

CD68

-

+++

+++

++

+++

+ или- НО

- -

       

        -                         -        

                       

       -         -
Таблица 2.

Иммунореактивность эндотелиальных клеток микроциркуляторного русла эндометрия человека на криостатных и парафиновых срезах и в культуре с использованием моноклональных и поликлональных антител (включая результаты по окраске с использованием лектина UEA-1).

Интенсивность окраски была определена полуколичественным методом - +++ очень интенсивная окраска; ++ сильная окраска; + слабая окраска; - отсутствие окраски; NE – анализ не проведен. а – Сходная окраска была получена при использовании поликлональных и моноклональных антител на замороженных срезах.

Сокращения указаны в Таблице 1.

a Данная таблица также включает результаты окраски с использованием лектина Ulex europaeus agglutinin 1 (UEA 1).

b Сходная окраска была получена на парафиновых и криостатных срезах.

Окраска была оценена с использованием полуколичественного метода: +++ - очень сильная окраска, ++ -

сильная окраска, + - слабая окраска, - - отсутствие окраски, НО – не определено.

Роль адреномедуллина в биологии
эндотелиальных        клеток

микроциркуляторного русла (ЭКМР) человека.

(А) Пролиферация ЭКМР эндометрия в
ответ на стимуляцию АМ (результаты
стимуляции с использованием VEGF,
bFGF и FGF приведены для сравнения).
(Б) Пролиферация ЭКМР миометрия
при стимуляции АМ. (В) Миграция
ЭКМР кожи (см. ниже) в ответ на
стимуляцию АМ. Данный эффект АМ
на ЭКМР in vitro сравним с эффектом
наблюдаемым in vivo при использовании
(Г) CAM (chicken chorioallantoic
membrane assay) (фото адаптировано из
Zhao et al., 1998) и (Д) мышиных
ксенографтных моделей (фото
адаптировано из Oehler et al., 2001) (Е)
АМ защищает монослой ЭКМР от
действия активаторов апоптоза
(например, низкое содержание
сыворотки в среде для культивации).
Данный эффект противоположен (Ж)
эффекту, наблюдаемому в сосудистой
системе        мышей        при

выключении/удалении        гена

адреномедуллина (фото адаптировано из Shindo et al., 2001).


Ингибирование апоптоза адреномедуллином

Нами были также проведены исследования по выявлению роли АМ в ингибировании апоптоза, вызванного пониженной концентрацией сыворотки в культивируемой среде (Рисунок 3). Результаты данных исследований показывают, что АМ защищает монослой эндотелиальных клеток человека от разрушений вызванных пониженной концентрацией сыворотки и гибелью эндотелиальных клеток в данных условиях. Значительный интерес при этом представляет сходство морфологии эндотелия человека при ингибировании АМ сигналов и эндотелия органов у гомозиготных АМ -/- эмбрионов мышей (Рисунок 3) [Shindo et al., 2001].

Таким образом, в результате первого этапа исследований нами были разработаны методы изолирования эндотелиальных клеток микроциркуляторного русла эндометрия и миометрия, как органов в которых происходят процессы физиологического ангиогенеза. Данные методы получения эндотелия сосудов микроциркуляторного русла человека позволили впервые проверить гипотезу о возможной роли адреномедуллина в данных клетках при процессах ангиогенеза и изучить роль этого пептида в биологии данного типа клеток. Результаты проведенных экспериментов продемонстрировали впервые роль адреномедуллина в росте и миграции эндотелиальных клеток микроциркуляторного русла человека.

Необходимо отметить, что одновременно исследованиями, проведенными в лабораториях за рубежом, были сделаны открытия о роли АМ в эмбриогенезе [Caron and Smithies, 2001; Shindo et al., 2001] и развитии раковых опухолей [Oehler et al., 2001; Oehler et al., 2002], ингибировании апоптоза [Kato et al., 1998; Shichiri et al., 1999] и гиперпроницаемости эндотелиальных клеток [Hippenstiel et al., 2001]. Обобщение данных исследований и предыдущего знания о вазоактивных свойствах АМ позволило нам сделать заключение о важной роли данного пептида в микроциркуляторном русле [Nikitenko et al., 2002].

В свою очередь данные открытия указывали на необходимость исследования адреномедуллиновых рецепторов в клетках и тканях человека, и в том числе механизмов регулирующих их экспрессию и функцию.

Механизмы, регулирующие экспрессию адреномедуллиновых рецепторов

Необходимость изучения экспрессии эндогенных адреномедуллиновых рецепторов  обусловлена прежде всего тем что лиганд может быть секретирован практически любой клеткой. Однако остается неясным, какие клетки являются мишенью для данного пептидного гормона в органах и тканях. Прежде всего, данная информация необходима для разработки методов терапии и регуляции (активирования или ингибирования) физиологических и патологических процессов ангиогенеза. Поэтому нами был разработан спектр методов для изучения экспрессии, а также механизмов регулирующих транскрипцию гена и функционирование рецептора в эндотелиальных клетках.

Исследованиями, проведенными С. Фордом и коллегами [McLatchie et al., 1998] было показано, что G-белок связывающий рецептор Calcitonin receptor-like receptor (CRLR, впоследствии переименованный в CALCRL ген и CL рецептор в соответствии с номенклатурой Геномного Проекта Человека и Фармакологического Союза, соответственно) путем формирования гетеродимера с одним из трех RAMPs (белков модифицирующих активность рецепторов) образует рецепторы для нескольких пептидов кальцитониновой группы. Таким образом, CL играет ключевую роль в формировании адреномедуллиновых рецепторов (Рисунок 4). Поэтому наши исследования на следующем этапе были сфокусированы на исследовании механизмов транскрипции CALCRL гена и экспрессии функционального CL рецептора.

Исследования экспрессии CALCRL гена in vitro и in vivo

Первоначально исследованиями, проведенными с использованием тканей человека в нашей лаборатории и применением метода гибридизации in situ было показано, что мРНК CALCRL локализована преимущественно в кровеносных сосудах in vivo. (Рисунок 5). Данные этих исследований указали на то, что in vivo именно микрососуды являются мишенью для адреномедуллина и CGRP, несмотря на широкий эффект данных гормонов in vitro на многие другие клеточные линии происходящие из разных органов [Hinson et al., 2000]. Несмотря на данные результаты, исследованию регуляции экспрессии адреномедуллиновых и CGRP рецепторов препятствовало отсутствие знаний прежде всего о регуляции экспрессии CALCRL гена. Поэтому первоначальной целью наших исследований являлось клонирование промотера, выявление регуляторных элементов в его структуре и исследование механизмов регулирующих транскрипцию CALCRL  гена в эндотелиальных клетках человека.

Транскрипционный анализ CALCRL гена с использованием метода RT-PCR

Для транскрипционного анализа (профайлинга) экспрессии человеческого CALCRL гена, нами были использован метод полимеразной цепной реакции с предварительным использованием обратной транскриптазы (RT-PCR) и кДНК полученных из эндотелиальных и неэндотелиальных клеток, а также из тканей человека. Полученные данные показали, что экспрессия CALCRL гена происходит преимущественно в микроциркуляторных эндотелиальных клетках человека изолированных из легких, эндометрия, миометрия и кожной ткани (Рисунок 5).

Определение транскрипционного старта CALCRL гена с использованием метода RАСЕ

Для выявления транскрипционного старта и промотера CALCRL гена человека нами был использован метода быстрой амплификации концов кДНК (RACE). RACE является методом, основанным на использовании метода ПЦР и служит эффективным методом в изолировании полной последовательности кДНК специфических генов. Первоначально мы провели дизайн ген-специфического праймера  5’CCCACAAGCAAGGTGGGAAAGAGTG, соответствующего первому экзону опубликованной последовательности CALCRL гена человека. РНК эндотелиальных клеток была транскрибирована обратной полимеразой с применением олиго-дТ праймера для получения одноцепочечной комплиментарной ДНК. Адапторные последовательности были лигированы к обоим концам полученной ДНК для получения двухцепочечной кДНК. Лигированная ДНК была использована для проведения ПЦР с использованием ген-специфического и адапторного праймеров.

Использование метода 5’-RACE привело к амплификации основного продукта длиной 200 нуклеотидов (Рисунок 6). Данный продукт ПЦР был очищен методом изолирования из геля, просиквенирован, и полученная последовательность сравнена с последовательностью кДНК и геномной последовательностью c целью определения транскрипционного старта CALCRL гена человека. Наши данные привели к выявлению начала транскрипции и позволили определить потенциальный промотер CALCRL гена, и поэтому сделать возможным проведение его клонирования и анализа.

G-белок связывающий рецептор CL -ключевая молекула в адреномедул-линовых рецепторах.

CL экспрессирован в клетке в виде основно-
гликозилированного белка который
локализирован в эндоплазматическом
ретикулуме. Белки модифицирующие
активность рецептора (RAMPs) принимают
участие в терминальном гликозилировании,
транспорте CL к плазматической мембране и
определяют фенотип гетеродимеров.
Гетеродимер CL/RAMP1 является
рецептором для CGRP (CGRP1 рецептор), в
то время как CL/RAMP2 и CL/RAMP3
гетеродимеры по своим Фармакологическим свойствам являются соответственно AM1 и AM2 рецепторами.

Транскрипция CALCRL гена в клетках и тканях человека.

(А) Преимущественная экспрессия CALCRL мРНК в эндотелиальных клетках полученных из разных органов человека. Экспрессия гена намного ниже в неэндотелиальных клеточных линиях и первичных клеточных культурах. (Б) CALCRL мРНК локализуется в клетках сосудов микроциркуляторного русла матки как в эндометриальной так и миометриальной тканях (стрелки), но не эпителиальных гландах (короткие стрелки) и строме (звезды) эндометрия (Э), либо гладких мышцах (звезды) миометрия (М). Замороженные срезы гибридизированы с антисенс-зондом меченым 35S для выявления локализации CALCRL мРНК (микроскопия с использованием светлого и темного полей). Сигнал отсутствует при использовании сенс-зонда. СП – светлое поле, ТП – темное поле.

Изначально нами были проведены исследования промотера CALCRL гена, а также гетерогенность его транскриптов и субхромосомной организации в эндотелиальных клетках человека.

Определение начала транскрипции CALCRL  гена человека в эндотелиальных клетках  с использованием метода 3RACE.

Праймер специфичный для экзона 1 CALCRL гена (GSP-1) был использован для проведения 3’RACE реакции амплификации. (А) Амплифицирован-ный продукт размером 200 нуклеотидных пар для CALCRL гена человека (1) и 2500 нуклкотидных пар для трансферринового рецептора (TFR; 2; контроль). GSP-1 (3), TFR (4) или смесь унмверсальных праймеров (5) при использовании поодиночке не производят данных продуктов, указывая на их специфичность. Амплифициро-ванный фрагмент CALCRL кДНК был выделен из геля, очищен и просеквенирован для определения 5’нетранслированного участка (5’UTR;

untranslated region) CALCRL кДНК. (Б) Проведенное секвенирование позволило  точно определить начало

транскрипции CALCRL гена человека.

Клонирование и характеристика промотера CALCRL гена

Клонирование промотера было проведено с использованием данных 5’RACE эксперимента. Нами был проклонирован фрагмент геномной ДНК соответствующий 2.3 кб до транскрипционного старта. Конструкты 5'-flanking участка были использованы в экспериментах с модифицированным вектором для подтверждения роли клонированного участка CALCRL гена в транскрипции [Nikitenko et al., 2003]. Полученные данные указывают на то, что клонированный участок геномной ДНК действительно обладает способностью обеспечивать транскрипцию и поэтому вполне вероятно что он является промотером CALCRL гена.

Кроме того, использование программы SIGNAL SCAN позволило определить потенциальные участки связывания известных транскрипционных факторов (ТФ), включая NF-1, Sp1 и глюкокортикоидные рецепторы [Nikitenko et al., 2003]. Кроме того, нами был проведен дополнительный анализ промотера, который позволил выявить наличие участка ответа на гипоксию (hypoxia-respose element, HRE). Для выявления роли этого участка в транскрипции CALCRL гена в гипоксических условиях, нами был проведен мутагенез данного фрагмента промотера и соответствующие функциональные исследования (Рисунок7).

Результаты данных исследований подтвердили функциональную роль HRE в экпрессии CALCRL гена.

Рисунок 7        

 

                      pGL3-  CALCRL-516mut 

pGL3-  CALCRL-516mut  _________________G__AT___         pGL3-CALCRL-516

pGL3-CALCRL-516  CACACACACACACACGCCTA  Относительная активность промотера

А)Последовательность нормальной и мутированной pGL3-CALCRL плазмид. pGL3-CALCRL-516 вектор  и pGL3-  CALCRL-516mut последовательности pGL3-CALCRL-516 одинаковы  (… … …        ) за  исключением замены трех нуклеотидов (подчеркнуто) в последовательности HRE мутированного  вектора. (Б)  Анализ  транзитной экспрессии  нормального и  мутированного  векторов. Первичные  ЭКМР кожи  человека  были транфицированы с phPGK (для определения равномерной трансфекции) и pGL3-CALCRL-516 либо pGL3-CALCRL-516mut. Трансфицированные клетки были проинкубированы при 20% 02 в течение 4 часов, после чего проинкубированы при 20% 02 либо 0.1% 02 в течении 16 часов. pGL3/phPGTK отношение было определено для каждой плазмиды и нормализовано к результатам для pGL3-CALCRL в клетках при 20% 02. Соотношение pGL3 (относительная активность pGL3) было расчитано для определения активности участка HRE при гипоксии (mean±S.E.M.; one way ANOVA анализ).

Гетерогенность CALCRL транскриптов

Проведенные нами эксперименты с использованием метода Northern blotting и CALCRL зонда выявили наличие нескольких РНК (данные не показаны), но в то же время 5’-RACE эксперимент показал наличие только одного фрагмента (промотера) CALCRL гена (Рисунок 6). Поэтому нами были проведены дальнейшие исследования гетерогенности транскриптов CALCRL гена.

Нами был использован метод З’-RACE и клонирования амплифицированных фрагментов для выявления гетерогенности CALCRL транскриптов. Анализ полученных клонов указал на наличие альтернативных участков терминации и полиаденилирования CALCRL гена

Субхромосомная организация CALCRL гена

Проведенные З’-RACE эксперименты и клонирование выявили наличие нескольких мРНК транскрибированных с CALCRL гена, а также наличие первого интрона длиной 60-kb [Nikitenko et al., 2003]. Поэтому мы предположили что пермиссивная транскрипция CALCRL гена обеспечивается уникальной структурой гена в эндотелиальных клетках.

Мы провели исследования регуляции промотера CALCRL гена в транскрипционно-пермиссивных (эндотелиальные клетки) и непермиссивных (неэндотелиальные клетки) клетках человека. Для этого нами был использован G-less вектор и ядерные экстракты из клеток человека и проведен эксперимент по транскрипции in vitro [Ramadass et al., 2007]. Данные этого эксперимента показали что промотер CALCRL гена может быть активен не только в эндотелиальных клетках но и в неэндотелиальных клетках, поскольку транскрипционные факторы, активирующие экспрессию данного гена, присутствуют в ядерных экстрактах тех и других клеточных линий [Ramadass et al., 2007].

Поскольку специфическая экспрессия CALCRL гена наблюдается в эндотелиальных клетках (Рисунок 5), но промотер может быть активен и в других клетках [Ramadass et al.,2007], это подтверждает ранее вынесенное предположение, что организация (трехмерная структура) данного гена различается в транскрипционно-пермиссивных (ЭК) и непермессивных (неэндотелиальных клетках) человека.

Для проверки данной гипотезы мы использовали метод chromosome conformation capture (3CC) разработанный в лаборатории А. Акуличева (Sir William Dunn School of Pathology, University of Oxford, United Kingdom) для выявления субхромосомной организации CALCRL гена [Akoulitchev et al., 2006; Ramadass et al., 2007]. Данный метод позволил нам проанализировать терхмерную структуру CALCRL гена в транскрипционно-пермессивных и непермиссивных клетках человека. Результаты данного эксперимента [Ramadass et al., 2007], подтверждают нашу гипотезу о наличии разных трехмерных структур CALCRL гена в эндотелиальных и неэндотелиальных клетках человека. Наличие разнообразия структур в CALCRL гене обеспечивается постоянной активностью РНК полимеразы и поэтому ее расположением в разных участках данного гена при активной транскрипции в эндотелиальных клетках. В то же время в неэндотелиальных клетках структура CALCRL гена указывает на то что, полимераза находится в одном доминирующем положении, которое препятствует активной транскрипции данного гена [Ramadass et al., 2007].

Таким образом, проведенные нами исследования указывают на то, что экспрессия CALCRL гена зависит прежде всего от клеточно- и ткане-специфического фона. При этом ключевым фактором в экспрессии CALCRL гена является его трехмерная субхромосомная структура, которая скорее всего обеспечивается эпигенетическими механизмами. В данных условиях активность промотера играет вторичную роль.

Регуляция экспрессии функционального CL рецептора в клетках и тканях

Для выявления механизмов регулирующих экспрессию CL рецептора необходимо изучение трансляции и экспрессии белка в клетках и тканях. Поэтому нами были получены и характеризованы специфические антитела (АТ) против CL рецептора.

Разработка антител против CL рецептора и их характеристика

Для выработки антител против CL человека (кодируемого CALCRL геном) нами была выбрана стратегия с применением синтезированного пептида из 19 аминокислот, соответствующего карбокси-окончанию белка (HDIENVLLKPENLYN; аминокислотная последовательность 427-461). Специфичность последовательности была проверена с использованием программы CLASTP analysis [http://www.ncbi.nlm.nih.gov] Иммунизация новозеландских кроликов была проведена после связывания пептида с KLH (keyhole limpet haemocyanin). Сыворотка кроликов была забрана один раз до и три раза после иммунизации (с промежутком в один месяц) для выявления титра полученных антител методом ELISA. После получения удовлетворительного титра сыворотка иммунизированных животных была забрана и заморожена при -20С.

Анализ антител был проведен с использованием метода иммуноблоттинга. кДНК CALCRL и RAMPs генов были клонированы в вектор pcDNA3.1 (вектор для экспрессии в клетках млекопитающих) для сверхэкпрессии функциональных гетеродимеров в клеточной линии HEK293T. CALCRL кДНК, содержащая полную последовательность кодирующую рецептор, была амплифицирована с использованием РНК полученной из эндотелиальных клеток. Белковые экстракты полученные из клеточных линий сверхэкспрессирующие CL, CL+RAMP1 или CL+RAMP2 были использованы для первичной оценки поликлональных антител выращенных против CL человека (Рисунок 8).

Временно экспрессированный и эндогенный CL.

Кодирующая ДНК CALCRL гена человека была

клонирована в pcDNA3.1 – вектор для экспрессии в

клетках и назван pcDNA3.1-CALCRL. Для проверки

функциональности клонированной кДНК нами

была осуществлена коэкспрессия с RAMPs в клетках

HEK293T и анализ содержания цАМФ при

стимуляции соответствующими лигандами. Дикий

тип HEK293T клеток не экспрессирует эндогенных

AM и CGRP рецепторов, т.к. концентрация цАМФ в

ответ  на  стимуляцию  данными  пептидами

отсутствует. В то же время в клетках HEK293T

которые содержат трансфицированные CALCRL и

RAMPs человека, рецепторы активны (данные не показаны). Белковые экстракты из (А) клеток и (Б) тканей были проанализированы методом SDS-PAGE при восстанавливающих условиях, и иммуноблоты обработаны первичными поликлональными антителами выращенными против CL человека. (А) Антитела специфически распознают CL человека в HEK293T клетках трансфицированных только pcDNA3.1-CALCRL или вместе с RAMP1 или RAMP2 (CL+ RAMP1 или CL+ RAMP2; функциональными АМ или СGRP рецепторами соответственно). Нетрансфицированные HEK293T клетки (MOCK) или трансфицированные с вектором pcDNA3.1 или RAMP1 или RAMP2 не экспрессируют CL. Разновидности рецептора массой ~40-45 кД (открытый ромб, основно-гликозилированный рецептор) присутствует в HEK293T клетках трансфицированных только с pcDNA3.1-CALCRL. Рецептор массой ~55 кД (закрытый ромб; терминально гликозилированный рецептор) производится клетками только в том случае коэкспрессии CL с RAMPs (детали эксперимента по дегликозилированию указаны на Рис.35). (Б) Антитела также распознают эндогенный CL человека

экспрессированный в тканях. Стрелка – дегликозилированный рецептор (~37 кД). Иммуноблоты  являются

экземпляром двух независимо проведенных экспериментов. Для подтверждения равномерности количества

использованных белковых экстрактов были использованы антитела против -актина.

Данные проведенных исследований с использованием метода иммуноблоттинга показали что антитела обладают высокой специфичностью против трех форм CL – дегликозилированного, основно- и терминально-гликозилированного рецептора (Рисунок 8). Для подтверждения данных выводов нами были проведены эксперименты с использованием эндогликозидаз F и H, с целью определения какие из детектируемых форм рецептора являются основно- и какие терминально-гликозилированными (данные не показаны). После подтверждения специфичности полученных антител, они были использованы для проведения иммуногистохимии и иммунофлуоресценции в разных тканях органов человека (Рисунок 9).

Локализация СL в тканях человека.

Определение локализации СL была проведена путем проведения метода иммуногистохимии на парафиновых срезах с использованием микро-чипа тканей и первичных антител против СL человека и вторичных антител конъюгированных с щелочной фосфатазой, локализация которой выявлена с применением реактива Vector Red (красный цвет). Клеточные ядра окрашены гематоксилином (голубой цвет). Выявлено преимущественная локализация рецептора в эндотелиальных клетках микроциркуляторного русла (А) эндометрия, (Б) миометрия, (В) аденокарциномы, (Г) желтого тела, и (Д и Е) стромы (стрелки) и (Е) эпителии шейки матки (короткие стрелки).

Результаты проведенных иммуногистохимических исследований обобщены в Таблице 3. Полученные данные позволили сделать заключение том, что в большинстве исследуемых органов и тканей человека рецептор экспрессирован в эндотелиальных клетках микроциркуляторного русла, а также в гладкомышечных клетках кровеносных сосудов в некоторых из исследуемых тканей. Для подтверждения данных выводов нами была проведена двойная иммунофлюоресценция с совместным использованием двух антител: поликлональных выращенных против CL и моноклональных – против маркеров индивидуальных типов клеток: эндотелиальных, гладкомышечных клеток, лейкоцитов и макрофагов (данные не показаны). Данные проведенного анализа также подтвердили специфическую экспрессию CL в эндотелиальных клетках микроциркуляторного русла

человека.

Исследование локализации и экспрессии функциональной формы CL рецептора в тканях и клетках

Высокая специфичность антител позволила нам также определить какие формы CL рецептора экспрессированы в тканях человека (Рисунок 10). Данные проведенных исследований указывают на то, что в большинстве исследованных тканей человека экспрессирован функциональный рецептор (терминально гликозилированный, ассоциированный с плазматической мембраной клетки) (Рисунок 10), и что этот рецептор находится на поверхности эндотелиальных клеток в соответствии с результатами иммуногистохимии (Рисунок 9). Дополнительный анализ позволил определить, что в раковых опухолях также экспрессирован функциональный рецептор (Рисунок 10Б).

  Гликозилирование СL рецептора in vivo.

Белковые экстракты были получены
из нормальных и раковых тканей
человека и проанализированы с
применением метода SDS-PAGE
при восстанавливающих условиях с
последующей обработкой иммуноблотов с использованием антител LN-1436 выращенными против СL человека. Стрелка, негликозилированный (~37 кД); открытый ромб, основно-гликозилированный (~45 кД); черный ромб, терминально-гликозилирован-ный (~55 кД) виды рецептора. (А)

Нормальные ткани человека (эндометрий, миометрий и желтое тело) содержат СL в той или иной форме.

Экспрессия рецептора отсутствует с плаценте человека на поздних стадиях бееременности. (Б) В тканях раковых

опухолей  (почек,  яичников,  лейомиомы  и саркомы Капоши) основная форма  СL - терминально

гликозилированный рецептор.

Таким образом, нами были выращены антитела, позволяющие определять не только наличие, но и функциональную форму (экспрессированную на поверхности клетки) CL рецептора в клетках и тканях человека. Высокая специфичность данных антител позволила нам провести дальнейшие исследования по изучению свойств рецептора в эндотелиальных клетках микроциркуляторного русла человека.

Исследование специфичности и динамики десенситизации CL рецептора

Для выявления свойств рецептора экспрессированного в ЭКМР человека, как типа клеток в которых рецептор экспрессирован in vivo, нами была проведена серия экспериментов по изучению:

-        экспрессии форм рецептора (дегликозилированного, основно- и терминально-
гликозилированного);

  • экспрессии RAMPs;
  • внутриклеточной локализации рецептора;
  • транспорта и интернализации рецептора;
  • специфичности рецептора к АМ и CGRP;
  • десенситизации рецептора.

Экспрессия CL рецептора и RAMPs в эндотелиальных клетках микроциркуляторного русла человека

Экспрессия различных форм рецептора была проанализирована с применением методов иммуноблоттинга. Нами были выявлено что в эндотелиальных клетках микроциркуляторного русла человека (ЭКМР) присутствуют как основно- так и теминально-гликозилированная формы рецептора (Рисунок 11А).

Орган

Другие типы клеток

CL-ИР

Заметки

Эндотелий CL-ИР

лимфатический

очень сильная

узел

эндотелий

.++

.++++

экспрессия сильная

матка

эндотелий

.++++

эпителий гладкомышечные клетки

_

.+++

экспрессия средняя

миометрия

.+

.++

экспрессия

яичники

эндотелий

•/+

перициты

•/+

.+

слабая экспрессия

желчный

отсутствие

пузырь

эндотелий

.++++

гладкомышечные клетки

.++

.-

экспрессии

эпителий слизистой оболочки

•+/-

Н/О

Не определялся

легкие

эндотелий

.++++

миндалины

эндотелий

.+++

плоский эпителий

.+/++

ОЯ

Окраска ядра CL - иммунно-

лимфоидные клетки

.+

CL-ИР

реактивность

•/+

желудок

эндотелий

или .+++

шифовый эпителий париетальные клетки

надпочечники

эндотелий

.++/+++ .-/+ или

эпителий

•/+

слюнная железа

эндотелий

++

эпителий протоков серозный эпитлеий

.+

паращитовидная

железа

эндотелий

-/++

эпителий

.++/++++

яички

эндотелий

.+/++

сперматогонии клетки Лейдига

.+

Сильная ОЯ

трахея

эндотелий

.++

почка

эндотелий

.++++

эпителий гладкомышечные клетки

.+++

пищевод

эндотелий

.++

сосудов

эпидермис

гладкомышечные клетки

.+++ .++/+++

кожа

эндотелий

•/+

сосудов

.++++

печень

эндотелий

.+

гепатоциты

.++++

поджелудочная

железа

эндотелий

.+/++

бета-клетки экзокринные железистые клетки

.+/++

ОЯ

плацента

эндотелий

.-

амнион

эндотелий

.-

       Таблица 3. Экспрессия CL в тканях и клетках человека.

Полуколичественный анализ экспрессии CL в индивидуальных клеточных типах в тканях человека был проведен по следующей шкале: – тсутствие окраски; -/+ очень слабая; + слабая; ++ средняя; +++ сильная.

Экспрессия СL и RAMPs в эндотелиальных клетках человека.

(А) Экспрессия СL проанализирована с использованием метода иммуноблоттинга. Белковые экстракты из эндотелиальных клеток микроциркуляторного русла кожи человека были проинкубированы с эндогликозидазой F (F, ячейка 2), либо эндогликозидазой H (H, ячейка 3) или в их отсутствии (-, ячейка 1) с последующим проведением SDS-PAGE при восстанавливающих условиях и иммуноблоттинга с использованием антител LN-1436 выращенными против СL человека. Стрелка, негликозилированный (~37 кД); открытый ромб, основно-гликозилированный (~45 кД); черный ромб, терминально-гликозилированный (~55 кД) виды рецептора. ~55 кД СL восстанавливается до ~37 кД белка в после обработки эндогликозидазой F, но устойчивы к действию эндогликозидазы H. Впоследствии мембраны были обработаны с использованием антител против -актина для подтверждения использования одинаковых количеств белковых экстрактов. (Б) Экспрессия СL и RAMPs мРНК в эндотелиальных клетках микроциркуляторного русла кожи (ячейка 1), легких (ячейка 2), миометрия (ячейка 3) и эндометрия (ячейка 4) человека были проанализированы с использованием метода РТ-ПЦР. Праймеры для -актина были использованы в качестве контроля для использования одинакового количества РНК для генерации кДНК использованной для РТ-ПЦР. В качестве контроля была использована РНК изолированная из ткани почек (ячейка 5). Цифры справа показывают размеры амплифицированных ПЦР-фрагментов.

Экспрессия рецептора на поверхности эндотелиальных клеток (терминально-гликозилированная форма) коррелирует с экспрессией RAMP2 и RAMP3, но не RAMP1 генов (Рисунок 11Б).

Полученные данные указывают на то, что вероятнее всего CL формирует гетеродимер CL/RAMP2 и/или CL/RAMP3 на поверхности ЭКМР человека, и поэтому представляет собой АМ1 и/или АМ2 рецептор.

Локализация CL рецептора в эндотелиальных клетках

Данный эндотелиальный рецептор экспрессирован на поверхности клетки и в эндоплазматическом ретикулуме (данные не показаны) in vitro, что подтверждает данные иммуноблоттинга (Рисунок 11), поскольку наличие основно-гликозилированного рецептора обычно ассоциировано с его локализацией в эндоплазматическом ретикулуме, а теминально-гликозилированного – на поверхности клетки, т.е. в плазматической мембране, после дополнительного гликозилирования в результате взаимодействия с RAMP в эндоплазматическом ретикулуме [McLatchie et al., 1998].

Специфичность и интернализация CL рецептора в эндотелиальных клетках

Для проверки предположения о том, что эндотелиальный CL образует АМ рецепторы (либо АМ1 - CL/RAMP2 и/или АМ2 - CL/RAMP3) нами были проведены исследования по выявлению фенотипа рецепторов, экспрессированных в эндотелиальных клетках человека.

Прежде всего нами было исследовано какие рецепторы - AM или CGRP – экспресированны эндогенно на поверхности ЭКМР человека. Результаты проведенных исследований с использованием методов по определению аккумуляции cAMP, являющейся одной из сигнальных молекул в системе адреномедуллиновых рецепторов, и миграции эндотелиальных клеток показали, что как AM так и CGRP рецепторы экспрессированы в этих клетках (данные не показаны). Эти данные противоречат сделанному предварительно предположению, что эндотелиальный CL образует только АМ рецепторы.

Поэтому нами были проведены эксперименты по исследованию динамики интернализации эндотелиального CL в ответ на стимуляцию AM или CGRP. Прежде всего такое решение было обусловлено тем, что данные работ Kuwasako и коллег [2001] указывают на то, что CL/RAMP1, CL/RAMP2 и CL/RAMP3 гетеродимеры интернализуются по разному в ответ на стимуляцию AM или CGRP. Например, CL/RAMP1 (CGRP1 рецептор) интернализуется преимущественно при взаимодействии с CGRP, а CL/RAMP2 (АМ1) и CL/RAMP3 (АМ2) рецепторы – при взаимодействии с АМ.

Проведенные нами исследования показывают, что CL в эндотелиальных клетках интернализуется только при взаимодействии с АМ (Рисунок 12; данные для CGRP не показаны). Эти данные соответствуют данных об экспрессии RAMP2 и RAMP3, но не RAMP1, в ЭКМР, предполагающих экспрессию АМ1 и АМ2 рецепторов (Рисунок 11).

Для проверки данных выводов и выяснения, существует ли какое-либо взаимодействие между CGRP и эндотелиальным CL, нами были проведены эксперименты с использованием антагонистов AM и CGRP рецепторов (AM22-52 и CGRP8-37 соответвенно). Данные антагонисты взаимодействуют с рецепторами, но не вызывают каких-либо функциональных изменений [Poyner et al., 2001].

Интересным результатом проведенных экспериментов явилось выявление того, что как AM22-52 так и CGRP8-37 способны ингибировать интернализацию эндотелиального CL после стимуляции АМ (Рисунок 12). Данные результаты указывают на то, что CGRP также может

взаимодействовать с эндотелиальным CL. Если это так, то наблюдаемое ранее влияние не только АМ, но также и CGRP на миграцию и аккумуляцию cAMP в ЭКМР человека (данные не показаны) могут быть связаны со взаимодействием данного пептида с CL рецептором.

Рисунок 12

Взаимодействие AM и CGRP с СL экспрессированным в эндотелиальных клетках человека.

Внутриклеточное распределе-ние СL в ЭКМР человека до (Control) и после стимуляции лигандом (AM 100 nM; в течение 15 минут) с или без добавления антагонистов

AM22-52 и CGRP8-37 (1М),

было определено с использованием иммунофлу-оресценции. Клетки были зафиксированы сразу после стимуляции. Иммунофлуо-ресцентная окраска была проведена с использованием антител против CL человека и вторичных антител меченных ФИТЦ (зеленый цвет). DAPI использовался для окраски ядер (синий цвет). Представленные рисунки отображают результаты двух экспериментов и демонстрируют экспрессию рецептора на клеточной поверхности (зеленые стрелки) и после интернализации (короткие стрелки).

Десенситизация CL рецептора в эндотелиальных клетках

Для проверки данного предположения нами были проведены эксперименты по исследованию механизмов десенситизации эндотелиального CL. Нами было выдвинуто предположение, что если CL взаимодействует как с АМ, так и с CGRP, то стимуляция/интернализация рецептора при взаимодействии с одним лигандом должна привести к потере ответа на повторную стимуляцию не только к лиганду который был использован для первичной стимуляции, но и на стимуляцию другим лигандом. Результаты проведенных нами экспериментов приведены на Рисунке 13, и показывают, что при стимуляции АМ ответ (фосфорилирование Akt) на стимуляцию с CGRP потерян, и наоборот.

Десенситизация эндогенных AM и CGRP рецепторов в эндотелиальных клетках.

Динамика        десенситизации

эндогенных AM и CGRP
рецепторов в эндотелиальных
клетках микроциркуляторного
русла (ЭКМР) человека была
изучена путем определения

степени фосфорилирования Akt
(Akt-P). В контрольной группе
клетки были простимулированы
100 nM АМ (линии 2-4) либо
CGRP (линии 11-13) в течение
обозначенного времени. В
группе предварительной стимуляции (с АМ либо CGRP; +/– обозначает было ли проведено предварительное стимулирование), клетки были простимулированы с АМ (5-9) либо CGRP (14-18) в течение 15 минут, а затем – проинкубированы в среде без лиганда в течение 30 минут. В группе предварительной стимуляции клетки затем были заново простимулированы либо с тем же антагонистом (100 nM) (5-8 для АМ и 14-17 для CGRP соответственно) или другим антагонистом (100 nM) (CGRP для клеток преинкубированных с АМ, линия 9, и АМ для клеток, престимулированных с CGRP) для изучения десенситизации рецепторов. Клетки стимулированные VEGF (10 ng/ml в течение 10 мин.; линия 10) служили в качестве контроля.

Таким образом, результаты проведенных нами исследований предполагают следующую модель регуляции рецептора, экспрессированного в ЭКМР человека (Рисунок 14). Эндотелиальный CL может взаимодействовать как с АМ, так и с CGRP (Рисунок 14). Данное взаимодействие с любым из лигандов приводит к десенситизации рецептора. Однако потеря функции (десенситизация) рецептора только в случае взаимодействия с АМ обусловлена интернализацией данного G-белок-связывающего рецептора.

Полученные данные открывают интересное направление в изучении биологии АМ и CGRP рецепторов в клетках и тканях человека. Особенно важным является изучение биологии CL при патологических условиях, при которых уровень АМ или CGRP повышен в тканях и клетках человека, как например сердечно-сосудистые заболевания различной этиологии [Hinson et al., 2000]. В данных условиях избыточная экспрессия одного или другого лиганда может привести к полнейшей десенситизации эндотелиального CL к обоим лигандам. Принимая во внимание значительную роль обоих пептидов в биологии сосудистой системы и эндотелиальных клеток в частности [Hinson et al., 2000; Nikitenko et al., 2002; Brain and Grant et al., 2004], данные изменения могут кардинально повлиять на состояние органов и тканей при патологии, особенно в том случае если CL действительно является посредником всех изученных до данного момента эффектов АМ на эндотелиальную клетку [Hinson et al., 2000; Nikitenko et al., 2006]. Результаты проведенных нами исследований указывают на то, что экспрессия и функциональное состояние CL могут оказывать значительное состояние на функционирование эндотелиальной клетки и играть роль в развитии дисфункции эндотелия при различных патологиях.

Свойства        эндотелиального        СL и

ассоциированной с ним рецепторной системы для AM и CGRP.

Эндотелиальный СL экспрессирован на клеточной поверхности в качестве терминально гликозилированного рецептора (полисахаридные остатки связанные с аминотерминусом схематически представлены как структуры серого цвета). AM и CGRP стимулируют фосфорилирование Akt (Akt-P). (IIА) Рецептор интернализуется и направлен на деградацию после стимуляции АМ, но (IIВ) остается на клеточной поверхности после взаимодействия с CGRP. Взаимодействие либо с АМ (I-IIА- III) или CGRP (I-IIВ) приводит к десенситизации (IV) рецептора к обоим пептидам, независимо от того какой агонист был использован для начальной стимуляции, и потере активности за счет различных механизмов.


Роль адреномедуллиновых рецепторов в тканях человека в норме и при некоторых патологиях.

Проведенные исследования показали, что АМ играет важную роль в развитии и функции сосудистой системы животных. В то же время, несмотря на полученные нами данные о роли пептида и механизмов регулирующих его экспрессию и функцию его рецепторов в ЭКМР человека in vitro, вопрос о значении АМ и его рецепторов в организме человека в норме и при различны патологиях остается недостаточно изученным. Это обусловлено прежде всего отсутствием достаточного количества данных об экспрессии АМ и функциональных эндогенных адреномедуллиновых рецепторов в органах и тканях человека.

Поэтому нами был проведен спектр исследований с применением разработанных нами методов для изучения экспрессии CALCRL гена человека и функциональной формы рецептора, а также механизмов регулирующих его функцию в эндотелиальных клетках человека. Наши исследования включали исследование возможности практического применения  полученных  знаний  о  функционировании  рецепторной  системы адреномедуллина в эндотелиальных клетках при патологических заболеваниях сосудистой системы, в том числе:

1). Исследование роли АМ и его рецепторной системы в ангиогенезе при развитии раковых опухолей и патологических заболеваний органов репродукции путем исследования экспрессии его рецепторов.

2). Исследование возможности использования разработанных реактивов и методов
(антител против человеческого CL рецептора и методов определения субхромосомной
организации CALCRL гена) для диагностики неоплазм, раковых  опухолей и других
заболеваний (в том числе исследование корреляции экспрессии и клинико-патологических показателей).

3). Исследование        возможности        модулирования        функционирования

адреномедуллиновых рецепторов с целью коррекции их функции при патологиях развития и функции сосудистой системы (к вопросу о разработке ингибиторов и активаторов с использованием современных методов и технологий, включая разработку антител против рецептора, экспрессированного на поверхности клетки).

Практическое применение исследований функционирования рецепторной системы адреномедуллина в эндотелиальных клетках при патологических заболеваниях сосудистой системы

Роль специфической транскрипции CALCRL гена в эндотелии кровеносных сосудов и лимфатических сосудов человека

Проведенные нами исследования указывают на специфичность экспрессии CL в эндотелии сосудов различных тканей и органов человека (Рисунки 5 и 9). Дальнейшее изучение механизмов регуляции экспрессии CALCRL гена в эндотелии человека в нормальных тканях и раковых опухолях позволит разработать методы контроля экспрессии данного гена с целью ингибирования патологического ангиогенеза или регуляции функции кровеносных и лимфатических сосудов.

С целью дальнейшего изучения регуляции экспрессии CALCRL гена в эндотелии нами была использована модель саркомы Капоши (КС) как эндотелиальной опухоли [Nikitenko and Boshoff, 2006]. Современными исследованиями было показано, что КС происходит из эндотелиальных клеток, поскольку профиль/спектр экспрессии генов в этой неоплазме очень схож с таковым в лимфатическом эндотелии [Wang et al., 2004]. Этиологически КС связан с инфекцией клеток человеческим герпесвирусом 8 (human herpesvirus 8, HHV8, или Kaposi’s sarcoma herpesvirus, KSHV) [Boshoff et al., 1995].

Нашими исследованиями с применением методов DNA microarray, иммуноблоттинга и иммуногистохимии было показано, что KSHV регулирует экспрессию CALCRL гена в ЭКМР человека (Рисунок 15).

Герпесвирус саркомы Капоши (KSHV) регулирует экспрессию СALCRL (CL) в эндотелиальных клетках микроциркуляторного русла человека.

Эндотелиальные клетки микроциркуляторного русла человека (ЭК) были инфицированы вирусом саркомы Капоши (ЭКKSHV). (А) Экспрессия генов была выявлена методом DNA микрочипа. Относительная экспрессия отражена с использованием аналитической шкалы (синий цвет – пониженная экспрессия; красный цвет – повышенная экспрессия). Результаты анализа также отображены в виде графика, демонстрирующего повышенную экспрессию СALCRL в инфицированных клетках ЭКKSHV (Vart et al., 2007). (Б) Экспрессия СALCRL также повышена в тканях Капози саркомы по сравнению с нормальной кожей. (В) Экспрессия CL в тканях Капоши саркомы была изучена с использованием метода иммуногистохимии и поликлональных антител против рецептора. Вторичные антитела меченные пероксидазой хрена и диаминобензидиновая реакция были использованы для выявления локализации рецептора в опухолевых веретенообразных клетках саркомы Капоши (левый и центральный снимки). Этиологически данные клетки связаны с инфицированием эндотелиальных клеток микроциркуляторного русла человека и их последующей трансформацией в опухолевые клетки. Срезы ткани обработанные преиммунной сывороткой были использованы в качестве контроля (правый снимок). Участок среза использованный на центральном и правом снимках обозначен на левом снимке. (Г) Эндотелиальные клетки микроциркуляторного русла человека (ЭК) были инфицированы вирусом Капоши (ЭКKSHV) in vitro. Экспрессия CL была изучена с использованием метода иммуноблоттинга. Трансляция рецептора соответствует повышенной транскрипции в ЭК инфицированных вирусом.

Мы произвели клонирование 27 генов, кодируемых вирусом [Vart et al., 2007] и провели анализ с целью выявления данных генов на экспрессию CALCRL гена человека (Рисунок 16). Нами было выявлено что К2 ген (кодирующий вирусный интерлейкин 6) является таким кандидатом (Рисунок 16). Таким образом, онкогенные вирусы способны регулировать экспрессию CALCRL гена человека. Поэтому нами была выдвинута гипотеза о том, что АМ и CALCRL играют роль в патологическом ангиогенезе и лимфангиогенезе, являющимся одним из симптомов КС. Дальнейшие исследования направлены на изучение механизмов регуляции данного G-белок связывающего рецептора с целью использования данных для разработки методов диагностики и, возможно, терапии данной неоплазмы.

Современными исследованиями с использованием мышиных моделей по изучению роли генов в эмбриогенезе была показана роль CALCRL в развитии сосудистой системы [Dakor et

al., 2006] и развитии эдемы при его отсутствии, а также сходство данного фенотипа с моделями в которых был выключен ген лиганда – адреномедуллина. [Caron et al., 2000; Shindo et al., 2001: Shimosawa et al., 2002]. Данные этих исследований также подтверждают предположения о роли CALCRL/CL в развитии и функционировании сосудистой системы и при патологическом лимфангиогенезе и ангиогенезе, как например  при развитии КС.

  Анализ регуляции экспрессии СALCRL гена в эндотелиальных клетках микроциркуляторного русла человека индивидуальными генами герпесвируса саркомы Капоши (KSHV).

Лентивирусная библиотека (27 индивидуальных KSHV генов) была произведена с использованием вектора pSIN и векторов двух векторов необходимых для производства лентивирусных частиц. Список клонированных генов и их производные. Эндотелиальные клетки были инфицированы с использованием лентивирусной библиотеки и экспрессия соответствующих вирусных генов была проверена с использованием метода RT-ПЦР. Эффективность инфекции была проверена с использованием лентивирусных частиц произведенных с использованием pSIN вектора экспрессирующего GFP (green fluorescent protein). Проведенный количественный RT-ПЦР анализ с использованием метода TaqMan выявил регуляцию CALCRL гена вирусным генов К2, кодирующим цитокин- вирусный интерлейкин-6 (vIL-6).

Потенциальная роль механизмов сенситизации и десенситизации адреномедуллиновых рецепторов в эндотелиальных клетках человека в дисфункции эндотелия и при сердечно-сосудистых заболеваниях

Транскрипция CALCRL гена (Рисунки 5 и 6) и экспрессия данного G-белок связывающего рецептора на поверхности клетки (Рисунок 8) являются одними из первоначальных ступеней в регуляции экспрессии данного рецептора в эндотелии. Циркуляция данного рецептора и механизмы его сенситизации и десенситизации к стимуляции лигандами также играют значительную роль в дальнейшей регуляции функции CL (Рисунки 12, 13 и 14) [Nikitenko et al., 2006; Parameswaran and Speilman, 2007].

Нами была использована модель диабетической беременности для изучения механизмов десенситизации и сенситизации АМ рецепторов в сосудистой системе человека. Нами было показано, что сосуды плаценты при диабетической беременности теряют чувствительность (десенситизируются) к стимуляции адреномедуллином (данные не показаны). Таким образом, повышенное давление у женщин при патологической беременности (диабете в данных исследованиях) может являться результатом недостаточного контроля расширения сосудов адреномедуллином. При этом регуляция АМ рецепторов в сосудистой системе может привести к уменьшению кровеносного давления у пациентов и, таким образом, облегчить течение беременности при диабете.

Аналогичный феномен наблюдался при повышении концентрации АМ в культуре эндотелиальных клеток [Nikitenko et al., 2006]. Кроме того, изменения в работе адреномедуллиновых рецепторов наблюдается в in vivo условиях когда концентрация АМ повышена. Так например, при хронической сердечной недостаточности, сердечно-сосудистом заболевании, при котором концентрация АМ в крови значительно повышена, значительный, и в то же время длительный эффект пептида на артерии скелетных мышц значительно ослаблен, частично из-за недостаточной продукции оксида азота в сосудах предплечья [Kato el al., 1996; Nakamura et al., 1997]. В то же время механизмы подобных эффектов до настоящего времени оставались не изученными. Данные проведенных нами исследований указывают на то, что данные эффекты могут быть результатом интернализации CL рецептора в эндотелиальных клетках, поскольку in vivo в тканях человека рецептор преимущественно экспрессирован именно в этих клетках (см. Рисунки 5 и 9), а также потому, что АМ стимулирует продукцию оксида азота этими клетками [Zhang and Hintze, 2001].

Таким образом, несмотря на повышенный уровень АМ при патологиях, чувствительность адреномедуллиновых рецепторов может быть понижена при определенных патологиях и поэтому существует необходимость коррекции их функции (или ресенситизации) с целью обеспечения нормальной работы сосудистой системы.

Роль  адреномедуллина  и  его  рецепторной  системы  в  пролиферации  и дифференцировке стволовых клеток

Современными исследованиями было показана роль АМ в пролиферации и дифференцировке стволовых клеток человека [Iwase et al., 2005; Yurugi-Kobayashi et al., 2006; Murakami et al., 2006]. Авторы предположили, что АМ влияет на стволовые клетки через гетеродимер CL/RAMP2, но какие-либо данные в поддержку данной гипотезы приведены не были. Разработанные нами антитела против CL человека могут помочь в дальнейшем решить по крайней мере вопрос об экспрессии функциональной формы данного рецептора в стволовых клетках человека, а также выявить, действительно ли АМ (или CGRP) взаимодействует с этим G-белок связывающим рецептором в данных клетках.

Нашими исследованиями была показана экспрессия всех компонентов рецепторной системы АМ (CL и RAMPs), по крайней мере на транскрипционном уровне, в предшественниках эндотелиальных клеток человека (данные не показаны) и в бластоцисте на ранних стадиях эмбрионального развития человека (Рисунок 17). Данные результаты указывают на возможную роль CL в дифференцировке стволовых клеток эмбриона и костного мозга. Таким образом, использование разработанных нами реактивов поможет ускоренному изучению роли АМ в эмбриогенезе и дифференцировке стволовых клеток человека.

Экспрессия СL и RAMPs в стволовых клетках человека.

Экспрессия СL и RAMPs в бластоцисте человека была исследована методом ОТ-ПЦР. CL, RAMP1 и RAMP2, но не RAMP3 мРНК экспрессируется в бластоцисте человека на шестом дне развития. мРНК миометрия служила положительным контролем, поскольку все компоненты рецепторной системы экспрессированы в данной ткани, включая RAMP3. -актин служил контролем.

Роль адреномедуллина и его рецепторной системы в ангиогенезе при развитии раковых опухолей и патологических заболеваний органов репродукции

Несмотря на изначальные неудачи и негативный результаты клинических испытаний, значительный прогресс сделан в течение нескольких последних лет в использовании ингибиторов ангиогенеза в опухолях и неоплазмах/новообразованиях. Несколько клинических исследований с использованием ингибиторов ключевого ангиогенного фактора - VEGF (фактор роста эндотелия) - A, не только подтвердили представление о том что ангиогенез – важная мишень для лечения опухолевых процессов, но также выявили феномен противодействия некоторых видов опухолей антиангиогенной терапии [Hurwitz et al., 2004; Kerbel et al., 2002]. В настоящее время существуют свидетельства того что ключевые ангиогенные факторы могут быть замещены другими факторами (в том числе и АМ) [Nikitenko et al., 2006] в процессе развития и дальнейшего прогресса болезни, или что другие известные или новые ангиогенные молекулы могут быть ответственны за компенсирующий («прорывной») ангиогенез в гипоксическом микроокружении раковых опухолей во время анти-ангиогенных стратегий [Ferrara and Kerbel, 2005]. Кроме того, эффективные тканеспецифические ангиогенные факторы могут быть ответственны за такое противодействие анти-ангиогенной терапии [LeCouter et al., 2002].

Поэтому определенной трудностью в транслировании результатов и открытий в исследованиях механизмов ангиогенеза является определение различий в молекулярных механизмах ангиогенеза между индивидуальными видами опухолей/стадиями путем определения роли известных и новых факторов, включая ключевые и тканеспецифичные ангиогенные факторы. Данный подход позволит осуществлять выбор селективной анти-ангиогенной терапии из спектра тех что уже используются в клинических исследованиях или в процессе разработки, а также определять вероятность эффективности для индивидуальных пациентов [Ferrara and Kerbel, 2005] для лечения того или иного типа опухоли.

В течение нескольких последних лет проявляется повышенный интерес к изучению адреномедуллина, который обусловлен в значительной мере ролью, которую данный пептид играет в ангиогенезе (Рисунок 18) [Nikitenko et al., 2006].

Роль адреномедуллина в прогрессии опухолей.

Предыдущими исследованиями была предположена роль гипоксии и цитокинов в регуляции экспрессии и секреции
адреномедуллина (АМ), способствует развитию ксенографтов раковых клеток путем стимуляции автокринного роста и повышенной выживаемости опухо-левых клеток, а также путем паракринного механизма за счет воздействия на окружающие сосуды. Возможные внутриклеточные эффекты действия АМ на клетки микроокружения опухоли (гладкомышечные клетки стенки сосудов, эндотелиальные клетки и опухолевые клетки) предполагает роль данного пептида в начальном развитии опухоли, устойчивости к химиотерапии и прогрессии. АС – аденилатциклаза, GC – гуанилатциклаза, PKA – протеинкиназа А, PKG – протеинкиназа G, PLC – фосфолипаза С, MEK – протеинкиназа активированная митогеном, ERK – экстрацеллюлярная киназа, регулирующаяся сигналом (также называемая MAPK – протеинкиназа активированная митогеном).

В случае АМ, как нового ангиогенного фактора (Рисунок 18), существует несколько насущных вопросов представленных ниже [Nikitenko et al., 2006]:

1). В каких раковых опухолях наблюдается повышенная экспрессия АМ?

2). Какие клетки экспрессируют адреномедуллиновые рецепторы в раковых тканях человека?

3). Существует ли корреляция экспрессии CL рецептора с клинико-патологическими показаниями в определенных раковых опухолях?

Исследование экспрессии адреномедуллина в раковых тканях человека

На начальном этапе мы исследовали в каких раковых опухолях наблюдается повышенная экспрессия адреномедуллина путем использования ДНК чипов и клонированных нами плазмидных векторов для получения CALCRL зондов. Из 13 изученных опухолей нами была выявлена повышенная экспрессия АМ в раковых тканях почек (Рисунок 19).

Поэтому наши дальнейшие исследования по изучению экспрессии CL были направлены на данный вид опухоли, а также на изучение лейомиомы, рака яичников и КС (см. Рисунок 15), где предварительные результаты указывали на возможную роль АМ и его рецепторов в развитии данных неоплазм [Hague et al., 2000; Giacolone et al., 2003; Vart et al., 2007].

Экспрессия адреномедуллина

(АМ) в нормальных и опухолевых тканях.

Cancer Profiling Array (кДНК блот) состоит из нормализованных парных кДНК образцов полученных из общей РНК из 13 органов. Каждая пара состоит из опухолевого (О) образца и нормальной (Н) ткани полученных из одного и того же пациента. Парная кДНК представляет собой общее количество мРНК экспрессированной в данной ткани. Блот был использован для получения данных о корреляции экспрессии гена адреномедуллина (АМ) c развитием опухоли. кДНК АМ и убиквитина были клонированы в вектор для получения зондов. Зонды были помечены 32Р-дЦТФ. Cancer Profiling Array и РНК Northern блот были последовательно прогибридизированы с каждым из зондов в соответствии с разработанными нами методами (Nikitenko et al., 2001). После гибридизации, промывки и экспозиции блотов, радиоактивный сигнал был зарегистрирован с использованием X-Ray пленки и измерен с помощью PhosphoScreen и ImageQuant Software. После этого зонд был удален и проведена гибридизация с последующим зондом. Отношение АМ/Убиквитин  было рассчитано для определения относительного уровня экспрессии мРНК. Специфичность зондов была проверена с помощью Northern блоттинга. Экспрессия АМ была повышена только в трех видах опухолей, при этом самая большая разница была обнаружена с опухолях почек (выделено штриховой линией). Статистический анализ был проведен с использованием теста Вилкоксона (Р=0.0067).

Нами была выдвинута гипотеза о том что экспрессия АМ и CL могут являться факторами прогноза развития раковых опухолей [Nikitenko et al., 2006]. Проведенные в течение последних двух лет исследования в нашей и других лабораториях показали, что существует корреляция между экспрессией лиганда либо его рецептора и развитием либо прогрессированием опухолевых образований в определенных органах человека [Ucar et al., 2006; Pavel et al., 2006; Michelsen et al., 2006].

Исследование  экспрессии  функционального  CL  рецептора  и его  локализации  в раковых тканях человека

Поскольку исследования проведенные в нашей лаборатории указывали на то, что экспрессия АМ повышена в опухолевых тканях почек, яичников, лейомиомы и саркомы Капоши, мы изучили экспрессию адреномедуллиновых рецепторов в этих тканях. Экспрессия АМ регулируется воспалительными цитокинами и гипоксией. Гипоксия является обычным показателем микроокружения опухолей и одной из основных причин роста и прогрессии раковых опухолей [Harris, 2002], и поэтому роль АМ как промотера данных процессов путем индуцирования ангиогенеза была предложена для многих опухолевых заболеваний включая лейомиому [Nikitenko et al., 2006]. В то же время экспрессия адреномедуллиновых рецепторов в опухолевых тканях до настоящего времени оставалась неизученной [Nikitenko et al., 2006]. Поэтому мы изучили какие клетки экспрессируют адреномедуллиновые рецепторы в опухолевых тканях на примере почек, яичников, лейомиомы и KC.

Экспрессия CL в раковых опухолях почек

Рак почек (РП) составляет 2% раковых заболеваний [http://www.cancerresearchuk.org]. Пятилетняя статистика выживаемости – 40.5% [Campaign, 2001], прежде всего из-за метастазов которые происходят у 75% процентов пациентов [Dawson and Whitfield, 1996]. Конвенционная химиотерапия либо иммунотерапия у данных пациентов приводит к ответу всего лишь у 10% процентов данных пациентов [Cancer: Principles and Practice of Oncology, 2001; Godley and Stinchcombe, 1999]. Основной проблемой при РП является диагностика и предсказание течения заболевания. Наиболее эффективным показателем является стадия развития. Другие показатели, как например, гистология и степень являются менее значительными при определении и предсказании исхода.

Экспрессия АМ мРНК была предварительно изучена при РП, но данные являлись очень немногочисленными [Fujita et al., 2002; Takahashi et al., 2002]. Исследования, проведенные Fujita и коллегами (2002) указывали на корреляцию экспрессии АМ и васкуляризацией опухолевых тканей, однако незначительное количество тканей было использовано для проведения достаточной статистической обработки полученных данных. В то же время данные о адреномедуллиновых рецепторах и корреляции их экспрессии с прогрессом развития опухолей оставался неизученным. Прежде всего это было обусловлено отсутствием антител против адреномедуллинового рецептора (CL).

Разработанные нами специфические поликлональные антитела против CL человека (Рисунок 8) позволили провести подобного рода исследования. Прежде всего нами было показано, что экспрессированный в опухолевых тканях рецептор терминально гликозилирован (Рисунок 10) и поэтому представляет собой функциональную форму рецептора (экспрессированного на поверхности клетки). Кроме того, нами были использован

микрочип содержащий значительное количество (180 пар) опухолевых и нормальных тканей почек (TMA, tissue microarray) для изучения экспрессии и локализации CL методом иммуногистохимии (Рисунок 20). В опухолевых тканях рецептор экспрессирован как эндотелиальными, так и опухолевыми клетками (Рисунок 20). Экспрессия CL в опухолевых клетках значительно повышена по сравнению с нормальными эпителиальными клетками (Рисунке 20) и коррелирует с показателями выживания пациентов.

Экспрессия CL рецептора в нормальных и опухолевых тканях почек.

Подобно Cancer Profiling Array (см. Рисунок 19), Multiple tissue array (MTA) состоит из гистологических образцов тканей полученных из парных опухолевой и нормальной ткани полученных от одного и того же пациента. Образцы (кол-во 180 пар; источник – архивы The Department of Cellular Pathology, John Radcliffe Hospital, Oxford, UK) были зафиксированы в формалине и гистология подтверждена патогистологами. МТА было составлено с использованием цилиндрических образцов диаметром 2м. Полученные таким образом образцы были смонтированы на блоки, с которых были произведены гистологические срезы, содержащие от 60 до 100 образцов тканей. Срезы были использованы для иммуногистохимии с применением выращенных нами антител против CL (см. Рис. 34). МТА был использован для получения данных о локализации рецептора в нормальных и опухолевых тканях и исследования уровня его экспрессии. Рецептор локализован преимущественно в эндотелии клубочков в нормальной ткани (стрелки) и его экспрессия повышена в опухолевых клетках. Иммунореактивность CL была измерена полуколичественным методом в опухолевых клетках и проведено сравнение с нормальными эпителиальными клетками почек.

Экспрессия CL в тканях лейомиом

Лейомиомы матки – опухолевые образования в миометрии. Данные неоплазмы встречаются у трети женщин и являются значительной причиной возникновения кровотечений, болей, бесплодия и спонтанных абортов [Flake et al., 2002]. В настоящее время наиболее распространенным методом лечения фиброидов является хирургическое вмешательство и данные опухоли являются обычным показателем для гистерэктомии. Существующее мнение о том, что патологический ангиогенез является значительным фактором в процессе развития и прогрессивного роста лейомиом. Экспрессия известных ангиогенных факторов, как например VEGF и bFGF была зарегистрирована в лейомиомах и предложена их роль в ангиогенных процессах. Тем не менее было показано что среди всех изученных ангиогенных факторов, экспрессия только АМ, но не других факторов, коррелирует с количеством сосудов микроциркуляторного русла миометрия и индексом пролиферации эндотелия при развитии лейомиом [Hague et al., 2002]. Тем не менее анализ экспрессии АМ и его рецепторов в тканях лейомиом и миометрия матки одного и того же пациента не был проведен. Необходимость данного рода исследований обусловлена потенциальной возможностью воздействия на сосудистую систему лейомиом без побочных эффектов на окружающий миометрий. В связи с этим нами были проведены исследования экспрессии АМ, CALCRL и RAMPs мРНК, а также локализации CL рецептора в парных тканях лейомиомы и миометрия полученных от одного и того же пациента (Рисунок 21).

Экспрессия CL в тканях нормального миометрия        и лейомиомы.

(А) Экспрессия CL была исследована
методом двойной иммуногистохимии с
использованием поликлональных антител против рецептора и моноклональных антител против
специфических маркеров разных типов клеток: CD31 (эндотелиальные клетки),CD45 (лейкоциты) и SMA(гладкомышечные клетки). Вторичные
антитела были мечены ФИТЦ либо ТК
(техасским красным) соответственно. Клетки экспрессирующие рецептор и один из маркеров определены по наличию желтой окраски после
соединения двух фотографий.

(Б)Экспрессия CALCRL и RAMPs мРНК в
тканях лейомиомы (Л) и окружающих тканях миометрия (М) была определена с использованием метода Northern blotting. Убиквитиновый зонд был
использован в качестве контроля. Соотношение экспрессии CALCRL и RAMPs к экспрессии убиквитина  отражает относительное содержание РНК в соответствующих тканях.

(В) Срезы тканей содержащих как опухоль (лейомиома; Л) так и окружающую ткань миометрия (М) были        окрашены

иммунгистохимически с использованием антител против CD34 - маркера эндотелиальных клеток и, соответственно, сосудов. Подсчет количества сосудов был произведен с использованием метода «горячих точек» Chalkley counting [Fox and Harris, 2004; Hague et al., 2001; Nikitenko et al., 2006]. Результаты анализа показывают корреляцию CL и RAMP2 мРНК и количества микроциркуляторных сосудов в тканях лейомиомы и окружающего миометрия.

Нами была выявлена специфическая экспрессия CL рецептора в эндотелиальных тканях как лейомиомы так и окружающего миометрия (Рисунок 21). Следует заметить, что данные результаты отличаются от распределения рецептора в опухолевых тканях почек (Рисунок 20). Экспрессированный в эндотелиальных клетках тканей лейомиомы CL является терминально гликозилированным, а поэтому – функционально активным (ассоциированным с экспрессией на поверхности клетки) (Рисунок 21). Кроме того, экспрессия CL понижена в тканях лейомиомы, что связано прежде всего с уменьшением количества сосудов микроциркуляторного русла в данной опухоли (Рисунок 21). Принимая во внимание то, что АМ играет роль в биологии эндотелиальных клеток микроциркуляторного русла миометрия [Nikitenko et al., 2006], нами было выдвинуто предположение о том, что для эффективной терапии с применением ингибиторов АМ и его рецепторов для лечения лейомиом необходимо дальнейшее изучение различий адреномедуллиновых рецепторов экспрессированных в эндотелии нормального миометрия и тканей лейомиом для выявления потенциальных различии и эффективной терапии избегающей побочных эффектов [Nikitenko et al., 2006].

Экспрессия CL в клетках саркомы Капоши

В связи с тем что нами была обнаружена повышенная экспрессия CL в КС - опухоли, связанной с трансформацией эндотелиальных клеток при инфекции онкогенным вирусом KSHV (Рисунки 15 и 16). Нами была изучена экспрессия рецептора в тканях КС с использованием метода иммуногистохимии. Результаты проведенных исследований показали, что веретенообразные клетки опухоли экспрессируют CL (Рисунок 15). Дополнительно проведенные исследования in vitro с использованием эндотелиальных клеток микроциркуляторного русла человека (Рисунок 15) указывают на то, что вирус увеличивает экспрессию рецептора в инфицированном эндотелии. Учитывая то, что АМ является ангиогенным фактором, нами была выдвинута гипотеза о возможной роли АМ в аберрантном ангиогенезе при развитии КС [Fliss et al., 2006].

Таким образом, в результате проведенных нами исследований, была впервые изучена экспрессия функциональной формы CL рецептора в опухолевых тканях почек, лейомиомы и КС, а также локализация данного G-белок связывающего рецептора. Нами впервые показано, что в зависимости от вида опухоли, рецептор экспрессирован либо только эндотелиальными клетками (лейомиома, саркома Капоши), либо еще и в опухолевых клетках (опухоли почек и яичников). Вполне возможно, что уровень экспрессии рецептора опухолевыми клетками отражает стадию прогресса опухоли либо обеспечивает защиту клетки от воздействия радио-и химиотерапии.

Результаты проведенных нами исследований указывают на то, что дальнейшие исследования должны быть направлены на изучение потенциальных различий в свойствах данного рецептора в нормальных и раковых тканях с целью разработки методов специфичной регуляции (ингибирования либо стимуляции) их функции, в зависимости от роли которую они играют в той или иной опухолевой или нормальной ткани, а также для предотвращения побочных эффектов [Nikitenko et al., 2006]. Данного рода исследования должны включать изучение фармакологии и фенотипа рецепторов которые CL образует в клетках, в которых он экспрессирован in vivo в норме и при патологии (например, раковых опухолях). Более подробно данные идеи описаны в нашем недавнем обзоре [Nikitenko et al., 2006].

Использование разработанных реактивов и методов в диагностике неоплазм и раковых опухолей

Для обеспечения лечения раковых опухолей необходимы современные диагностические методы. К сожалению, методы диагностики рака почек в настоящее время отсутствуют. Полученные в наших исследованиях данные о возможной роли АМ в биологии рака почек (Рисунок 20), а также разработанные методы исследования экспрессии CL рецептора, позволяют диагностировать данный вид рака и прогнозировать исход данного заболевания у индивидуальных пациентов, поскольку нами было обнаружена корреляция экспрессии CL рецептора и прогнозом развития болезни у пациентов с раком почек [Nikitenko et al., 2007]. Кроме того, на основе метода 3С разработаны методы диагностики раковых и других заболеваний [Akoulitchev et al., 2006; Ramadass et al,., 2007].

Перспективы модулирования функционирования адреномедуллиновых рецепторов с целью коррекции их функции при патологиях развития и функции сосудистой системы (разработка ингибиторов и активаторов с использованием современных методов и технологий).

Результаты наших исследований механизмов регулирующих экспрессию и функцию G-белок связывающего рецептора CL в клетках и тканях человека указывают на наличие и роль многоступенчатого регуляционного процесса. Таким образом, регуляция функции CL рецептора может быть осуществлена на нескольких уровнях (Рисунок 22) и поэтому использование нескольких современных технологий может быть применено с данной целью (Таблица 4).

Многоступенчатая регуляция специфической экспрессии и функциональных свойств CL  рецептора в эндотелиальных клетках микроциркуляторного русла человека.

Нами был разработан особенный реактив для специфического ингибирования АМ
рецептора. Мы использовали метод генетической инженерии для получения
моноклональных антител узнающих CL/RAMP гетеродимер, экспрессированный на
поверхности клетки (Рисунок 23). Оценка антител указывает на то, что они
распознают        CL/RAMP2  гетеродимер  (АМ1  рецептор)  (данные  не  показаны).

Использование данных антител в функциональных исследованиях показало, что они обладают способностью ингибировать действие АМ и, соответственно, оказывать влияние на физиологию эндотелиальных клеток человека (Рисунок 23). Проведение дальнейших исследований укажет на возможность использования данных и других антител (Таблица 4) для ингибирования ангиогенеза в раковых опухолях и регуляции АМ сигналов при патологиях связанных с повышенной активностью данного пептида или его рецептора АМ1 (CL/RAMP2).

Разработка моноклональных антител против гетеродимера CL/RAMP человека.

Моноклональные антитела против гетеродимера CL/RAMP были выращены против
нативного эпитопа с использованием метода

генетической иммунизации. Позитивный моноклон LCNL-Clone 6 был использован для:

(А) сравнительного анализа с использованием поликлональных антител LN-1436 выращенных нами против внутриклеточного карбокси-окончания рецептора (см.Рис. 8) и

(Б) для блокирования действия лигандов. Моноклональные антитела распознают только рецептор экспрессированный на поверхности клетки (зеленые стрелки), в то время как поликлональные антитела распознают как рецептор на плазматической мембране (белые стрелки), так и в эндоплазматическом ретикулуме (короткие белые стрелки). (Б) Применение моноклональных антител против гетеродимера CL/RAMP in vitro приводят к разрушению монослоя эндотелиальных клеток (ЭК). Монослой эндотелиальных клеток в культуре окрашен с использованием красителя calcein-AM.

       

Таблица 4.

Специфические и неспецифические модуляторы эффектов индуцированных адреномедуллином.

Основано на литературном источнике Nikitenko et al., 2006.

Побочные эффекты

или недостатки

Тест не проведен

Вазодилатация in vivo

Вазоконстрикция

Мишень

Лиганд (AM)

Реактив/вещество

Рибозим против АМ мРНК

AMBP-1 (связывающий белок)

Блокирующие антитела против АМ

Позитивные непептидные

регуляторы Негативные непептидные

регуляторы

Образ действия

Биологическая

активность

Деградация AM мРНК

Аффиность к

рецептору

не изменена

Защите пептида

от деградации

протеазами

Ингибирование

активности АМ

Связывание с АМ Связывание с АМ

Анти-ангиогенный

потенциал

Тест не проведен

Отсутствие

направленной

доставки

Тест не проведен Тест не проведен

Уменьшенное

  количество

сосудов в

ксенографтных  опухолях

Тест не проведен

Тест не проведен

Рецептор

Фрагменты пептидов: AM22-52 (антагонист

рецептора)

CGRP8-37 (антагонист

рецептора)

Блокирующие антитела против CL

Блокирующие антитела против RAMPs

Конкуренция с

лигандом

за связывание с

рецептором

Предполагаемое

Прямое взаимодействие с рецептором

Предотвращает Короткая half-life  неоваскуляризацию

Ингибирует

миграцию и

формирование

капиллярной сети

HUVEC

Короткая half-life Тест не проведен Тест не проведен Тест не проведен

Антитела против        Прямое взаимодействие        Ингибирует

нативного комплекса        с рецептором        Тест не проведен        функцию

Сигнальные

каскады

(вторичные

мессенджеры)

Неизвестные

CL/RAMP

wortmannin (ингибитор

PI3K)

PD98059 (ингибитор

MAPK)

Винбластин

экспрессированным на поверхности клетки эндотелия

Предотвращает ангиогенез

Ингибирование фосфорилирования Неспецифическое

вызванного лигандом  Неспецифическое in vitro и in vivo

Предотвращает
Неизвестно        Неспецифическое  формирование

капилляров

индуцированное

АМ

ВЫВОДЫ

  1. Путем использования лектина Ulex Europeus Agglutinin 1 (UEA1), связанного с магнитными шариками, разработаны методы выделения чистых популяций эндотелиальных клеток микроциркуляторного русла эндометрия и миометрия матки человека, как органов в которых происходят процессы физиологического ангиогенеза, а также методы культивирования первичных культур данных клеток, позволяющие изучать роль ангиогенных и других факторов в их биологии.
  2. Доказана роль нового ангиогенного фактора адреномедуллина в биологии эндотелиальных клеток микроциркуляторного русла человека путем демонстрации его влияния на пролиферацию и миграцию этих клеток, а также ингибирование апоптоза и регуляцию проницаемости эндотелиального монослоя.
  3. Клонированы и охарактеризованы промотер и новые гетерогенные транскрипты CALCRL гена человека, а также разработан метод определения трехмерной субхромосомной структуры генов. Показано, что экспрессия CALCRL гена зависит прежде всего от клеточно- и ткане-специфического фона. При этом ключевым фактором экспрессии CALCRL гена является его трехмерная структура, а активность промотера играет вторичную роль. Продемонстрированы влияние гипоксии на активность промотера CALCRL гена человека и роль онкогенного вируса саркомы Капоши на экспрессию CL рецептора в эндотелиальных        клетках микроциркуляторного русла человека.
  4. В экспериментах с использованием первичных клеточных культур и тканей человека и разработанных плазмидных векторов, позволяющих производить зонды для гибридизации in situ и Northern блоттинга, показана специфическая экспрессия CALCRL гена человека и CL рецептора в эндотелиальных клетках микроциркуляторного русла in vitro и in vivo.
  5. Впервые определены функциональные свойства G-белок связывающего рецептора CL
    экспрессированного в тканях и эндотелиальных клетках микроциркуляторного русла
    человека. Продемонстрировано, что именно CL рецептор непосредственно взаимодействует
    с адреномедуллином и осуществляет роль рецептора для данного пептида в эндотелии
  6. человека, обеспечивая работу известных до настоящего момента сигнальных каскадов ассоциированных со стимуляцией эндотелия адреномедуллином. В экспериментах по изучению интернализации рецептора с использованием антагонистов АМ и CGRP рецепторов показано, что CL рецептор также играет роль CGRP рецептора в эндотелиальных клетках микроциркуляторного русла человека.
  7. Продемонстрировано, что избыточная экспрессия одного или другого лиганда (АМ либо
    CGRP) приводит к потере функции (десенситизации) эндотелиального CL к обоим
    лигандам, и поэтому может играть роль при развитии сердечно-сосудистых заболеваний
    различной этиологии. При этом десенситизация рецептора обусловлена его
    интернализацией только в случае взаимодействия с АМ.
  8. Разработаны поликлональные антитела против  человеческого CL рецептора  и продемонстрирована их  способность  распознавать дегликозилированный, основногликозилированный и терминально-гликозилированные формы рецептора, а также возможность их использования для определения локализации рецептора в клетках человека in vitro и in vivo.
  9. Впервые продемонстрирована экспрессия CL рецептора в тканях человека в норме и при патологии (на примере опухолевых тканей почек, яичников, лейомиомы и саркомы Капоши). Показано, что в раковых опухолях рецептор может быть экспрессирован либо только в эндотелиальных клетках (лейомиома и саркомы Капоши), либо в эндотелиальных клетках и в раковых клетках (опухолевые заболевания почек и яичников). Впервые выявлена необходимость исследования фармакологии адреномедуллиновых рецепторов как в эндотелиальных клетках опухолей, так и в самих опухолевых клетках; а также необходимость выявления различий свойств CL рецептора экспрессированного в нормальном и опухолевом эндотелии.
  10. Показано, что существует корреляция между экспрессией лиганда, либо его рецептора, и развитием/прогрессированием опухолевых заболеваний человека. Выявлено, что в опухолевых тканях экспрессия рецептора в раковых клетках может быть ассоциирована с появлением раковых клеток в сосудах микроциркуляторного русла.
  11. Продемонстрировано, что онкогенные вирусы (например, вирус саркомы Капоши) обладают способностью регулировать экспрессию CL рецептора в эндотелиальных клетках микроциркуляторного русла человека. Сконструированная лентивирусная «библиотека» позволила выявить индивидуального вирусного гена К2 (кодирующего vIL6) в регуляции экспрессии CL рецептора. Полученные данные впервые указывают на необходимость дальнейшего изучения роли адреномедуллиновых рецепторов в трансформированном вирусом эндотелии человека и выявление различий свойств CL рецептора экспрессированного в нормальном и трансформированном вирусом эндотелии.
  12. Получены моноклональные антитела против гетеродимера CL/RAMP, экспрессированного на поверхности клетки, и показана возможность их использования для регуляции свойств эндотелиальных клеток микроциркуляторного русла человека, указывает на возможность их применения в качестве эффективного метода коррекции патологий, связанных с функцией адреномедуллиновых рецепторов, как например патологический ангиогенез и гиперпроницаемость эндотелия.
  13. Экспрессия адреномедуллиновых рецепторов на ранних стадиях эмбриогенеза и дифференцировки стволовых клеток во взрослом организме указывает на их возможную роль в процессе дифференцировки клеток человека.
  14. Впервые выявлены и обобщены роль многоступенчатой регуляции специфической

экспрессии и функциональных свойств CL рецептора в биологии эндотелиальных клеток в норме и при патологии 4).

Список научных работ опубликованных по теме диссертации

  1. Oehler MK, Nikitenko LL, Hague S, Bicknell R, Rees MCP. Expression of the angiogenic growth factor adrenomedullin in endometrial carcinoma cell lines and endometrial adenocarcionoma. Xth Hamburg Symposium on Tumor Markers, Hamburg, Germany – 1999. – P. 112.
  2. Oehler MK, Nikitenko LL, Hague S, Bicknell R, Rees MCP. Prognostic relevance of serum vascular endothelial growth factor in ovarian cancer. // Xth Hamburg Symposium on Tumor Markers, Hamburg, Germany. – 1999. – P. 128.
  3. Nikitenko LL, MacKenzie IZ, Rees MCP, Bicknell R. Adrenomedullin is an autocrine regulator of endothelial growth in human endometrium. // Molecular Human Reproduction. – 2000. – Vol. 6 (9). – P. 811-819.
  4. Nikitenko LL, Lloyd BH, Rudland PhS, and Barraclough R. Localisation by in situ hybridisation of S100A4 (p9Ka) mRNA in primary human breast tumour specimens. // International Journal of Cancer. – 2000. – Vol. 86. – P. 219-228.
  5. Nikitenko LL, MacKenzie IZ, Bicknell R, Rees MCP. Adrenomedullin/CGRP receptors in the human uterus. // XIth International Congress of Histochemistry and Cytochemistry, York, United Kingdom. – 2000. – P. 234.
  6. Nikitenko LL, MacKenzie IZ, Rees MCP, Bicknell R. Isolation, culture and growth factor responsiveness of human endometrial endothelium. // Annual ICRF Colloquium, Warwick, United Kingdom– 2000. – P. 54.
  7. Nikitenko LL, MacKenzie I, Rees MCP, Bicknell R. Adrenomedullin is an autocrine regulator of endothelial growth in human endometrium. // Introduction to Molecular and Cellular Research, San-Diego, USA. – 2000. – P. 97.
  8. Nikitenko LL, Brown NS, Smith DM, MacKenzie I, Bicknell R, Rees MCP. Differential and cell-specific expression of calcitonin-receptor-like receptor and receptor activity modifying proteins in the human uterus. // Molecular Human Reproduction. – 2001. – Vol. 7(7). – P. 655-664.
  9. Nikitenko LL, Smith DM, Hague S, Wilson CR, Bicknell R, Rees MCP. Adrenomedullin and the Microvasculature. // Trends in Pharmacological Sciences. – Vol. 23(3). – P. 101-103.
  10. Rees MCP, Nikitenko LL, Hague S, Bicknell R. Endometrial angiogenesis. In: Maruo T, Barlow D, Mardon H, Kennedy S. (eds) Cell and Molecular Biology of Endometrium in Health and Disease. Soeshi Publishing. – 2002. – P. 145-155.
  11. Wilson CR, Nikitenko LL, Smith DM, Sargent IL, Rees MCP. Expression of adrenomedullin and its receptors in placenta and decidua. // 8th IFPA Meeting, Melbourne, Australia. – 2002. – P. – 121.
  12. Nikitenko LL, Patel S, Clissold P, Rees MCP, Bicknell R. Molecular characterization of the adaptive response of endothelial cells to hypoxia. // Angiogenesis: basic mechanisms and therapeutic implications, Ascona, Switzerland. – 2002. – P. - 27.
  13. Nikitenko LL, Rees MCP, Bicknell R. Adrenomedullin signalling system and microvascular endothelial cell response to hypoxia. 5th Imperial College School of Medicine Symposium “Vascular endothelium: Role in disease pathogenesis and as a therapeutic target”. // London, United Kingdom. – 2002. – P. 18.
  14. Nikitenko LL, Smith DM, Bicknell R, Rees MCP. Transcriptional regulation of human CRLR in microvascular endothelial cells. // 676th Biochemical Society Meeting, Heriot-Watt University, Edinburgh, United Kingdom. – 2002. – P. 81.
  15. Nikitenko LL, Smith DM, Bicknell R, Rees MCP. Transcriptional regulation of the CRLR gene in human microvascular endothelial cells by hypoxia. // The FASEB Journal. – Vol. 17(11). – P. 1499-501. Full-length article is available at: http://www.fasebj.org/cgi/reprint/02-0993fjev1.pdf
  16. Nikitenko LL. Molecular mechanisms of the adaptive response of endothelial cells to hypoxia. // 6th International Engelhardt Conference on Molecular Biology, Москва и Санкт Петербург, Российская Федерация. – 2003. – P. 17.
  17. Nikitenko LL, Smith DM, Bicknell R, Rees MCP. Mechanisms of transcriptional regulation of GPCR CRLR in the microvasculature. // Special FEBS 2003 Meeting on Signal Transduction, Brussels, Belgium. EJB The FEBS Journal. 2003. - Vol. 270(1). - P. 49.
  18. Patel S, Nikitenko LL, Terret J, Bicknell R. Identification of hypoxia inducible messengers expressed in human dermal microvascular endothelial cells. // The 40th American Association for Cancer Research Annual Meeting, New Orleans, USA. – 2003. – P. 270.
  19. Wilson CR, Nikitenko LL, Sargent IL, Rees MCP. Adrenomedullin: multiple functions in human pregnancy. // Angiogenesis. – 2004. – Vol. 7(3). – P. 203-12.
  20. Nikitenko LL. Heterogeneity of novel CRLR transcripts in human microvascular endothelial cells. Joint International Symposium on CGRP, Amylin and Calcitonin 4th Symposium on Adrenomedullin and Proadrenomedullin N-20 Peptide, Zurich, Switzerland. – 2004. – P. 21.
  21. Pathak H, Staff AC., Harsem NK, Braekke K, Sargent I, Rees MCP, and Nikitenko LL. Adrenomedullin expression in the decidua in normal and pre-eclamptic pregnancy. XXXIV Congress of Nordic Federation of Obstetrics of Obstetrics and Gynaecology, Helsinki, Finland. – 2004. – P. 58.
  22. Carroll VA, Nikitenko LL, Bicknell R., Harris AL. Antiangiogenic activity of a domain deletion mutant of tissue plasminogen activator containing kringle 2. // Arteriosclerosis, Thrombosis and Vascular Biology. – 2004. – Vol. 25(4). – P. 736-41.
  23. Nikitenko L.L. Embryonic development: Tutorials for biomedical students. // Collection MCQ. Keble College, Oxford, United Kingdom. – 2005. – 24 P.
  24. Wilson J, Pathak H, Staff AC, Harsem NK, Braekke K, Rees MCP, Sargent IL, Nikitenko LL. Expression of adrenomedullin and its receptor in third trimester placental bed decidua from normal and pre-eclamptic pregnancies. // XI European Placenta Group Meeting, Glasgow, United Kingdom. – 2005. – P. – 72.
  25. Nikitenko LL, Blucher N, Fox S, Smith DM, Bicknell R, Rees MCP. Adrenomedullin and CGRP interact with endogenous calcionin-receptor-like receptor in endothelial cells and induce its desensitisation via different mechanisms. // Journal of Cell Science. – 2006. – Vol. 119(5). – P. 910-922.
  26. Nikitenko LL, Cross T, Campo L, Leek R, Helen T, Manek S, Bicknell R, Rees MCP. Expression of terminally glycosylated calcitonin receptor-like receptor in uterine leiomyoma: endothelial phenotype and association with microvascular density. // Clinical Cancer Research/ -2006. – Vol. 12(19). – P. 5648-58.
  27. Nikitenko LL, Fox S, Kehoe S, Rees MCP, Bicknell R. Adrenomedullin and tumour angiogenesis. // British Journal of Cancer. – 2006. – Vol. 94. – P. 1-7.
  28. Nikitenko LL, Boshoff C. Endothelial Cells and Cancer. // In: Moncada S, Higgs A. (eds) Handbook of Experimental Pharmacology, The Vascular Endothelium. Springer-Verlag, Berlin Heidelberg. – 2006. – Vol. 176. – P. 637-664.
  29. Nikitenko LL, Morrison J, Roseman F, Rees MCP, Kehoe S. Expression of adrenomedullin and terminally glycosylated calcitonin receptor-like receptor in ovarian cancer. // 11th Biennial International Gynecologic Cancer Society Meeting, Santa Monica, CA, USA. – Int. J. Gynecol. Cancer.– 2006. Vol. 16 (Suppl.3). – P. 690.
  30. Nikitenko LL, Blucher N, Fox SB, Bicknell R, Smith DM, Rees M. Adrenomedullin and CGRP interact with endogenous calcitonin receptor-like receptor in microvascular endothelial cells and induce its desensitization via two different mechanisms.// The 24th European Conference on Microcirculation. From Vascular Biology to Clinical Microcirculation, Amsterdam, Netherlands. -2006. - P43.
  31. Nikitenko LL, Blucher N, Fox SB, Bicknell R, Smith DM, Rees M. Desensitisation of endogenous calcitonin receptor-like receptor in human microvascular endothelial cells. The 21st Scientific Meeting of the International Society of Hypertension (ISH2006), Fukuoka, Japan. – 2006. – P. 153.
  32. Fliss P, Vart R, Trotter M, Boshoff C, Nikitenko LL. Calcitonin receptor-like receptor is upregulated in Kaposi’s sarcoma. The 9th International Workshop on Kaposi’s Sarcoma Associated Herpesvirus (KSHV) and Related Agents, Hyannis, USA. – 2006. – P. 64.
  33. Nikitenko LL, Blucher N, Fox SB, Bicknell R, Smith DM, Rees M. Adrenomedullin and CGRP interact with endogenous calcitonin receptor-like receptor in microvascular endothelial cells and induce its desensitization via two different mechanisms.// Abstracts of The Physiological Society 2006 Main Meeting, University College London, London, United Kingdom. – 2006. – P. 80.
  34. Vart R, Nikitenko LL, Lagos D, Trotter M, Boshoff C. Viral CPCR and FLIP upregulate angiopoietin-2 expression in lymphatic endothelium via MAPK pathway. The 9th International Workshop on Kaposi’s Sarcoma Associated Herpesvirus (KSHV) and Related Agents, Cape Cod, USA. – 2006. – P. 53.
  35. Vart R, Nikitenko LL, Lagos D, Trotter M, Gratrix F, Bourboulia D, Takeuchi Y, Boshoff C. Kaposi’s Sarcoma-associated Herpesvirus encoded vIL6 and vGPCR regulate angiopoietin-2 expression in lymphatic endothelial cells Cancer Research. – 2007. – Vol. 67(9). – P. 4042-51.
  36. Nikitenko LL, Generali D, Pellagatti A, Leek R, Rees MCP and Fox S. Upregulation and internalisation of calcitonin-receptor-like receptor in renal cancers. – 2007. – В печати.
  37. Ramadass AS, Nikitenko LL, Martianov I, Chow N, Rees MCP, Akoulitchev A. Regulatory switch between distinct chromosomal conformations of active transcriptional units. – 2007. – В печати.

Монография

Никитенко Л.Л. Роль адреномедуллина в биологии эндотелиальной клетки человека. // – М. – ОАО «Издательство  Геотар» – 2007. – 147 C.

Патенты оформленные по материалам диссертации

Nikitenko LL, Smith DM, Bicknell R, Rees MCP. Transcriptional Regulation of Therapeutically Useful Gene. // International Patent GO1N 33/50 – 2003.

Akoulitchev A, Ramadass A, Nikitenko LL. Chromosomal conformation footprints in diagnostics of aberrant gene expression. // UK Patent Application No.0603251.0 – 2006.







© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.