WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

ЕФИМОЧКИНА Наталья Рамазановна

НОВЫЕ БАКТЕРИАЛЬНЫЕ ПАТОГЕНЫ В ПИЩЕВЫХ ПРОДУКТАХ:

ЭКСПЕРИМЕНТАЛЬНОЕ ОБОСНОВАНИЕ И РАЗРАБОТКА СИСТЕМЫ КОНТРОЛЯ С ПРИМЕНЕНИЕМ МЕТОДОВ МИКРОБИОЛОГИЧЕСКОГО И МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОГО АНАЛИЗА

14.02.01 – гигиена

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук

Москва -  2010

Работа выполнена в лаборатории санитарно-пищевой микробиологии и микроэкологии Учреждения Российской академии медицинских наук научно-исследовательский институт питания  РАМН

Научный консультант  Доктор медицинских наук, профессор,

  академик РАМН

Тутельян Виктор Александрович

                       

Официальные оппоненты:                        доктор медицинских наук, профессор,

академик РАМН

Пивоваров Юрий Петрович

доктор биологических наук, профессор 

Алешкин Владимир Андрианович

доктор биологических наук, профессор

Ревазова Юлия Анатольевна

Ведущая организация:                                Федеральное государственное

Учреждение науки

Федеральный научный центр гигиены

им. Ф.Ф.Эрисмана Роспотребнадзора

Защита диссертации состоится «____ »___________ 2010 г. в ____часов на заседании Диссертационного совета Д.001009.01 Научно-исследовательского института экологии человека и гигиены окружающей среды имени А.Н. Сысина  РАМН по адресу:

119992, Москва, ул.Погодинская, д.10/15, стр.1

С диссертацией можно ознакомиться в библиотеке института

Автореферат разослан «____»_______________2010 г.

Ученый секретарь

Диссертационного совета,

доктор биологических наук, профессор                                        Н.Н.Беляева

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Обеспечение микробиологической безопасности пищевых  продуктов является одной из приоритетных задач, решение которой непосредственно направлено на охрану здоровья населения. Во всем мире эта проблема приобретает особую актуальность в связи с увеличением числа заболеваний, передающихся через пищевые продукты.

Необходимость всестороннего изучения  данной проблемы очевидна и включает многоплановую оценку факторов, воздействующих на здоровье человека, наиболее значимым из которых  в настоящее время является  микробное загрязнение пищевых продуктов возбудителями новых или так называемых «эмерджентных» бактериальных инфекций с пищевым путем передачи (Listeria monocytogenes, Salmonella, энтерогеморрагические E.coli (ЕНЕС), Campylobacter jejuni, Enterobacter sakazakii и др.).

На современном этапе происходит формирование  новых представлений о том, какие эволюционные изменения претерпевают пищевые бактериальные патогены в условиях антропогенной трансформации внешней среды, влияющие на этиологические  и патогенетические свойства возбудителя, пути передачи инфекции и восприимчивость к ним человеческой популяции [Покровский В.И., 1996, Тутельян В.А., 2002, Гинцбург А.Л., 2002, Литвин В.Ю., 1997, Бухарин О.В., 2009, Тартаковский И.С., 2002, Куликовский А.В., 2004, Fratamico P.M. et al., 2005, Солодовников Ю.П., 2009].

Феномен появления новых возбудителей пищевых инфекций и токсикоинфекций должен рассматриваться с общих позиций эпидемиологической экологии бактерий, изучающей в первую очередь те аспекты существования бактериальных популяций в окружающей среде, которые определяют возможность возникновения инфекционных заболеваний у человека. При этом  пищевые продукты и процессы их производства представляются как  качественно новая «внешняя среда» обитания или экологическая ниша, сформировавшаяся в условиях развитого индустриального производства и благоприятная для ряда патогенных и потенциально патогенных микроорганизмов.

Выживание бактерий, находящихся в той или иной экологической нише, непосредственно связано с генетически закрепленной способностью включать регуляторные системы изменчивости и адаптации на различных стадиях развития бактериальной популяции [Бондаренко В.И., 1997, Ермолаева С.А., 2001, Доморадский И.В., 2002, Маркова Ю.А. с соавт., 2009]. Однако в свете современных концепций перестройка популяционных структур  патогенов по вирулентности и факторам патогенности в условиях окружающей среды существенно отличается от характера персистенции возбудителя в клеточных системах макроорганизма при разных  типах инфекций, что требует углубленного изучения биохимических и молекулярно-генетических аспектов этой проблемы.

Оценка частоты появления новых возбудителей  пищевых инфекций свидетельствует об ускорении процессов адаптации бактериальных патогенов в неблагоприятных условиях внешней среды, вследствие чего микроорганизмы даже с весьма ограниченным ареалом распространения способны в короткие сроки превращаться в возбудителей острых пищевых инфекций с тяжелым течением и высоким процентом летальных исходов (листериоз, энтерогеморрагический эшерихиоз и др. инфекции).

Нарастающая озабоченность мировой общественности проблемой микробиологической безопасности пищи обусловила появление концепции «эмерджентных пищевых инфекций», в соответствии с которой они рассматриваются не только в медико-генетических аспектах, но и с учетом экологических и технологических факторов, что позволяет расшифровать структуру заболеваемости и  прогнозировать появление новых возбудителей [Smith J.L., Fratamico P.M., 2005, MMWR, 2009].

Термин «эмерджентные пищевые инфекции» широко используется в научных публикациях и официальных документах международного сообщества и Всемирной организации здравоохранения, он происходит от английского «emergent» и означает «внезапно появляющиеся» или «вновь возникающие»; в отечественной терминологии используется понятие «новые или возвращающиеся» инфекции.

По определению ВОЗ эмерджентные инфекции – это болезни (и возбудители), возникающие или появляющиеся внезапно и этим обуславливающие чрезвычайные  эпидемиологические ситуации, как правило, очень напряженные. Эти заболевания, особенно пищевые зоонозы,  являются наиболее эпидемиологически значимыми, наносящими большой социально-экономический  ущерб.

Современные подходы к организации системы обеспечения безопасности пищевых продуктов требуют детального исследования  особенностей новых патогенов, биохимических и генетических механизмов их вирулентности, а также регулирующей роли технологических факторов в условиях индустриального производства. Это обосновывает необходимость разработки новых критериев в системе санитарно - эпидемиологического контроля продовольственного сырья и готовой продукции, в том числе на основе создания и внедрения высокочувствительных и эффективных методов микробиологического и молекулярно-генетического анализа.

Цель работы: совершенствование  системы обеспечения микробиологической  безопасности пищевых продуктов путем  разработки и внедрения современных методов микробиологического и молекулярно-генетического анализа и новых нормативов безопасности для основных групп пищевых продуктов на основе подробного изучения экологии и особенностей выживания новых видов патогенных микроорганизмов, оценки роли технологических факторов в формировании измененных свойств этих патогенов в условиях пищевых производств.

Задачи исследования:

  1. Провести анализ распространенности наиболее значимых эмерджентных  пищевых патогенов (Listeria monocytogenes, Salmonella, ЕНЕС, Campylobacter jejuni, Enterobacter sakazakii и др.) в пищевых продуктах и объектах окружающей среды;
  2. Изучить основные закономерности  эпидемиологии и экологии бактерий Listeria monocytogenes,  роль физических, химических и биологических стрессовых факторов в формировании различных типов поведения патогенных  листерий, контаминирующих пищевые продукты в процессе их производства и хранения, и обосновать необходимость введения  нового  норматива безопасности для основных групп пищевых продуктов;
  3. Разработать новые методические подходы, позволяющие проводить ускоренную индикацию L. monocytogenes в различных видах пищевых продуктов с использованием высокоспецифичных комбинированных схем бактериологического и молекулярно-генетического анализа;
  4. На основе изучения культурально-биохимических свойств и генетических характеристик  нового вида патогенных микроорганизмов  E. sakazakii сделать анализ диагностической значимости ряда фенотипических  и генотипических тестов идентификации и разработать на их основе схему и методику выделения возбудителя; теоретически и экспериментально обосновать необходимость введения нового микробиологического норматива для продуктов  питания детей раннего возраста;
  5. Определить значение некоторых потенциально патогенных микроорганизмов в возникновении эмерджентных пищевых токсикозов; изучить условия, влияющие на  жизнедеятельность токсигенных стафилококков и биосинтез энтеротоксинов в пищевых продуктах; разработать методы выделения и количественной оценки стафилококковых энтеротоксинов в пищевых продуктах с применением  иммуноферментного анализа; исследовать  токсигенные свойства новых видов мицелиальных грибов – возбудителей пищевых микотоксикозов.
  6. Провести  сравнительные испытания методов ПЦР, ДНК- гибридизации и иммуномагнитной сепарации для  выделения патогенных микроорганизмов родов Salmonella,  Listeria, Campylobacter и Escherichia  с традиционными стандартизованными методами анализа; на основе полученных данных разработать  критерии стандартизации  и гармонизации бактериологических и молекулярно-генетических методов с целью создания единой системы внедрения современных диагностических систем и средств измерений в лабораторную практику микробиологического контроля пищевых продуктов.

Основные положения, выносимые на защиту:

  1. Изменение свойств микроорганизмов в условиях развитого индустриального производства  и антропогенной трансформации внешней среды сопровождается нарастанием патогенного потенциала некоторых видов бактерий, появлением новых или эволюционно измененных возбудителей заболеваний с пищевым путем передачи (эмерджентных пищевых патогенов).
  2. В свете современных концепций  микроорганизмы  Listeria monocytogenes, Salmonella, энтерогеморрагические E.coli, Campylobacter jejuni, Enterobacter sakazakii, S.aureus характеризуются экологическим своеобразием, детерминированностью источников выделения и по частоте обнаружения являются доминирующими среди обширной группы возбудителей пищевых зоонозов.
  3. Феномен появления новых и вновь возникающих патогенов сопровождается усилением роли оппортунистических инфекций и их возбудителей: обнаружение среди энтеробактерий нового вида Enterobacter sakazakii характеризует тенденцию изменения экологической ниши и расширения спектра эмерджентных патогенных бактерий  среди хорошо изученных популяций семейства Enterobacteriaceae; уточнение таксономических характеристик потенциальных патогенов с неясным систематическим положением повышает надежность системы микробиологического контроля.
  4. Изучение основных закономерностей  эпидемиологии, экологии и биологических свойств Listeria monocytogenes, а также  экспериментальное исследование поведения этих микроорганизмов в модельных системах, имитирующих условия производства пищевых продуктов, позволит расширить базу данных для разработки новых критериев безопасности и анализа степени микробиологического риска возникновения пищевого листериоза.
  5. Появление среди известных токсических метаболитов бактерий и грибов «суперантигенов» и других модуляторов системных иммунных реакций повышает степень риска, связанную с накоплением в пищевых продуктах токсинов потенциально патогенных и токсигенных микроорганизмов (S.aureus, B.cereus, микромицеты и др.), что диктует необходимость изучения условий  токсинообразования и создания методов их выявления и идентификации.
  6. Изучение биологии эмерджентных патогенов и системных механизмов регуляции экспрессии генов факторов патогенности этих бактерий позволяет разработать новые методические подходы с использованием высокоспецифичных комбинированных схем бактериологического и молекулярно-генетического анализа  путем подбора наиболее информативных биохимических тестов и генотипирования.

Научная новизна.

Впервые детально изучены экологические особенности, распространение, видовой состав  и свойства эмерджентных патогенов Listeria spp., Escherichia coli, Salmonella spp., Enterobacter sakazakii , выделенных из сырья молочного и мясного происхождения, пищевой продукции на различных этапах изготовления и объектов внешней среды (свыше 1500 образцов). Полученные новые данные о характере и количественных уровнях контаминации различных звеньев пищевой цепи позволили выявить наиболее вероятные источники попадания опасных возбудителей в готовые продукты, обуславливающие высокую степень риска даже при соблюдении технологических режимов производства и хранения продукции. 

Обоснованы теоретические положения о возможном присутствии в пищевых продуктах новых видов патогенных бактерий семейства Enterobacteriaceae, подтвержденные  наличием филогенетических связей между таксономически родственными группами микроорганизмов родов Enterobacter и Pantoea  с обнаруженными возбудителями неонатальных инфекций. Впервые в РФ из детских инстантных смесей выделены колиформные микроорганизмы с измененными биологическими свойствами, детальное исследование которых позволило идентифицировать их как малоизученный вид Enterobacter  sakazakii. Установлена высокая  степень идентичности фенотипических профилей выделенного нового патогена с бактериями вида  E.cloacae и фитопатогенными вариантами P.agglomerans, свидетельствующая о возможных единых генетических регуляторных механизмах экспрессии вирулентных свойств этих микроорганизмов. 

С  использованием новейшей классификации теоретически обоснована таксономическая принадлежность ряда штаммов Е.sakazakii и Pantoea spp., выделенных из детских продуктов, к роду Cronobacter.  Введение новых таксономических единиц расширяет перечень потенциальных патогенов, которые не входят по традиционной классификации в группу колиформных бактерий и не учитываются при оценке безопасности детских инстантных продуктов. С учетом значимости E. sakazakii как оппортунистического патогена для новорожденных и вариабельности биологических свойств возбудителя разработана новая схема идентификации.

Анализ основных закономерностей  эпидемиологии, экологии и биологических свойств эмерджентных бактерий L.monocytogenes, а также экспериментальное изучение поведения этих микроорганизмов в модельных системах, имитирующих условия производства пищевых продуктов и основные физико-химические параметры технологических процессов, позволили расширить отечественную базу данных о функциональных признаках возбудителя для разработки новых критериев безопасности и анализа степени микробиологического риска возникновения пищевого листериоза.  Впервые подробно изучены особенности выживания листерий в процессе длительного хранения в молоке при низких температурах. Установлены исключительно высокая жизнеспособность штаммов L.monocytogenes в этих условиях и длительный период выживания, составивший более 7 месяцев. Выявлена изменчивость основных морфологических и культурально-физиологических свойств штаммов в процессе их длительного хранения в молоке, в частности, постепенное ослабление патогенности, вплоть до полной утраты этого признака после  6-7 месячного периода наблюдения.

В результате изучения биологии L. monocytogenes и системных механизмов регуляции экспрессии генов факторов патогенности этих бактерий разработаны новые методические подходы, позволяющие проводить ускоренную индикацию возбудителя в различных видах пищевых продуктов с использованием высокоспецифичных комбинированных схем бактериологического и молекулярно-генетического анализа  на основе подбора наиболее информативных биохимических тестов и их генотипирования с применением ПЦР. Разработанные методические подходы могут быть распространены на другие виды эмерджентных возбудителей заболеваний, имеющих близких непатогенных представителей в пределах рода,  идентификация которых должна основываться на определении патогенетических признаков.

На основе проведенного анализа и экспериментального сравнения эффективности существующих модификаций молекулярно-биологических методов, обладающих технологической новизной и  универсальностью в отношении различных групп эмерджентных бактериальных патогенов, осуществлены подбор и адаптация твердофазного метода ДНК-гибридизации. Метод включает использование специфических ДНК-зондов для выявления кодируемых признаков патогенности L.monocytogenes или видоспецифических последовательностей рибосомальной ДНК бактерий рода Salmonella, c последующей хемилюминесцентной детекцией продуктов гибридизации нуклеиновых кислот.

Разработана новая методология внедрения современных диагностических систем и средств измерения на основе создания специальных требований и общих критериев стандартизации методик для гармонизации их с традиционными и общепринятыми схемами контроля в пищевой микробиологии; интеграция новых  методов молекулярной биологии в действующую систему микробиологического контроля позволит повысить эффективность проводимых исследований, обеспечит сопоставимость и достоверность результатов испытаний. 

Практическая значимость.

В результате проведенных аналитических и экспериментальных исследований: 

  • обоснованы и введены в действие новые дифференцированные  микробиологические нормативы безопасности, регламентирующие отсутствие патогенных микроорганизмов Listeria monocytogenes  в основных группах пищевых продуктов, предназначенных для различных категорий населения;
  • предложено введение нового микробиологического норматива («отсутствие E. sakazakii в 300 г продукта») для снижения риска  возникновения новой пищевой инфекции  и обеспечения безопасности продуктов, предназначенных для новорожденных, недоношенных  и больных детей раннего возраста;
  • экспериментально обоснован системный подход к исследованию пищевых продуктов на обсемененность S.aureus и наличие стафилококковых энтеротоксинов, который включает разработанный способ экстракции токсинов из различных пищевых продуктов и использование высокоразрешающих методов иммуноферментного анализа.

Разработаны, адаптированы и стандартизованы новые методы исследования условно-патогенных и патогенных микроорганизмов - контаминантов пищевых продуктов, основанные на применении бактериологического, биохимического, иммуноферментного анализа, ДНК-гибридизации и ПЦР в реальном времени. Апробированы и внедрены в практику микробиологического контроля пищевых продуктов:

методы выявления Listeria monocytogenes в пищевых продуктах (МУК 4.2.1122-02);

метод выявления и определения бактерий рода Salmonella и Listeria  monocytogenes на основе гибридизационного ДНК-рРНК анализа (МУК 4.2.1955-05);

метод определения бактерий Enterobacter sakazakii в продуктах для питания детей раннего возраста (МУК 4.2.2428-08);

методы микробиологического контроля продуктов детского, лечебного питания и их компонентов (МУК 4.2.577-96);

метод определения Campylobacter spp. в пищевых продуктах (МУК 4.2.2321-08);

метод определения стафилококковых энтеротоксинов в пищевых продуктах (МУК 4.2.2429-08);

метод real-time ПЦР для идентификации патогенных бактерий, выделенных при контроле пищевых продуктов (МР № 02.036-08);

количественный  микробиологический анализ пищевых продуктов НВЧ-методом при использовании автоматического анализатора ТЕМПО (МР № 02.031-08).

Результаты работы использованы при разработке 27 нормативных и методических документов, в том числе  СанПиН 2.3.2.1078-01 «Гигиенические требования безопасности и пищевой ценности пищевых продуктов», ГОСТ Р 51921-2002 «Продукты пищевые. Методы определения и выделения Listeria monocytogenes», СанПиН 2.3.2.1324-03 «Гигиенические требования к срокам годности и условиям хранения пищевых продуктов», МУК 4.2.1847-2004 «Санитарно-эпидемиологическая оценка обоснования сроков годности и условий хранения пищевых продуктов».

Апробация работы. Полученные материалы и основные положения диссертации представлены в 40 докладах и тезисах, которые были доложены и обсуждались  на 15 международных научных форумах, 13 всероссийских конгрессах, симпозиумах, межрегиональных совещаниях  и научно-практических конференциях.

Публикация результатов исследований. Основные положения диссертации опубликованы в 2 монографиях и 66 научных работах, в том числе 20 – в журналах, рекомендованных ВАК РФ.

Структура и объем диссертации. Диссертационная работа изложена на 327 страницах машинописного текста, состоит из введения, 11 глав, заключения, выводов, списка литературы, включающего 445 наименований, в том числе 355 на иностранных языках. Работа содержит 102 таблицы и 61 рисунок.

Личный вклад автора  составляет более 80% и заключается в формулировании проблемы, постановке цели и задач работы, выборе методов исследования, выполнении аналитической и экспериментальной работы, обобщении и интерпретации полученных данных, подготовке научных публикаций. Теоретические и экспериментальные исследования выполнялись лично автором и совместно с другими исследователями в НИИ питания РАМН в рамках программ и планов НИР №№ 030, 087, 111, 018, 063, 095.

Автор выражает искреннюю глубокую благодарность доктору медицинских наук, академику РАМН, профессору В.А.Тутельяну, заслуженному деятелю науки и техники Российской Федерации, доктору биологических наук, профессору И.Б. Куваевой, доктору медицинских наук С.А. Шевелевой, доктору биологических наук, профессору И.С. Тартаковскому за поддержку, консультативную помощь и сотрудничество.

CОБСТВЕННЫЕ ИССЛЕДОВАНИЯ

Организация проведения работ, материалы и методы исследований

Аналитическая часть работы включала литературный поиск, сбор информационных  и статистических материалов, публикуемых в отечественных и зарубежных научных изданиях, в официальных сборниках Роспотребнадзора и ФГУЗ «Федеральный центр гигиены и эпидемиологии», Международной программы ВОЗ по контролю и надзору за пищевыми инфекциями и токсикоинфекциями в Европе, Центра по контролю заболеваемости в США и других опубликованных источниках.

Всего обработано свыше 480 публикаций отечественных и зарубежных авторов. Собранный материал обобщен, систематизирован и опубликован издательством РАМН в виде монографии «Эмерджентные бактериальные патогены в пищевой микробиологии» (Н.Р.Ефимочкина, 2008) и справочно-обзорного издания «Листерии в молоке и молочных продуктах» (в соавторстве с И.Б.Куваевой и С.Н.Карликановой, 1999 г.).

Материалы о вспышках пищевых бактериальных отравлений и острых кишечных  инфекций в Российской Федерации в период с 1992 по 2006 г.г. обработаны с использованием формализованных схем и включены в Международные сборники программы ВОЗ по контролю и надзору за пищевыми инфекциями и токсикоинфекциями в Европе.

Экспериментальная часть исследований проведена в 1989 – 2009 г.г. в лаборатории санитарно-пищевой микробиологии и микроэкологии НИИ питания РАМН (с 1989 г. по 1998 г. руководитель лаборатории  - Заслуженный деятель науки и техники РФ, доктор биологических наук, профессор  Куваева И.Б., далее – доктор медицинских наук  Шевелева С.А.).

Отдельные этапы экспериментальных работ, включая методическое обоснование и технику выполнения молекулярно-генетических исследований L.monocytogenes  проведены на базе лаборатории легионеллеза НИИ эпидемиологии и микробиологии им. Н.Ф.Гамалеи РАМН под руководством доктора биологических наук, профессора Тартаковского И.С. Исследования микробиологического состава и свойств молока, сыра и других молочных продуктов, касающиеся непосредственно обнаружения L.monocytogenes, S.aureus и др., выполнены в творческом сотрудничестве с лабораториями ГНУ ВНИИМС и ГНУ ВНИМИ Россельхозакадемии.

Для разработки новых и усовершенствованных методов анализа использовали приборы и диагностические средства (тест-системы, реактивы, питательные среды и др.),  представленные в рамках договоров о научном сотрудничестве с ЦНИИ эпидемиологии Роспотребнадзора, фирмами «Ниармедик плюс», «Стайлаб», «Дюпон», «Био-Мерье».

Работа проводилась с использованием музейных и промышленных штаммов, полученных из коллекций ГИСК им. Л.А.Тарасевича, НИИЭМ им. Н.Ф.Гамалеи РАМН,  Всеросийской коллекции микроорганизмовИнститута биохимии и физиологии микроорганизмов РАН. В экспериментах также использовали штаммы энтеробактерий, выделенных из пищевых продуктов, смывов и клинического материала в ФГУЗ «Центр гигиены и эпидемиологии в г. Москве». Всего использовано свыше 300 штаммов бактерий и микроскопических грибов, подробные характеристики которых приведены в соответствующих главах и разделах данной работы.

В работе были использованы коллекционные и выделенные штаммы бактерий рода Listeria (L.monocytogenes, L.innocua, L.ivanovii, L.welshimeri – всего около 200 штаммов), E.coli – 75 штаммов, Salmonella spp. – 11 штаммов, Enterobacter sakazakii – 7 штаммов, других видов семейства Enterobacteriaceae – 190, S. аureus – 137 штаммов, B.cereus – 11 штаммов, Lactobacillus spp. – 66 штаммов, Campylobacter spp. – 5 штаммов, Penicillium citrinum – 17 штаммов (всего более 600 штаммов).

Объектами исследования служили образцы сырья и пищевых продуктов различных групп, а также смывы с поверхностей оборудования, инвентаря, посуды, вспомогательных средств на разных стадиях производства и этапах хранения готовой продукции (свыше 1700 образцов). Отбор проб проводили в соответствии с утвержденными стандартными методами на конкретные виды пищевой продукции.

Выделение и изучение свойств эмерджентных патогенов проводили с использованием стандартных методов микробиологических исследований. Для подтверждения и сравнительного сопоставления полученных данных подбирали или разрабатывали  специализированные и адаптированные к поставленным задачам методики, подробное изложение которых приведено в соответствующих разделах диссертационной работы.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ

1. Анализ распространенности некоторых патогенных микроорганизмов в пищевых продуктах и объектах окружающей среды

Оценивая рейтинг возбудителей по частоте возникновения вспышек, числу пострадавших и тяжести заболевания, международные организации (например, ФАО/ВОЗ) относят к числу наиболее важных эмерджентных патогенов следующие виды: бактерии рода Salmonella, в том числе S.enteritidis и S.typhimurium DT104; энтерогеморрагические E.coli; Listeria monocytogenes;Campylobacter jejuni;Yersinia enterocolitica.

Характеризуя роль этих микроорганизмов в возникновении эмерджентных пищевых инфекций, следует отметить, что их доминирующее влияние было установлено в результате анализа этиологии и патогенеза массовых вспышек заболеваний в различных странах мира начиная с 70-80-х гг. двадцатого века. Подавляющее большинство  вспышек относились к пищевым зоонозам и возникали как вследствие потребления продуктов, полученных от больных животных, так и в результате вторичной контаминации при заготовке и переработке животноводческого сырья, в процессе приготовления и хранения пищи. В данной работе изучены особенности распространения, частота и источники выделения наиболее значимых эмерджентных пищевых патогенов L.monocytogenes, Campylobacter spp., EHEC, Salmonella spp.

L.monocytogenes.

Существующие  данные об обнаружении  листерий в мясопродуктах весьма противоречивы и свидетельствуют о разных уровнях  выявления L. monocytogenes (от 0,5%  до 30-40% проб в количествах от  0,1 до 103 КОЕ/г и более) и широкой распространенности наиболее  близких к ним по фенотипическому  профилю листерий, в первую очередь вида L.innocua. При этом используются различные методические схемы идентификации  штаммов листерий, что затрудняет сопоставление полученных данных и существенно усложняет анализ ситуации [Beumer R.R. et al., 1996; Farber J.M. et al., 1999; Wilson I.G., 1995]. 

Несмотря на большое число зарубежных публикаций о выделении L.  monocytogenes на различных пищевых предприятиях, данных о частоте обнаружения листерий на отечественных заводах крайне недостаточно. Для получения информации о циркуляции этого возбудителя на предприятиях пищевой индустрии проведено изучение  распространения бактерий рода Listeria  при производстве мясных продуктов (табл. 1).

Таблица 1

Частота обнаружения бактерий рода Listeria на мясоперерабатывающих предприятиях

                                                                               

Объект исследования

Число исследованных проб

Частота обнаружения бактерий рода Listeria (%)

В том числе:

L.monocyto-genes

L.innocua

L.welshimeri

Говядина – сырье

14

5 (35,7%)

1

4

0

Свинина – сырье

7

4 (57,1%)

2

2

0

Полуфабрикаты мясные  рубленые

19

7 (36,8%)

3

4

0

Полуфабрикаты мясные кусковые

12

3(25,0%)

2

1

0

Сырокопченые и сыровяленые колбасы

19

6 (31,6%)

1

5

0

Смывы с поверхности оборудования, инвентаря, посуды

72

24

(32,4%)

15

6

3

Всего

143

49 (34,3 %)

24 (16,8%)

22

3

       Установлено, что в технологических  циклах происходит  постоянное инфицирование объектов производственной среды бактериями рода Listeria, частота обнаружения листерий на поверхностях оборудования достигала 71,4%, инвентаря – 29,2%, что безусловно может приводить не только к обсеменению сырья, но и к загрязнению готовых мясных изделий. Из 24 культур, предварительно идентифицированных как L.monocytogenes  9 штаммов (37,5 %) обладали типичными для этого возбудителя факторами патогенности. Наибольшее число штаммов (77,6%) относились к виду L. innocua. Три штамма, выделенные из смывов, были идентифицированы как L. welshimeri.  Другие виды листерий в данном исследовании обнаружены не были.

Частота обнаружения L.monocytogenes в смывах с технологического оборудования и инвентаря - 9,7 % - свидетельствует об интенсивной циркуляции возбудителя листериоза на мясоперерабатывающих предприятиях и требует ужесточения санитарно - гигиенических требований к производству и хранению мясопродуктов. С этой целью должен быть регламентирован и налажен  контроль на наличие L.monocytogenes не только в сырье и готовой продукции, но и наиболее значимых участков технологических процессов, включая посев смывов с технологического и холодильного оборудования, инвентаря, посуды, вспомогательных материалов, рук и одежды работников.

Фекальным загрязнением объясняется преимущественно контаминация листериями сырого молока. По данным многочисленных анализов сырого сборного молока в течение ряда лет было показано, что частота обнаружения L. monocytogenes  в основном колеблется  в пределах от 1 до 12% от числа исследованных проб. Попадание такого сырья на завод обуславливает постепенное накопление возбудителя и массивную контаминацию помещений предприятия, оборудования, инвентаря, создавая условия вторичного обсеменения готовых молочных продуктов.

Источниками  экзогенного, или постсекреторного обсеменения сырого молока являются корма, включая сено и концентраты; частота обнаружения в них  L.monocytogenes варьирует  от 1 до 8,7 % [Farber  J.M., 1989; Husu J.R., 1990], и  вероятность такого способа заражения сырого молока очень велика даже при отсутствии на фермах больных животных. Это в свою очередь может приводить не только к попаданию возбудителя в заготавливаемое сырье, но и к заражению емкостей, в которых собирают молоко на фермах, посуды,  инвентаря  и т.п.

Исследования по выявлению листерий  в образцах сырого молока, полученных в хозяйствах Центрального региона РФ (свыше 60 проб) показали, что 5,7% проб содержали L.monocytogenes в количестве до 100 КОЕ/см3 (табл. 2). Листерии обнаруживали на фоне высокого уровня микробной контаминации молока, санитарно-гигиенические характеристики которого свидетельствовали о неудовлетворительных условиях производства и хранения молочного сырья: уровень колиформных бактерий  колебался  в зависимости от сезона, в летне-осенний период количество БГКП в молоке достигало величин 107 – 108 КОЕ/см3 и в среднем находилось на уровне 5 х 106 КОЕ/см3; содержание бактерий рода Enterococcus превышало 104 КОЕ/см3.

                                                                               Таблица 2.

Результаты исследования сырого молока по санитарно-микробиологическим показателям и на наличие L.monocytogenes

Показатели

Частота обнаружения, %*

Количество, КОЕ/см3*

КМАФАнМ

100,0

3,9 х 107 -:- 1,8 х 108

Бактерии семейства Enterobacteriaceae

100,0

6,4 х 105 -:- 4,9 х 106

Escherichia coli

21.4 -:- 66,6

8,0 х 103 -:- 2,84 х 106

Enterococcus spp.

26,6 -:- 78,5

1,0 х 104 -:- 3,23 х 104

L.monocytogenes

5,7

< 100

* - приведенные колебания цифровых показателей отражают результаты исследований в различные сезоны года.

Роль сырого молока в передаче возбудителя на молокоперерабатывающих предприятиях очень велика. Заражение молочных продуктов, и в первую очередь сыров, как правило, происходит после пастеризации молока во время производственного процесса: L.monocytogenes и другие виды листерий, попадая с сырым молоком на завод, могут здесь обитать и размножаться, обуславливая вторичное обсеменение вырабатываемой продукции. В каждом конкретном случае заражение предприятия может происходить своим путем, который бывает довольно трудно установить, поскольку возбудитель распространен повсеместно и массивность контаминации, как правило,  зависит от санитарно - гигиенического состояния производства.

Энтерогеморрагические E.coli. Рассматривая фекальное заражение сырья как наиболее вероятный источник энтерогеморрагических E.coli, авторы многих работ приводят данные по частоте обнаружения их в пробах фекалий. Данные о частоте обнаружения E.coli O157:H7 или других энтеротоксигенных эшерихий колеблются в большом интервале (1,6 – 8,5%) и, вероятно, отражают климатические, сезонные и географические условия, различия в методиках отбора проб и проведения исследований. Взрослые животные обычно являются бессимптомными бактерионосителями и выделяют эти микроорганизмы в окружающую среду в течение длительного времени. Имеются сообщения о выделении животными в течение месяца шигатоксинпродуцирующих E.coli, патогенных для человека [Chapman P.A. et al., 1997, Brichta-Harhay D.M. et al., 2008].

Основные пути трансмиссии возбудителя и удельный вес (%) некоторых видов сырья,  пищевых продуктов и воды как факторов передачи E.coli O157:H7- инфекций показаны на рис.1. Приведенная схема в значительной мере отражает характер распространения и пути передачи большинства эмерджентных зоонозов. Очевидно, что сырые продукты, такие как мясо, молоко, овощи, фрукты и салаты из них, а также любые другие продукты, подвергнутые прямо или косвенно фекальной контаминации, или контактировавшие с зараженной водой, являются потенциальными источниками пищевых инфекций. Ферментированные продукты из сырого молока или мяса, которые вырабатываются без применения технологий, снижающих бактериальную контаминацию (например, пастеризация), также представляют опасность в санитарно-эпидемиологическом отношении.

Микробиологические исследования, проведенные в 2002-2007 гг. показали, что среди  270 штаммов энтеробактерий, выделенных из мясного сырья, полуфабрикатов и смывов, 75  относились  к виду E.coli.  Один штамм E.coli, выделенный из мясного сырья - говядины, относился к серотипу О157:Н7  (1,3 %) и обладал выраженной способностью к токсинообразованию. Этот токсигенный штамм  характеризовался типичными для энтерогеморрагических эшерихий  культуральными и метаболическими свойствами  (в том числе был сорбитнегативным и не обладал -D-глюкуронидазной активностью), что подтвердило реальную возможность контаминации пищевой продукции этими патогенными микроорганизмами.

В исследованных  образцах выделяли преимущественно  бактерии видов E.сoli (36,6%), цитратассимилирующие бактерии видов  Citrobacter braakii (14,6%) и Citrobacter freundii (7,3%),  а также Enterobacter сloacae  и aerogenes  (7,3 %), Serratia odorifera (2,4%). Кроме того,  в образцах  готовых колбас присутствовали  Hafnia alvei и Pantoea spp. (табл.3).

Таблица 3

Частота выявления различных видов энтеробактерий

Образцы сырья, полуфабрикатов и  готовой продукции

Число штаммов

Выделенные культуры, % обнаружения

E.coli

Citrobacter

Еnterobac-ter

Klebsiella

Serratia

Proteus

Говядина охлажденная

43

41,9

34,9

2,3

4,7

2,3

13,7

Говядина замороженная

3

33,0

0

0

0

0

33,3

Свинина охлажденная

5

12,5

50,0

12,5

0

0

0

Полуфабрикаты кусковые

53

39,6

34,0

11,3

1,9

7,6

5,4

Полуфабрикаты рубленые

18

33,3

38,9

12,7

5,6

0

9,5

Фарши для колбас

9

60,7

10,1

20,2

0

0

11,0

Готовые мясные изделия сырокопченые

41

36,6

22,0

7,3

2,44

4,9

0

Одновременно проводили сравнительное изучение загрязненности колиформными бактериями различных объектов: пищевых продуктов, питьевой воды, смывов с оборудования предприятий общественного питания, фекалий  взрослых и детей [Ефимочкина Н.Р. и др., 2002]. Данные о частоте обнаружения энтеробактерий приведены в табл.4.

Рис.1. Основные пути передачи ЕНЕС и удельный вес сырья,  пищевых продуктов и воды в этиологии возникновения инфекций.

  Таблица 4

Характеристика штаммов энтеробактерий, выделенных из различных объектов

                       

Объекты исследования

Количество выделенных культур (%)

В том числе:

Лактозопо-ложительных

Цитратассимилирующих

Образующих индол

С -глюкуро-нидазой

Пищевые продукты

66 (41.2%)

61

38

14  (21.2%)

10  (15,1%)

В том числе

Молоко и молочные продукты

12 (7,5 %)

10

3

5

4

Мясопродукты

8  (5,0 %)

5

3

2

7

Продукция обществ. питания

33 (20,6 %)

31

26

5

7

БАД к пище

17 (10,6%)

15

5

2

2

Объекты внешней среды

12 (7,5%)

8

2

5

5

Клинический материал

82

(51,2 %)

61

13

55

(67,1%)

51

(62,2)

ВСЕГО:

160

130 (81,2%)

53 (33%)

71 (44.3%)

67  (42%)

Количество штаммов E.coli, типичных по культурально-биохимическим признакам, в том числе обладающих способностью к образованию индола,  не превышало 45% от общего числа исследованных штаммов. Из 70 исследованных штаммов эшерихий 3 были отнесены к серогруппе О157; эти культуры были выделены из клинического материала (при анализе на дисбактериоз и из мочи), а также из одного образца кисломолочного продукта – йогурта.

Большинство выделенных штаммов E.coli  характеризовались высокой степенью патогенности, что подтверждалось наличием одного или нескольких факторов агрессии (токсинообразование, антилизоцимная, антиинтерфероновая активность, антибиотикорезистентность). Было установлено, что частота обнаружения штаммов E.сoli, обладающих антиинтерфероновой и антилизоцимной активностью,  была более чем в 2 раза выше при исследовании клинического материала, нежели при анализе продуктов питания. Вместе с тем привлекает внимание факт проявления вышеназванных признаков патогенности не только эшерихиями, но и культурами родов Klebsiella и Enterobacter. Однако в этом случае штаммов с выраженной аггрессивностью обнаруживалось больше в продуктах питания (Klebsiella – 50%, Enterobacter – 24%). Результаты серологического типирования выделенных штаммов свидетельствовали о возможной контаминации пищевых продуктов энтерогеморрагическими эшерихиями, которые при определенных условиях могут способствовать развитию заболеваний, связанных с пищевым путем передачи.

Campylobacter spp. Учитывая значительную распространенность и циркуляцию в природе кампилобактеров, большое внимание исследователей уделяется частоте обнаружения этих микроорганизмов в различных объектах. Они присутствуют в окружающей среде как комменсалы или патогены в организме домашней птицы или животных, и могут персистировать длительное время при неблагоприятных условиях. В первую очередь C.jejuni рассматривается как нормальный комменсал кишечника птиц. Степень бактерионосительства у домашней птицы очень высока и достигает 90% [Куликовский А.В., 2004]. В содержимом кишечника кур количество C.jejuni может достигать 106 КОЕ/г.

Частота обнаружения бактерий рода Campylobacter у других видов сельскохозяйственных животных и  птицы, а также в полученном от них сырье свидетельствует о значительном распространении этих микроорганизмов и о возможной контаминации вырабатываемых пищевых продуктов По данным различных авторов частота выделения кампилобактеров при обследовании мясного скота колеблется от 43 до 83%,  молочных животных  - 6 -64%, свиней – 50 - 69%, овец – 18 – 44%. Уровень обсеменения мяса домашней птицы достигает в отдельных случаях 100%, в среднем % положительных проб при исследовании тушек кур, индеек и уток составляет 58 -78% [Т. Humphrey et al., 2007].         Установлено, что при сравнительно высокой частоте обнаружения этих бактерий в разных видах мясного сырья наибольший риск для здоровья человека связан с употреблением куриного мяса, поскольку его удельный вес в структуре питания населения очень велик.

Результаты проведенных исследований показывают, что обсемененность Саmpylobacter spp. сырых птицепродуктов составила 37% (42 из 113), при этом  Саmpylobacter наиболее часто обнаруживали в мясе и полуфабрикатах птицы натуральных, а также в субпродуктах, обсемененность которых составила 40% и 35% соответственно.

Salmonella spp. Для большинства зоонозных  инфекций, в том числе для сальмонеллеза и кампилобактериоза, первостепенное значение имеет загрязнение сырья интестинальным содержимым при его производственной разделке и обработке. При этом уровень вторичной контаминации готового продукта находится в прямой зависимости от интенсивности заражения и степени бактерионосительства птиц и животных. По данным ФДА частота выделения сальмонелл в США в среднем составляла 5% от общего количества  (более 4000) исследованных проб пищевого сырья [Shao-hua Jhao et al., 2003, Foley S.L. et al., 2008]. Контаминированное куриное мясо идентифицируется как один из основных пищевых источников бактерий рода Salmonella. При исследовании более 200 цыплят – бройлеров сальмонеллы были выделены в 23% случаев, при изучении загрязненности куриного мяса – сырья было обнаружено, что более 19% тушек бройлеров обсеменено бактериями рода Salmonella, 32% проб  -  C.jejuni, и около 20% - L. monocytogenes [Whyte P. Et al., 2002, van Nierq W. et al., 2005].

Тем не менее, собственные исследования 48 образцов мяса кур и субпродуктов, отобранных на предприятиях оптового продовольственного комплекса Московского региона, показали отсутствие бактерий рода Salmonella (в 25 г продукта). В тех же образцах L.monocytogenes были обнаружены в 3,9% случаев, а  C.jejuni – в более 50% проб.

Обобщение сравнительных  данных о частоте выделения некоторых видов эмерджентных патогенных бактерий показывает, что  они характеризуются высокой степенью распространения в продовольственном сырье, поскольку являются зоонозными микроорганизмами и могут присутствовать в организме сельскохозяйственных животных и птиц (табл. 5).

Таблица 5

Частота выделения некоторых видов эмерджентных пищевых патогенов, %

Патогены

Навоз или содержимое ЖКТ крупного  рогатого скота и птицы

Говядина и птица (сырье)

Молоко-сырье

Salmonella spp.

5,0

до 19 - 23

6,1

Campylobacter jejuni

до 90

32,0

9,2

Энтеротоксигенные E.coli

1,6 – 8,5

4-16

3,8

L.monocytogenes (Listeria spp)

-

1,7-3.2  (20,0)

4,6

Таким образом, проведенные исследования вышеназванных патогенов позволили выявить экологическое своеобразие этих возбудителей, которое определяется специфическими закономерностями их распространения, детерминированностью источников выделения, вариабельностью уровней контаминации и частоты выделения.  Неудовлетворительные условия получения, первичной обработки и хранения сырья  становятся  основной причиной интенсивного накопления широкого спектра условно патогенной и патогенной микрофлоры, на фоне которого возможно присутствие наиболее опасных возбудителей пищевых инфекций, в том числе энтерогеморрагических E.coli, сальмонелл, C.jejuni, L.monocytogenes и др. Дальнейшая переработка такого сырья сопровождается перекрестной контаминацией  и  попаданием возбудителей в готовые продукты, обуславливая высокую степень риска даже при соблюдении технологических режимов производства и хранения пищевой продукции. В свою очередь имеющие место нарушения традиционной технологии и внедрение новых, порой недостаточно изученных способов переработки, упаковки и хранения продуктов и полуфабрикатов являются не менее важными факторами риска обнаружения новых патогенов.

2. Оценка роли L.monocytogenes  как одного из наиболее значимых новых патогенов

На современном этапе одной из наиболее актуальных задач обеспечения  микробиологической  безопасности пищевых продуктов  является снижение  риска возникновения пищевого листериоза – заболевания, вызываемого  бактериями Listeria monocytogenes. Решение данной  проблемы связано с необходимостью совершенствования методологии выделения и идентификации возбудителя, разработки эффективных ускоренных способов обнаружения L. monocytogenes в пищевых продуктах, основанных на применении современных методов анализа.

Существующие  данные об обнаружении листерий в пищевых продуктах весьма противоречивы и свидетельствуют как о разных частоте и уровнях  выявления L. monocytogenes, так  и о большой распространенности наиболее  близких к ним по фенотипическому  профилю бактерий L.innocua. При этом используются различные методические схемы идентификации  листерий, что затрудняет сопоставление полученных данных и существенно усложняет анализ эпидемиологической ситуации.

2.1. Межвидовая дифференциация и изучение фенотипических свойств листерий

Начиная с 2000 года проведена многоплановая работа, включающая изучение свойств листерий, скрининг новых штаммов L.monocytogenes и создание коллекции отечественных культур, персистирующих в пищевых продуктах, сырье и объектах внешней среды продовольственных предприятий. Для накопления данных о циркуляции различных видов листерий на основных стадиях пищевой цепи выполнены исследования с использованием традиционных методов бактериологического и биохимического анализа, позволяющих проводить выявление и видовую дифференциацию выделенных штаммов путем оценки ключевых фенотипических свойств микроорганизмов рода  Listeria.

Всего проанализировано свыше 200 культур, выделенных из мясного и молочного сырья, полуфабрикатов, готовых мясопродуктов, сыра, творога, и различных объектов внешней среды (смывы с оборудования, инвентаря, посуды и др.).  По результатам родовой идентификации к листериям были отнесены 125 штаммов,  которые имели типичные морфологические и культурально-биохимические свойства. Исследованные штаммы по комплексу изученных свойств были отнесены к 4 видам: L.monocytogenes – 48 штаммов, L.innocua – 69 штаммов, L.welshimeri – 6 штаммов , L.ivanovii – 2 штамма.

Все культуры L.monocytogenes обладали гемолитической активностью, формируя на поверхности кровяного агара зоны просветления, интенсивность которых варьировала в зависимости от свойств штамма (от очень слабого до умеренного или хорошо выраженного -гемолиза). У слабо гемолизирующих штаммов активность культур усиливалась после нескольких пассажей на кровяном агаре. Штаммы L.innocua и L.welshimeri не обладали гемолитической активностью, рост L.ivanovii на кровяном агаре сопровождался  образованием широких зон лизиса диаметром 3 мм и более. Лецитиназная активность была четко выражена у всех штаммов L.monocytogenes и L.ivanovii,  тогда как  листерии видов L.innocua и L.welshimeri не проявляли этого признака при культивировании на хромогенных средах и в присутствии  активированного угля.

Все изученные штаммы L.monocytogenes не сбраживали ксилозу, маннит, лактозу, сахарозу и арабинозу; ферментировали с образованием кислоты (без газа) рамнозу, глюкозу и галактозу (табл. 6). Гидролиз сорбита, лактозы и мальтозы был непостоянным и определялся индивидуальными особенностями штаммов. По совокупности изученных признаков была подтверждена наибольшая информативность ферментативных тестов в отношении 3 углеводов – ксилозы, рамнозы и маннита, позволяющая проводить видовую дифференциацию L.monocytogenes от непатогенных листерий. Некоторые отклонения в сахаролитической активности тех или иных культур, подвижности, степени выраженности гемолиза, а также способности диссоциировать в стареющих культурах нередко отмечаются различными исследователями и характерны для внутривидовой изменчивости штаммов [Hammer P. et al., 1989, Карликанова С., 1994]. 

Таблица 6

Ферментативная активность выделенных штаммов листерий

Виды листерий

Ферментация углеводов

Ксилоза

Рамноза

Маннит

Арабиноза

Галактоза

Глюкоза

Лактоза 

Мальтоза

Сахароза

Сорбит 

Выделенные штаммы

L.monocytogenes

-

+

-

-

+

+

±

±

-

±

L.innocua

-

±

-

±

+

+

-

±

-

±

L.welshimeri

+

±

-

-

-

+

-

+

-

±

L.ivanovii

+

-

-

-

±

+

±

-

-

+

Коллекционные штаммы

L.monocytogenes 10527

-

+

-

-

+

+

-

+

-

-

L.monocytogenes № 766

-

+

-

-

+

+

-

+

-

+

При тестировании выделенных культур листерий с использованием наборов для идентификации «API Listeria» ф.«BioMerieux» были подтверждены вышеописанные результаты типирования штаммов традиционными бактериологическими и биохимическими методами, при этом сходимость полученных данных в эксперименте превышала 95%.

На основе анализа зарубежного опыта и обобщения накопленных экспериментальных материалов разработаны и введены в действие Методические указания 4.2.1122-02 «Организация контроля и методы выявления и определения бактерий Listeria monocytogenes в пищевых продуктах» и ГОСТ Р 51921-2002 «Продукты пищевые. Методы выявления и определения бактерий Listeria monocytogenes». Этими документами регламентируется применение вышеописанных бактериологических и биохимических тестов, позволяющих проводить выделение и идентификацию листерий по комплексу основных родовых и видовых фенотипических признаков.

2.2. Cовременный комплексный подход к идентификации листерий при микробиологическом контроле на предприятиях пищевой индустрии

Освоение высокоспецифичных комбинированных методов  быстрой идентификации и типирования направлено на создание современных схем эффективного мониторинга за L. monocytogenes в продуктах питания на этапах их изготовления и хранения,  получение более достоверных сведений о циркуляции этого возбудителя на предприятиях пищевой индустрии.

С этой целью проведена разработка методологии детекции патогенных листерий на основе комплексного применения традиционных и новых методов анализа.  Работа включала подбор и сравнительную оценку стандартизованных микробиологических и биохимических методов в сопоставлении с молекулярно–генетическими методами. При этом изучали информативность и диагностическую значимость отдельных тестов идентификации листерий, определяли эффективность и чувствительность различных модификаций методов генотипирования и возможность их практического применения для экспресс-индикации L.monocytogenes.

Метод иммуномагнитной сепарации. Изучена возможность применения иммуномагнитной сепарации (IMS) при исследовании пищевых продуктов на наличие Listeria monocytogenes в различных вариантах предварительного обогащения проб с использованием  тест-наборов «Listeria A-Beads» («Aureon Biosystems»).

В модельных экспериментах за счет IMS удавалось достигнуть 10-100 кратного концентрирования тест-микроорганизма, продолжительность процедуры при этом составляла 30-40 мин (табл.7).

                                                                               Таблица 7

Выявление L. monocytogenes в  суспензиях, обработанных методом IMS

Расчетная концентрация тест-культур в пробах, lg КОЕ/см3

Содержание листерий, выявленное микробиологическим посевом,  lg КОЕ/см3  (n = 4)

L. monocytogenes

L.innocua

До сепарирования

После сепарирования

1,0

-

-

-

2,0

-

0,9 + 0,3

1,6 + 0,51

3,0

-

2,60 +  0,27

3,36 + 0,33

4,0

-

3,61 +  0,44

5,15 + 0,79

-

3.0

3,09 + 0,55

-

-

4,0

4,08 + 0,35

-

Отмечено, что жизнеспособность клеток L. monocytogenes до и после сепарирования достоверно не изменялась. При оценке микро-  и макроморфологии тест-штамма, а также скорости роста культуры установлено, что IMS не оказывает ингибирующего воздействия на L.monocytogenes и не меняет их культуральных свойств. Подтверждена специфичность метода: штаммы листерий вида L.innocua не взаимодействовали с индикаторными антителами, сенсибилизированными на магнитном носителе.

Получены сопоставимые результаты при использовании двух различных схем селективного обогащения L.monocytogenes при низком уровне контаминации (102 КОЕ/г) – 1-стадийной с последующей IMS  и  традиционной, предусматривающей двойное селективное обогащение посевов [Ефимочкина Н.Р. и др., 2003]. Включение в схему микробиологических исследований пищевых продуктов по показателю  L. monocytogenes методики иммуномагнитной сепарации позволяет сократить время анализа до 4 суток в сравнении с классическим методом, продолжительность которого составляет  не менее 6-7 суток.  Данная схема может быть  использована при разработке ускоренных методов определения L.monocytogenes в пищевых продуктах.

Метод ДНК-гибридизации. Исследована возможность определения L.monocytogenes в  пищевых продуктах методом  твердофазного гибридизационного метода ДНК-рРНК анализа с хемилюминесцентным детектированием в системе «LUMIProbe 24» (Франция). Мишенью в реакции ДНК - гибридизации  являлась последовательность ДНК, кодирующая продукцию  токсичного белка  листериолизина.

Для оценки специфичности метода проведены исследования по видовой идентификации L. monocytogenes  с использованием штаммов листерий как в монокультурах, так и  смесях различных представителей  рода. Результаты показали высокую специфичность (100%) и чувствительность метода. Данные были получены при анализе 11 штаммов L. monocytogenes и 14 штаммов листерий других  видов - L. ivanovi, L. innocua, L. welshimeri. При оценке чувствительности метода с использованиием двух референс-штаммов L. monocytogenes было показано, что достоверная детекция возбудителя  достигается при плотности бактериальной суспензии не менее 5х105- 1х106 КОЕ/см3. При меньших концентрациях клеток L. monocytogenes в испытуемых пробах  величины люминесценции находились ниже или на уровне пороговой величины измерений.

Таким образом установлена возможность использования  метода твердофазного ДНК-рРНК гибридизационного анализа с хемилюминесцентным детектированием для подтверждения видовой принадлежности штаммов L.  monocytogenes, выделенных из пищевых продуктов и других объектов.

Для оценки эффективности  метода ДНК-гибридизации  при прямом выявлении L.  monocytogenes в пищевых продуктах и объектах окружающей среды проводили экспериментальную контаминацию проб коллекционными штаммами L.  monocytogenes. Контаминированные пробы инкубировали двукратно в течение 6 и 18 часов в бульоне Фрейзера и в RM Listeria бульоне, входящим в состав тест-наборов «LUMIProbe» и исследовали на наличие листерий (табл. 8).

                                                                               Таблица 8

% открываемости проб продуктов,  контаминированных L.monocytogenes

Объекты исследования

Дозы контаминации, КОЕ/г (см3)

Результаты анализа,% (n=5)

Методом ДНК - гибридизации

Бактериологическим

методом

Рыбные продукты

101

96,5

95,4

102

100

100

Салат «Столичный»

101

85,0

85,0

102

100

96,7

103

100

100

Фарш куриный

101

84,7

84.7

102

100

90,0

103

100

100

Молоко сырое

101

85,8

85.8

102

96,7

86,0

103

100

100

Кисломолочные продукты

101

100

100

102

100

100

Сыры «адыгейский», «сулугуни», брынза

101

67,0

67,0

102

100

100

Анализ полученных данных показал, что метод ДНК-РНК гибридизации с наборами «LUMIProbe» позволяет определить наличие L.  monocytogenes при уровнях исходной контаминации 10-100 КОЕ/г. Результаты исследований позволили разработать и впервые в России внедрить стандартизованный метод выявления бактерий Listeria  monocytogenes в пищевых продуктах на основе гибридизационного ДНК-анализа (МУК 4.2.1955-05).

Применение метода ПЦР для изучения L.  monocytogenes.  Сравнительное изучение существующих методов детекции эмерджентных пищевых патогенов позволяет  выделить в качестве наиболее перспективного направления в генодиагностике L. monocytogenes применение различных форматов постановки полимеразной реакции (ПЦР).

В работе использовали Taq-полимеразу и другие реагенты производства фирмы «Бионем». Праймеры для родовой и видовой идентификации были синтезированы в ГУ НИИЭМ им. Н.Ф. Гамалеи (табл.9). Амплификацию проводили в термоциклере «Терцик». Режимы амплификации:

для пары prs 1- prs 2 – 94С- 2 мин., 5 циклов: 94С – 5c, 42С – 5c, 72С – 5c, затем 25 циклов - 94С – 1c, 42С – 1c, 72С – 1c.

для пары Plc 1- Plc 2 - 94С – 2мин., затем 5 циклов: 94С – 5c, 55С – 5c, 72С – 5c, затем 25 циклов - 94С – 1c, 55С – 1c, 72С – 1c.

для пары Act 1- Act 2 –  94С – 2мин., затем 5 циклов: 94С – 20с., 60С – 20с., 72С – 20с и еще 30 циклов: 94С – 5с, 60С – 5с, 72С – 5с.        

                                                                                Таблица 9

Праймеры для идентификации L.monocytogenes

Наименование праймера

Нуклеотидный состав праймера

Prs 1

GCATTGCGTGAAGCTGGCGCAAC

Prs 2

CAGAAGCATTTTCATGAAC

Plc 1

AGGGGGCCATTTTGTATAAG

Plc 2

ATCGTTGCTGTTTTGCTCGT

Act 3

CATGCGGTCGACCAGTATTCGGCGGG

Act 4

TCTGTTGGATCCCACTTATACTCCC

Амплифицированные фрагменты ДНК анализировали гель-электрофорезом в 1% агарозном геле в трис-ацетатном буфере в присутствии 5 мкг/мл бромистого этидия. Результаты учитывали путем окраски и выявления окрашенных ампликонов  в УФ-свете (254нм), оценивая молекулярную массу полученных участков ДНК в сравнении со стандартными  маркерами (100 bp DNA  Ladder).

В качестве объектов исследования были выбраны различные образцы мясных продуктов, полуфабрикатов, мясного сырья,  и смывы с технологического оборудования и инвентаря (всего 143 пробы). По результатам первичных посевов было выделено 49 культур, которые по культурально-морфологическим и биохимическим свойствам (типичный рост на Оксфорд или ПАЛКАМ-агаре, подвижность при 220C, наличие каталазы, отсутствие ферментации маннита) были отнесены к роду Listeria. При проведении видовой идентификации выделенных культур рода Listeria  24  штамма соответствовали культуральным и биохимическим характеристикам L.monocytogenes: они ферментировали рамнозу и маннозу, но не сбраживали маннит и ксилозу, и по остальным  тестам API Listeria были типичны. Из них  только 9 (37,5 %) образовывали четкие зоны β-гемолиза. Эти же культуры обладали выраженной лецитиназной активностью на среде с добавлением желточной эмульсии в присутствии активированного угля.  Ранее было показано [Ermolaeva S. et al., 2003], что секретируемый листериями продукт, выполняющий функции авторепрессора синтеза лецитиназы, может быть устранен из среды гидрофобным сорбентом, в частности активированным углем. При этом происходит активация генов патогенности и, как следствие, увеличение уровня экспрессии лецитиназы в среду. Использование данного теста позволяет дифференцировать  L.monocytogenes от другого вида – L.ivanovii,  синтез фосфолипаз которым не зависит от присутствия в среде авторепрессора.

Вышеописанные культуры L. monocytogenes были выделены из смывов с оборудования и инвентаря (конвейеры, пилы, рабочие столы, разделочные ножи, доски)  - 8 штаммов и из свинины-сырья - 1 культура. Штаммы листерий, не обладающие гемолитической и лецитиназной активностью, по совокупности признаков были отнесены к виду L.innocua. Кроме того, фенотипическим характеристикам этого вида соответствовали еще 23 культуры, выделенные из фарша, полуфабрикатов, сырья для производства сырокопченых и сыровяленых колбас, смывов, а также из готовых продуктов. Приведенные данные свидетельствуют о том, что наибольшее число  выделенных культур листерий – 77.6% относится к виду L. innocua. Три штамма, выделенные из смывов, были идентифицированы как L. welshimeri.  Листерии видов L.ivanovii, L.seeligeri, L.grayi обнаружены не были.

Для идентификации  многих  микроорганизмов, в том числе «пищевых» патогенов,  в настоящее время наиболее  надежным признается комплексный подход, основан

ный на комбинировании молекулярно-генетических методов с тестированием наиболее специфичных фенотипических признаков рода, вида или серотипа.  В отношении патогенных микроорганизмов, имеющих близких непатогенных представителей в пределах рода,  к которым относятся  L.monocytogenes,  подбор наиболее информативных биохимических тестов  и ДНК-зондов для идентификации должен основываться на определении именно патогенетических признаков,  а не только метаболических свойств, большинство которых в пределах рода кодируются консервативными участками генома. При оценке фенотипа L.monocytogenes  такими признаками являются подвижность, способность к гемолизу,  наличие специфичных лецитиназ; при генотипировании – это индикация  участков генома, определяющих выработку гемолизинов и фосфолипаз, факторов инвазии и цитотоксичности. 

Дальнейшее изучение выделенных культур листерий проводили методом ПЦР с родоспецифическими и видоспецифическими праймерами. Для подтверждения родовой принадлежности использовали праймеры prs1 и prs2, направляющие синтез фрагмента гена, кодирующего консервативный для рода Listeria белок фосфорибозилпирофосфатсинтазу, участвующий в общем метаболизме бактериальной клетки. Подбор видоспецифических праймеров проводили путем выделения фрагментов ДНК, участвующих в кодировании наиболее значимых для L.monocytogenes факторов вирулентности. Для видовой дифференциации использовали две пары праймеров:  act3-act4 – амплифицирующих участок гена, ответственного за синтез поверхностного белка АстА, индуцирующего полимеризацию актина и обеспечивающего способность к движению возбудителя в цитоплазме инфицированных клеток;  plс1-plс 2, направляющих амплификацию гена PlcA – фосфатидилинозитол специфичной фосфолипазы С.

Результаты ПЦР - анализа культур полностью соответствовали данным микробиологических исследований в части родовой идентификации листерий. Положительные результаты ПЦР с видоспецифическими для L.monocytogenes  парами праймеров Аct3 - Аct4 и Рlс1-Рlс2 были получены только у штаммов, обладающих лецитиназной и гемолитической активностью, что безусловно подтверждает диагностическую значимость этих тестов.  Из 24 штаммов, первоначально (по данным тестирования с применением «API Listeria») отнесенных к L.monocytogenes, по результатам ПЦР-анализа подтверждена принадлежность к данному виду только 8-ми штаммов. Все они при этом обладали - гемолитической и лецитиназной  активностью.

Применение  комбинированного подхода к идентификации бактeрий рода Listeria на основе использования наиболее информативных фенотипических тестов и ПЦР-анализа с праймерами на участки генов, кодирующих факторы патогенности листерий,  позволило сократить в три раза число культур, изначально признанных как L. monocytogenes по комплексу биохимических признаков. Положение о том, что  только выявление участков ДНК возбудителя,  кодирующих факторы патогенности, является достоверным критерием принадлежности к «эмерджентным» патогенам, было доказано также сопоставлением с другим молекулярно-биологическим методом – ДНК- гибридизации, где целевым являлся ген, кодирующий синтез листериолизина – одного из  основных  факторов  вирулентности  L.monocytogenes. Это подтверждается 100% специфичностью метода ДНК-рРНК гибридизации при определении видовой принадлежности L. monocytogenes.

Проведенные сравнительные методические исследования позволили разработать принципиально новый комплексный подход к идентификации бактeрий L. monocytogenes путем комбинирования наиболее информативных фенотипических тестов, характеризующих патогенетические свойства данного возбудителя, и ПЦР-анализа с праймерами на участки генов, направляющих экспрессию этих  факторов патогенности (рис.2).

Рис.2. Биохимические и генетические тесты идентификации L. monocytogenes

Предлагаемый комбинированный метод индикации бактeрий L. monocytogenes включает следующие основные этапы:

  • подготовка проб пищевых продуктов (измельчение и гомогенизация твердых субстратов в физиологическом растворе, нейтрализация продуктов до рН 7,0-7,5 1N раствором NaOH);
  • первичное обогащение – инкубирование в бульоне Фрейзера концентрации в течение 24 часов при температуре 30±1С (25 cм3 образца в 225 cм3 среды);
  • вторичное обогащение – инкубирование в бульоне Фрейзера в течение 24-48 часов при температуре 36±1С (0,1 cм3 образца в 9 cм3 среды), или проведение IMS;
  • высев на поверхность селективно-диагностических сред (ПАЛКАМ или Окфорд-агар), инкубирование в течение 24-48ч при 36±1С;
  • отбор 5 характерных колоний,  пересев их на триптон-соевый агар с дрожжевым экстрактом (TSYEA) и одновременно - на поверхность хромогенных сред (ALOA или Rapid L’mono или лецитин-агар) и кровяного агара; инкубирование в течение 24 ч при 36±1С;
  • проведение ПЦР-анализа скультурами листерий, продуцирующими гемолизин и лецитиназу, с праймерами к генам PlcA и ActA.

В лабораториях, оснащенных системой «Люмипроб», возможно проведение экспресс-идентификации выделенных культур методом ДНК-гибридизации с хемилюминесцентной детекцией. Данный анализ может проводиться как в варианте прямого выделения возбудителя из пищевых продуктов, так и в  качестве подтверждающего теста при исследовании L. monocytogenes. 

Разработанная в результате проведенных исследований схема  (рис.3) положена в основу арбитражного экспресс-метода выявления и видовой идентификации  L.monocytogenes,  который включен в проект Санитарных правил «Порядок учета и расследования пищевых отравлений и вспышек заболеваний с пищевым путем передачи».

Выделение и ускоренная идентификация L.monocytogenes

Навеска  продукта 25г

225 мл среды первичного обогащения

                       инкубация 24ч

                                  при 30±1С

0,1 мл

9мл среды вторичного обогащения

               инкубация 24-48ч

                при 36±1С

селективно-диагностическая среда

инкубация 24-48ч при 36±1С 

  кровяной агар (β-гемолиз) лецитин-агар

инкубация 24-48ч при 36±1С инкубация 24-48ч при 36±1С

  Подращивание культуры для ПЦР

инкубация 12-24ч при 36С

 

Проведение ПЦР-анализа

с праймерами к генам PlcA и ActA

 

Анализ результатов и выдача ответа

Рис.3. Ускоренная идентификация L.monocytogenes

2.3. Экспериментальное изучение некоторых закономерностей выживания и размножения листерий в модельных системах

Для выявления механизма и условий выживаемости L.monocytogenes, а также с целью разработки предупредительных мер на предприятиях пищевой промышленности особое значение имеет изучение факторов, влияющих на жизнедеятельность листерий, которое может быть выполнено только путем экспериментального моделирования процессов производства и хранения различных видов продуктов.

Влияние тепловой обработки на L.monocytogenes

Многочисленные экспериментальные работы  посвящены определению возможности выживания листерий в процессе пастеризации молока, поскольку чувствительность L.monocytogenes к тепловому воздействию трактуется авторами по-разному и порой противоречиво. Имеются сообщения о том, что листерии обладают повышенной устойчивостью к тепловой обработке, выдерживая общепринятые в сыроделии режимы кратковременной пастеризации молока [Карликанова Н.Р. и др., 1999]. Это положение подкрепляется известными данными о выживании L.monocytogenes в качестве факультативно интрацеллюлярного микроорганизма в фагоцитарных клетках, создающих защитную систему от внешних воздействий и тем самым снижающих чувствительность бактерий к тепловому воздействию, то есть высокая термоустойчивость L.monocytogenes объясняется их внутриклеточным паразитированием [Farber  J.M., 1989].

Изучение возможности выживания листерий при тепловой обработке молока проводили, используя общепринятые в отечественном сыроделии температурные режимы пастеризации, а именно: 70 -:- 72оС с выдержкой от 20 до 25 с (режим 1); 76оС с выдержкой от 20 до 25 с (режим 2). Эффективность режимов пастеризации в значительной степени определялась исходным уровнем L.monocytogenes в молоке (рис.4). При содержании 103 КОЕ/см3 и менее повышенная температура прогрева – 76оС в течение 20с оказывалась достаточной для подавления бактериальных клеток листерий. При  72оС с той же выдержкой наблюдалась значительная инактивация листерий под влиянием тепловой обработки, однако жизнеспособные клетки в таком молоке все-таки сохранялись в небольшом количестве. При массивном исходном обсеменении молока листериями в количестве 105 и тем более 108 КОЕ/см3  регламентированные в сыроделии режимы пастеризации оказывались недостаточно эффективными, обеспечивая лишь некоторое снижение числа жизнеспособных клеток.

Рис.4. Влияние температурных режимов пастеризации молока на L.monocytogenes.

Более эффективной в этом отношении была двойная тепловая обработка молока, включающая первоначальную термизацию (при 65оС с выдержкой 20 – 25 с)  и через 16 – 20 ч - обычную пастеризацию  при 72оС в течение 20 с (рис.5). Применение двойной тепловой обработки обеспечивало бактерицидный эффект в отношении листерий даже при массивном обсеменении ими молока в количестве 105 КОЕ/см3. Такая значительная контаминация редко бывает в естественных условиях. Однако при резервировании сырого молока при низких температурах возможно увеличение числа попавших в него листерий до того уровня, который изучали в данном эксперименте. Поэтому применение термизации молока с последующей его пастеризацией создает определенные предпосылки для защиты перерабатываемого сырья от развития в нем L.monocytogenes.

Рис.5. Влияние двойной тепловой обработки молока на L.monocytogenes

Изучение выживаемости L.monocytogenes в молоке при длительном хранении

Изучение условий роста и выживания листерий в процессе длительного хранения молока проводили с использованием двух коллекционных штамма L.monocytogenes, которые выдерживали в течение 4 – 7 мес при температуре 4 - 8оС. Наряду с определением основных культурально-морфологических признаков штаммов через 1, 2, 3 и 6 мес хранения ставили биопробу, заражая белых мышей исследуемым материалом.

Установлено очень длительное (в течение 7 месяцев и более) выживание листерий в молоке, необычное для вегетативных форм микроорганизмов. В то же время на других питательных субстратах выживаемость листерий была самой обычной и не превышала 2 – 3 месяцев.

Патогенность  штаммов листерий в процессе хранения в молоке постепенно снижалась и к 6-7 месячному периоду они полностью становились непатогенными. По мере старения культур отмечались изменения их тинкториальных, морфологических и культурально-биохимических признаков: терялись подвижность и восприимчивость к окраске по Граму, при культивировании на МПА появлялись укрупненные, шероховатые R-формы, в микроскопических препаратах наблюдали некоторое увеличение размера клеток, появление цепочек или длинных нитей, а при посевах на кровяной агар – снижение или полную потерю гемолитической активности штаммов в 2 – 3 месячном возрасте. Кроме того, регистрировали некоторые сдвиги в гидролитических свойствах хранившихся культур листерий в части утраты способности ферментировать некоторые виды углеводов (галактозу, рамнозу, сахарозу).

Наблюдаемые изменения характерны для стареющих культур листерий, они являются одним из признаков изменчивости микроорганизмов и должны учитываться при установлении видовой принадлежности штаммов L.monocytogenes, выделяемых при исследованиях сырья и пищевых продуктов длительного хранения. 

Чувствительность листерий к неблагоприятным воздействиям среды

Серия экспериментов по изучению воздействия некоторых факторов на рост и жизнеспособность L.monocytogenes включала наряду с тепловой обработкой оценку влияния рН среды, антагонистической активности молочнокислых бактерий или их субстратов и др.

При величине рН 5.2 обезжиренного молока, установленного добавлением молочной кислоты, происходило довольно активное развитие L.monocytogenes (увеличение числа клеток на 1.5 – 2 порядка). Почти при том же значении рН, но в гидролизате казеина с уксусной кислотой наблюдалось значительное подавление роста листерий (в среднем на 2 порядка). Практически полное ингибирование роста культуры L.monocytogenes наблюдалось при внесении ее в инактивированную культуральную среду L. acidophilus при рН 3,9 – 4,0. Это бактерицидное влияние проявлялось особенно наглядно в сравнении с жизнеспособностью листерий в обезжиренном молоке с той же кислотностью, но в присутствии молочной кислоты. Это позволяет предполагать, что наряду с низкой кислотностью в субстрате с L. acidophilus  проявлялось бактерицидное действие на листерии антибактериальных веществ, продуцируемых ацидофильной палочкой. 

Анализ данных  о характере воздействия различных физико-химических и биологических факторов в отношении L.monocytogenes определили необходимость оценить способность листерий выживать в присутствии молочнокислых микроорганизмов, обладающих антагонистическими свойствами с использованием модели совместного культивирования в соевом субстрате, используемом в производстве новых видов ферментированных продуктов. В зараженное листериями молоко вносили заквасочные культуры  лактобактерий (L.fermentum и L.rhamnosus) в количестве 104, 106 и 108 КОЕ/см3.

Результаты совместного культивирования листерий и заквасочной микрофлоры при параметрах, имитирующих нарушения технологического процесса ферментации соевого молока,  показаны на рис.6. Заражение соевого молока бактериями L.monocytogenes в количестве 100  и 10  КОЕ/см3 не приводило к ингибированию возбудителя даже при высоких уровнях содержания заквасочной микрофлоры. При меньшей расчетной дозе листерий 1 КОЕ/см3 обнаружить L.monocytogenes удавалось  в 66 % проб после 6 и 24 часов термостатирования. Во всех исследованных вариантах опыта  снижение концентрации молочнокислых микроорганизмов и, соответственно, замедление процесса ферментации обеспечивали более благоприятные условия для выживания и накопления возбудителя.

Рис. 6. Ингибирование роста листерий заквасочной микрофлорой

Используя модель «ассоциативного роста», проведено сравнительное изучение особенностей размножения не только листерий, но и других видов эмерджентных патогенов, в частности энтерогеморрагических E.coli (штамм № 1330, серотипа О157:Н7).

При экспериментальной контаминации сырья энтеротоксигенным  штаммом E.coli cеротипа О157:Н7 в дозе 100 КОЕ/см3 ингибирования роста возбудителя не удавалось достигнуть как при низких, так и при высоких уровнях заквасочной микрофлоры (рис.7). При малых дозах заражения – 1 - 10 КОЕ/см3 степень выживания E.coli зависела от концентрации молочнокислых микроорганизмов в среде и активности процесса кислотообразования. Рост  E. coli после 6 ч ферментации отсутствовал в 52% проб, а к концу наблюдения (24 ч) ингибировался только в тех вариантах, содержание молочнокислых микроорганизмов в которых составляло не менее 108 КОЕ/см3.

Таким образом установлено, что в процессе ферментации при заданных параметрах сквашивания и высоких уровнях  заквасочной микрофлоры отмирание L.monocytogenes и E.coli О157:Н7 идет интенсивнее, чем при снижении активности заквасок, что может быть обусловлено как антагонистическими свойствами  штаммов закваски в отношении патогенов, так и быстрым повышением уровня кислотности среды модельного продукта.

В целом полученные данные подтверждают предположение о высокой устойчивости  эмерджентных патогенов  с генетически закрепленными факторами вирулентности  к воздействию внешней среды и о их способности  выживать в среде с наличием технологической заквасочной микрофлоры, что указывает на необходимость более жесткого микробиологического контроля ферментированных  продуктов.

Рис.7. Ингибирование роста E.coli 1330 заквасочной микрофлорой

По оси ординат - % проб, в которых после 6 или 24 ч ферментации не обнаружены  L. monocytogenes и E.coli.

Исследование взаимодействия L.monocytogenes и других эмерджентных патогенов с  антагонистически  активной микрофлорой пищевых продуктов

Приведенные данные о характере воздействия разнообразных физико-химических и биологических факторов в отношении L.monocytogenes обусловили проведение специальных исследований по изучению способности некоторых микроорганизмов проявлять антагонистические свойства в сложном биоценозе не только с листериями, но и с другими патогенными микроорганизмами – возбудителями эмерджентных пищевых инфекций. Наибольшее значение в этом плане придается молочнокислым бактериям с выраженным антимикробным действием и выделенным из них субстанциям, которые могут использоваться для коррекции микрофлоры желудочно-кишечного тракта, лечения и профилактики целого ряда заболеваний, что рассматривается в настоящее время как одно из перспективных  направлений и в медицине, и в ветеринарии, и в животноводстве.

В связи с этим в 2007-2008 г.г. проведена работа по поиску и отбору антагонистически активных штаммов лактобактерий (LAB). Выделение LAB проводили из продуктов непромышленного производства, для изготовления которых традиционно используются методы микробной ферментации заквасочными культурами, полученными из естественных источников. Всего было исследовано свыше 200 образцов продуктов из 7 областей и регионов, территориально удаленных друг от друга и различающихся по климатическим и экологическим условиям, имеющим местные особенности в структуре питания населения. В процессе работы было выделено и идентифицировано 66 штаммов микроорганизмов, отнесенных к 4 родам молочнокислых бактерий.

Наиболее часто в ферментированных молочных продуктах обнаруживали микроорганизмы рода Lactococcus (50 %). Бактерии родов Leuconostoc и Lactobacillus  преимущественно выделяли из сыров и овощных продуктов  (100%  и 70,6%  выделенных штаммов, соответственно).

Анализ таксономической принадлежности исследованных штаммов показал большое разнообразие выделенных видов LAB, включающих представителей  практически всех известных филогенетических групп лактобактерий в соответствии с общепринятой  классификацией, основанной на комплексной оценке фенотипических свойств и данных  16s rРНК-гомологии [Vandamme P. et al., 1996, Шабанова Н.А. и др., 2009]. Наиболее часто антагонистически активные LAB относились к группе гомоферментативных лактобактерий группы L.delbrueckii – 6 штаммов из 16, 5 штаммов по результатам идентификации были отнесены к факультативно гетеротрофным лактобактериям группы  L.casei.

Наибольшую антагонистическую активность проявляли штаммы Lactobacillus helveticus L8  и Lactobacillus curvatus L4 (табл.10). Эти штаммы обладали широким спектром ингибирующего действия практически на все изученные тест-культуры патогенных микроорганизмов. Наиболее выражен был антагонизм L. helveticus и L. curvatus в отношении патогенных L.monocytogenes. Достаточно высокий уровень активности был также отмечен у штамма L.fermentii (L1/1), выделенного из творога, произведенного в Ростовской области. Антимикробное действие данного штамма проявлялось в отношении  L.monocytogenes, Salmonella, E.sakazakii.

                                                                               Таблица 10

Антагонистическая активность выделенных штаммов LAB

Исследованные штаммы LAB

Тест  - культуры (диаметр зон задержки роста, мм, n =4)

L. monocytogenes 766

Salmonella typhimurium

E.coli O157:H7

E.coli

M-17

Enterobacter sakazakii

Lactobacillus fermentii L1/1

11,0 + 0,5

9.5 + 0,2

0

9.5 + 0,3

10.0 + 0,5

Lactococcus lactis L14

-

-

10.5 + 0,5

21.0 + 1,0

-

Lactobacillus curvatus L4

16.5 + 2,0

-

11,0+ 0,5

15,2+ 0,4

10,8 + 0,6

Lactobacillus helveticus L8

13,6 + 1,2

10,3 + 0,75

11,75 + 0,8

9.5 + 0,5

9.5 + 0,3

Lactobacillus acidophilus L5

-

н/д**

н/д

18,0 + 2,0

-

Lactobacillus salivarius L17

н/д

н/д

-

10,0 + 0,5

14,0+ 0,6

Lactococcus lactis A 5.11

12,0 + 0,45

-

-

-

11.5 + 0,2

* - « - » -  зоны  задержки роста отсутствуют; ** - н/д – нет данных

С целью изучения способности культур LAB к синтезу антибактериальных веществ проведены исследования по оптимизации условий культивирования штаммов-продуцентов. По результатам оценки ростовых характеристик и рецептур различных питательных субстратов  были составлены 4 варианта модифицированных сред, в которых варьировали ростовые факторы (в т.ч. триптон, углеводы, олигосахариды, микронутриенты). В качестве основы использовали стандартную рецептуру MRS-бульона. Эффективность исследуемых композиций сред культивирования оценивали по скорости накопления биомассы клеток  LAB и уровню их антагонистической активности по отношению к патогенным тест – микроорганизмам. Результаты оценки  ростовых и функциональных свойств испытанных субстратов приведены на рис. 8.

Проведенные исследования показали возможность улучшения условий культивирования LAB – продуцентов антимикробных субстанций при добавлении в состав MRS- бульона стимуляторов роста лактобактерий (дрожжевой экстракт, глюкоза, лактоза), а также при использовании соевого пептона в сочетании с инулином, моно- и дисахарами. Испытанные варианты сред могут быть использованы для получения антагонистически активных бактериальных препаратов  или антимикробных субстанций LAB.

Рис.8. Функциональные свойства модифицированных сред (% прироста биомассы штаммов LAB)

В результате экспериментальных исследований отработана модель совместного культивирования молочнокислых микроорганизмов и эмерджентных патогенов.  Отобрано 5 штаммов с наиболее выраженным антагонистическим потенциалом в отношении L.monocytogenes, которые могут быть рекомендованы для промышленного использования в составе бактериальных заквасок в производстве ферментированных и новых видов пищевых продуктов, а также микробных ассоциаций с направленным антилистериозным действием.

2.4. Применение общих принципов обеспечения микробиологической безопасности для эффективного контроля L.monocytogenes в пищевых продуктах

Результаты изучения свойств и распространенности L.monocytogenes, эпидемиологии листериозных заболеваний возбудителя постоянно систематизируются, обобщаются и используются гигиенистами в различных странах мира для разработки национальных программ и организационных мероприятий, направленных на производство и потребление безопасных пищевых продуктов. Принято считать, что анализ риска для одного из наиболее опасных эмерджентных возбудителей пищевых инфекций L.monocytogenes практически завершен, однако решение практических задач по внедрению программ HACCP в системы контроля предприятий отечественной пищевой индустрии  остается чрезвычайно актуальным. Использование универсальной структурной модели АМР (анализ микробиологического риска) обеспечивает более целостный подход к безопасности пищи путем интеграции рисков по всей пищевой цепи, направлено на уменьшение количества связанных с ней инфекций, и способствует гармонизации  национальных и международных стандартов, норм и санитарных правил.

Актуальность проблемы в условиях современной пищевой индустрии, переработки и хранения продукции, благоприятствующих выживанию листерий в пище, чрезвычайно обострилась. Она в первую очередь связана со способностью микроорганизма при пищевом пути передачи вызывать тяжелую, часто смертельную инфекцию у людей всех возрастов, его возрастающей ролью в перинатальной и неонатальной смертности. А во-вторых, обусловлена биологическими свойствами Listeria monocytogenes – психротрофных, факультативно-анаэробных и галотолерантных микроорганизмов, способности размножаться при холодильном хранении продуктов и в современных видах упаковки, ограничивающей доступ кислорода. Пять ключевых факторов определены как наиболее значимые, с которыми связан наибольший риск возникновения пищевого листериоза, а именно:

  • Количество и частота употребления продукта
  • Частота и уровень контаминации продукта бактериями L.monocytogenes
  • Способность продукта поддерживать рост L.monocytogenes
  • Температура замораживания/охлаждения продукта при хранении
  • Продолжительность хранения замороженного/охлажденного продукта

Комбинация этих категорий  для оценки риска листериоза более эффективна, нежели  определение влияния каждого фактора по отдельности. В дополнение к перечисленным ключевым моментам, влияющим на количество L.monocytogenes в продукте на момент его употребления, выделяется еще один значимый признак – индивидуальная восприимчивость потребителя к данному патогену. 

Необходимость создания в нашей стране свода правил, предупреждающих возможность пищевого листериоза, анализ изученности этой проблемы за рубежом, материалов международных организаций, собственные экспериментальные данные  и методические проработки позволили впервые в системе санитарно-эпидемиологического нормирования в России обосновать и ввести в действие новый гигиенический норматив безопасности по показателю Listeria monocytogenes: «Гигиенический норматив ГН 2.3.2.1010-01 (дополнение к СанПиН 2.3.2.560-96) – микробиологический норматив безопасности: “Listeria monocytogenes в 25 г продукта не допускается».

Этот показатель конкретизирован с учетом результатов собственных экспериментальных исследований и сформулирован в виде дифференцированных нормативов для наиболее значимых групп пищевой продукции в Санитарных правилах и нормативах 2.3.2.1078-01 «Гигиенические требования безопасности и пищевой ценности пищевых продуктов». В разработанном документе отражены также специальные (более жесткие) требования к  продуктам, предназначенным для наиболее уязвимых групп населения по степени риска заболеваемости листериозом, в том числе детей раннего возраста, беременных и кормящих женщин, больных и ослабленных людей.

3. Enterobacter sakazakii новый вид эмерджентных энтеробактерий в общей системе микробиологической оценки продуктов детского питания

Обширная группа колиформных бактерий, традиционно используемая в пищевой микробиологии в качестве санитарно-показательных микроорганизмов – индикаторов фекального загрязнения, в последние десятилетия все чаще становится объектом изучения этиологии новых и вновь возникающих пищевых инфекций, вызываемых измененными вариантами отдельных видов семейства Enterobacteriaceae.

Одним из наиболее наглядных примеров появления таких эмерджентных патогенов среди хорошо изученных популяций непатогенных и условно патогенных энтеробактерий является обнаружение среди бактерий Enterobacter cloacae нового вида Enterobacter sakazaki – возбудителя эмерджентных инфекций у новорожденных и детей раннего возраста. Названный в честь японского микробиолога Riichi Sakazaki, впервые выделившего этот микроорганизм,  E.sakazakii в настоящее время интенсивно исследуется в различных странах мира [Gurtler J.B. et al., 2005, Iversen C. et al., 2008, Johler S. et al., 2009].

C целью выявления возможной контаминации сухих инстантных молочных смесей новыми видами патогенов  проведены исследования по обнаружению E. sakazakii при санитарно - микробиологическом контроле продуктов детского питания. С применением метода количественного подсчета и расширенной биохимической идентификации в образцах детских сухих молочных смесей впервые в РФ были обнаружены эмерджентные патогенные бактерии E.sakazakii в количестве 0,04 - 0,4 КОЕ/г. Следует подчеркнуть, что E. sakazakii были выделены также при анализе 100 г продукта при использовании селективных сред для патогенных энтеробактерий. Интересен факт выявления этих микроорганизмов в ассоциации с Acinetobacter baumannii/calcoaceticus, которые достаточно часто обнаруживаются  в клинических материалах, в смывах в отделениях интенсивной терапии, и считаются возбудителями некоторых нозокомиальных инфекций.

Проведенные  исследования показали необходимость оценить диагностическую значимость традиционно используемых тестов идентификации и разработать схему, пригодную для дифференциации E.sakasakii от фенотипически близких вариантов энтеробактерий. Идентификация E. sakazakii вызывает  значительные затруднения в связи с идентичностью этого вида по большинству культурально-биохимических признаков с другим представителем  рода – E. cloacae. Основной дифференцирующий признак двух видов энтеробактеров - способность E. sakazakii к образованию желтого пигмента также является характерным для бактерий  Erwinia herbicola, которые  не относятся к колиформным, но достаточно часто обнаруживаются при анализе на БГКП  в сухих детских продуктах, содержащих наряду с молочной основой  компоненты растительного происхождения [Карликанова Н.Р. и др., 1991].  Известно, что E.herbicola, являясь одним из представителей микробиоты растительных экосистем, считается видом непатогенным для человека, однако имеющиеся литературные данные свидетельствуют о наличии у них фитопатогенных свойств, механизм регуляции которых недостаточно изучен.

Бактерии E. herbicola по своим таксономическим признакам относятся к микроорганизмам, роль и место которых в семействе Enterobacteriaceae многократно менялись:  вначале E. herbicola отождествлялись с Enterobacter agglomerans; позднее, Erwinia выделяется как один из родов семейства (E. herbicola является одним из 13 входящих в него видов), а E. agglomerans признается отдельным видом в составе рода Enterobacter. В  современной систематике бактерий  E. herbicola и E. agglomerans  вновь объединены в один вид под названием Pantoea  agglomerans  и переведены в род Pantoea. Данный представитель семейства энтеробактерий  наряду со способностью к пигментообразованию обладает значительным числом одинаковых с E. sakazakii и E. cloacae биохимических и генетических признаков. Следует отметить, что в последние годы P. agglomerans неоднократно регистрировались как возбудители оппортунистических инфекций – ожоговых, раневых,  мочевыводящих путей. 

Биохимические свойства, наиболее четко  дифференцирующие E. sakazakii от близкородственных представителей энтеробактерий Enterobacter cloacae и Pantoea agglomerans, приведены в табл.11. Выделенные из детских сухих инстантных  смесей культуры энтеробактерий,  соответствующие комплексу признаков, указанных в таблице, имеющие желтый пигмент, не ферментирующие сорбит и не разжижающие желатину, с высокой степенью вероятности могут быть отнесены к Enterobacter sakazakii.

                                                                               Таблица 11.

Биохимическая дифференциация Enterobacter sakazakii.

Тест или субстрат

Реакции

E. sakazakii

E. cloacae

P. agglomerans

Лизиндекарбоксилаза

-

-

-

Аргининдегидролаза

+

+

-

Орнитиндекарбоксилаза

+

+

(-)

Подвижность

+

+

(+)

Утилизация цитратов

+

+

+

Реакция с метиловым красным

-

-

-

Реакция Фогес–Проскауэра

+

+

(+)

Индол

-

-

(-)

Глюкоза

+

+

+

Лактоза

+

+

(+)

Сахароза

+

+

(+)

Дульцит

-

-

(-)

Адонит

-

(-)

-

Раффиноза

(+)

+

(+)

D-cорбит

-

+

(+)

-метил-D-глюкозид

+

(+)

-

мальтоза

+

+

+

Маннит

+

+

+

Разжижение желатины (22ОС)

-

-

+

Мукоидный рост

+

+

+

Желтый пигмент при 24оС

+

-

(+)

Примечания:

«+» - 90-100% штаммов положительные;  «(+)» – 21-89% штаммов положительные;

« - » -  0 -  9%  штаммов положительные; «(-)» -  10-24% штаммов положительные.

Оценивая значение E. sakazakii как оппортунистического патогена для новорожденных, установлена  вариабельность биологических свойств возбудителя и необходимость уточнения классификации на основе подробного анализа филогенетических связей выделяемых штаммов.

Общая направленность экспериментальных исследований по проблеме оценки риска возникновения E. sakazakii –ассоциированных заболеваний у новорожденных определялась и интерпретировалась в свете новейших данных о таксономическом положении возбудителя. С использованием последней (альтернативной) классификации E. sakazakii  как пяти отдельных видов в составе нового рода «Cronobacter» были изучены и заново типированы штаммы E. sakazakii и Pantoea spp., выделенные  при посеве 85 образцов продуктов, предназначенных для питания детей первого года жизни (табл. 12).

Таблица 12

Результаты типирования штаммов, выделенных из детских смесей

Исследованные штаммы

Источник выделения

Тесты идентификации

Видовая принадлежность по классификации рода Cronobacter

Сбраживание дульцита

Индол

Утилизация малоната

Сбраживание метил –-D- глюкозида

утили-зация сорбита

E.sakazakii № 1M

Сухая смесь

-

-

-

+

-

Cronobacter sakazakii subsp. sakazakii

E.sakazakii № 4/2

Сухая смесь

-

-

+

+

-

Cronobacter sakazakii subsp. malonaticus

Референс-штамм E.sakazakii

-

-

-

+

-

Cronobacter sakazakii subsp. sakazakii

Pantoea spp. №1/1

Сухая каша 

+

-

+

+

-

Cronobacter turicensis

Pantoea spp. № 2/5

Сухая смесь

-

-

+

+

-

Cronobacter sakazakii subsp. malonaticus

Pantoea spp. № 4/5

Сухая каша

+

-

+

+

+

Не соответствует роду Cronobacter

Pantoea spp. № 8/2

Рисовая мука

+

-

+

+

+

Не соответствует роду Cronobacter

Buttiauxella agrestis№ 84/1

Сухая смесь

-

-

+

-

-

Не соответствует роду Cronobacter

С учетом полученных развернутых биохимических профилей все выделенные штаммы, идентифицированные как E.sakazakii, соответствовали характеристикам вида Cronobacter sakazakii (subsp. sakazakii и subsp. malonaticus). Наиболее часто выделяемые микроорганизмы рода Pantoea, которые не входят по традиционной классификации в группу колиформных бактерий и не учитываются при оценке безопасности детских инстантных продуктов, по результатам проведенных исследований были отнесены к роду Cronobacter: два из четырех изученных штаммов были реклассифицированы как Cronobacter turicensis и Cronobacter sakazakii subsp. malonaticus.

Установлено, что виды Cronobacter sakazakii subsp. sakazakii, Cronobacter sakazakii subsp. malonaticus и Cronobacter turicensis ассоциируются с неонатальными инфекциями, в то время как штаммы, идентифицированные как Cronobacter muytjensii и Cronobacter dublinensis, были выделены из асептически полученного клинического материала (костной ткани и крови). Введение новых таксономических единиц упрощает включение вышеназванных потенциальных патогенов в систему контроля на наличие E.sakazakii, поскольку схемы идентификации, предложенные для этого вида микроорганизмов, могут быть распространены на весь род Cronobacter.

Результаты экспериментальных исследований доказали возможность неполного выявления патогенных представителей вида  E.sakazakii (Cronobacter) при использовании общепринятых систем и тестов биохимической идентификации энтеробактерий. Поэтому в целях дальнейшего совершенствования дифференциации бактерий рода Cronobacter от других представителей семейства Enterobacteriaceae, включая новые недостаточно изученные группы бактерий с неясным таксономическим положением (Enterobacter turicensis, Enterobacter helveticus, Buttiauxella agrestis, Kluyvera spp., Leclercia adecarboxylata, Hafnia alvei и др.), предложена новая схема идентификации Cronobacter spp, включающая основные биохимические тесты – маркеры (образование желтого пигмента; -глюкозидазная активность; способность к утилизации цитратов; реакция Фогес-Проскауэра; наличие аргинин дегидрогеназы; ферментация раффинозы и сахарозы).

Проведенные исследования позволили сформулировать новый подход к контролю сухих инстантных смесей для питания детей раннего возраста (в том числе для недоношенных и новорожденных детей), включающий количественный учет бактерий семейства Enterobacteriaceae и расширенную биохимическую идентификацию всех культурально - морфологических типов изолятов для исключения возможного присутствия E. sakazakii и других новых патогенов кишечной группы.

Обнаружение E. sakazakii в 300 г  инстантных молочных продуктов, предназначенных для детей раннего возраста, должно рассматриваться как присутствие патогенных бактерий в исследуемых образцах, и служить основанием для запрета использования такой продукции с принятием соответствующих мер, направленных на обеспечение безопасности  продуктов детского питания.

Новый микробиологический показатель безопасности (отсутствие E. sakazakii в 300 г продукта) послужил отправной точкой при пересмотре действующих нормативов с  целью  ужесточения требований в отношении продуктов для питания детей раннего возраста. Этот показатель включен в проект Санитарных правил «Дополнения и изменения к СанПиН 2.3.2.1078-01 «Гигиенические требования безопасности и пищевой ценности пищевых продуктов», дополняющий требования безопасности продуктов детского питания микробиологическим нормативом «Патогенные микроорганизмы Enterobacter sakazakii».

Для практической реализации нового подхода к контролю детских продуктов разработаны и введены в действие Методические указания МУК 4.2.2428-08 «Метод определения бактерий Enterobacter sakazakii в продуктах для питания детей раннего возраста». Методическая схема определения E. sakazakii представлена в табл.13.                                                                                                 Таблица 13

Схема исследования сухих детских смесей на наличие E.sakazakii

Этап

Время инкубации, ч

температура

1. Неселективное инкубирование пробы массой 100 г в фосфатном буферном растворе (ФБР) в соотношении 1:10

18-24

36оС

2. Посев 10 см3 проинкубированной суспензии  в селективный питательный бульон (1:10) для выделения бактерий семейства Enterobacteriaceae (среда Кесслер с глюкозой или бульон Мак-Конки с глюкозой или бульон с желчью, бриллиантовым зеленым и глюкозой) и инкубация

18-24

36оС

3. Пересев 0,1 см3 проинкубированного бульона для выделения Enterobacteriaceae на поверхность фиолетово-красного желчного агара с глюкозой (VRBG agar) или агара Эндо

18-24

36оС

4. Отбор 5 подозрительных на E.sakazakii колоний и пересев на триптон-соевый агар с дрожжевым экстрактом (TSYEA) и инкубация

48-72

25оС

5. Отбор колоний с желтым пигментом, микроскопия по Граму и подтверждение их видовой принадлежности

6. При обнаружении в 100 г продукта бактерий семейства Enterobacteriaceae  - посев 3 проб по 100 г в соответствии  с п.п.1 -4 для выявления или подтверждения отсутствия  E.sakazakii по п.5

7.При необходимости - подсчет наиболее вероятного числа (НВЧ) по количеству положительных проб в каждой из навесок продукта

4. Значение некоторых потенциально патогенных микроорганизмов в возникновении эмерджентных пищевых токсикозов

Новые данные о появлении среди известных токсических метаболитов бактерий и грибов так называемых «суперантигенов» и других модуляторов системных иммунных реакций (в результате длительного селекционного давления, в том числе в окружающей среде)  требуют углубленного изучения свойств этих микроорганизмов и их потенциальной роли в возникновения эмерджентных пищевых токсикозов. К ним относятся заболевания, вызываемые токсигенными штаммами S.aureus, пищевые отравления смешанной этиологии, вызываемые  S.aureus в сочетании с B.cereus, протеем, E.coli и другими условно патогенными бактериями, а также микроскопическими грибами – продуцентами новых видов микотоксинов. Появление новых токсигенных штаммов и усиление вирулентных свойств продуцируемых ими метаболитов обуславливают необходимость проведения микробиологических и токсикологических исследований в этой области применительно ко всем аспектам безопасности питания.

В целях совершенствования системы микробиологического контроля пищевых продуктов выполнена работа по изучению условий накопления в них токсинов потенциально патогенными и токсигенными микроорганизмами с созданием методов их выявления, идентификации и количественного определения.

Установлена высокая степень контаминации сырого молока коагулазоположительными стафилококками (табл.14), продуцирующими энтеротоксины типов А и В, обладающими т-ДНКазной и лецитиназной активностью (в количестве 103 – 105 КОЕ/см3 – свыше 30% изученных проб). В 23,7% образцов «российского» сыра обнаружены S.aureus в количестве 45 – 500 КОЕ/г продукта. Показано, что молоко и сыр могут служить источником попадания в организм человека энтеротоксигенных стафилококков, способных стать причиной возникновения пищевых интоксикаций.

                                                                        Таблица 14

Контаминация стафилококками сырого молока

Показатель

Количество образцов

Число

%

Общее количество проб

49

100

Количество проб, обсемененных стафилококками

48

97,9

Количество проб с наличием коагулазоположительных стафилококков

26

53,1

В том числе с содержанием клеток в 1 см3:

менее 1000

10

20,4

от 1000 до 10000

12

24.5

от 10000 до 100000

4

8,2

Количество выделенных штаммов стафилококков

57

Проведен анализ культуральных и биохимических свойств 137 штаммов стафилококков, выделенных из молока и сыров, установлена высокая степень корреляции между способностью S.aureus продуцировать энтеротоксины и наличием ферментов коагулазы, термостабильной ДНКазы и другими факторами патогенности (рис.9).

1 – число исследованных штаммов;

4 - коагулаза (+), т-ДНКаза (+), энтеротоксин (-)

2 – коагулаза (-), т-ДНКаза (-), энтеротоксин (-)

5 - коагулаза (+), т-ДНКаза (+), энтеротоксин (+)

3 - коагулаза (+), т-ДНКаза (-), энтеротоксин (-)

6 - коагулаза (-), т-ДНКаза (-), энтеротоксин (+)

Рис.9. Факторы патогенности штаммов стафилококков, выделенных из молока и сыра

Изучены условия выживания энтеротоксигенных стафилокков при моделировании процессов производства и хранения плавленых сыров. Установлена возможность размножения S.aureus в сырной массе до плавления и накопления значительных доз энтеротоксина, устойчивого при термической обработке[Karlikanova N.R. et al., 1994].

Показано, что плавление сырной массы не приводит к инактивации энтеротоксинов, хотя их концентрация несколько снижается (на 23 - 42%). При малых исходных концентрациях (50 нг/г) в плавленом сыре выявлялись незначительные количества токсина – менее 3% от исходной дозы. В процессе хранения плавленого сыра в течение 30 и 45 суток существенных изменений в содержании энтеротоксинов не выявлено (рис.10).

Рис.10.  Содержание энтеротоксина в модельных образцах плавленого сыра

Установлена возможность обнаружения стафилококковых энтеротоксинов в плавленых сырах при использовании сырья, обсемененного коагулазоположительными  стафилококками, обладающими энтеротоксигенной активностью. Бактериальные клетки могут не обнаруживаться при микробиологическом контроле, тогда как накопившиеся в сычужных сырах или других пищевых компонентах энтеротоксины будут сохраняться после термообработки, достигая в готовом продукте значительного уровня, зависящего от исходной концентрации контаминанта и дозы токсина.

С целью создания  метода выявления стафилококковых энтеротоксинов в пищевых продуктах проведена отработка оптимальных режимов и способов культивирования стафилококков, обеспечивающих накопление энтеротоксинов и других метаболитов S.aureus. Для получения концентрированных препаратов токсинов предложен метод выращивания культур на целлофане, помещенном на поверхность агаровой среды Хоттингера, обеспечивающий высокий выход энтеротоксина (50 – 100 мкг/см3). Для выявления низких концентраций токсинов в культуральных фильтратах стафилококков  (0,5 – 1,2 нг/см3) рекомендовано использование ультрафильтрации через мембраны с диаметром с диаметром 0,70 и 0,45 нм, позволяющей сочетать концентрирование энтеротоксинов в ультрафильтрате с его обеспложиванием.

Показана возможность использования способности большинства энтеротоксигенных S.aureus образовывать термостабильную ДНКазу для экспресс-контроля пищевых продуктов на обсемененность коагулазоположительными стафилококками и наличие стафилококковых энтеротоксинов.

Для обнаружения стафилококковых энтеротоксинов предложено применение иммуноферментного твердофазного «сэндвич»-метода, что потребовало методической проработки некоторых стадий постановки ИФА. В частности, при подборе способов экстракции разработана модифицированная схема экстракции, очистки и количественного определения стафилококков. Применение данного метода позволяет выявить количественные закономерности степени сорбции энтеротоксинов, возможность расчетным путем устанавливать их фактическое содержание в продуктах различного физико-химического состава. Так, при исходном содержании энтеротоксина 10-50 нг/г (см3) степень его выявления данным методом ИФА в молоке и твороге составляет 50-60%, в сыре – 30 - 40%, в мясном бульоне – 50 - 55%, в кремово-кондитерских изделиях – 30 - 40%, в суфле – 15 – 20%. Тем самым создается возможность коррекции результатов анализа и установление истинных количеств токсина в исследуемых образцах, что имеет практическое значение при расследовании вспышек пищевых отравлений стафилококковой этиологии.

Углубленное комплексное исследование свойств энтеротоксигенных стафилококков послужило основой для совершенствования микробиологического нормирования  возбудителя, а также для разработки эффективных ускоренных методов контроля пищевых продуктов на наличие стафилококков и стафилококковых энтеротоксинов. Результаты проведенных исследований практически реализованы при разработке Методических указаний МУК 4.2.2429-08 «Методы определения стафилококковых энтеротоксинов в пищевых продуктах», внедренных с 2009 г в  лабораториях Роспотребнадзора и других ведомств, осуществляющих  контроль качества и безопасности продовольственного сырья и пищевых продуктов.

Совместное вегетирование S.aureus c другими условно-патогенными и патогенными микроорганизмами в различных видах пищевой продукции регистрируется довольно часто, в том числе при вспышках отравлений. Эта проблема заслуживает особого внимания, поскольку закономерности формирования смешанных биоценозов изучены недостаточно, что обусловило более детальную ее проработку в плане исследования взаимовлияния токсигенных штаммов B.cereus, S.aureus, E.coli  и др. 

При изучении взаимодействия различных эмерджентных микроорганизмов проведены серии экспериментов по совместному культивированию стафилококков – продуцентов энтеротоксина А с наиболее распространенными условно-патогенными бактериями, в том числе споровыми аэробами B.cereus, бактериями рода Proteus и E.coli. Установлено, что при одновременном культивировании S.aureus и B.cereus отмечается определенное взаимное синергетическое  воздействие, сопровождающееся активизацией процесса токсинообразования энтеротоксигенными штаммами S.aureus. Степень этого взаимовлияния в значительной мере определяется условиями  культивирования, составом питательных сред и соотношением исходных уровней контаминантов.

Совместное вегетирование S.aureus и B.cereus приводило к более интенсивному накоплению стафилококковых энтеротоксинов как в среде культивирования, так и в модельных продуктах (рис. 11), тогда как выращивание S.aureus совместно с бактериями рода Proteus или с E.coli не оказывало потенцирующего эффекта на интенсивность продукции энтеротоксинов стафилококками.

Рис.11. Накопление энтеротоксинов (нг/г) в продуктах при их заражении S.aureus в смеси с B.cereus.

В связи с появлением новых продуцентов токсических метаболитов мицелиальных грибов проведены микологические исследования по изучению условий, способствующих загрязнению продовольственного сырья одним из малоизученных микотоксинов – цитринином. Результаты  экспериментов, выполненных в модельных системах, имитирующих нарушения условий хранения зерна и зернопродуктов, показали возможность интенсивного накопления цитринина в зараженных токсигенными плесневыми грибами Рenicillium citrinum  зерновых субстратах. Наиболее высокие уровни цитринина обнаруживали в результате роста P.citrinum  в рисе (300-350 мг/кг) при хранении зерна в условиях повышенной влажности и при температуре 30оС (рис.12).

Установлена  высокая частота обнаружения среди грибов рода  Рenicillium  токсигенных штаммов  – продуцентов цитринина (5,9%),  что указывает на значительную степень риска для здоровья по требителей контаминации продовольственного зерна этим достаточно широко распространенным видом микроскопических грибов. Для получения данных о частоте и уровнях загрязненности цитринином исследуемых субстратов предложено использовать метод твердофазного иммуноферментного анализа с применением тест-систем «Ридаскрин фаст цитринин». 

Рис. 12. Влияние температуры на продукцию цитринина штаммом P. citrinum

5. Разработка методологии внедрения новых диагностических систем и средств измерения в лабораторную практику микробиологического контроля пищевых продуктов.

Анализ современной методологии и новых направлений в изучении ключевых таксономических и патогенетических свойств микроорганизмов послужили основой для разработки комплексных схем выделения и идентификации эмерджентных патогенов, включающих наряду с бактериологическими  и иммунологическими тестами методы молекулярно-генетического анализа нового поколения, направленных на повышение эффективности лабораторной диагностики и развитие методической базы микробиологических исследований пищевых продуктов. 

Приведенный в работе подробный аналитический обзор существующих методов исследования пищевых патогенов включает не только их детальные характеристики, но и может служить отправной точкой при выборе наиболее эффективных и адекватных схем микробиологического анализа. При этом методы, основанные на новейших достижениях  молекулярной биологии, находят все более широкое применение в пищевой микробиологии и при исследованиях разнообразного биологического материала. Эти методы позволяют не только  выявить наличие и этиологическую роль возбудителя в возникновении инфекционной патологии, но и расшифровать природу патогенности, которая генетически заложена в исследуемом микроорганизме [Fratamico P.M., Bhunia A.K.,2005, Hill W.E., 1996, Espy M.J.,2006, Mackay I.M., 2004, Huang J. et al., 2009, Liu K. et al., 2009].

Предложенные в рамках данного исследования комплексные схемы и комбинированные методы выявления, идентификации и количественного учета эмерджентных патогенов (Enterobacter sakazakii, Listeria monocytogenes, Salmonella) позволяют создать систему их эффективного мониторинга и контроля продуктов питания на этапах изготовления и хранения,  обеспечивают получение более достоверных сведений о циркуляции возбудителей на предприятиях пищевой индустрии и в окружающей среде; позволяют повысить качество лабораторной диагностики.

Данными, полученными при проведении  сравнительных испытаний методов ПЦР, ДНК-рРНК гибридизации и иммуномагнитной сепарации для  выделения патогенных микроорганизмов родов Salmonella,  Listeria, Campylobacter и Escherichia,  подтверждена необходимость их  обязательной межлабораторной апробации для оценки эффективности и успешной интеграции в  традиционные схемы микробиологического анализа.

Между тем молекулярно-генетические методы исследования, для которых характерны технологическая новизна, высокая инвестиционная стоимость и отсутствие  официально одобренных регламентов и инструкций,  не получили еще широкого распространения в пищевой микробиологии. Это определило необходимость разработки общих критериев стандартизации  и гармонизации бактериологических и молекулярно-генетических методов с целью создания единой методологии внедрения современных диагностических систем и средств измерений.

Предлагаемые критерии стандартизации молекулярно-генетических методов должны обеспечивать:

аналитическую и диагностическую точность анализа с минимальным уровнем ложнопозитивных и ложнонегативных результатов;

чувствительность метода – нижний предел определения 1 КОЕ на 25 г продукта;

сходимость и межлабораторную воспроизводимость результатов исследований;

наличие реагентных, внешних и внутренних контролей; 

минимальный риск контаминации ампликонами;

возможность быстрой детекции патогена (минимальная или в режиме on-line скорость проведения анализа);

доступность и низкая стоимость стандартизованных непатентованных реагентов и наборов праймеров;

простота выполнения анализа и возможность его автоматизации;

универсальность способов пробоподготовки пищевых продуктов;

возможность определения количественных уровней загрязнения данным патогеном (количественный анализ).

Применение разработанных критериев позволило провести стандартизацию и адаптацию метода идентификации бактерий Salmonella spp., Listeria spp., Listeria monocytogenes, E.coli O157:H7, Campylobacter spp., выделенных из пищевых продуктов, с использованием системы BAX® Q7 на основе  полимеразной цепной реакции (ПЦР) в режиме реального времени.

Проведенная сравнительная оценка специфичности, чувствительности и воспроизводимости метода, выполненная путем тестирования 250 проб суспензий, экспериментально  контаминированных штаммами листерий, кампилобактеров, сальмонелл и эшерихий, показала его пригодность и перспективность для экспресс-идентификации и подтверждения видовой принадлежности бактерий, выделенных на дифференциально-диагностических средах в виде чистых культур.

Сопоставление ПЦР-анализа  на основе BAX® Q7 с культурально-биохимическими методами показало, что применение ПЦР на этапе идентификации позволяет повысить диагностическую достоверность исследования  за счет снижения числа ложнопозитивных и ложнонегативных  результатов и сократить общую длительность анализа.  По результатам проведенной работы разработаны и введены в действие  Методические рекомендации № 02.036-08 «Идентификация патогенных бактерий, выделенных при контроле пищевых продуктов, с применением системы BAX® System Q7».

С учетом специфики оснащения отечественных лабораторий проведены подбор и адаптация  методов генодиагностики с использованием имеющихся в стране тест-систем и амплификаторов, предназначенных для проведения традиционной  ПЦР в сочетании с электрофоретической детекцией результатов.

Установлено, что использование отечественных тест-наборов для клинической диагностики «АмплиСенс» обеспечивает возможность проведения родовой и видовой идентификации штаммов эмерджентных патогенов, выделенных из пищевых продуктов. При этом специфичность  метода идентификации L.monocytogenes составляла 100% (при исследовании в ПЦР 16 штаммов  различных видов листерий (рис.13). Высокая специфичность  ПЦР- метода и его преимущества выявлены и при анализе проб, содержащих смешанные ассоциации различных видов листерий, идентификация которых затруднена в связи с отсутствием различий культурально-морфологических свойств при росте на дифференциально-диагностических средах.

1

L.m 766 

11

L.m 20 

2

L.m 20 

12

L.welshimeri 56

3

L.m 53

13

L.welshimeri 47

4

L.m 61 

14

L.innocua 28

5

маркер

15

маркер

6

L.m 63 

16

L.innocua 10

7

ОК

17

L.m 5 

8

ПК

18

ОK выделения

9

-

19

ПК выделения

10

-

20

-

L.m. – L. monocytogenes

Рис. 13. Оценка видовой специфичности метода ПЦР с электрофоретической детекцией

На основании полученных  данных установлена пригодность  метода ПЦР c электрофоретической детекцией для  подтверждения принадлежности бактерий, выделенных на дифференциально-диагностических средах в виде чистых культур,  к группе патогенных бактерий L.monocytogenes. Использование различных моделей амплификаторов отечественного и импортного  производства  обеспечивает  в достаточной степени воспроизводимость  и сопоставимость результатов испытаний, проведенных в разных лабораториях, использующих наборы «АмплиСенс L.monocytogenes».

Для осуществления основной задачи микробиологического контроля – выявления возбудителей  непосредственно в пищевом продукте проведены подбор, адаптация  и стандартизация методов генной диагностики, обеспечивающих с высокой степенью чувствительности экспресс-детекцию  патогенных микроорганизмов на заданном уровне  нормируемых показателей (1 КОЕ в 25, 50 или 100 г продукта).

На основе обобщения данных по применению ПЦР в отношении наиболее значимых эмерджентных патогенов и экспериментальной апробации ряда молекулярно-генетических методов был подобран для практической реализации  вариант ПЦР  с гибридизационно-флуоресцентной детекцией в реальном времени на приборе «Rotor-Gene 6000» («Corbett Research», Австралия) с использованием  тест-систем «АмплиСенс® - FL» (ФГУН ЦНИИЭ Роспотребнадзора).

Для обеспечения заданных параметров чувствительности и специфичности метода ПЦР с гибридизационно-флуоресцентной детекцией (ПЦР-FRT) проведен подбор оптимальных способов предварительной пробоподготовки  и селективного обогащения различных видов пищевых продуктов для детекции в них бактерий рода Salmonella и L.monocytogenes. Предложенные режимы подготовки проб обеспечивают ускорение проведения анализов в 2 – 3 раза за счет сокращения длительности предварительных  этапов обогащения исследуемых образцов без снижения уровня чувствительности реакции и открываемости проб.

Апробация метода  ПЦР-FRT в реальном времени на модельных образцах экспериментально контаминированных пищевых продуктов позволила определить его  основные аналитические характеристики (чувствительность,  специфичность, воспроизводимость) в сравнении с традиционными стандартизованными методами бактериологического анализа (табл.15).

                                                                               Табл. 15

Выявление  бактерий рода Salmonella  в модельных системах

Расчетная доза Salmonella spp., клеток в 25 г (см3)

Фактическое содержание Salmonella spp., КОЕ в 25 г (см3)

Результаты обнаружения Salmonella spp.

(НВЧ)

Методом ПЦР, клеток в 25 г (см3)

Микробиологическим методом, КОЕ в 25 г (см3)

Мясо куриное - сырье

2,5 х 104  (n=3)

1,4 х 104

>1100

>1100

2,5 х 103 (n=3)

1,5 x 103

240

210

2,5 х 102 (n=3)

1,6 x 102

21,0

24,0

102 (n=2)

1,24 x 102

21,0

21,0

25 (n=2)

17,5

0,92

1,5

10 (n=3)

12,4

0,92

0,92

Контроль (неконтаминированное мясо)

Не обнаружено

Не обнаружено

Проведенный сравнительный анализ использованных способов детекции позволил выявить преимущества метода  ПЦР-FRT, который обеспечивал возможность обнаружения L.monocytogenes и Salmonella spp. в пороговых дозах, соответствующих требованиям норматива (отсутствие патогена в 25 г продукта).

Полученные данные подтвердили высокую эффективность выбранного формата молекулярно-генетического метода диагностики; использование метода ПЦР с гибридизационно-флуоресцентной детекцией в реальном времени для выявления эмерджентных патогенов  позволяет не только повысить эффективность проводимого контроля, но и обеспечивает получение достоверных и сопоставимых результатов при существенном сокращении времени проведения анализа. Применение данного метода при микробиологическом контроле пищевых продуктов позволяет снизить трудоемкость исследований и улучшить качество проводимых анализов.

На основании полученных результатов разработаны и рекомендуются для практического внедрения  комбинированные схемы микробиологического анализа пищевых продуктов на наличие патогенных микроорганизмов рода Salmonella  и L.monocytogenes  с применением ПЦР с гибридизационно - флуоресцентной детекцией в режиме реального времени (рис.14).

Схема анализа пищевых продуктов на наличие патогенных микроорганизмов рода Salmonella  и  L.monocytogenes

Рис.14. Ускоренный комбинированный метод обнаружения эмерджентных патогенов Salmonella  и  L.monocytogenes в пищевых продуктах

Предлагаемые методические схемы могут быть адаптированы и распространены на другие виды эмерджентных возбудителей заболеваний, имеющих близких непатогенных представителей в пределах рода,  идентификация которых должна основываться на определении патогенетических признаков.

Внедрение современных гармонизированных и стандартизованных схем анализа бактериальных патогенов ознаменует переход системы микробиологического контроля пищевых продуктов на новый  научно-методический уровень. Возможность использования  молекулярно-генетических, иммунологических, биохимических и бактериологических методов в едином диагностическом пространстве обеспечит выбор оптимальных решений для  изучения эмерджентных пищевых патогенов и повышения эффективности исследований.

ВЫВОДЫ

1. Рассмотрен феномен новых и вновь возникающих заболеваний с пищевым путем передачи («эмерджентных пищевых инфекций»), связанных с появлением новых или эволюционно измененных патогенных микроорганизмов; анализ мирового рейтинга эмерджентных пищевых патогенов позволил выделить среди них в качестве объектов научного исследования наиболее эпидемиологически значимые бактерии:  Listeria monocytogenes, Salmonella, энтерогеморрагические E.coli (ЕНЕС), Campylobacter jejuni, Enterobacter sakazakii.

2. Установлено, что общим и ведущим признаком для L.monocytogenes, Campylobacter spp., EHEC, Salmonella spp. является переход их во внешнюю среду, сырье и готовую продукцию вследствие фекальной контаминации с последующим пищевым путем передачи инфекта. Уровень загрязненности сырья молочного и мясного происхождения для отдельных видов патогенов достигает значительных величин (Campylobacter spp. - 100% в мясе кур, Salmonella spp. – до 23% в сырьевых птицепродуктах, L.monocytogenes – до 12%  в сыром молоке) и находится в прямой зависимости от санитарно-гигиенических условий получения, хранения и первичной переработки животноводческой продукции.

3. Впервые в РФ при исследовании  детских молочных продуктов выделены колиформные микроорганизмы с измененными биологическими свойствами, детальное исследование которых позволило идентифицировать их как малоизученный вид Enterobacter  sakazakii; обнаружение среди хорошо изученных популяций семейства Enterobacteriaceae нового вида E. sakazakii свидетельствует о расширении сферы влияния эмерджентных патогенов и усилении роли оппортунистических инфекций.

4. Установлено  наличие филогенетических связей между таксономически родственными группами микроорганизмов родов Enterobacter, Pantoea  и вновь обнаруженными возбудителями неонатальных инфекций E.sakazakii. Сформулирован новый подход к контролю продуктов для питания детей раннего возраста, включающий подсчет бактерий семейства Enterobacteriaceae и расширенную биохимическую идентификацию всех культурально - морфологических типов изолятов для исключения возможного присутствия E. sakazakii и других новых патогенов кишечной группы.

5. Теоретически обоснована таксономическая принадлежность к роду Cronobacter выделенных штаммов Е.sakazakii и Pantoea spp.  Введение новых таксономических единиц расширяет перечень потенциальных патогенов, которые не входят по традиционной классификации в группу колиформных бактерий и не учитываются при оценке безопасности детских инстантных продуктов, что повышает надежность системы контроля на наличие патогенных бактерий семейства Enterobacteriaceae.

6. С учетом значимости одного из наиболее опасных эмерджентных патогенов  - L.monocytogenes проведено многоплановое изучение основных закономерностей  эпидемиологии, экологии и биологических свойств возбудителя, включая экспериментальное исследование поведения этих микроорганизмов в модельных системах, имитирующих условия производства пищевых продуктов и основные физико-химические параметры технологических процессов. Результаты исследования свойств 125 штаммов листерий, персистирующих в продуктах, сырье и объектах внешней среды, позволили расширить базу данных о функциональных признаках возбудителя для оценки степени микробиологического риска пищевого листериоза.

7. Изучен характер воздействия физико-химических и биологических факторов на жизнедеятельность листерий, показана их высокая устойчивость,  вариабельность основных функциональных свойств и механизмов патогенности. Разработана экспериментальная модель совместного культивирования, позволившая доказать способность молочнокислых микроорганизмов проявлять антагонистические свойства в сложном биоценозе не только с листериями, но и с другими эмерджентными патогенами. 

8. Впервые в системе санитарно-эпидемиологического нормирования в России обоснован и введен в действие новый гигиенический норматив безопасности: «Listeria monocytogenes в 25 г продукта не допускается». Этот показатель конкретизирован в виде дифференцированных нормативов по основным группам пищевой продукции с учетом специальных требований к  продуктам, предназначенным для наиболее уязвимых групп населения по степени риска заболеваемости листериозом.

9. В свете новых данных о появлении среди известных токсических метаболитов «суперантигенов» и других модуляторов системных иммунных реакций выполнена работа по изучению условий накопления в пищевых продуктах бактериальных токсинов; проведен анализ культуральных и биохимических свойств 137 штаммов стафилококков, установлена высокая степень корреляции между способностью S.aureus продуцировать энтеротоксины и наличием ферментов коагулазы, термостабильной ДНКазы и другими факторами патогенности; изучены условия выживания энтеротоксигенных стафилокков при моделировании процессов производства и хранения пищевых продуктов; теоретически и экспериментально обоснован системный подход к исследованию пищевых продуктов на обсемененность S.aureus и наличие стафилококковых энтеротоксинов: система включает разработанный способ экстракции токсинов из различных пищевых продуктов и использование высокоразрешающих методов иммуноферментного анализа.

10. Проведены экспериментальные исследования токсигенных свойств  микромицетов – продуцентов  малоизученных видов микотоксинов,  выявлена способность грибов Penicillium citrinum  накапливать микотоксин цитринин в количествах, представляющих опасность для здоровья потребителей, при нарушениях режимов хранения продовольственного зернового сырья.

11. На основе  изучения биологии эмерджентных патогенов и системных механизмов регуляции экспрессии генов факторов патогенности этих бактерий разработаны новые методические подходы, позволяющие проводить ускоренную индикацию возбудителей в различных видах пищевых продуктов с использованием высокоспецифичных комбинированных схем бактериологического и молекулярно-генетического анализа  путем подбора наиболее информативных биохимических тестов и генотипирования с применением методов ПЦР  и ДНК-гибридизации. Для видовой идентификации L.monocytogenes  предложен комплексный метод, включающий определение диагностически значимых  фенотипических тестов (подвижность, способность к гемолизу,  наличие специфичных лецитиназ) в сочетании с  ПЦР-анализом участков генома, кодирующих  выработку фосфолипаз, факторов инвазии и цитотоксичности. Разработан  и впервые в России внедрен метод выявления эмерджентных патогенов  Salmonella и L.monocytogenes на основе твердофазного гетерогенного гибридизационного ДНК-РНК анализа  с хемилюминесцентным детектированием.

12. Предложены принципиальная схема стандартизации и алгоритм оценки пригодности новых методов на основе комплекса критериев, обеспечивающих успешную адаптацию и интеграцию средств измерений и диагностических тест-наборов в системе микробиологического контроля пищевых продуктов.  На основе предложенной методологии проведены  стандартизация и адаптация метода идентификации бактерий Salmonella spp., Listeria spp., L.monocytogenes, E.coli O157:H7, Campylobacter spp., выделенных из пищевых продуктов, с использованием  ПЦР в режиме реального времени в системе BAX® Q7. Для прямого обнаружения эмерджентных патогенов в пищевых продуктах апробирован и рекомендуется к практическому использованию метод ПЦР в реальном времени с гибридизационно-флуоресцентной детекцией, обеспечивающий с высокой степенью чувствительности выявление  этих патогенов на заданном уровне  нормируемых показателей.

Список основных работ, опубликованных по теме диссертации
       Монографии

  1. Ефимочкина Н.Р. Эмерджентные бактериальные патогены в пищевой микробиологии (Монография) /М., Издательство РАМН, 2008, 256 с.
  2. Карликанова Н.Р., Куваева И.Б., Карликанова С.Н. Листерии в молоке и молочных продуктах  / Москва – Углич,  1999, 121 с.

                               Статьи в журналах, рекомендованных ВАК РФ:

  1. Ефимочкина Н.Р. Роль физико-химических и биологических воздействий в формировании толерантности бактерий, контаминирующих пищевые продукты./ ЖМЭИ, 2009, № 4, с.120-125.
  2. Ефимочкина Н.Р. Идентификация нового вида патогенных микроорганизмов Enterobacter sakazakii  с использованием современных таксономических подходов./ ж. Вопросы питания, 2009, № 3, с.25-32
  3. Ефимочкина Н.Р., Чоха О.А., Пименова В.В., Шевелева С.А. Изучение токсигенных свойств мицелиальных грибов - продуцентов цитринина, выделенных из пищевых продуктов./ Вопросы питания, 2008, т.77,  № 4, с. 70-76.
  4. Ефимочкина Н.Р. Молекулярно-генетические методы в идентификации пищевых патогенных бактерий./ ж. Вопросы питания, 2007, № 2, с. 4-15. 
  5. Ефимочкина Н.Р. Некоторые закономерности появления эмерджентных пищевых патогенов./ ж. Вопросы питания, 2006, № 4, с.9-15.
  6. Ефимочкина Н.Р., Быкова И.Б., Барбер Н.В., Нитяга И.М., Шевелева С.А. Обнаружение Enterobacter sakazakii в детских сухих молочных продуктах./ ж. Вопросы детской диетологии, 2005, т.3, № 4, с.46-49.
  7. Ефимочкина Н.Р., Шевелева С.А., Нитяга И.М., Тартаковский И.С.и др. Современные подходы к идентификации листерий при производственном контроле  ферментированных мясных продуктов /Вопросы питания, 2005, № 2, с.39-45
  8. Ефимочкина Н.Р., Карликанова С.Н. Выделение L. monocytogenes из молока и молочных продуктов./ж. Молочная промышленность, №5, 2004, с.36-38
  9. Ефимочкина Н.Р., С.А. Шевелева, И.Б. Куваева и др. Индикация и серологический скрининг условно-патогенных энтеробактерий, выделенных из продуктов питания и объектов внешней среды./ж. Вопросы питания, 2002, № 6, с.29-34.
  10. Ефимочкина Н.Р. Методы определения эмерджентных патогенных бактерий Listeria monocytogenes в молоке и молочных продуктах / ж.Молочная промышленность, 2007, № 3, с.38-42.
  11. Ефимочкина Н.Р., Миргородский Б.Г., Карликанова С.Н.  и др. Совершенствование методических подходов к конструированию и оценке качества сухих питательных сред. /ж. Молочная промышленность, №3, 2006, c.36-41
  12. Ефимочкина Н.Р., С.Н.Карликанова, В.Ф. Семенихина, И.В.Рожкова.  Расширение ассортимента сухих питательных сред для санитарно-гигиенической оценки молочных продуктов./ж. Молочная промышленность, №7, 2005, с.44-45
  13. С.А.Шевелева, Н.Р.Ефимочкина, А.А. Иванов и др. Пищевые отравления и инфекции в Российской Федерации за период 1992-2001 гг.: состояние проблемы и тенденции./Гигиена и санитария, 2003. № 3, с.38-45
  14. Карликанова Н.Р., Семенихина В.Ф., Рожкова И.В. и др. Сухие питательные среды для микробиологического контроля. / Молочная промышленность, 1999, № 3, с.14-15
  15. Карликанова Н.Р., Куваева И.Б., Захарова Н.П. Исследование возможности накопления энтеротоксинов S.aureus при выработке и хранении плавленых сыров./Вопросы  питания, 1995, № 1, с.15-17
  16. Карликанова Н.Р., Куваева И.Б., Лукина И.Б. Обнаружение энтеротоксигенных стафилококков в молоке и сыре ./ Вопросы питания, 1994, № 4, с.29-31
  17. Карликанова Н.Р., Шевелева С.А. Выявление бактерий рода Erwinia при санитарно-микробиологическом контроле детских сухих молочных продуктов. / Вопросы питания, 1991, № 3, с.42-45
  18. Батищева С.Ю., Кузнецова Г.Г., Быкова И.Б., Ефимочкина Н.Р., Шевелева С.А. Влияние плесневых грибов, потребляемых с пищей, на кишечную микрофлору у крыс/ ж. Вопросы питания, 2009, № 2. с.42-46
  19. С.А.Шевелева, И.В. Гмошинский, Ефимочкина Н.Р., и др.. Влияние потребляемых с пищей спор плесеней на протекание системной анафилаксии у крыс./ ж. Вопросы питания, 2004, № 6, с.14-17
  20. Шевелева С.А., Ефимочкина Н.Р., Нестеренко Л.Н., Тутельян В.А., Гинцбург А.Л. и др. Требования к медико-биологической оценке и гигиеническому контролю за оборотом пищевой продукции, полученной из генно-инженерно-модифицированных микроорганизмов./ Вопросы питания, 2008, т.77,  № 3, с.49-57

                               Работы, опубликованные в других изданиях:

  1. Тутельян В.А., С.А. Шевелева, Н.Р.Ефимочкина. 7-й доклад Программы ВОЗ по  контролю за пищевыми инфекциями и интоксикациями в Европе за 1993-1998 гг. Раздел: Российская Федерация. WHO Surveillance Programme for Control of Foodborne Infections and Intoxications in Europe./ FAO/WHO, Берлин, 2001 г., с.292-297
  2. Тутельян В.А., С.А. Шевелева,  Н.Р.Ефимочкина. 8-й доклад Программы ВОЗ по  контролю за пищевыми инфекциями и интоксикациями в Европе за 1999-2000 гг. Раздел: Российская Федерация. /FAO/WHO, Берлин, 2003 г.
  3. Шевелева С.А., Лисицын А.Б., Любченко В.И., Коршунова Т.Н., Карликанова Н.Р., Сохранность вареных колбас в оболочке «Амитан»./ Мясная Индустрия, 1997, № 6.
  4. Шевелева С.А., Карликанова Н.Р. О регламентировании показателя Listeria monocytogenes в пищевых продуктах и сырье в России./ Информационный бюллетень. «Здоровье населения и среда обитания», МЗ РФ, ФЦСЭН, 1999, №11, с.22-24.
  5. Карликанова Н.Р., Шевелева С.А., Куваева И.Б. и др. К вопросу о микробиологическом контроле препаратов и продуктов с пробиотическими свойствами. / Всероссийская. Конференция  с межд. участием «Пробиотики и пробиотич. продукты в профилактике и лечении наиболее распрост. заболеваний человека», М., 1999,  с.27-29.
  6. Шевелева С.А., Ефимочкина Н.Р., Народицкий Б.С., Нестеренко Л.Н. Нормативные требования к пищевым продуктам, полученным с использованием генно - инженерно-модифицированных микроорганизмов. Материалы 5 Московского межд. Конгресса «Биотехнология: состояние и перспективы развития», 16-20 марта 2009 г., с.133-134.
  7. Ефимочкина Н.Р., Черкашин А.В., Шевелева С.А. Поиск новых штаммов молочнокислых бактерий – продуцентов антибактериальных веществ./ Материалы 5 Московского межд. Конгресса «Биотехнология: состояние и перспективы развития», с.65-66.
  8. Батищева С.Ю., Ефимочкина Н.Р., Шевелева С.А. Оценка пробиотической микрофлоры в обогащенных пищевых продуктах и БАД к пище./ Материалы 5 Московского межд. Конгресса «Биотехнология: состояние и перспективы развития», с.49-50.
  9. Ефимочкина Н.Р. Совершенствование методов микробиологического контроля безопасности биотехнологических продуктов. /Материалы 5 Московского межд. Конгресса «Биотехнология: состояние и перспективы развития», 16-20 марта 2009 г., с.27-28.
  10. Шевелева С.А., Ефимочкина Н.Р., Чоха О.А. Экспериментальное изучение токсигенного потенциала продуцентов цитринина в зерне злаковых. /Материалы III Cъезда токсикологов России, г. Москва, 1 – 5 декабря 2008 г.
  11. Черкашин А.В., Ефимочкина Н.Р., Шевелева С.А. Изучение антагонистической активности лактобактерий из естественных заквасок в отношении патогенных бактерий – возбудителей пищевых токсикоинфекций. /Материалы Х Всероссийского конгресса диетологов и нутрициологов «Питание и здоровье», 1 – 3 декабря 2008 г., с.119-120.
  12. Ефимочкина Н.Р., Шевелева С.А., Тартаковский И.С., Карпова Т.И. Выделение и идентификация листерий при микробиологическом контроле пищевых продуктов. /Материалы  6-й Всероссийской научно - практической конференции с международным участием «Молекулярная диагностика – 2007», 28-30 ноября 2007 г.
  13. Шевелева С.А., Ефимочкина Н.Р. Анализ микробиологического риска как основа для совершенствования системы оценки безопасности и контроля пищевых продуктов. /Мат. X Всероссийского съезда гигиенистов и санитарных врачей, М., 2007.
  14. Ефимочкина Н.Р., С.А.Шевелева, А.М.Григорьев. Применение метода ДНК-РНК гибридизации для обнаружения патогенов в пищевых продуктах./ II Международная конференция «Молекулярная медицина и биобезопасность», Москва, 2005, c.127.
  15. Шевелева С.А.,  Шурышева Ж.Н., Н.Р.Ефимочкина. Проблемы и задачи изучения пищевого кампилобактериоза в Российской Федерации. /VIII Всероссийский конгресс  «Оптимальное питание - здоровье нации», М., 26-28 окт. 2005 г., с.297.
  16. Ефимочкина Н.Р., Тартаковский И.С., Ермолаева С.А. и др. Современные методы идентификации и типирования патогенных листерий и их применение для обеспечения безопасности продуктов питания. /VIII Всероссийский конгресс  «Оптимальное питание - здоровье нации», М., 26-28 окт. 2005 г., с.250
  17. Быкова И.Б., Н.Р.Ефимочкина. Сравнение эффективности молекулярно - биологических и культуральных методов при контроле  качества пищевых продуктов. /III Моск. Межд. Конгресс «Биотехнология: состояние и персп. развития», М., 2005, ч.2, с.92-93.
  18. Ефимочкина Н.Р., С.А. Шевелева, А.М. Григорьев, И.Б. Быкова. Оценка взаимодействия патогенных микроорганизмов рода Salmonella  с технологической микрофлорой ферментированных продуктов./III Московский Международный Конгресс «Биотехнология: состояние и перспективы развития», Москва, 14-18 марта 2005, ч.2., с. 101-102.
  19. Ефимочкина Н.Р., Шевелева С.А. Изучение выживаемости некоторых возбудителей заболеваний с пищевым путем передачи в ферментированных пищевых продуктах. /VIII Всеросс. конгресс  «Оптимальное питание - здоровье нации», М., 2005 г., с. 93.
  20. Барбер Н.В., Шевелева С.А., Н.Р.Ефимочкина и др. Задачи контроля остаточных количеств антибиотиков в пищевых продуктах. /Материалы III межрегион. научно-практ. конф. «Питание здорового и больного человека», С-Петербург, 2005, с.12-13
  21. Шевелева С.А., Кузнецова Г.Г., Батищева С.Ю, Н.Р.Ефимочкина. Функциональная эффективность различных кисломолочных и пробиотических продуктов. /Материалы Межд. Конференции «Пробиотики, пребиотики, синбиотики и функциональные продукты питания. Современное состояние и перспективы», М., 2004, с.11.
  22. Шевелева С.А., Н.Р.Ефимочкина. Использование комплекса генотипических и фенотипических признаков – необходимый подход к идентификации малоизученных патогенов в пищевых продуктах. /Материалы I Международной Конференции «Молекулярная медицина и биобезопасность», М., октябрь 2004 г.
  23. С.А.Шевелева, Ж.Н. Шурышева, Ефимочкина Н.Р. Проблемы и задачи изучения пищевого кампилобактериоза в Российской Федерации./Мат. Международной научно-практической Конференции «Политика здорового питания в республике Казахстан», Алматы, октябрь 2004 г.
  24. С.А.Шевелева, Н.Р.Ефимочкина. Стратегия анализа риска в пищевой микробиологии и задачи её внедрения./Материалы Пленума Межведомственного научного совета по экологии человека и гигиене окружающей среды РФ «Угрозы здоровью человека: современные гигиенические проблемы и пути их решения», Москва, 2002 г., с.286-289.
  25. Ефимочкина Н.Р.,  С.А.Шевелева, И.М.Нитяга. Изучение выживаемости энтеротоксигенных эшерихий в процессе хранения ферментированных мясопродуктов./ Мат. 2 Межд. Конгресса «Биотехнология: состояние и персп. развития» М., 2003, с.154-155.
  26. Ефимочкина Н.Р., С.А.Шевелева, Н.В.Барбер. Оптимизация иммуноферментного метода анализа для определения сульфаниламидов в пищевых продуктах животного происхождения./ Материалы YII Всероссийского Конгресса с международным участием «Здоровое питание населения России», Москва, ноябрь 2003, с. 181.
  27. Ефимочкина Н.Р.,  С.А.Шевелева, И.М.Нитяга. Выделение L.monocytogenes из пищевых продуктов с применением метода иммуномагнитной сепарации. /Мат.YII Всеросс. Конгресса с межд. участием «Здоровое питание населения России», М.,2003 г., с. 182.
  28. С.А.Шевелева, И.Б.Куваева. Н.Р.Ефимочкина. Пробиотические продукты: квалификация  и регламентация требований к характеристикам. /Мат. Межд. научно-практ. Конференции  памяти Г.И.Гончаровой «Пробиотические микроорганизмы - современное состояние вопроса и перспективы использования», М., 2002, с.13- 14.
  29. Ефимочкина Н.Р., С.А.Шевелева. Микробиологический контроль пищевых продуктов, обогащенных пробиотическими микроорганизмами./ Мат. Межд. научно-практ. Конференции памяти Г.И.Гончаровой «Пробиотические микроорганизмы -  современное состояние вопроса и перспективы использования», М., 2002, с. 14.
  30. Тартаковский И.С., С.А.Шевелева, С.А.Ермолаева, Ефимочкина Н.Р. Выделение, идентификация и типирование листерий – новый важный компонент контроля безопасности продуктов питания. /Материалы YIII съезда Всероссийского общества эпидемиологов, микробиологов и паразитологов., 2002,  Москва, т.3, с.342
  31. С.А.Шевелева, Ефимочкина Н.Р. Нормирование Listeria monocytogenes в пищевых продуктах в Российской Федерации. Сб. докл. Межд. Конф. «Нейроинфекции: бешенство, губкообразная энцефалопатия крупного рогатого скота, Крейцфельда – Якоба и др. прионные болезни; листериоз; болезнь Ауески; болезнь Тешена», г.Покров, с.11.
  32. С.А.Шевелева, Н.Р.Ефимочкина. Принципы регламентации микроорганизмов в пищевых продуктах, выработанных по новым технологиям. /Материалы Всероссийского съезда гигиенистов и санитарных врачей, 2001, Москва, т.1.
  33. Шевелева С.А., Ефимочкина Н.Р. Современные подходы к оценке микробиологической безопасности продуктов для питания беременных, кормящих женщин и детей./ Материалы III Российского Форума «Мать и дитя», Москва, 22-26 окт. 2001, с. 636
  34. Куваева И.Б., Шевелева С.А., Ефимочкина Н.Р. Особенности санитарно - микробиологической экспертизы продуктов детского питания. / Мат. I Всеросс.  Конгресса с межд. участием «Питание детей: XXI век», М., 2000.
  35. Ефимочкина Н.Р., С.А.Шевелева, В.Ф.Семенихина, И.В.Рожкова, С.Н.Карликанова. Применение сухих питательных сред для микробиологического контроля продуктов детского питания. / Мат. I Всеросс.  Конгресса с межд. участием «Питание детей: XXI век», М., 2000, с.174-175.
  36. С.А.Шевелева, Ефимочкина Н.Р. Гигиеническая оценка сроков годности продуктов детского питания. / I Всеросс. Конгр. «Питание детей: XXI век», М., 2000, с.172-173.
  37. Куваева И.Б., Шевелева С.А., Н.Р.Карликанова. Создание сухих питательных сред для микробиологического контроля качества пищевых продуктов./Научно-практ. конференция «Прогрессивные, экологически безопасные технологии технологии хранения и комплексной переработки сельхозпродукции», М., 1998, с.193-194.
  38. Zakharova N.P., Karlikanova N.R., Kuvajeva I.B. Presence of Staphylococcus enterotoxins in processed cheeses. 24th International Dairy Congress “Dairying in a new global environment”, 1994, Melbourne, Australia, p.290.
  39. Шевелева С.А., Куваева И.Б., Карликанова Н.Р. Проблемы микробиологической безопасности продуктов детского питания при их гигиенической сертификации. /Межд. конференция. «Науч. и практ. аспекты совершенствования качества продуктов детского и геродиетического питания», М., Пищепромиздат, 1997.
  40. Куваева И.Б., Шевелева С.А., Карликанова Н.Р., Быкова И.Б. Микроэкология молока и молочных продуктов в зависимости от санитарно-технического состояния. /Сессия РАМН «Химия и здоровье. Экология человека и инф. заболеваемость», С.-Пб., 1995.
  41. Карликанова Н.Р., Куваева И.Б., Карликанова С.Н. Изучение возможности выживания листерий в процессе выработки и хранения плавленых сыров. /Межд. Симпозиум «Пищевые зоонозы – сальмонеллезы, кампилобактериоз,  иерсиниозы, листериоз. Методы и средства диагностики, лечения и профилактики»,1995, М., с.101
  42. Карликанова С.Н., Куваева И.Б., Карликанова Н.Р. Изучение заготавливаемого молочного сырья по микробиологическим критериям безопасности. /Нучно-техническая конференция «Вклад науки в развитие маслоделия и сыроделия», 1994, г.Углич, с. 20.
  43. Куваева И.Б., Карликанова Н.Р., Быкова И.Б. Степень контаминации молочных продуктов бактериями рода Klebsiella / Нучно-техническая конференция «Вклад науки в развитие маслоделия и сыроделия», 1994, г.Углич, с. 183.
  44. Карликанова Н.Р., Куваева И.Б. Изучение возможности контаминации  молочных продуктов условно-патогенной микрофлорой. /Нучно-техническая конференция «Вклад науки в развитие маслоделия и сыроделия», 1994, г.Углич, с. 182.
  45. Куваева И.Б., Карликанова Н.Р. Исследование свойств энтеротоксигенных стафилококков. /Нучно-техн. конф.«Вклад науки в развитие маслоделия и сыроде  лия»,1994, Углич, с. 184.
  46. Калунянц К.А., Смирнова Т.А., Карликанова Н.Р. Интенсификация производства на основе применения протеолитических ферментных препаратов микробного происхождения в молочной промышленности. Обзорная информация «Молочная промышленность», М., АгроНИИТЭИ ММП, 1987, 108 с.





© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.