WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

КОЗЛОВА

Ирина Валерьевна

НАУЧНОЕ ОБОСНОВАНИЕ И ПУТИ СОВЕРШЕНСТВОВАНИЯ ЭКСТРЕННОЙ ДИАГНОСТИКИ И ПРОФИЛАКТИКИ
ТРАНСМИССИВНЫХ КЛЕЩЕВЫХ ИНФЕКЦИЙ
В УСЛОВИЯХ СОЧЕТАННОСТИ ПРИРОДНЫХ ОЧАГОВ

14.00.30 – эпидемиология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора медицинских наук

Иркутск – 2008

Работа выполнена в ГУ «Научный центр медицинской экологии ВСНЦ СО РАМН» (ИЭМ, отдел природно-очаговых инфекций), г. Иркутск.

Научный консультант:

академик РАМН, доктор медицинских наук,

профессор                                                 В.И. Злобин

Официальные оппоненты:

доктор медицинских наук                        М.В. Чеснокова

доктор медицинских наук,

профессор                                                 Н.И. Владимиров 

доктор медицинских наук                         В.А. Астафьев

Ведущая организация:

ФГУН «Омский НИИ природно-очаговых инфекций»

Роспотребнадзора РФ

Защита состоится «_____»_____________2008 г. в «______» часов на заседании диссертационного совета Д 001.038.01 при ГУ «Научный центр медицинской экологии ВСНЦ СО РАМН» по адресу: 664025, г. Иркутск, ул. Карла Маркса, 3.

С диссертацией можно ознакомиться в библиотеке ГУ «Научный центр медицинской экологии ВСНЦ СО РАМН»

Автореферат разослан «______»_____________2008 г.

Ученый секретарь диссертационного совета,

кандидат медицинских наук,

старший научный сотрудник                                         В.М. Коган

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Природно-очаговые трансмиссивные клещевые инфекции имеют широкое распространение в мире и отличаются большим этиологическим разнообразием (вирусы, риккетсии, бактерии, простейшие). Последние 15 лет в России и, особенно, в Сибири характеризуются беспрецедентным ростом заболеваемости населения клещевым энцефалитом (КЭ), иксодовыми клещевыми боррелиозами (ИКБ), а также клещевым риккетсиозом (КР) (Оберт А.С., 2001; Злобин В.И., 2002; Коренберг Э.И., 2002; Борисов В.А., 2002; Жукова Н.Г., 2002; Волкова Л.И., 2003; Зинченко Н.С., 2003; Лашкевич В.А., 2003; Романенко В.В., 2003; Утенкова Е.О., 2003; Воробьева М.С., 2005; Гратц Н.Г., 2005; Ястребов В.К., 2006). Отмечается перманентный рост численности клещей в пригородных лесах и формирование новых антропургических очагов. Количество лиц, прежде всего горожан, пострадавших от укусов клещей, ежегодно возрастает.

Несмотря на то, что исследованиями освещены многие проблемы клещевых трансмиссивных заболеваний, остаются нерешенными принципиальные вопросы, связанные с новой эпидемиологической ситуацией, возникшей в начале ХХI века, требующей на современном этапе пересмотра стратегии и тактики борьбы с этими природно-очаговыми инфекциями.

В последние годы существенно изменились представления о распространении, таксономии и экологии риккетсий группы клещевой пятнистой лихорадки (КПЛ). В различных регионах мира обнаружен ряд новых риккетсий группы КПЛ, некоторые из которых могут обрести статус самостоятельного вида (Рудаков Н.В., 2001; Шпынов С.Н., 2002; Fournier P.E., 2000; Parola P., 2005; Raoult D., 1996). На эндемичных по клещевому риккетсиозу и сопредельных с ними территориях юга Сибири, Северного Казахстана, Дальнего Востока в последние годы выявлен и охарактеризован ряд риккетсий группы КПЛ, существенно отличающихся от возбудителя клещевого риккетсиоза – R. sibirica (Шпынов С.Н., 2003; Иголкина Я.П., 2006; Ливанова Н.Н., 2005; Рудаков Н.В., 2001; Shpynov S, 2001; Brouqui P., 2004; Rydkina E., 1999). У многих риккетсий новых генотипов патогенность для человека не установлена. Эти данные свидетельствуют о высокой актуальности исследований генетического разнообразия риккетсий, циркулирующих на территории Иркутской области и необходимости уточнения вопроса о роли риккетсий новых генотипов в региональной инфекционной патологии.

В последние годы в клещах тех же видов, с которыми связана передача вируса КЭ и боррелий, обнаружены возбудители Ehrlichia muris и Anaplasma phagocytophilum и описаны новые для России заболевания – моноцитарный эрлихиоз человека (МЭЧ) и гранулоцитарный анаплазмоз человека (ГАЧ) (Ohashi N., 2005; Bakken J.S., 1994; Brouqui P., 1999; Stafford III K.C.C., 1996; Inokuma H., 2004; Dumler J.S., 1991; Tylewska-Weirzbanowska S., 2001; Bjoersdorff A., 2002; Stuen S., 2006; Chen S., 1994; Ogden N.H., 1998; Karsson U., Alekseev A.N., 2001; Kim C.M., 2003; Petrovec M., 2002). Громадный ареал таежного клеща позволяет предполагать, что природные очаги МЭЧ и ГАЧ, по всей видимости, широко распространены на территории страны. Циркуляция этих возбудителей обнаружена в Пермской, Ленинградской, Томской, Новосибирской, Тюменской, Челябинской областях и в Алтайском, Приморском, Хабаровском краях (Коренберг Э.И., 1999; Григорян Е.В., 2000; Медянников О.Ю., 2001; Telford III S.R., 2002; Сидельников Ю.Н., 2002; Шпынов С.Н., 2002; Рудакова С.А., 2005; Шутова Н.А., 2006; Рар В.А., 2006). На территории Иркутской области имеются все биоценотические предпосылки для существования очагов МЭЧ и ГАЧ (это наличие соответствующих переносчиков – клещей I. persulcatus, резервуарных хозяев и др.). В пользу предположения о существовании природных очагов этих инфекций в регионе можно отнести и тот факт, что 14,6 % случаев сезонных лихорадок у больных, находящихся на лечении в Иркутской городской инфекционной больнице после укуса клещей, остаются нерасшифрованными. Все это свидетельствует о необходимости проведения поисковых исследований на наличие очагов МЭЧ и ГАЧ на территории области.

Таким образом, современная эпидемиологическая ситуация характеризуется, с одной стороны, ростом известных клещевых инфекций, с другой – выявлением новых, ранее не известных на тех или иных территориях. Чрезвычайно важным новым аспектом является то, что очаги разных клещевых инфекций «накладываются друг на друга», т.е. речь идет о сочетанных очагах вирусных, бактериальных и риккетсиозных инфекций.

В условиях существования сочетанных очагов клещевых инфекций и роста числа людей, пострадавших от укусов клещей, ведущее место в борьбе с природно-очаговыми заболеваниями приобретают экстренная лабораторная диагностика и дифференцированная профилактика этих заболеваний. Достижение высокой эффективности этих мероприятий требует научного обоснования, отработки методических и организационных подходов.

Цель исследования: научно обосновать и разработать комплекс мер дифференциальной диагностики и экстренной специфической профилактики клещевого энцефалита и других трансмиссивных клещевых инфекций в условиях сочетанных природных очагов.

Для достижения указанной цели были поставлены следующие задачи:

  1. провести сравнительный анализ современной эпидемиологической ситуации по клещевому энцефалиту и другим трансмиссивным клещевым инфекциям в Иркутской области и г. Иркутске;
  2. обосновать организационные принципы, методическую базу экспресс-диагностики КЭ и ИКБ и разработать схемы исследования материала;
  3. оценить уровень зараженности клещей, снятых с людей, возбудителями КЭ и ИКБ и определить риск инфицирования пострадавших лиц;
  4. разработать и внедрить в практическую работу тактику экстренной профилактики КЭ и ИКБ, основанную на скрининге лиц, пострадавших от укусов инфицированных данными патогенами переносчиков, дать оценку эффективности такого подхода к профилактике;
  5. с помощью современных молекулярно-биологических методов изучить видовое разнообразие боррелий и риккетсий, циркулирующих на территории Прибайкалья;
  6. провести рекогносцировочные исследования по оценке эпидемиологической ситуации в отношении МЭЧ и ГАЧ в Прибайкалье;
  7. разработать алгоритм комплексной лабораторной экспресс-диагностики и экстренной профилактики инфекций, переносимых иксодовыми клещами в условиях юга Восточной Сибири.

Научная новизна работы. Впервые дана комплексная характеристика эпидемиологической ситуации в отношении КЭ, ИКБ, КР и оценка эффективности осуществляемых в Иркутской области и г. Иркутске мер профилактики данных инфекций. Проведено сравнительное изучение эпидемиологических особенностей этих инфекций и установлено, что основные закономерности развития эпидемического процесса КЭ и ИКБ на данной территории совпадают. В эпидемиологии клещевых инфекций (КЭ, ИКБ с одной стороны и КР – с другой) имеются как общие черты (тенденция к неуклонному росту заболеваемости, расширение ареала, увеличение числа случаев нападений клещей в городской черте), так и существенные различия (несовпадение основных переносчиков инфекции, территориальная приуроченность, сезонность и структура заболеваемости).

Показано, что для объективной оценки индивидуального риска заражения и развития КЭ и других клещевых инфекций у лиц, пострадавших от присасывания клеща, необходимо экспресс-определение возбудителей в переносчике.

Впервые доказана эпидемиологическая и экономическая эффективность экстренной профилактики клещевых инфекций, основанной на результатах экспресс-исследования снятых с людей переносчиков. Показано, что скрининг лиц, покусанных инфицированными клещами, позволяет отказаться от огульного подхода к экстренной профилактике КЭ и осуществлять адресную профилактику только в отношении пациентов с высокой степенью риска заболевания. Предложенный дифференцированный подход к профилактике позволяет не только значительно снизить социальный и экономический ущерб, наносимый КЭ и ИКБ, но и избежать необоснованного расхода дорогостоящего и дефицитного препарата, каким является специфический противоэнцефалитный иммуноглобулин.

Cущественно дополнены представления о структуре популяций риккетсий в очагах клещевого риккетсиоза Иркутской области. Показано, что наряду с R. sibirica на данной территории циркулируют риккетсии новых генотипов, в том числе, с неустановленной патогенностью для человека (R. sp.DnS14, R. sp.DnS28, R. raoultii, Candidatus R. tarasevichiae).

Впервые на территории Прибайкалья установлено существование природных очагов МЭЧ и ГАЧ с циркуляцией в них E. muris, A. phagocytophilum и Candidatus «Neoehrlichia mikurensis». Доказано участие эрлихий и анаплазм в формировании региональной инфекционной патологии.

Получена достоверная информация о генетической вариабельности возбудителей ИКБ, которая подтверждает роль B. garinii и B. afzelii в развитии ИКБ у больных в Иркутской области.

Впервые дано научное обоснование комплексу методов для диагностики и профилактики вирусных, бактериальных и риккетсиозных трансмиссивных инфекций в сочетанных природных очагах. Показано, что перспективным путем повышения эффективности и качества лабораторной диагностики трансмиссивных клещевых инфекций является использование современных молекулярно-генетических методов, в частности ПЦР.

Теоретическая значимость работы. Научно обоснован и разработан новый комплексный подход к экстренной профилактике трансмиссивных клещевых инфекций в условиях сочетанных природных очагов, основанный на результатах экспресс-определения возбудителей в снятых с пациентов членистоногих и скрининге лиц с высокой степенью вероятности заражения.

Разработаны методические основы оценки индивидуального риска заражения людей возбудителями клещевых инфекций, которые базируются на результатах экспресс-исследования присосавшегося переносчика.

Разработана методология повышения качества лабораторной диагностики трансмиссивных клещевых инфекций за счет внедрения современных молекулярно-генетических тестов и расширения спектра определяемых патогенов.

Практическая значимость работы. Предложен новый подход к экстренной профилактике трансмиссивных клещевых инфекций, основанный на результатах предварительного исследования присосавшегося переносчика, который позволил конкретизировать показания к назначению этиотропных препаратов и повысить на этой основе эпидемиологическую и экономическую эффективность экстренной профилактики данных инфекций. Экономия денежных средств за счет предотвращенного экономического ущерба, наносимого КЭ и ИКБ и введения иммуноглобулина только при наличии показаний за период с 1995 по 2006 гг. в г. Иркутске составила 84 млн. 825 тыс. рублей.

Для улучшения лабораторной диагностики предложено использование современных молекулярно-генетических методов исследования, внедрение которых в практическую работу будет способствовать повышению качества экстренной профилактики клещевых инфекций и, в конечном итоге, реальному снижению заболеваемости трансмиссивными клещевыми инфекциями в регионе.

Разработан алгоритм лабораторных исследований снятых с людей иксодовых клещей для выявления всего спектра возбудителей трансмиссивных клещевых инфекций, циркулирующих в сочетанных природных очагах Прибайкалья и тактика проведения профилактических мероприятий.

Результаты исследований легли в основу информационно-методических документов для органов практического здравоохранения Иркутской области: «Эпидемиология и профилактика болезни Лайма в пригородной зоне г. Иркутска» (1996), «Эпидемиология и профилактика болезни Лайма в пригородной зоне г. Ангарска» (1997), «Эколого-эпидемиологическая характеристика природных очагов трансмиссивных инфекций на территории Иркутской области» (2002), «Методические рекомендации «Иксодовый клещевой боррелиоз: тактика клинико-эпидемиологического, лабораторного обследования и профилактика заболевания» (МР 3.2.002-06, Иркутск, 2006).

В Государственную коллекцию вирусов ГУ НИИ Вирусологии им. Д.И. Ивановского депонирован штамм вируса КЭ 886-84 с уникальной антигенной и генетической структурой (номер в ГКВ – 977). Полногеномные нуклеотидные последовательности (10 758 н.о.) двух штаммов (178-79 и 886-84) депонированы в международный компьютерный банк данных (GenBank, США) под №EF469661 и №EF469662.

Результаты работы внедрены в работу Центра диагностики и профилактики трансмиссивных клещевых инфекций ГУ НЦ МЭ ВСНЦ СО РАМН. Полученные данные используются в учебном процессе Иркутского государственного медицинского университета, на курсах повышения квалификации Иркутского института усовершенствования врачей.

Апробация работы. Основные результаты исследований по теме диссертации были представлены: на Международной научной конференции «Вирусные, риккетсиозные и бактериальные инфекции, переносимые клещами» (Листвянка, Иркутск, 1996), четвертом Российско-японском международном медицинском симпозиуме (Иркутск, 1996), VII съезде Всероссийского общества эпидемиологов, микробиологов и паразитологов (Москва, 1997), научной конференции «Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера» (Новосибирск, 1998), Всероссийской научно-практической конференции «Природноочаговые инфекции в России: современная эпидемиология, диагностика, тактика защиты населения» (Омск, 1998), Интернациональной конференции «Diversity of the Fauna of North Eurasia» (Новосибирск, 2000), Пятом международном форуме по глобальной вакцинологии (Минск, 2001), межрегиональной научно-практической конференции «Актуальные аспекты природно-очаговых болезней» (Омск, 2001), Научной конференции с международным участием «Инфекции человека в начале XXI века: эволюция, новые проблемы, перспективы контроля», посвященной 90-летию ИЭМ (Иркутск, 2002), Всероссийской научно-практической конференции с международным участием «Клещевые боррелиозы» (Ижевск, 2002), VIII съезде Всероссийского научно-практического общества эпидемиологов, микробиологии и паразитологии (Москва, 2002), Второй научной конференции с международным участием «Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера» (Новосибирск, 2002), Научно-практической конференции с международным участием «Актуальные вопросы инфектологии», посвященной 80-летию организации кафедры инфекционных болезней ИГМУ (2003), Расширенном Пленуме проблемной комиссии РАМН «Клещевой и другие вирусные энцефалиты» (Москва, 2003), Первой Всероссийской конференции по вакцинологии «Медицинские иммунобиологические препараты для профилактики, диагностики и лечения актуальных инфекций» (Москва, 2004), Всероссийской научно-практической конференции «Эпидемиология, лабораторная диагностика и профилактика вирусных инфекций» (Санкт-Петербург, 2005), Всероссийской научно-практической конференции «Современная ситуация и перспективы борьбы с клещевыми инфекциями в XXI веке» (Томск, 2006), научно-практической конференции по профилактике вирусного клещевого энцефалита (Пермь, 2007).

Основные положения, выносимые на защиту:

  • Население Иркутской области подвержено высокому риску заражения возбудителями таких клещевых инфекций, как КЭ, ИКБ, КР, МЭЧ и ГАЧ.
  • Структура популяций возбудителей клещевых инфекций на территории Прибайкалья неоднородна и представлена: тремя генотипами вируса КЭ (восточный, урало-сибирский, западный); двумя геновидами боррелий (B. afzelii и B. garinii); пятью генотипами риккетсий (R. sibirica,R. sp.DnS14, R. sp.DnS28, R. raoultii, Candidatus R. tarasevichiae); двумя видами эрлихий (E. muris, Candidatus «Neoehrlichia mikurensis») и одним видом анаплазм (A. phagocytophilum).
  • В условиях высокой заболеваемости клещевыми инфекциями, слабого охвата населения вакцинацией против КЭ и низкого уровня проведения неспецифической профилактики возрастает значение экстренной специфической профилактики, осуществляемой после укуса человека клещом – переносчиком инфекции.
  • Современный подход к экстренной профилактике в совмещенных природных очагах должен носить комплексный характер (т.е. быть направленным против всех известных патогенов, переносимых клещами) и основываться на скрининге лиц, подвергшихся высокой вероятности инфицирования.
  • Проведение дифференциальной экспресс-диагностики позволяет конкретизировать показания к назначению этиотропных препаратов и повысить на этой основе эпидемиологическую и экономическую эффективность экстренной профилактики КЭ и других трансмиссивных клещевых инфекций.

Публикации. По теме диссертации опубликовано 118 научных работ, в том числе: 1 коллективная монография и 24 статьи в научных журналах, рекомендованных ВАК для публикации материалов докторских диссертаций.

Личный вклад автора. Работа выполнена в отделе природно-очаговых инфекций Института эпидемиологии и микробиологии НЦ МЭ ВСНЦ СО РАМН. Материалы диссертации вошли в отчеты по научным и хоздоговорным темам, выполненным при активном участии автора: «Ландшафтно-эпидемиологическое районирование и оценка эпидемической опасности в отношении КЭ и КБ (болезни Лайма) пригородной зоны г. Ангарска» (1996), «Эпидемиология и профилактика болезни Лайма в пригородной зоне г. Иркутска» (1997), «Экологические и эпидемиологические особенности совмещенных очагов КЭ, мало изученных арбовирусных инфекций и Лайм-боррелиоза на территории Восточной Сибири» (1998), «Цикл работ по КЭ и КБ» (2000), «Эколого-эпидемиологический мониторинг совмещенных очагов трансмиссивных инфекций и эколого-генетический анализ природных популяций вирусных, бактериальных и риккетсиозных патогенов в Восточной Сибири» (2002), «Комплексная эколого-эпидемиологическая и молекулярно-генетическая характеристика возбудителей трансмиссивных клещевых инфекций Восточной Сибири» (2005).

Автором сформулирована идея выполнения комплексных научных исследований по проблеме дифференциальной диагностики и экстренной профилактики трансмиссивных клещевых инфекций в условиях сочетанных природных очагов, определены цель и задачи работы, проведена информационная проработка темы исследования, выполнен сбор, анализ и обобщение материалов, сделаны выводы. Доли личного участия автора составляют: в получении и накоплении научной информации – 80 %, в обобщении, анализе, интерпретации материалов – 100 %.

Автор выражает глубокую признательность научному консультанту работы академику РАМН Злобину Владимиру Игоревичу, всем сотрудникам Центра диагностики и профилактики трансмиссивных клещевых инфекций, лаборатории молекулярной эпидемиологии вирусов ГУ НЦ МЭ ВСНЦ СО РАМН, научным сотрудникам Института химической биологии и фундаментальной медицины СО РАН (Новосибирск)
В.А. Рар и Я.П. Иголкиной, сотрудникам лаборатории трансмиссивных инфекций ГУ НЦ МЭ ВСНЦ СО РАМН к.б.н. М.А. Хаснатинову и С.С. Шулунову, сотрудникам Лимнологического института СО РАН (Иркутск) д.б.н. С.И. Беликову и С.Э. Дигас, работнику ФГУЗ «Центр гигиены и эпидемиологии в Иркутской области» А.М. Антоновой за помощь, оказанную при выполнении данной работы.

Структура и объем диссертационной работы. Диссертационная работа состоит из введения, обзора литературы, 7 глав собственных исследований, заключения, выводов, списка литературы. Работа изложена на 307 страницах, иллюстрирована 37 рисунками и 40 таблицами. Библиографический указатель содержит 392 источника, из которых 253 работы отечественных и 139 – зарубежных авторов.

СОДЕРЖАНИЕ РАБОТЫ

Объекты, методы и объем исследований. Для анализа эпидемиологической ситуации по трансмиссивным клещевым инфекциям в Иркутской области и г. Иркутске использованы архивные данные заболеваемости КЭ, ИКБ, КР Управления Роспотрбнадзора по Иркутской области и ФГУЗ «Центр гигиены и эпидемиологии в Иркутской области» за период с 1995 по 2004 гг.

С целью определения критериев риска инфицирования лиц, покусанных клещами, обоснования подходов к экстренной профилактике КЭ и ИКБ, определения эффективности профилактических мер, основанных на данных экспресс-исследования, обработаны и проанализированы данные обследования 56 355 человек, обратившихся в Центр диагностики и профилактики трансмиссивных клещевых инфекций за период с 1995 по 2006 гг.

В ходе работы по определению антигена вируса КЭ исследованы 41 404 экземпляров клещей и 11 564 образцов сыворотки крови от пострадавших людей. Определение зараженности возбудителем ИКБ осуществлено у 30 469 переносчиков.

Для изучения генетического разнообразия риккетсий группы КПЛ, циркулирующих на территории Иркутской области и Республики Бурятия, исследовано 311 экземпляров клещей I. persulcatus, 232 – D. silvarum и 14 – D. nuttalli. Для уточнения роли риккетсий в региональной инфекционной патологии проанализировано 45 образцов сыворотки крови от больных людей, госпитализированных в медицинские учреждения в связи с подозрением на КР или наличием у них лихорадки неустановленной этиологии.

На присутствие антител к возбудителям МЭЧ и ГАЧ обследовано 644 образца сыворотки крови больных с острыми лихорадочными заболеваниями неясной этиологии, возникшими после присасывания клещей. На наличие ДНК E. muris и A. phagocytophilum исследовано 139 клещей.

Генетическая вариабельность боррелий изучена при исследовании 224 экземпляров клещей I. persulcatus, 68 образцов крови больных ИКБ, взятых в различные сроки от начала заболевания и 9 проб мочи.

Общее количество проведенных лабораторных исследований приведено в табл. 1.

Таблица 1

Общее количество проведенных лабораторных исследований

Вид исследования

Количество

исследований

Определение антигена вируса КЭ в клеще (ИФА)

41 404

Определение антигена вируса КЭ в крови (ИФА)

11 564

Определение зараженности клещей боррелиями (микроскопия)

30 469

Определение наличия ДНК риккетсий в клеще (ПЦР)

557

Определение наличия ДНК риккетсий в крови (ПЦР)

45

Определение наличия ДНК боррелий в клеще (ПЦР)

224

Определение наличия ДНК боррелий в крови (ПЦР)

68

Определение наличия ДНК боррелий в моче (ПЦР)

9

Определение IgM-антител к возбудителю МЭЧ (ИФА)

644

Определение IgG-антител к возбудителю МЭЧ (ИФА)

644

Определение IgM-антител к возбудителю ГАЧ (ИФА)

460

Определение IgG-антител к возбудителю ГАЧ (ИФА)

460

Определение наличия ДНК эрлихий и анаплазм в клеще (ПЦР)

138

Определение наличия ДНК эрлихий и анаплазм в крови (ПЦР)

34

Определения наличия РНК вируса КЭ в клеще (ПЦР)

40

В ходе данной работы из клещей и крови людей, обратившихся за диагностической и профилактической помощью в Центр диагностики и профилактики трансмиссивных клещевых инфекций, было изолировано 7 штаммов вируса КЭ. Сведения о выделенных штаммах приведены в табл. 2.

Таблица 2

Штаммы, изолированные от клещей и из крови людей,
пострадавших от укуса клещей

№ штамма

Источник изоляции

Место

изоляции

Год

Генотип

1.

1Г-98

Сгусток крови больного

Иркутский район, Байкальский тракт

1998

2

2.

3869

Сыворотка крови «укушенного»

Иркутский район, Голоустненский тракт

2003

3

3.

1392-04

Сыворотка крови «укушенного»

Республика Бурятия,

п. Горячинск

2004

3

4.

413-04

Сыворотка крови больного

Иркутский район, Голоустненский тракт

2004

3

5.

2517-05

Сгусток крови больной

Иркутская область, Шелеховский район

2005

1

6.

1955с

I. persulcatus

Иркутский район, Байкальский тракт

2005

3

7.

2041-05

I. persulcatus

Иркутская область, Слюдянский район

2005

3

Для достижения цели и решения поставленных задач был использован комплекс эпидемиологических, серологических, вирусологических, молекулярно-генетических и статистических методов. При анализе эпидемиологической ситуации по трансмиссивным клещевым инфекциям в Иркутской области и г. Иркутске использовали методы описательной и аналитической эпидемиологии (Черкасский Б.Л., 1988). Изучали уровни, возрастную и профессиональную структуру, территориальную приуроченность, сезонность, обстоятельства заражения лиц заболевших КЭ, ИКБ и КР. При проведении ретроспективного анализа заболеваемости основное внимание уделяли ее многолетней и внутригодовой динамике, изучали объем и качество профилактических мероприятий, осуществляемых на территории рекреационных зон г. Иркутска и направленных на борьбу с трансмиссивными клещевыми инфекциями

У пациентов, обратившихся в Центр диагностики и профилактики трансмиссивных клещевых инфекций, собирали и подвергали анализу эпидемиологический анамнез. Изучали состояние клеща и степень его пригодности для лабораторного исследования на наличие двух возбудителей (антигена вируса КЭ и боррелий), уточняли сроки от момента укуса до обращения за медицинской помощью, местность и обстоятельства, при которых произошел укус, пол, возраст, род деятельности пострадавших т.д. С целью оценки эпидемиологической эффективности проводимых диагностических мероприятий, тщательному анализу подвергались результаты лабораторного исследования клещей. Особое внимание обращали на сведения о наличии профилактической вакцинации против КЭ, объем, полноту и качество проведенных экстренных профилактических мероприятий в отношении возбудителей КЭ и ИКБ.

Присосавшихся к людям клещей разделяли на 5 групп (от 0 до IV) пропорционально степени «напитанности» переносчика.

Для обнаружения вируса КЭ в клещах или сыворотках крови людей применяли комплекс методов.

Для экспресс-индикации антигена вируса КЭ в клещах и крови людей использовали ИФА. Исследование проводили согласно инструкции производителя тест-системы (ФГУП НПО «Микроген», Томск). Результаты ИФА учитывали на спектрофотометре ELx800 (BIO-TEK Instruments, USA) при длине волны 450 нм, «бланк» осуществляли по воздуху. При превышении «пороговой величины» оптической плотности (P/N) от 1,2 до 1,5 раз считали содержание антигена вируса КЭ в клеще низким, от 1,6 до 2,0 – средним, более 2,1 – высоким.

Детекцию РНК вируса КЭ в клещах осуществляли с помощью коммерческой ПЦР-тест-системы «ВектоВКЭ-РНК-ампли-100» согласно инструкции производителя («Вектор-Бест», Новосибирская область).

Изоляцию штаммов вируса КЭ осуществляли путем заражения культуры клеток СПЭВ пробами крови людей, или суспензиями клещей. Выделенные штаммы поддерживали путем 2-3 пассажей на сосунках беспородных белых мышей. Генотипирование штаммов осуществляли с помощью генотипспецифических дезоксиолигонуклеотидных зондов в реакции МГНК или путем секвенирования по методу Сэнгера с помощью автоматического секвенатора ABI 373.

Для обнаружения боррелий в клещах применяли метод светлопольной микроскопии фиксированных препаратов содержимого кишечника клеща (Коренберг Э.И., 1991). Полученные препараты окрашивали по Романовскому-Гимза и докрашивали кристаллическим фиолетовым. Просмотр мазков осуществляли посредством иммерсионной микроскопии с использованием микроскопа МИКМЕД-2. Степень инфицированности клеща считали высокой при обнаружении более 50 боррелий в 100 полях зрения (п.з.), средней – 10-50 боррелий в 100 п.з. и низкой – менее 10 боррелий в 100 п.з.

Также для индикации и идентификации боррелий в исследуемом материале использовали ПЦР. Выделение ДНК проводили по Дойлу-Диксону с незначительными модификациями (Doyle J.J., Dikson E., 1987). Данный раздел работы проводили совместно с к.б.н., с.н.с. лаборатории трансмиссивных инфекций ИЭМ ГУ НЦ МЭ ВСНЦ СО РАМН М.А. Хаснатиновым. Для выявления специфической ДНК боррелий использовали следующие праймеры: 1323 (5- TGGCAGTGCGTCTTAAGCATG – 3) и 1499 (5-ATCGAATTAAACCACATGCTCCAC – 3), фланкирующие фрагмент гена 16S pРНК боррелий длиной 922 н.о.); 1284 (TCTGATGATGCTGCTGGTATGGG) и 1285 (GCACCTAAATTTGCTCTTTGATC), позволяющие амплифицировать фрагмент гена флагеллина длиной 683-689 н.п. Для постановки ПЦР использовали амплификаторы «Терцик» (ЗАО «ДНК-технология», Москва) или «GeneAmp 2700» (USA). В качестве положительного контроля использовали ДНК типового штамма B. afzelii Ip21(НИИЭМ им. Гамалеи, Москва), в качестве отрицательного – ДНК E. coli (штамм Jm109). Размер и чистоту амплифицированного фрагмента оценивали при помощи электрофореза в 4 % полиакриламидном геле. Продукты ПЦР окрашивали аммиакатом серебра по J.G. Guillemette. Очистку ампликонов проводили с помощью электрофореза в геле легкоплавкой агарозы. Фрагменты клонировали в плазмидном векторе pGEM 3Zf+ с использованием набора pGEM T-Easy Vector System («Promega», USA) с последующей трансформацией вектором клеток E. coli (штаммы Jm и Novablue). Клонированные фрагменты секвенировали с помощью набора fmol DNA Sequencing System («Promega», USA) по протоколу производителя. Для выравнивания нуклеотидных последовательностей использовали программу Gene Tools 1,0 (Resenchuk, 1991). Для построения филогенетических схем применяли программы из пакета TREECON (Van de Peer Y., 1993). Для составления матрицы генетических дистанций использовали двухпараметрический метод Кимуры (Kimura M., 1980). Для построения филогенетических деревьев применяли метод объединения ближайших соседей – Neighbor-joining. Также для детекции ДНК боррелий использовали коммерческие ПЦР-тест-системы производства «Хеликс» (Санкт-Петербург) и «ВектоЛайм-ДНК-ампли-100» («Вектор-Бест», Новосибирская область) согласно инструкции производителей.

Контроль за эффективностью проведенной антибиотикопрофилактики осуществляли с помощью НРИФ или ИФА. Для постановки НРИФ использовали диагностикумы НИИЭМ им. Гамалеи РАМН (Москва) и НПО «Вирион» (Томск). Учет результатов проводили с помощью люминесцентной микроскопии (Крючечников В.Н., 1985). Определение IgM и IgG-антител в ИФА осуществляли с помощью тест-систем «ЛаймБест» (ЗАО «Вектор-Бест», Новосибирская область) и «Боррелиоз-ИФА-комби», «Боррелиоз-ИФА-скрининг» (ООО «Омникс», Санкт-Петербург) по инструкции производителя.

Для обнаружения риккетсий и изучения их генетического разнообразия использовали молекулярно-генетические методы. Данный раздел исследований проводили совместно с сотрудниками Института химической биологии и фундаментальной медицины СО РАН (Новосибирск) Я.П. Иголкиной, сотрудниками Лимнологического института СО РАН (Иркутск) д.б.н. С.И. Беликовым, С.Э. Дигас, сотрудником лаборатории трансмиссивных инфекций ГУ НЦ МЭ ВСНЦ СО РАМН С.С. Шулуновым.

Для оценки зараженности клещей риккетсиями использовали ПЦР и праймеры RICK33 (5`-GCAATACAACAAGGTCTTAAAGCCGC-3`) и RICK532 (5`-TGCAGCATTCGCTCCCCCTAAAG-3`), амплифицирующие фрагмент гена rOmpA длиной 500 п.о. Структуры для синтеза данных праймеров отобраны С.Э. Дигас. Кроме того, детекцию ДНК риккетсий и их типирование осуществляли с помощью метода двухраундовой ПЦР с использованием праймеров, соответствующих фрагментам генов цитратсинтазы (gltA) и поверхностного белка rOmpA (Ливанова Н.Н., 2005). На первом этапе использовали родоспецифичные праймеры (из области гена gltA). Во втором раунде видовую принадлежность и генетические варианты выявленных риккетсий определяли как с помощью праймеров, специфичных участкам гена rOmpA R. sibirica и R. slovaca, так и посредством определения нуклеотидных последовательностей продуктов ПЦР по методу Сэнгера. Также, детекцию ДНК риккетсий осуществляли с помощью коммерческой ПЦР-тест-системы «GenePak» («Biokom», Санкт-Петербург) (Rri, Риккетсия Rickettsia rickettsii).

Для изучения гетерогенности популяции риккетсий использовали ПДРФ-анализ. Оптимальный выбор ферментов рестрикции проводили с помощью программы Webcutter 2.0. Рестриктазы PvuII и Ksp22I, были выбраны, как отличающие R. sibirica от риккетсий близких к R. montanensis.

Первичную структуру фрагмента гена поверхностного мембранного белка rOmpA определяли с помощью секвенирования с использованием набора fmol Sequenсing System («Promega», США) по протоколу производителя.

Для обнаружения эрлихий, анаплазм и антител к ним использовали ряд методов. ДНК эрлихий и анаплазм в образцах клещей выявляли с помощью двухраундовой ПЦР. На первом этапе использовали родоспецифичные праймеры из области гена
16S рРНК:

Ehr1 (5'-GAACGAACGCTGGCGGCAAG-3');

Ehr2 (5'AGTA(T/C)CG(A/G)ACCAGATAGCCGC-3');

Ehr3 (5'-ATTACCCAATCCTGACACAGGG-3');

Ehr4 (5'-CTAGGAATTCCGCTATCCTCT-3').

Данные праймеры фланкировали фрагмент гена 16S pРНК эрлихий и анаплазм длиной 524 п.о. Видовую принадлежность и генетические варианты выявленных возбудителей определяли как при проведении ПЦР с использованием праймеров, специфичных для A. phagocytophilum (HGE1 – 5'-CGGATTATTCTTTATAGCTTGC-3'), E. muris (Em1-5'-CGAACGGATAGCTACCCATAGC-3' и Em2-5'-CGCTCCAAAGTTAAGCTTTGGT-3'), так и посредством определения нуклеотидных последовательностей продуктов ПЦР (Рар В.А., 2005). Также использовали праймеры Ekh1 (5'-CAGATGCTTCTAGCTATTTATAGC-3') и Ekh2 (5'-AGCTCCAAAGTTAAGCTCTGGT-3'), специфичных для spр. Ehrlichia. Выполнение данного раздела работ осуществляли совместно с сотрудником Института химической биологии и фундаментальной медицины СО РАН (Новосибирск) В.А. Рар. Определение нуклеотидных последовательностей проводили с помощью секвенатора ABI PRISM 3100 («Applied Biosystems», USA) в Центре севенирования ДНК Сибирского отделения РАМН,
г. Новосибирск. Анализ последовательностей проводили с помощью программ BLAST (http:// www.ncbi.nlm.nih.gov/BLAST) и CLUSTALW (http://www.ebi.ac.uk/clustalw/index.html). Филогенетический анализ осуществляли с помощью программы MEGA 3.1.

Кроме того, для обнаружения ДНК эрлихий и анаплазм использовали однораундовую ПЦР с коммерческой тест-системой «GenePak» («Biokom», Россия) (Ehr, Эрлихия общ. Ehrlichia spp.).

Для обнаружения иммуноглобулинов класса M и G к возбудителям МЭЧ и ГАЧ использовали ИФА с диагностическими тест-системами производства НПО «Омникс» (Санкт-Петербург). Исследования выполняли в соответствии с инструкцией производителя. Для каждой сыворотки рассчитывали коэффициент серопозитивности (КС). Положительными считали сыворотки с КС>1,1.

Статистический анализ данных с вычислением общепринятых показателей осуществляли с использованием пакета прикладных программ «STATISTICA» и системы электронных таблиц Microsoft Excel 2000. Достоверность разницы величин, исследуемых в динамике, определяли с помощью стандартных параметрических и непараметрических критериев статистики (Савилов Е.Д., 1993).

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Современная эпидемиологическая обстановка и профилактика трансмиссивных клещевых инфекций (на примере Иркутской области и г. Иркутска)

Проблема заболеваний, переносчиками которых являются иксодовые клещи, в последнее десятилетие приобретает все большее значение для многих регионов России, в том числе и для Восточной Сибири. Иркутская область занимает географически центральное место в огромном регионе Восточной Сибири и относится к одной из наиболее экономически развитых и населенных территорий азиатской части страны. Особый интерес анализу эпидемиологической обстановки в данном регионе придает возникновение здесь новой ситуации, когда на протяжении короткого отрезка времени стремительно возросла заболеваемость природно-очаговыми клещевыми инфекциями, превратив Восточную Сибирь (особенно ее наиболее обжитую южную часть), наряду с Уралом и Западной Сибирью, в территорию высокого риска заражения. В настоящее время в Иркутской области официально регистрируются три инфекции, передающиеся через укус клеща: КЭ, ИКБ и КР.

Анализ эпидемиологической ситуации в отношении трансмиссивных клещевых инфекций и организации их профилактики, проведенный нами на примере Иркутской области и г. Иркутска, показал, что основные закономерности развития эпидемического процесса КЭ на данной территории сходны с таковыми в других эндемичных регионах России (Борисов В.А., 2000; Волкова Л.И., 2003; Злобин В.И., 1996; 2004; 2006; Жукова Н.Г, 2002; Леонова Г.Н., 1997; Утенкова Е.О., 2003; Ястребов В.К., 2006).

К наиболее значимым эпидемиологическим особенностям современного КЭ в Иркутской области относятся: 1) высокий уровень и темп роста заболеваемости (показатель заболеваемости КЭ в области ежегодно превышает средне-республиканский в 1,6–4,3 раза; за период с 1977 по 1999 гг. отмечено увеличение заболеваемости КЭ в 136 раз); 2) расширение ареала вируса КЭ – в 1986 г. КЭ был зарегистрирован на 15 административных территориях области, в 2006 г. эндемичными признаны уже 24 территории; 3) неблагоприятное изменение структуры заболеваемости – в последние годы обострение эпидемиологической обстановки на территории Иркутской области происходит за счет неуклонного роста заболеваемости среди городского населения (73,4 %), при относительно низкой заболеваемости жителей сельской местности (26,6 %); случаи профессиональных заболеваний не превышают 0,6 % от общего числа заболевших КЭ; 4) рост количества покусов людей клещами, обусловленный возросшим числом посещений горожанами пригородных лесов (главными причинами контакта населения с клещами и заражения вирусом КЭ являются посещение лесных массивов или других мест отдыха, работа на садоводческих участках, сбор дикоросов); 5) неодинаковая напряженность эпидемического процесса на различных территориях Иркутской области – основные активные антропургические очаги КЭ сформировались вокруг крупных промышленных городов, расположенных в южной части области, на которые приходится свыше 80 % заболеваемости; 6) на территории Иркутской области наблюдается значительная генетическая вариабельность штаммов вируса КЭ, а именно, здесь имеет место циркуляция трех генотипов вируса КЭ (дальневосточного, урало-сибирского, западного), из которых урало-сибирский генотип является доминирующим; также на территории области обнаружены штаммы (178-79, 886-84), отличающиеся по молекулярно-генетической структуре от штаммов трех известных генотипов.

Не менее актуальной проблемой для Иркутской области являются иксодовые клещевые боррелиозы (ИКБ). Наличие одного и того же вида переносчика (клещи I. persulcatus) возбудителей КЭ и ИКБ обусловливает существование на территории области сочетанных очагов этих инфекций и сходство многих эпидемиологических проявлений. Для ИКБ в Иркутской области, также как и для КЭ, характерен высокий уровень заболеваемости, которая ежегодно превышает аналогичные показатели в РФ в 1,3-2,4 раза. Ареал данной инфекции шире, чем КЭ и включает 28 районов области.

Наименее благополучная эпидемиологическая обстановка сложилась в Иркутске, где заболеваемость в отдельные годы превышала областные показатели в 2 раза. Структура заболеваемости ИКБ и основные места заражения аналогичны таковым при КЭ.

Анализ эпидситуации при клещевом риккетсиозе (КР) показал, что заболеваемость этой инфекцией на территории Иркутской области, также как КЭ и ИКБ, имеет тенденцию к неуклонному росту, расширению ареала основных переносчиков, увеличению числа случаев нападений клещей в черте г. Иркутска. В результате эпидемиологического анализа был выявлен и ряд различий в эпидемиологии КР и других клещевых инфекций, регистрируемых на территории области. Одним из таких отличий является территориальное распространение заболеваемости КР, которое охватывает только 10 районов Иркутской области. Наиболее высокие показатели заболеваемости отмечаются на территории Усть-Ордынского Бурятского автономного округа (УОБАО), где до настоящего времени сохраняются обширные участки нераспаханных степей – типичных мест обитания клещей рода Dermacentor, являющихся основными переносчиками данной инфекции. Высокая заболеваемость КР на территории округа обусловлена не только особенностями ландшафта, но и особенностями хозяйственной деятельности (преобладает животноводство), и уровнем медицинской помощи (возможна гипердиагностика заболевания). Существенные различия касаются и основных переносчиков возбудителей, для возбудителя КР – это клещи D. silvarum и D. nuttalli, для возбудителей КЭ и ИКБ – клещи I. persulcatus. Отмечены отличия в реализации факторов, способствующих заражению людей КР и проявлениям его сезонности. Наиболее часто заражение людей происходит при сборе дикорастущих лекарственных трав и ягод, а также при выпасе скота и уходе за ним. Отличительной особенностью КР является наличие более раннего начала эпидемического сезона и его большая продолжительность (апрель-октябрь). Возбудителем КР в Иркутской области традиционно считается R. sibirica, однако появление в последнее время сведений о новых видах риккетсий на территории Сибири и Дальнего Востока, свидетельствует о необходимости уточнения вопроса об этиологии этой инфекции в Иркутской области.

В 2003 г. на территории области впервые верифицированы случаи инфекций, вызванные возбудителями МЭЧ и ГАЧ, но официальная регистрация этих заболеваний в области не ведется. Переносчиком этих возбудителей, также как вируса КЭ и боррелий является таежный клещ I. persulcatus. Поэтому высока вероятность того, что в Иркутской области эти риккетсиозные инфекции существуют и их природные очаги территориально совпадают с сочетанными очагами КЭ и ИКБ.

В условиях сочетанных природных очагов, оптимальным является применение тех методов профилактики, которые могли бы одновременно защищать человека от всего комплекса инфекций, передающихся клещами. К ним относятся, прежде всего, методы неспецифической профилактики. Анализ эффективности проведения акарицидных обработок в рекреационных зонах г. Иркутска показал, что ни один из используемых в настоящее время препаратов не обеспечивает защиту населения в течение всего эпидемического сезона; площади, охватываемые обработками, недостаточны. При выборочной проверке обработанных акарицидами объектов в 20-63 % случаев обнаружены клещи. Ежегодно на этих территориях регистрируется от 7 до 30 присасываний клещей, отмечен один случай КЭ (табл. 3).

Таблица 3

Результаты проверки эффективности противоклещевых обработок рекреационных зон г. Иркутска за период с 1995 по 2004 гг.

Количество проверенных объектов, обработанных акарицидами

Количество объектов, в которых обнаружены клещи

Количество присасываний, зарегистрированных на данных объектах

(±m)

Количество заболеваний КЭ, зарегистрированных на территории данных объектов

120

36 (30,0 %)

21,2±2,8

1

Наиболее надежным и эффективным средством защиты населения от КЭ является вакцинопрофилактика. Однако ежегодно вакцинацию и ревакцинацию в г. Иркутске проходит не более 15 тысяч человек (менее 3 % населения), такой уровень «привитости» населения является недостаточным для того, чтобы реально повлиять на ситуацию в отношении КЭ в городе. По-прежнему, основное внимание при проведении вакцинации уделяется контингентам риска в традиционном их понимании (работники «лесных» профессий), тогда как в настоящее время группой высокого риска являются жители городов.

В условиях низкого охвата населения вакцинацией особое значение приобретает экстренная серопрофилактика КЭ, единственным надежным средством которой продолжает оставаться специфический гомологичный донорский иммуноглобулин. Эпидемиологическая оценка эффективности серопрофилактики КЭ, проведенная нами в г. Иркутске, показала, что эффект от экстренного применения противоэнцефалитного иммуноглобулина чрезвычайно высок (99,4 % среди детей и 98,5 % среди взрослых). Но имеющиеся ресурсы иммуноглобулина расходуются нерационально: большая часть препарата вводится лицам, не нуждающимся в нем, в то время как другие люди, пострадавшие от укусов инфицированных вирусом клещей, не получают серопрофилактики из-за его дефицита.

Таким образом, анализ эффективности различных мер профилактики клещевых инфекций, проводимых в г. Иркутске, показал, что ни один из применяемых в настоящее время методов не обеспечивает надежной защиты населения от заболевания этими инфекциями.

Изложенные выше материалы свидетельствуют о необходимости разработки методических подходов к оценке индивидуального риска заражения людей, пострадавших от укуса клеща, что позволило бы конкретизировать показания к введению специфического иммуноглобулина и усовершенствовать на этой основе тактику экстренной профилактики. В данном аспекте наиболее перспективно определение риска заражения обратившихся по поводу укуса клеща лиц на основании индикации вируса КЭ в переносчиках, снятых после присасывания. Одновременное выявление возбудителей других клещевых инфекций предоставило бы возможность решать вопрос о необходимости проведения экстренной профилактики в отношении ИКБ, КР, МЭЧ, ГАЧ.

Организация дифференциальной экспресс-диагностики клещевого энцефалита и клещевого боррелиоза в г. Иркутске. Тактика профилактических мероприятий в отношении лиц, пострадавших от укуса клещей

С целью оказания диагностической и профилактической помощи населению, пострадавшему от укусов клещей, апробации и внедрения современных методов лабораторной диагностики в 1992 г. в городе Иркутске на базе Института эпидемиологии и микробиологии был создан Центр экстренной диагностики и профилактики трансмиссивных клещевых инфекций. Главным принципом, положенным в основу экстренной профилактики было назначение хорошо зарекомендовавших себя средств (иммуноглобулин против КЭ или антибиотики в случае ИКБ) по результатам дифференциальной экспресс-диагностики, призванной установить факт или высокую степень вероятности инфицирования пациента при укусе клеща вирусом КЭ или боррелиями.

Аргументами в пользу предлагаемого подхода явились: беспрецедентный рост заболеваемости КЭ и ИКБ в регионе Восточной Сибири и Иркутской области, значительное увеличение числа лиц, обращающихся с жалобами на укусы клещей, дефицит и дороговизна иммуноглобулина против КЭ, известные данные о невысоком проценте вирусофорности клещей, необходимость использования различных видов профилактики при заражении вирусом КЭ и боррелиями, разработка эффективных экспресс-методов выявления данных патогенов.

Для практической реализации намеченного подхода необходимо было решить следующие задачи: 1) отобрать методы, адекватные целям экспресс-диагностики КЭ и ИКБ; 2) разработать алгоритм диагностических исследований и тактику профилактических мероприятий в отношении лиц, пострадавших от присасывания клещей.

Наиболее приемлемым методом для оперативного решения вопроса о наличии вируса КЭ в присосавшемся клеще является иммуноферментный анализ (ИФА). Реакция высоко чувствительна, специфична, экономична и проста в исполнении, экспресс-исследование занимает всего несколько часов. ИФА позволяет не только провести индикацию антигена вируса КЭ в клеще, но и оценить количественно его содержание в исходном материале (Наволокин О.В., 1984). Высокая эффективность ИФА для прямого обнаружения антигена вируса КЭ в клеще показана многими исследователями (Бочкова Н.Г., 1990; Караванов А.С., 1990). Вместе с тем, диагностические возможности и надежность использования ИФА для оценки риска заражения людей по результатам обнаружения антигена вируса КЭ в клещах оставались малоизученными. После разработки в 1989 г. коллективом авторов под руководством Л.Е. Подоплекиной тест-системы для выявления антигена вируса КЭ и апробации ИФА для индикации вируса КЭ в отдельных экземплярах клещей в г. Перми (1986–1990 гг.) стало возможным более широкое использование данного метода экспресс-диагностики. Именно ИФА, начиная с 1992 г., применяется нами для индикации антигена вируса КЭ в переносчиках. За период с 1992 по 2006 гг. исследовано 47 352 экземпляра клещей. Анализ случаев заболевания у людей с отрицательными результатами ИФА на наличие антигена вируса КЭ показал, что в дальнейшем ложноотрицательными признаны только 18 (0,04 %). У заболевших КЭ людей отмечались только лихорадочные (72,2 %) и менингеальные
(27,8 %) формы заболевания. Ложноотрицательные результаты исследования в основном были связаны с плохой сохранностью клеща, доставленного на исследование, и невозможностью точного определения срока укуса.

Для выявления в клещах боррелий наиболее подходящей оказалась прямая микроскопия фиксированных мазков содержимого кишечника членистоногих. Метод был апробирован рядом исследователей и рекомендован для широкого практического использования. С 1995 г. он внедрен в работу «Центра диагностики» г. Иркутска. За двенадцатилетний период наблюдений из 26 980 отрицательных результатов только 16 оказались ложноотрицательными (0,06 %). В 40,0 % случаев гиподиагностика была связана с исследованием клещей, продолжительность питания которых на человеке составляла более 2-3 суток. В этих случаях, из-за густого мазка и наличия в нем крови, обнаружение спирохеты было затруднено, что снижало эффективность проводимой диагностики.

На территории Иркутской области существуют сочетанные очаги КЭ и ИКБ, что увеличивает риск заражения людей одновременно двумя патогенами и ведет к развитию микстформ, затрудняет диагностику, профилактику и требует комплексного подхода. Поэтому одним из важных аспектов настоящей работы явилась разработка алгоритма исследований, позволяющего проводить надежное выявление в клещах обоих патогенов. Учитывая разную преимущественную локализацию вируса КЭ (слюнные железы) и боррелий (кишечник) в переносчике, мы посчитали возможным объединить метод ИФА с прямой микроскопией и использовать их одновременно, но в виде последовательных стадий. При этом стадия детекции боррелий в кишечнике клеща предшествует стадии определения антигена вируса КЭ в суспензии клеща с помощью ИФА. Десятилетний опыт работы «Центра диагностики» доказал успешность применения данного алгоритма лабораторной диагностики для обнаружения возбудителей КЭ и ИКБ.

Начиная с 1995 г., в случае отсутствия клеща или его непригодности для исследования, анализу на наличие антигена вируса КЭ подвергали кровь пациента. Принципиально важным моментом было установление оптимальных сроков забора материала. В литературе отмечается, что первичная вирусемия у пациентов наблюдается в сроки от нескольких часов до 1 недели с момента инфицирования. Максимум антигенемии приходится на первые четверо суток (Леонова Г.Н., 1996; Подоплекина Л.Е., 1998; Стронин О.В., 1998). Исследование крови в ИФА спустя 96 часов после укуса клеща показывает высокую результативность обнаружения антигена вируса КЭ, но практически не оставляет времени для проведения экстренной профилактики в рекомендуемые для нее сроки. Исходя из этого, оптимальными сроками для выявления вируса КЭ в крови инфицированных людей являются 24-72 часа с момента укуса.

Была разработана тактика профилактических мероприятий у лиц, пострадавших от присасывания клещей. Экстренную профилактику проводили только при наличии возбудителей в снятом переносчике или крови пациента. В случае обнаружения антигена вируса КЭ вводили специфический иммуноглобулин, в случае обнаружения боррелий в клеще проводили антибиотикопрофилактику. Через месяц после завершения профилактики проводили контрольное серологическое обследование пациентов.

В процессе многолетней работы нами были выявлены некоторые недостатки применяемых методов, которые требуют устранения. Например, прямая микроскопия содержимого кишечника клеща не всегда позволяет обнаружить спирохеты в напитавшемся клеще, что приводит к ложноотрицательному результату. Кроме того, около 30 % представленных на исследование клещей не пригодны для анализа на наличие боррелий, вследствие их плохой сохранности (сухие, фрагментированные, раздавленные и т.д.). Поэтому поиск более эффективных диагностических тестов был продолжен, в частности, для экспресс-определения боррелий апробирована полимеразная цепная реакция (ПЦР).

Наличие коммерческого выпуска в стране ИФА-тест-систем для определения антигена вируса КЭ и ПЦР-тест-систем для детекции ДНК боррелий позволяет рекомендовать разработанный нами подход к комплексной экспресс-диагностике обеих клещевых инфекций для широкого внедрения в практику работы диагностических лабораторий.

Критерии риска инфицирования лиц, покусанных клещами и обоснование подходов к экстренной профилактике клещевого энцефалита и боррелиоза, основанной на результатах определения возбудителей

Для оценки индивидуального риска инфицирования лиц, пострадавших от укуса клещей и обоснования подходов к экстренной профилактике КЭ и ИКБ, проведен анализ результатов экспресс-определения возбудителей за период с 1995 по 2006 гг.

За этот период вирусофорность клещей, снятых с людей, была достоверно выше (p<0,001), чем отловленных непосредственно из природы (рис. 1).

 

Рис. 1. Вирусофорность клещей I. persulcatus снятых с людей и собранных в природных стациях Прибайкалья (за период с 1995 по 2004 гг.)

Примечание: А –– вирусофорность клещей, собранных с растительности; Б -  вирусофорность клещей, снятых с пострадавших людей.

Этот факт неоднократно отмечали и другие исследователи (Алексеев А.Н., 1993; Коренберг Э.И., 1984; Мельникова О.В., 1997; Наумов Р.Л., 2002), указывая на две возможные причины этого явления – изменение поведенческих реакций зараженных клещей и размножение вируса КЭ в организме питающихся переносчиков. В среднем за 12 лет наших наблюдений вирусофорность клещей составила 12,7±0,2 % (Табл. 4).

Таблица 4

Зараженность клещей, снятых с пострадавших от их укусов людей вирусом клещевого энцефалита за период с 1995 по 2006 гг.

Год

Количество исследованных клещей

Количество клещей, содержащих антиген вируса КЭ

% клещей, зараженных вирусом КЭ

1995

804

102

12,7±1,2

1996

1946

284

14,6±0,8

1997

2196

188

8,6±0,6

1998

1649

302

18,3±0,9

1999

4203

516

12,3±0,5

2000

2413

326

13,5±0,7

2001

5216

465

8,9±0,4

2002

5499

552

10,0±0,4

2003

4605

652

14,2±0,5

2004

4178

734

17,6±0,6

2005

4605

858

18,6±0,6

2006

4090

272

6,7±0,4

Всего:

41404

5251

12,7±0,2

Анализ зараженности переносчиков в зависимости от длительности его питания на человеке показал, что вирусофорность напитавшихся клещей была в несколько раз выше, чем не напитавшихся (30,1±0,4 % и 6,1±0,1 % соответственно, p<0,001) (табл. 5).

Таблица 5

Сравнительные данные зараженности голодных и напитавшихся клещей,
снятых с людей за период с 1995 по 2006 гг.

Год

Количество исследованных напитавшихся клещей

Из них содержат антиген вируса КЭ

%(±m)

Количество исследованных не напитавшихся клещей

Из них содержат антиген вируса КЭ

%(±m)

1995

281

90

32,0±2,8

523

12

2,3±0,7

1996

696

223

32,0±1,8

1250

61

4,9±0,6

1997

778

166

21,3±1,5

1418

22

1,6±0,3

1998

402

161

40,1±2,4

1247

141

11,3±0,9

1999

1649

409

24,8±1,1

2554

107

4,2±0,4

2000

858

249

29,0±1,5

1555

77

4,9±0,5

2001

1583

369

23,3±1,1

3633

96

2,6±0,3

2002

1691

423

25,0±1,0

3808

129

3,4±0,3

2003

1148

441

38,4±1,4

3457

211

6,1±0,4

2004

756

316

41,8±1,8

3422

418

12,2±0,6

2005

808

430

53,2±1,8

3797

428

11,3±0,5

2006

782

159

20,3±1,4

3308

113

3,4±0,3

Всего:

11432

3436

30,0±0,4

29972

1815

6,1±0,1

Большую часть исследованных переносчиков составляли слабо напитавшиеся клещи – I степени «напитанности» (61,6 %), затем клещи II (18,9 %), III (11,0 %), IV (8,5 %) степеней «напитанности». Вирусофорность в этих группах клещей составляла соответственно 14,1±0,4 %, 39,7±1,0 %, 68,3±1,3 % и 74,9±1,4 %, т.е. возрастала пропорционально степени их «напитанности» (рис. 2).

Рис. 2. Вирусофорность клещей, снятых с людей, в зависимости
от степени «напитанности» переносчика

Частота нападений на человека самок клещей I. persulcatus в 20-40 раз превышала частоту нападения самцов. Вирусофорность самок, снятых с людей также была достоверно выше, чем самцов (табл. 6).

Таблица 6

Вирусофорность самок и самцов I. persulcatus за период с 1995 по 2006 гг.

Год

Всего исследовано

Количество положительных

результатов

Всего

исследовано

Количество положительных результатов

Абс.

% (±m)

Абс.

% (±m)

1995

768

101

13,2±1,2

28

-

-

1996

1798

259

14,4±0,8

44

2

4,5±3,1

1997

2004

176

8,8±0,6

90

1

1,1±1,1

1998

1544

290

18,8±1,0

57

3

5,3±3,0

1999

3927

467

11,9±0,5

124

5

4,0±1,7

2000

2069

272

13,±0,74

80

3

3,8±2,1

2001

4702

407

8,7±0,4

210

7

3,3±1,2

2002

4977

513

10,3±0,4

188

4

2,1±1,0

2003

3984

534

13,4±0,5

196

10

5,1±1,6

2004

3839

681

17,7±0,6

185

7

3,8±1,4

2005

4106

784

19,1±0,6

246

13

5,3±1,4

2006

3450

231

6,7±0,4

208

3

1,4±0,8

Всего:

37178

4715

12,7±0,2

1656

58

3,5±0,5

Большая часть зараженных клещей содержала антиген вируса КЭ в невысокой концентрации (P/N от 1,2 до 2,0) – 82,5 % и только около 17,5 % клещей – в высокой
(P/N >2,1) (табл. 7).

Таблица 7

Степень зараженности клещей вирусом клещевого энцефалита за период с 1995 по 2006 гг.

Год

Низкая степень

зараженности

%(±m)

Средняя степень
зараженности

%(±m)

Высокая степень
зараженности

%(±m)

1995

6,9±2,5

22,5±4,1

70,6±4,5

1996

6,0±1,4

31,8±2,8

61,8±2,9

1997

42,0±3,6

28,2±3,3

29,8±3,3

1998

50,7±2,9

27,5±6,6

21,9±2,4

1999

61,9±2,8

25,4±2,5

12,7±1,9

2000

63,8±2,7

26,1±2,4

10,1±1,7

2001

72,3±2,1

20,2±1,9

7,5±1,2

2002

71,0±1,9

16,8±1,6

12,1±1,4

2003

69,0±1,8

17,0±1,5

14,0±1,4

2004

67,2±1,7

19,9±1,5

12,9±1,2

2005

66,1±1,6

17,1±1,3

16,8±1,3

2006

89,0±1,9

7,7±1,6

3,3±1,1

ВСЕГО:

62,2±0,5

20,3±0,3

17,5±0,3

Наличие антигена вируса КЭ в среднем за 9 лет было обнаружено в 21,4±0,4 % исследованных образцов сыворотки крови лиц, покусанных клещами. Аналогичные результаты были получены и томскими исследователями (Жукова Н.Г., 2002). Проведенный анализ материала показал, что, как правило, концентрация антигена в крови была невысокой (P/N от 1,2 до 2,0). Доля проб сыворотки, содержащих антиген в невысокой концентрации, достигала 70–80  %.

С целью установления взаимосвязи между количественным содержанием вируса КЭ в переносчике и риском последующего развития заболевания у человека, нами проведено динамическое наблюдение за пациентами с положительными результатами исследования клеща или крови (группа риска). За 12 лет в состав этой группы вошло 7733 пациента. Наблюдение за ними показало, что, несмотря на проведенную серопрофилактику, 42 человека в дальнейшем заболели КЭ (0,5 %). Еще у 17 человек КЭ развился при отсутствии профилактики в связи с поздним обращением за медицинской помощью. Из 3261 пациента, пострадавшего от укусов клещей с содержанием антигена вируса КЭ в клеще в низкой концентрации, в дальнейшем заболели 17 (0,5 %). Число больных КЭ, инфицированных клещами с высоким и средним содержанием вирусного антигена было приблизительно одинаковым и составило соответственно 1,0 % и 0,8 %.

Из 2481 пациента с наличием антигена вируса КЭ в крови, в дальнейшем заболели 12 человек. Из 1197 пострадавших, у которых антиген в крови обнаруживался в низкой концентрации, КЭ заболело 0,42 %, из 613 пациентов со средним содержанием антигена – 0,6 %, из 671 пострадавшего с высокой концентрацией антигена в крови – 0,5 %. В случае низкого или среднего уровня содержания антигена в клеще или крови пациента в дальнейшем развивались только неочаговые формы КЭ – лихорадочная (88,6 %) и менингеальная (11,4 %), а в случае высокого содержания антигена развивались, как неочаговые формы (75,0 %), так и очаговые (менингоэнцефалитическая и радикулоневритическая) (25,0 %).

За период с 1995 по 2006 гг. зараженность клещей, снятых с покусанных людей, возбудителем ИКБ колебалась в значительных пределах от 6,1±0,4 % в 2004 г. до 15,9±2,1 % в 1998 г., составив в среднем за 12 лет – 10,3±0,2 % (табл. 8).

Таблица 8

Зараженность снятых с людей клещей боррелиями за период с 1995 по 2006 гг.

Год

Количество

исследованных клещей

Количество клещей, содержащих боррелии

%(±m) клещей, зараженных боррелиями

Количество

клещей с ВСИ

%(±m) клещей с ВСИ

1995

472

60

12,7±1,5

15

3,2±0,8

1996

712

66

9,3±1,1

11

1,5±0,5

1997

1128

105

9,3±0,9

13

1,2±0,3

1998

1839

292

15,9±0,9

36

2,0±0,3

1999

2678

299

11,2±0,6

44

1,6±0,2

2000

2907

402

13,8±0,6

92

3,2±0,3

2001

3614

433

12,0±0,5

58

1,6±0,2

2002

3804

253

6,7±0,4

20

0,5±0,01

2003

3134

312

10,0±0,5

47

1,5±0,1

2004

3182

193

6,1±0,4

33

1,0±0,2

2005

3729

262

7,0±0,4

36

1,0±0,2

2006

3271

461

14,1±0,6

134

4,1±0,3

ВСЕГО:

30469

3138

10,3±0,2

539

1,9±0,1

Этот показатель был достоверно ниже (р<0,05), чем у клещей, собранных в природных стациях Прибайкалья в эти же годы (16,7 %). Среди клещей, инфицированных возбудителями ИКБ, преобладали членистоногие с низким содержанием боррелий (82,8 %). Одновременно два вида возбудителя (вирус КЭ и боррелии) были обнаружены в 0,3±0,03 % случаев. Тот факт, что часть клещей одновременно заражена боррелиями и вирусом КЭ, имеет важное практическое значение и его необходимо учитывать при проведении антибиотикопрофилактики. Некоторые антибиотики, рекомендуемые для лечения и профилактики боррелиоза (в частности, доксициклин), обладают активирующим действием на вирус КЭ, что может приводить к утяжелению течения заболевания. В то же время, имеются данные о том, что поступивший в кровь человека при укусе клеща вирус КЭ может приводить к снижению эффективности профилактического лечения ИКБ (Алексеев А.Н., 2001). Поэтому ранняя профилактика боррелиоза – через сутки после присасывания зараженного боррелиями клеща – может быть рекомендована только при отрицательном результате исследования присосавшегося клеща на наличие антигена вируса КЭ (Алексеев А.Н., 2001). Это обстоятельство является важным аргументом в пользу необходимости осуществления экстренной профилактики как КЭ, так и ИКБ только на основе результатов определения индивидуального риска инфицирования пострадавшего от укуса клеща лица возбудителями данных инфекций.

Полученные нами данные подтверждают возможность развития ИКБ у лиц с кратковременным (не более 24 часов) присасыванием клеща. Так за период 1995-2004 гг., из 33 человек, укушенных инфицированными боррелиями клещами и заболевших ИКБ, в 48,5 % случаев продолжительность питания на них клещей не превышала одних суток. В остальных случаях, время питания переносчика было более двух суток.

Таким образом, нами было показано, что одновременное применение ИФА для индикации и количественного определения содержания антигена вируса КЭ в клещах, а также в крови лиц, не представивших клещей для исследования и прямой микроскопии для обнаружения боррелий в клещах, позволяет оценить риск заражения и развития заболевания КЭ и ИКБ. Это, в свою очередь, определяет необходимость дифференцированного подхода к проведению специфической профилактики этих инфекций: назначение иммуноглобулина в случае определения антигена вируса КЭ в клеще или крови пациента, либо антибиотиков – в случае обнаружения боррелий.

В ходе работы выявлены дополнительные факторы, способные увеличивать риск развития КЭ или ИКБ. К ним, во-первых, относится степень «напитанности» клеща, зависящая от продолжительности его питания на человеке. Как в случае КЭ, так и в случае ИКБ, при увеличении времени питания присосавшегося переносчика, увеличивается и риск развития заболевания. Вторым, не менее важным фактором, способным повышать риск заражения людей, является доза возбудителя. И хотя прямой зависимости между концентрацией возбудителя в клеще или уровнем антигенемии в ходе работы не выявлено, показано, что при увеличении содержания вирусного антигена в крови или клеще увеличивался риск развития у пациента очаговых форм КЭ. Важным фактором, способствующим повышению опасности заболевания КЭ и ИКБ, является частота контакта населения с зараженными переносчиками или посещение ими определенных местностей, так называемых, территорий риска. В результате исследования нами показано, что к ним в окрестностях города Иркутска относятся Байкальский тракт, Мельничная падь, Голоустненский тракт и рекреационные зоны, расположенные вдоль железнодорожной ветки «Иркутск-Слюдянка». На этих территориях зарегистрировано наибольшее количество присасываний клещей и наибольшее количество заболеваний КЭ и ИКБ (табл. 9).

Таблица 9

Места наибольшего риска заражения возбудителями КЭ и ИКБ

(за период с 1995 по 2004 гг.)

Место нападения клеща

%(±m) от общего числа обратив-шихся

Зараженность клещей вирусом КЭ

%(±m)

Зараженность клещей боррелиями

%(±m)

Количество лет, на протяжении которых наблюдались случаи КЭ

Количество лет, на протяжении которых наблюдались случаи ИКБ

Байкальский тракт

27,2±0,2

10,1±0,2

26,3±0,3

ежегодно

ежегодно


Мельничная падь

13,7±0,2

10,5±0,2

24,7±0,3

ежегодно

ежегодно


Голоустненский тракт

10,2±0,2

10,1±0,2

24,5±0,3

ежегодно

ежегодно


Ж/д «Иркутск-Слюдянка»

11,4±0,2

10,1±0,2

25,8±0,3

9 лет из 10

9 лет из 10


Черта города

7,7±0,1

13,5±0,2

21,1±0,3

9 лет из 10

8 лет из 10


Александровский тракт

3,3±0,1

9,8±0,1

21,3±0,3

4 года из 10

3 из 10


Качугский тракт

3,5±0,1

14,3±0,2

21,1±0,3

3 года из 10

1 год из 10


Московский тракт

1,5±0,1

8,7±0,1

17,4±0,2

2 года из 10

2 года из 10


Култукский тракт

1,4±0,1

10,6±0,2

27,1±0,3

-

1 год из 10


Эти магистрали ведут к местам концентрации садовых участков горожан, наиболее интенсивно осваиваемым в последние годы, а также местам массового отдыха и сбора даров природы.

Оценка эффективности экстренной профилактики клещевого энцефалита и иксодового клещевого боррелиоза по результатам экспресс-исследования клещей, снятых с людей

Так как в научной литературе имеются неоднозначные оценки эффективности введения иммуноглобулинов с профилактической целью (Зиновьев А.С., 1983; Львов Д.К., 1964; Николаева С.П., 1980; Подоплекина Л.Е., 1998; Толоконская Н.П., 2006; Aebi C., 1994; Christmann D., 1996; Kunzer W., 1990), представляло интерес проведение анализа эффективности экстренной серопрофилактики КЭ, основанной на результатах исследования присосавшегося переносчика.

Для иммунопрофилактики использовали два вида иммуноглобулина: низкотитражный (отечественного производства) и гипертитражный («FSME-Bulin» австрийской фирмы «Immuno AG»). Сроки введения препарата зависели от срока обращения пациента за профилактической помощью. Экстренную профилактику по показаниям (при наличии антигена вируса КЭ в клеще или крови человека) в Центре диагностики и профилактики клещевых инфекций получили 5152 человека. Эффективность профилактики была высокой – 99,2 %. За 12 лет из числа получивших иммуноглобулин против КЭ заболело 29 человек. Среди этих пациентов удалось предотвратить развитие очаговых форм КЭ. У данных больных зарегистрированы только лихорадочные (89,7 %) и менингеальные (10,3 %) формы заболевания, без развития остаточных явлений (рис. 3а).

Рис. 3. Клинические формы, зарегистрированные у заболевших КЭ за период с 1996 по 2006 гг.: а) осуществлявших серопрофилактику в Центре диагностики и профилактики;
б) не обращавшихся за медицинской помощью в Центр диагностики и профилактики.

Количество лиц, заболевших КЭ и не обращавшихся за диагностической и профилактической помощью в «Центр», составило 977 человек. У этих пациентов наряду с легкими формами заболевания (95,2 %), отмечались и очень тяжелые формы КЭ
(4,8 %): энцефалополирадикулоневритическая, менингоэнцефалитическая, полиомиелитическая, менингорадикулоневритическая (рис. 3б). Кроме того, зафиксировано 7 летальных исходов, в трех случаях зарегистрированы остаточные явления в виде парезов.

Анализ эффективности иммуноглобулинопрофилактики в зависимости сроков введения серопрепарата показал, что среди пациентов, которым вводили иммуноглобулин в первые сутки с момента присасывания клеща, ни один не заболел КЭ (табл. 10).

Таблица 10

Заболеваемость КЭ среди лиц, получивших серопрофилактику в зависимости от срока введения иммуноглобулина после укуса клеща

Иммуноглобулин

введен в первые сутки

Иммуноглобулин

введен на вторые сутки

Иммуноглобулин

введен на третьи сутки

Иммуноглобулин

введен позднее третьих суток

-

0,9±0,1 %*

0,7±0,1 %**

2,4±0,6 %

Примечание: достоверность различий по сравнению с  % заболевших, которым профилактика осуществлялась позднее 3-х суток (* – p<0,05; ** – p<0,01).

Заболеваемость КЭ у людей, которым иммуноглобулин вводили на вторые сутки, составила 0,9±0,1 %, на третьи – 0,7±0,1 %, позднее третьих суток – 2,4±0,6 % от всех лиц, которым экстренная профилактика была показана. При этом если у пациентов, которым иммуноглобулин был введен на вторые и третьи сутки, отмечались только лихорадочные и менингеальные формы КЭ, то среди пациентов с более поздними сроками введения препарата зарегистрированы и очаговые формы.

При исследовании крови пострадавших на наличие антигена вируса КЭ нами было отмечено, что не всегда высокие показатели антигенемии приводят к развитию заболевания даже при отсутствии серопрофилактики и, наоборот, наблюдались случаи заболевания при очень низком уровне антигена (P/N=1,2) и при проведенной в ранние сроки иммуноглобулинопрофилактике. Присутствие в крови пациентов различных генотипов вируса КЭ было доказано нами путем изоляции вируса (рис. 4).

Рис. 4. Топологическое древо штаммов, изолированных от клещей и из крови людей,
пострадавших от укусов клещей

Примечание: красным цветом выделены штаммы, генетические структуры которых взяты из GenBank; штамм 1955с изолирован из клеща I. persulcatus, снятого с пациента;
штаммы 413-04, 1392-04, 3869-03, 2041-05, 2517-05, 1G-98 – выделены из крови пациентов,
пострадавших от укусов клещей.

Вероятно, некоторая часть случаев заболеваний у людей, получивших с профилактической целью иммуноглобулин, может быть связана с недостаточной степенью специфичности препарата, получаемого из крови доноров, привитых вакцинами на основе одного (обычно дальневосточного) типа вируса. Так, например, штамм 1G был изолирован в 1998 г. из крови больного КЭ. По результатам генотипирования он отнесен к западному генотипу (генотип 2). Несмотря на раннее введение иммуноглобулина, у данного человека в дальнейшем развился двухволновый КЭ. А штаммы 1955с и 3869 были отнесены к урало-сибирскому генотипу (генотип 3). Введение иммуноглобулина в обоих случаях предотвратило развитие у пациентов КЭ.

За период с 1995 по 2006 гг. за диагностической и профилактической помощью в Центр обратилось 56355 человек. Согласно полученным данным, не более 20,0 % пациентов нуждалось во введении дорогостоящего иммуноглобулина, поэтому, применяемая ранее тактика максимального охвата экстренной серопрофилактикой лиц, покусанных клещами, не является оправданной. Так, несмотря на более высокий риск заражения, ситуация по заболеваемости КЭ в г. Иркутске, где применяется новая тактика серопрофилактики, в настоящее время развивается более благоприятно, чем на остальной территории Иркутской области и имеет более выраженную тенденцию к снижению (коэффициент регрессии = -1,83)(рис. 5).

Если в 1999 г. показатель заболеваемости КЭ среди жителей г. Иркутска превышал уровень заболеваемости на остальной территории области в 2 раза, то в 2006 г. он стал ниже, чем по области. В 2006 г. иммуноглобулин против КЭ в г. Иркутске введен 10,9 % пострадавшим, тогда как на остальных территориях области охват экстренной профилактикой составил 39,3 % (в том числе среди детей – 58,5 %). Более того, соотношение числа пострадавших от укусов клещей и заболевших КЭ в 2006 г. составило в г. Иркутске 1:296, на остальной территории области – 1:48.

Рис. 5. Динамика заболеваемости клещевым энцефалитом в Иркутской области
и г. Иркутске за период с 1995 по 2006 гг.

Таким образом, на примере г. Иркутска показано, что новый подход к серопрофилактике, заключающийся во введении иммуноглобулина только при наличии показаний, является эпидемиологически эффективным и позволяет более рационально использовать дефицитный и дорогостоящий серопрепарат, сохранив его для введения лицам с реально существующим риском заболевания. Теоретически возможное количество предупрежденных случаев КЭ, рассчитанное с помощью алгоритма, приведенного в работе П.М. Лузина и соавт. (Лузин П.М. и др., 1992), за 12 лет составило 3740.

За период с 1995 по 2006 гг. по результатам проведенного экспресс-исследования антибиотик для профилактики ИКБ был назначен 3138 пациентам, из них ИКБ заболел 21 человек. Эффективность профилактики составила 99,3 %, а теоретически возможное количество предупрежденных случаев заболевания – 1660.

На примере г. Иркутска с прилегающими районами, можно отметить два противоположных явления: с одной стороны – снижение уровня заболеваемости КЭ и ИКБ среди лиц, обратившихся за экстренной диагностикой и профилактикой и, с другой – рост заболеваемости среди остального населения области. Об этом же свидетельствуют материалы сравнения заболеваемости жителей областного центра, получивших и не получивших медицинскую помощь в «Центре». Так, среди иркутян, не обращавшихся за профилактической помощью, заболеваемость КЭ была в 33 раза, а ИКБ в 21 раз выше, чем среди лиц, которым проводили исследование клеща.

В результате проведенного анализа было показано, что одним из важнейших факторов, оказывающих влияние на заболеваемость населения области КЭ и ИКБ, является уровень оказания медицинской помощи лицам, пострадавшим от укуса клещей, своевременность и полнота проведения экстренных профилактических мероприятий.

Учитывая положительный опыт работы Центра экстренной диагностики и профилактики трансмиссивных инфекций в г. Иркутске, внедрение предлагаемой схемы оказания медицинской помощи лицам, пострадавшим от укусов клещей, может быть рекомендовано для всех эндемичных по КЭ и ИКБ регионов.

Изучение генетического разнообразия риккетсий, циркулирующих
на территории Прибайкалья

Ранее было показано, что на территории Иркутской области существуют активные очаги КР. С помощью традиционных риккетсиологических методов было установлено, что основными переносчиками и хранителями R. sibirica в природе являются клещи D. nuttalli и D. silvarum.

В настоящее время ежегодно увеличивается число лиц, пострадавших от укусов клещей рода Dermacentor. Так, если в 1996 г. в Центре диагностики и профилактики трансмиссивных инфекций зафиксировано 22 таких обращения, то в 2006 г. – уже 410.

Наблюдается не только рост числа обращений людей, пострадавших от укуса клещей данного рода, но и расширяется ареал этих клещей. Если в 1996-2000 гг. нападения клещей рода Dermacentor отмечались преимущественно на территории УОБАО и вдоль Александровского тракта (автомобильная магистраль, ведущая с территории автономии к г. Иркутску), то в 2006 г. они отмечены на территории Усть-Ордынского, Боханского, Баяндаевского, Эхирит-Булагатского, Ольхонского, Осинского, Усть-Удинского, Ново-Нукутского, Иркутского, Братского, Слюдянского и Нижнеудинского районов Иркутской области.

Отмечено приближение ареала клещей D. silvarum к рекреационной зоне г. Иркутска и увеличение числа случаев нападения клещей непосредственно в черте города. Так, обращения по поводу укуса клещей зафиксированы вблизи всех основных автомобильных магистралей, ведущих к г. Иркутску (Качугском, Александровском, Голоустненском, Байкальском, Московском, Култукском, Московском трактах), а также по ходу железнодорожной магистрали «Иркутск-Слюдянка». Отмечены случаи нападения клещей D. silvarum и на территории микрорайонов города Иркутска: Ново-Ленино, Радищева, Приморского, Зеленого.

В последние годы отмечается выявление новых риккетсий группы КПЛ, связанное с совершенствованием методов их идентификации, но вклад риккетсий данных генотипов в патологию человека до сих пор остается неясным. В связи с этим представляло интерес изучение генетического разнообразия риккетсий группы КПЛ, циркулирующих на территории Иркутской области. Уточнение спектра циркулирующих в регионе риккетсий и их возможных переносчиков имеет огромное значение для совершенствования диагностики КР и дальнейшей разработки средств специфической профилактики этого заболевания.

В исследование были взяты 120 клещей из различных районов Иркутской области, Республики Бурятия и УОБАО. Обнаружение риккетсий проводили в трех видах клещей – I. persulcatus, D. silvarum и D. nuttalli, которые были доставлены в Центр диагностики и профилактики трансмиссивных инфекций в период с 9 мая по 3 сентября 2003 гг. пострадавшими от их укусов людьми. Для детекции риккетсий использовали праймеры на основе консенcуса нуклеотидных последовательностей гена rOmpA риккетсий группы КПЛ. Большинство исследованных клещей (45,8 %) были доставлены из Усть-Ордынского, Эхирит-Булагатского, Баяндаевского, Осинского, Ольхонского районов УОБАО. Именно эти районы в основном и обеспечивают заболеваемость КР в Иркутской области. ДНК риккетсий в этих клещах обнаружена в 60,0±6,6 % случаев (табл. 11).

Таблица 11

Результаты исследования клещей на наличие ДНК риккетсий группы КПЛ

Вид клеща

Всего исследовано
образцов

Количество проб, положительных в ПЦР

абс. / (M±m %)

I. persulcatus

33

16 / (48,5±8,7)

D. silvarum

73

37 / (50,6±5,9)

D. nuttalli

14

13 / (92,9±6,9)

ВСЕГО:

120

66 / (55,0±4,5)

42,5 % исследованных проб составили клещи из Иркутского района. Зараженность их риккетсиями также была высокой (52,9±6,9 %). В результате исследования было обнаружено 13 микстинфицированных клещей (10,8 %). Восемь из них содержали ДНК риккетсий и антиген вируса КЭ в низкой концентрации, четыре – риккетсии и боррелии, а в одном – обнаружены все три вида возбудителя одновременно.

На следующем этапе был проведен анализ полученных амплифицированных фрагментов. У одного из образцов структура фрагмента гена rOmpA была изучена с помощью секвенирования, по результатам исследования он был отнесен к R. sibirica. Полученные ПЦР-фрагменты остальных образцов затем были обработаны рестриктазами Pvu II и KspII. Данные рестриктазы позволяли отличать R. sibirica от риккетсий, близких к R. montanensis. Ни один из исследованных образцов не содержал сайта рестрикции для Pvu II, т.е. все они отличались от R. sibirica. Один образец не содержал сайта рестрикции для Ksp II, все же остальные образцы разрезались рестриктазой
Ksp II на два фрагмента, как и риккетсии группы R. montanensis. Две пробы давали двойную полосу, что может свидетельствовать о микстинфицированности данных клещей двумя видами риккетсий группы КПЛ. Обе пробы ДНК были получены из клещей
I. persulcatus.

Таким образом, в результате исследований было еще раз подтверждено, что на территории Иркутской области и Бурятии циркулируют риккетсии, относящиеся к двум группам – к группе R. sibirica и группе, близкой к R. montanensis. Большинство из детектируемых риккетсий по первичной структуре гена поверхностного мембранного белка rOmpA отличается от R. sibirica и, следовательно, их патогенность для человека не установлена.

В 2005 г. на наличие ДНК риккетсий было исследовано 65 суспензий клещей, снятых с людей. Клещи D. silvarum в 66,6±5,8 % случаев содержали ДНК риккетсий. Зараженность клещей I. persulcatus была еще выше, в 7 из 8 исследованных клещей были обнаружены риккетсии. В ходе исследования были определены нуклеотидные последовательности фрагмента гена rOmpA длиной 337 п.н. у 9 образцов клещей
D. silvarum. По результатам секвенирования 6 из них были отнесены к группе
R. sp.DnS14, два – к группе R. sp.DnS28 и только один образец (77ChapDs) оказался генетически близок R. sibirica (рис. 6).

Этот образец был получен из клеща D. silvarum, снятого с человека, пострадавшего от его укуса на территории Усть-Ордынского района УОБАО. В дальнейшем у данного пациента развилась клиническая картина КР. При изучении с помощью ПЦР в 2005 г. 66 особей таежных клещей I. persulcatus, присутствие ДНК риккетсий было обнаружено в 18 клещах (27,3±5,5 %). По предварительным данным, в 3-х образцах установлено наличие ДНК Candidatus R. tarasevichiae, которая относится к группе риккетсий с неустановленной патогенностью для человека.

Рис 6. Филогенетическое древо риккетсий группы клещевых пятнистых лихорадок,
построенное с помощью метода neighbor-joining на основе нуклеотидных
последовательностей фрагмента гена rOmpA длиной 337 п.н.

В 2006 г. при проведении совместных исследований с сотрудниками Института химической биологии и фундаментальной медицины СО РАН (г. Новосибирск) впервые на территории Иркутской области была установлена циркуляция риккетсий
R. sp.RpA4 (R. raoultii). С помощью двухраундовой ПЦР было проанализировано 20 клещей D. silvarum из Нукутского района и 28 – из Эхирит-Булагатского района Иркутской области. На первом этапе при использовании родоспецифичных праймеров (из области гена цитратсинтазы) ДНК риккетсий выявлена в 45 образцах (93,8 %).

При проведении ПЦР с видоспецифичными праймерами (по гену rOmpA) во всех этих пробах обнаружена ДНК R. sp.RpA4. Кроме того, в 7 образцах (14,6 %) обнаружено инфицирование двумя видами риккетсий. Помимо ДНК R. sp.RpA4 в них обнаружена ДНК R. sibirica. Фрагменты четырех положительных образцов длиной около 450 н.п. были секвенированы. Результаты исследования показали их принадлежность R. sibirica.

В последнее время появились данные, свидетельствующие об участии риккетсий новых генотипов в патологии человека. Так, Л.В. Кумпан при исследовании образцов сыворотки крови от больных клещевыми инфекциями из Алтайского края и Новосибирской области было отмечено, что часть из них, не реагировавших в РСК с антигеном R. sibirica, вступала в реакцию с антигенами, приготовленными из риккетсий новых генотипов (R. sp.DnS28 и R. sp.RpA4) (Кумпан Л.В., 2006). Таких образцов крови в Новосибирской области было 6,8±1,9 %, а в Алтайском крае – 42,8±10,8 %.

С целью изучения роли различных генотипов в развитии КР в Иркутской области нами было проведено исследование 45 проб крови больных людей, в 14 из них была обнаружена ДНК риккетсий (31,1 %). У двух ампликонов были определены нуклеотидные последовательности фрагмента гена rOmpA длиной 337 п.н. Оба образца оказались генетически близки к риккетсиям группы R. sp.DnS14. Сыворотка № 2853 была взята у больного, в анамнезе которого присутствовали жалобы на высокую температуру (до 38,5С), головную боль, тошноту, появление сыпи по всему телу на 5 сутки с момента присасывания клеща. Результаты анализа крови на клещевой энцефалит и клещевой боррелиоз были отрицательными. Сыворотка № 3088 получена от больного, находящегося в реанимации ГКБ № 10. У данного больного наблюдались признаки полинейрорадикулопатии. Нападение клеща произошло в Качугском районе Иркутской области. Кроме присутствия ДНК риккетсий R. sp.DnS14, в крови было обнаружено присутствие B. garinii. Таким образом, у больного было установлено наличие микстинфекции КР и ИКБ. Сочетание двух инфекций привело к крайне тяжелому развитию заболевания. Микстинфицирование возбудителями КР и ИКБ обнаружено также в сыворотке крови № 1796 (ДНК риккетсий + ДНК B. garinii). В сыворотке крови № 2245 были детектированы одновременно РНК вируса КЭ, ДНК риккетсий и боррелий (B. garinii). У всех остальных больных, в сыворотках которых обнаружено наличие ДНК риккетсий, в анамнезе были указания на наличие лихорадки, первичного аффекта, лимфаденита или сыпи на теле.

Таким образом, результаты наших исследований подтверждают полученные ранее данные о широком распространении R. sibirica на территории Иркутской области и Республики Бурятия. Впервые в ходе работы было показано, что на территории
Иркутской области циркулируют риккетсии группы КПЛ новых генотипов с неустановленной патогенностью для человека (R. sp.DnS14, R. sp.DnS28, R. raoultii,
Candidatus R. tarasevichiae (рис. 7).

Высокая степень инфицированности клещей D. nuttalli, D. silvarum и I. persulcatus риккетсиями, расширение их ареала, рост числа обращений людей, пострадавших от укуса клещей на территории очагов КР, а также рост заболеваемости этой инфекцией, делают очевидной необходимость внедрения экстренной профилактики КР на основе результатов экспресс-определения возбудителя в клещах. Наличие смешанных инфекций КР, ИКБ и КЭ требует обязательного проведения дифференциальной экспресс-диагностики этих заболеваний и разработки мер профилактики.

Лабораторную диагностику КР затрудняет значительная генетическая вариабельность риккетсий и все еще остающаяся неясность вклада риккетсий «новых» генотипов в инфекционную патологию. Учитывая возможное присутствие в клещах непатогенных риккетсий, проводить антибиотикопрофилактику необходимо только в тех случаях, когда установлен вид риккетсий. В качестве профилактического лекарственного средства при этом заболевании С.И. Дьяков и М.А. Мисникова рекомендуют использовать рифампицин и его производные пролонгированного действия азориф и рифапентин, а также доксициклин и азитромицин (Дьяков С.И., 2000).

Рис. 7. Карта-схема распространения различных генотипов риккетсий
на территории Иркутской области

Генетическая вариабельность боррелий, циркулирующих
на территории Иркутской области

По данным ряда авторов, особенности клинического течения ИКБ и эффективность серо- и генодиагностики зависят от генетической структуры возбудителей. Поэтому очевидно, что для своевременной диагностики и терапии ИКБ необходима достоверная информация о геновидовом разнообразии боррелий, циркулирующих на данной территории и установление вклада боррелий различных геновидов в развитие региональной инфекционной патологии. Прямая микроскопия препаратов, полученных из содержимого кишечника клеща, такую информацию дать не может. К недостаткам данного метода также относится и невозможность проведения исследования в случае высокой степени «напитанности», плохой сохранности переносчика (сухие, раздавленные, фрагменты) или его отсутствии. Кроме того, с помощью микроскопии нельзя получить информацию о патогенности боррелий. По данным А.Н. Алексеева, только 85-90 % боррелий, обнаруживаемых в клещах, являются патогенными для человека (Алексеев А.Н., 2004, 2006). Следовательно, от 10 до 15 % пациентов, пострадавших от укусов клещей, могут получать антибиотикопрофилактику необоснованно. Возможно, что недостатки применяемых методов лабораторной диагностики смогло бы устранить использование ПЦР с проведением генотипирования возбудителей.

С помощью ПЦР с праймерами на основе фрагмента гена 16S pРНК было проанализировано 108 клещей, собранных с растительности, 25 суспензий и 17 мазков, приготовленных из клещей, доставленных на исследование пациентами. В работу брали только те мазки и суспензии, в которых боррелии были обнаружены ранее с помощью прямой микроскопии. Специфичные фрагменты ДНК удалось получить из 6
(24,0 %) суспензий и 6 мазков (35,3 %). Низкий процент положительных ответов из образцов, заведомо содержавших боррелии, объясняется, прежде всего, тем, что ДНК в суспензиях, и особенно в мазках, подвергается разрушению в процессе подготовки к исследованиям (фиксация пламенем, окраска мазков, приготовление суспензий) и при последующем хранении. Для генотипирования использовали 2 фрагмента (длина 337 н.о.), полученных из суспензий клещей и 1 фрагмент, полученный из мазка. Один образец из суспензии клещей был полностью гомологичен B. garinii (гомология 100 %), а уровень гомологии образца из мазка и B. afzelii НТ61 составил 99 %. Еще один образец из суспензии клещей принадлежал к той же группе, в которую входят изоляты B. japonica и B. afzelii. Его установленная нуклеотидная последовательность оказалась сходной с последовательностями японских изолятов B. afzelii НТ61 (98 % гомологии) и J1 (97 %).

В 2003 г. с целью обнаружения ДНК боррелий в различных видах материала, полученного от пострадавших от укуса клещей людей, нами была применена ПЦР. ПЦР-анализ проводили с коммерческим набором «Хеликс» и собственными наборами реактивов на основе праймеров к генам 16S рРНК и флагеллина. Исследовали различные образцы биологического материала: кровь, мочу, напитавшихся имаго I. persulcatus, суспензии клещей, оставшиеся после постановки ИФА (табл. 12). ДНК боррелий обнаружена в 8,8 % клещей I. persulcatus. При изучении 22 проб напитавшихся имаго клещей, ДНК возбудителя ИКБ была обнаружена в восьми из них. Зараженность напитавшихся клещей по данным ПЦР составила 36,4 %. Этот результат важен, т.к. именно клещи с продолжительностью питания от 24 часов и больше являются наиболее опасными для человека в плане передачи ему боррелиозной инфекции. Была показана возможность использования ПЦР для детекции боррелий в напитавшихся, сухих клещах и фрагментах клещей, что не удается при использовании прямой микроскопии.

Таблица 12

Результаты исследования материала на наличие ДНК боррелий с помощью ПЦР

Вид материала

Количество исследованных проб

Количество позитивных проб в ПЦР

абс. / (M±m)

Суспензии клещей I. persulcatus

135

12 / (8,9±2,5)

Напитавшиеся клещи I. persulcatus, снятые с людей

23

9 / (39,1±10,2)

Сыворотки крови от больных ИКБ людей

9

1 / (11,1±10,5)

Моча от больных ИКБ людей

9

2 / (22,2±13,9)

ВСЕГО:

клещи

158

21 / (13,3±2,7)

материал от больных

18

3 / (16,6±8,8)

Исследовали также возможность параллельного проведения анализа на наличие антигена вируса КЭ и боррелий (ИФА и ПЦР). Нами показано, что в процессе приготовления суспензий клещей для ИФА и их хранении, происходит разрушение ДНК боррелий, поэтому ее выделение нужно проводить сразу после гомогенизации клеща, до исследования в ИФА. В ходе работы также было сделано заключение о том, что для повышения достоверности ПЦР необходимо исследовать сразу несколько клинических образцов материала от одного и того же больного (кровь и моча, СМЖ и кровь, синовиальная жидкость и кровь и т.д.).

С целью определения геновида боррелий, циркулирующих на территории Иркутской области и принимающих участие в развитии ИКБ у людей, в 2004–2005 гг. было проведено типирование 59 образцов сыворотки крови, взятых в разные сроки с момента укуса клеща (табл. 13).

Таблица 13

Результаты исследования в ПЦР сывороток крови людей

Число исследованных сывороток

Положительный результат

в том числе

Отрицательный результат

абс.

% (±m)

абс.

% (±m)

Только

B. garinii

абс.

% (±m)

только

B. afzelii

абс.

% (±m)

B. garinii + B. afzelii абс.

% (±m)

59

20

(33,9±6,2)

11

(18,6±5,1)

2

(3,4±2,4)

7

(11,9±4,2)

39

(66,1±6,1)

Проведенные исследования позволили установить, что в 11 пробах содержится ДНК B. garinii, в 2-х образцах генотипирована B. afzelii. В 7 пробах одновременно присутствовала ДНК B. garinii и B. afzelii.

6 проб крови были получены от пациентов, обратившихся за помощью в ранние сроки с момента укуса (от 3 до 8 дней). Клещи, покусавшие этих пациентов, не были исследованы. Во всех 6 пробах обнаружено присутствие B. garinii. Использование ПЦР в этих случаях позволило провести детекцию боррелий в крови в ранние сроки, назначить данным пациентам доксициклин с профилактической целью и предотвратить развитие заболевания.

Остальные образцы крови были взяты в поздние сроки с момента укуса (от 1 месяца до 2 лет). В 11 случаях с помощью ПЦР удалось провести контроль эффективности антибиотикопрофилактики и лечения ИКБ. ДНК боррелий в этих сыворотках не обнаружена. В других случаях использование ПЦР позволило провести дифференциальную экспресс-диагностику ИКБ и других трансмиссивных клещевых инфекций и исключить роль боррелий как возможных этиологических агентов данных заболеваний. Еще у одного больного было зафиксировано наличие микстинфекции (ИКБ и КР), одновременное заражение двумя возбудителями различных инфекций (B. garinii и риккетсии) вызвало у него крайне тяжелое течение заболевания с необходимостью лечения в отделении интенсивной терапии.

Таким образом, было показано, что ПЦР может широко использоваться для целей экспресс-диагностики ИКБ. Кроме того, ее внедрение в практику позволит устранить ряд недостатков, которыми обладает прямая микроскопия. Использование ПЦР дает возможность исследовать напитавшихся, сухих клещей, фрагменты клещей и обнаруживать боррелии в крови пациентов в ранние сроки с момента укуса. С помощью этого метода можно проводить определение возбудителя до геновида, диагностику микстформ инфекций, выявлять случаи повторных заражений, проводить контроль эффективности профилактики и терапии в отношении разных геновидов боррелий.

Использование ПЦР позволило получить достоверную информацию о генетической вариабельности возбудителей ИКБ, циркулирующих на территории Иркутской области. Результаты этих исследований подтвердили полученные ранее данные об обнаружении на территории Иркутской области двух геновидов боррелий – B. garinii и B. afzelii и получить доказательства участия этих геновидов в развитии ИКБ у больных в Прибайкалье. Учитывая широкое распространение B. garinii и B. afzelii на данной территории, при проведении лабораторной диагностики ИКБ целесообразным было бы использование диагностикумов на основе этих двух геновидов. Хотя для более корректного заключения о роли различных генотипов в развитии ИКБ в Иркутской области исследования в этом направлении должны быть продолжены.

Результаты рекогносцировочных исследований эпидемиологической ситуации в отношении моноцитарного эрлихиоза и гранулоцитарного анаплазмоза человека в Прибайкалье

На территории Прибайкалья сложились все биоценотические предпосылки для существования очагов МЭЧ и ГАЧ. В пользу этого же предположения можно отнести и тот факт, что 14,6 % случаев сезонных лихорадок у больных, находящихся на лечении в городской инфекционной больнице после укуса клещей, остаются нерасшифрованными. Все это свидетельствует о необходимости проведения поисковых исследований на наличие очагов МЭЧ и ГАЧ на данной территории.

В последние годы в литературе появились сообщения о тестировании крови больных с отрицательными результатами на КЭ и ИКБ с целью выявления возбудителей других инфекций. Описаны случаи микстинфекции ИКБ и эрлихиозов (Григорян Е.В., 2001; Дроздов В.Н., 2006; Дубинина И.В., 1999; Мебель Б.Д., 1998; Коренберг Э.И., 1987, 1991, 1993, 1994, 1999). С целью выяснения возможной роли в инфекционной патологии Восточной Сибири возбудителей МЭЧ и ГАЧ нами проведено ретроспективное изучение материалов, полученных от людей с лихорадкой неясной этиологии или укусом клеща в анамнезе.

Исследование проб сыворотки крови на наличие IgM и IgG-антител к возбудителю МЭЧ проводили с помощью иммуноферментных тест-систем производства фирмы «Омникс» (С-Петербург), в которых используется композиция рекомбинантных белков эрлихий E. chaffeensis и E. muris. Для обнаружения IgM- и IgG-антител к возбудителю ГАЧ использовали диагностическую тест-систему на основе рекомбинантных белков Anaplasma phagocytophilum. Суммарные данные по тестированию проб сыворотки крови за период с 2003-2006 гг. приведены в таблице 14.

Таблица 14

Суммарные результаты ретроспективного изучения проб сыворотки крови больных за период с 2003 по 2006 гг.

Наличие антител к возбудителям МЭЧ, ГАЧ

Число обследованных проб сыворотки

Число положительных проб сыворотки

Абс.

%(±m)

МЭЧ – IgM

МЭЧ – IgG

644

644

2

5

0,3±0,2

0,8±0,4

МЭЧ -IgM +ИКБ

644

2

0,3±0,2

ГАЧ- IgM

ГАЧ- IgG

460

460

5

3

1,1±0,4

0,7±0,3

IgM-ГАЧ+ИКБ

IgG- ГАЧ+ИКБ

IgM+IgG ГАЧ + ИКБ

IgG ГАЧ + антиген ВКЭ

460

460

460

460

2

1

1

1

0,4±0,3

0,2±0,2

0,2±0,2

0,2±0,2

Из 644 исследованных проб сыворотки антитела к возбудителю МЭЧ обнаружены в 7 пробах (1,1±0,4). При исследовании 460 образцов крови людей, пострадавших от укуса клещей, антитела к возбудителю ГАЧ в виде моноинфекции – обнаружены в 8 (1,7±0,6 %) случаях.

Особую группу составили больные люди, у которых положительная сероконверсия к анаплазмам и эрлихиям сочеталась с обнаружением антител к возбудителям ИКБ или вирусу КЭ. В 2-х пробах одновременно выявлены IgM-антитела к возбудителям МЭЧ и ИКБ (0,3±0,2 %). Зафиксированы случаи микстинфекций ГАЧ и ИКБ (0,9±0,4 %). Так, две образца сыворотки крови давали положительный результат в НРИФ с боррелиозным антигеном и в ИФА с возбудителем ГАЧ.

Эти пробы крови были получены от больных, госпитализированных в инфекционный стационар по поводу заболевания, возникшего после укуса клеща. ИКБ в обоих случаях протекал без наличия кольцевой мигрирующей эритемы. Еще в одной пробе крови одновременно были обнаружены антитела к возбудителю ГАЧ, а также с помощью НРИФ и ИФА – антитела к возбудителю ИКБ. Затем данные о наличии у пациента боррелиозной инфекции были подтверждены с помощью ПЦР. Результаты генотипирования показали, что у данного больного в сыворотке крови присутствует B. afzelii. Пациент за профилактической помощью по поводу присасывания клеща не обращался. Спустя три недели на месте укуса возникла эритема. Одновременно антитела к возбудителю ГАЧ и ИКБ обнаружены и в сыворотке крови больного, который обратился за диагностической помощью спустя месяц после укуса клеща, с появлением в месте укуса эритемы. Выявлена 1 проба крови, в которой одновременно присутствовали антиген вируса КЭ и IgG-антитела к возбудителю ГАЧ. Учитывая, что с момента укуса клещом прошло всего 3 дня, вероятнее всего, что антитела к возбудителю ГАЧ у данного пациента сформировались в результате предыдущих укусов.

Путем сбора анамнеза у пациентов с положительными результатами анализа на наличие антител к возбудителям МЭЧ и ГАЧ были выявлены основные места нападения клещей, зараженных данными возбудителями. Так, у людей, снявших с себя клещей, содержащих эрлихии, зафиксированы укусы на территории Шелеховского, Усольского, Усть-Ордынского, Ольхонского и Осинского районов Иркутской области. Наличие антител к возбудителю ГАЧ выявлено у людей, пострадавших от укусов клещей на территории Иркутского, Шелеховского, Баяндаевского и Куйтунского районов. Эти данные могут свидетельствовать в пользу широкого распространения очагов возбудителей МЭЧ и ГАЧ на территории области. Впервые в Иркутской области осуществлена серологическая верификация случаев МЭЧ и ГАЧ. Благодаря ретроспективному исследованию крови на наличие антител к возбудителям МЭЧ и ГАЧ удалось провести этиологическую расшифровку 3,4±0,7 % случаев лихорадок неясной этиологии. На основании полученных данных уточнена этиологическая структура заболеваемости клещевыми инфекциями на территории Иркутской области.

С целью доказательства существования природных очагов МЭЧ и ГАЧ на территории Прибайкалья в 2004 г. нами было проведено исследование 40 суспензий клещей
I. persulcatus и 34 проб крови людей, пострадавших от укуса клещей. Для ПЦР были использованы праймеры к участкам гена 16S RNA, амплифицирующие фрагмент ДНК длиной 450-500 п.о. и ПЦР-диагностикумы «Ehr. Ehrlichia spp.» производства фирмы «Биолот» (Санкт-Петербург). Положительных проб в клещах и крови больных людей не выявлено.

В 2006 г. при проведении совместных исследований с сотрудниками Института химической биологии и фундаментальной медицины СО РАН (г. Новосибирск) Было исследовано 48 клещей I. persulcatus из Слюдянского района Иркутской области. ДНК эрлихий и анаплазм выявляли методом «nested» ПЦР с использованием родоспецифичных праймеров из области гена 16S рРНК. Видовую принадлежность и генетические варианты выявленных анаплазм и эрлихий определяли при проведении ПЦР с использованием праймеров, специфичных для A. phagocytophilum и E. muris. Суммарные данные результатов исследования клещей I. persulcatus, собранных на территории Иркутской области, на наличие ДНК анаплазм и эрлихий приведены в таблице 15.

Таблица 15

Результаты исследования клещей на наличие ДНК анаплазм и эрлихий (ПЦР, 2006 г.)

Количество исследованных клещей

I. persulcatus

Количество клещей, содержащих ДНК:

A. phagocytophilum

E. muris

A. phagocytophilum
+ E. muris

“Candidatus

Neoehrlichia mikurensis”

98

4 / 4,1

14 / 14,3

1 / 1,0

1 / 1,0

Примечание: числитель – абсолютные цифры; знаменатель –  %.

ДНК E. muris была обнаружена в 5 образцах (10,4 %), ДНК A. phagocytophilum – в одном образце клещей (2,1 %), одновременно два этих вида возбудителей детектированы также в одной пробе (2,1 %). При исследовании 50 клещей из Иркутского района ДНК E. muris обнаружена в 9 пробах (18,0 %), ДНК A. phagocytophilum – в трех (6,0 %). Кроме того, в результате исследования в одном из клещей генотипирована “Candidatus Neoehrlichia mikurensis”. Идентификация образца была проведена путем секвенирования фрагмента гена 16S рРНК длиной 473 п.н. Сравнение первичной структуры амплифицированного фрагмента с нуклеотидными структурами микроорганизмов семейства Anaplasmataceae, имеющимися в GenBank, показало его идентичность соответствующему участку “Candidatus Neoehrlichia mikurensis” (GenBank AB196305) (рис. 8).

Рис. 8. Филогенетическое древо микроорганизмов семейства Anaplasmataceae,
построенное на основе анализа нуклеотидных последовательностей фрагмента гена
16S рРНК (473 п.н.) c применением программ MEGA 3.0 (метод Kumar S. et al., 2004)

Примечание: красным цветом выделена эрлихия, обнаруженная в клеще I. persulcatus
в Иркутской области, в скобках указаны номера в GenBank для ранее опубликованных последовательностей.
Шкала представляет 1 % дивергенции.

Впервые этот вид был обнаружен в Японии в клещах Ixodes ovatus и грызунах (Kawahara M., 2004). В настоящее время “Candidatus Neoehrlichia mikurensis” генотипирована в образцах крови и селезенки Microtus rossiaemeridionalis из Новосибирской области (Rar V., 2006). На филогенетическом древе Candidatus “Neoehrlichia mikurensis” образует самостоятельную ветвь и имеет 100 % гомологию с «Ehrlichia-like» sp. Schotti variant (GenBank AF104680). Этот вид был описан ранее при исследовании клещей
I. ricinus, инфицированных A. phagocytophilum, собранных в Голландии (Schouls L.M., 1999), а также генотипирован в клещах I. persulcatus из Омской области (Shpynov S., 2006). Данные о патогенности «Ehrlichia-like» sp. Schotti variant для теплокровных отсутствуют.

Основные места контакта населения Иркутской области с возбудителями МЭЧ и ГАЧ, установленные на основании серологических и молекулярно-генетических исследований показаны на рисунке 9.

Рис. 9. Карта-схема основных мест контакта населения Иркутской области
с возбудителями МЭЧ и ГАЧ, установленных на основании серологических
и молекулярно-генетических исследований

Таким образом, в ходе данных исследований впервые установлено существование на территории Прибайкалья природных очагов МЭЧ и ГАЧ. С помощью двухраундовой ПЦР, позволяющей генотипировать возбудителей, доказана циркуляция на территории Иркутской области E. muris, A. phagocytophilum и “Candidatus Neoehrlichia mikurensis”.

Полученные в ходе работы материалы свидетельствуют о том, что для Восточной Сибири, наряду с существовавшими проблемами профилактики и лечения таких клещевых инфекций, как КЭ, КР и ИКБ, выявлены новые проблемы, связанные с необходимостью изучения этиологии и эпидемиологии, а также осуществлением диагностики, лечения и профилактики заболеваний эрлихиозной природы.

Наиболее эффективными и доступными средствами этиотропной терапии для указанных заболеваний являются препараты группы тетрациклинов (Лобзин К.М., 2002). Оценка чувствительности возбудителя моноцитарного эрлихиоза человека E. chaffeensis к различным антибиотикам показала перспективность назначения рифампицина и доксициклина (Лобзин К.М., 2002). В клинической практике целесообразно использование доксициклина, а для лечения эрлихиоза у детей – применение рифампицина (Walker D.H., 1996). Гранулоцитарный анаплазмоз успешно излечивается тетрациклинами (Bakken J.S., 1996, 2000). Экстренная специфическая профилактика МЭЧ и ГАЧ может осуществляться однократным приемом этих же антибиотиков (Лобзин К.М., 2002).

Вопросы совершенствования лабораторной диагностики и профилактики клещевых инфекций

В литературе последних лет особое внимание уделяется фактам возможного одновременного инфицирования лиц, отмечавших присасывание клеща, возбудителями сразу нескольких трансмиссивных заболеваний. Появились сообщения о случаях сочетанного инфицирования вирусом КЭ и боррелиями на различных территориях России (Алексеев А.Н., 2001, 2004; Амосов М.Л., 1998; Леонова Г.Н., 2005; Лобзин Ю.В., 2000; Коренберг Э.И., 2001; Наумов Р.Л., 2002). Так, Э.И. Коренберг считает, что широкое распространение природно-очаговых микстинфекций, передающихся клещами, – это нормальное, закономерное явление в природных очагах, которое встречается значительно чаще, чем моноинфекция (Коренберг Э.И., 2001). В настоящее время диагностированы смешанные инфекции боррелиозно-эрлихиозной природы (Алексеев А.Н., 2004), энцефалитно-бабезиозные (Семенов А.В., 2003), риккетсиозно-энцефалитные (Леонова Г.Н., 2005) и др.

Поскольку на территории Иркутской области большинство очагов трансмиссивных клещевых инфекций является совмещенными, каждое инфицирование, которое может возникнуть в результате укуса клеща, необходимо рассматривать как потенциальную микстинфекцию. Для проведения адекватных профилактических мероприятий необходим скрининг снятых с людей переносчиков, который должен предусматривать комплекс исследований, проводимых с целью одновременного обнаружения всех возбудителей, передаваемых через укус клещей.

В настоящее время наиболее эффективным методом детекции возбудителей клещевых инфекций является ПЦР. Для одновременного обнаружения в клещах возбудителей КЭ, ИКБ, КР, МЭЧ и ГАЧ нами использован комплекс диагностических методов (ПЦР, ИФА, микроскопия содержимого кишечника клеща). Было исследовано 40 клещей I. persulcatus, доставленных на исследование пациентами, пострадавшими от укусов клещей. С помощью ИФА антиген вируса КЭ обнаружен в 11 пробах клещей (27,5 %), применение ПЦР показало наличие РНК вируса КЭ только в 4 образцах (10,0 %). При использовании прямой микроскопии боррелии в содержимом среднего отдела кишечника клеща обнаружены в 3-х случаях (7,7 %), а при применении ПЦР – все пробы оказались отрицательными. Ни одна из 40 проб не содержала ДНК эрлихий. Из 8 суспензий, исследованных на наличие риккетсий, в 2-х пробах (25,0 %) обнаружена ДНК данных возбудителей. Таким образом, с помощью комплекса экспресс-тестов нами была показана принципиальная возможность одновременного определения инфицированности переносчиков возбудителями сразу нескольких клещевых инфекций. Для корректного сравнения эффективности каждого из применяемых методов с эффективностью ПЦР исследования в этом направлении должны быть продолжены.

По нашему мнению, наиболее перспективным путем повышения качества экстренной лабораторной диагностики инфекций, передаваемых через укус клеща, является сочетание уже хорошо зарекомендовавших себя в практической работе методов – ИФА (для обнаружения антигена вируса КЭ) и микроскопии (для обнаружения боррелий) с детекцией фрагментов генома возбудителей методом ПЦР. Использование комплекса методов позволит нивелировать некоторые недостатки, присущие каждому из этих методов в отдельности. Для детекции и идентификации возбудителей мы предлагаем применение двухраундовой ПЦР с использованием в первом раунде праймеров к высоко консервативным участкам генома, позволяющим детектировать многие патогены, принадлежащие одному роду, а во втором – праймеры, специфичные к определенному виду патогенов. При наличии в клеще патогенных для человека возбудителей рекомендуется проведение профилактических мероприятий. Такой подход может быть применен для целей экстренной комплексной диагностики широкого спектра возбудителей, передаваемых через укус клеща. Нами составлен алгоритм скрининга снятых с людей иксодовых клещей для выявления всего спектра возбудителей клещевых инфекций, циркулирующих на территории Прибайкалья и разработана тактика проведения профилактических мероприятий (рис. 10).

Таким образом, по нашему мнению, современный подход к экстренной профилактике в совмещенных природных очагах клещевых инфекций должен носить комплексный характер (т.е. быть направленным против всех известных патогенов, переносимых клещами) и основываться на скрининге лиц, подвергшихся высокой вероятности инфицирования. Именно в таком виде, в варианте наибольшей эффективности экстренная профилактика должна занять прочное место в системе мер защиты населения от клещевых инфекций, включающих также вакцинопрофилактику, коллективную и личную неспецифическую профилактику.

ВЫВОДЫ

  1. На территории Иркутской области и в рекреационных зонах г. Иркутска существуют сочетанные очаги КЭ, ИКБ, КР, МЭЧ и ГАЧ.
  2. В условиях слабого охвата населения вакцинацией против КЭ, а также низкого уровня проведения мероприятий по неспецифической профилактике КЭ и других клещевых инфекций большое значение приобретают разработка и внедрение комплекса экстренных мер по дифференциальной диагностике и специфической профилактике клещевых инфекций, осуществляемых после присасывания зараженного переносчика.
  3. Разработанный алгоритм лабораторных исследований позволяет проводить надёжное выявление в клещах возбудителей КЭ и ИКБ, оценивать риск заражения и развития этих инфекций у людей. Для индикации антигена вируса КЭ и его количественного определения в клещах, крови пациентов методами выбора являются ИФА и ОТ-ПЦР, а для обнаружения в клещах боррелий – прямая микроскопия и ПЦР.
  4. Предлагаемая тактика профилактики КЭ, ИКБ и других клещевых инфекций, основанная на результатах экспресс-определения возбудителей, позволяет конкретизировать показания к введению специфического иммуноглобулина (в случае обнаружения антигена вируса КЭ) и назначению антибиотиков (в случае выявления в клеще боррелий, риккетсий, эрлихий, анаплазм). Эпидемиологическая эффективность экстренной профилактики КЭ и ИКБ, основанной на результатах экспресс-исследования, составляет 99,2 % и 99,3 % соответственно.
  5. Получена достоверная информация о генетической вариабельности возбудителей ИКБ в Иркутской области. Результаты исследований подтвердили данные о циркуляции на территории области B. garinii и B. afzelii и позволили получить доказательства участия этих геновидов боррелий в формировании заболеваемости.
  6. Современная эпидемиологическая обстановка в отношении КР, а также высокая степень инфицированности клещей D. nuttalli, D. silvarum и I. persulcatus риккетсиями группы КПЛ свидетельствуют о необходимости внедрения в практику методов экспресс-диагностики и экстренной профилактики данного заболевания.
  7. Выявлена значительная генетическая вариабельность риккетсий, циркулирующих на территории региона. Наряду с R. sibirica обнаружены риккетсии новых генотипов, в том числе, с неустановленной патогенностью для человека (R. sp.DnS14,
    R. sp.DnS28, R. raoultii, Candidatus R. tarasevichiae).
  8. На территории Иркутской области впервые выявлено наличие природных очагов МЭЧ и ГАЧ с циркуляцией в них E. muris, A. phagocytophilum и Candidatus «Neoehrlichia mikurensis». Обнаружена высокая степень зараженности клещей I. persulcatus анаплазмами, эрлихиями и возможность микстинфицирования клещей этими возбудителями. Ретроспективное исследование сывороток на наличие антител к возбудителям МЭЧ и ГАЧ позволило провести этиологическую расшифровку 3,4±0,7 % случаев лихорадок неясной этиологии, что обосновывает значение анаплазм и эрлихий в региональной инфекционной патологии.
  9. Современный подход к экстренной профилактике в сочетанных природных очагах клещевых инфекций должен носить комплексный характер (т.е. быть направленным против всех известных патогенов, переносимых клещами) и основываться на скрининге лиц, высокая вероятность инфицирования которых установлена с помощью лабораторных исследований.

СПИСОК УСЛОВНЫХ СОКРАЩЕНИЙ

ВСИ         высокая степень инфицированности боррелиями

ГАЧ                 гранулоцитарный анаплазмоз человека

ДНК                 дезоксирибонуклеиновая кислота

ИФА         иммуноферментный анализ

ИКБ         иксодовые клещевые боррелиозы

КПЛ         группа клещевой пятнистой лихорадки

КР                – клещевой риккетсиоз

КЭ                – клещевой энцефалит

МГНК         молекулярная гибридизация нуклеиновых кислот

МЭЧ         моноцитарный эрлихиоз человека

н.о. (п.о.)        – нуклеотидные основания (количество пар оснований)

ОТ-ПЦР        – обратная транскрипция полимеразной цепной реакции

ПДРФ         полиморфизм длин рестриктных фрагментов

ПЦР                 полимеразная цепная реакция

п.з.                 поле зрения

НРИФ        – реакция непрямой иммунофлюоресценции

РНК (RNA)        – рибонуклеиновая кислота

рРНК        – рибосомальная РНК

СПЭВ         культура клеток почки эмбриона свиньи

УОБАО        – Усть-Ордынский Бурятский автономный округ

nested-ПЦР        – двухраундовая ПЦР

OspA        – поверхностный мембранный белок А

p41                – белок боррелий флагеллин с молекулярной массой 41 kDa

p66                – белок мембранной основы с молекулярной массой 66 kDa

rrf(5S)-rrl(23S) – межгенный спейсерный регион боррелий

16S, 23S          – коэффициенты седиментации

СПИСОК ОСНОВНЫХ РАБОТ, ОПУБЛИКОВАННЫХ
ПО ТЕМЕ ДИССЕРТАЦИИ

  1. Географическое распространение генетических вариантов вируса клещевого энцефалита / В.И. Злобин, В.А. Шаманин, Д.А. Дрокин, Ю.П. Джиоев, И.В. Воронко,
    О.В. Мельникова, Н.А. Гусарова, Т.В. Вихорева, И.В. Козлова // Вопросы вирусологии. – 1992. – № 5–6. – С. 252–256.
  2. Genetic variation among tick-borne encephalitis virus strains / V.I. Zlobin,
    L.V. Mamaev, O.Z. Gorin, Yu.P. Dzhioev, I.V. Kozlova et al. // J. Clin. Microb. and Infect. – 1997. – Vol. 3. – Suppl. 2. – P. 1389.
  3. Some problems of vector-borne infections epidemiology and prophylaxis in Siberia / O. Gorin, V. Zlobin, L. Ivanova, L. Chernogor, O. Suntsova, I. Kozlova et al. // Journal of Clin. Microb. and Infect. – 1997. – Vol. 3. – Suppl. 2. – P. 1390.
  4. Анализ генетической вариабельности штаммов вируса клещевого энцефалита по первичной структуре фрагмента гена белка Е / В.И. Злобин, Т.В. Демина, Л.В. Мамаев, Т.В. Бутина, С.И. Беликов, О.З. Горин, Ю.П. Джиоев, М.М. Верхозина, И.В. Козлова и др. // Вопросы вирусологии – 2001. – № 1. – С. 12–16.
  5. Гено- и фенотипическая гетерогенность вируса клещевого энцефалита и проблемы конструирования вакцинных препаратов / В.И. Вотяков, Л.П. Титов, В.И. Злобин, Ю.П. Джиоев, И.И. Протас, Т.И. Самойлова, Т.В. Амвросьева, И.В. Козлова и др. // Здравоохранение. – Минск, 2001. – № 11. – С. 29–31.
  6. Молекулярные зонды для генетического типирования вируса клещевого энцефалита / В.И. Злобин, М.Х. Газо, С.И. Беликов, Ю.П. Джиоев, Т.В. Демина, М.М. Верхозина, И.В. Козлова и др. // Вопросы вирусологии – 2001. – № 4. – С. 43–47.
  7. Молекулярно-эпидемиологическая характеристика региональной популяции вируса клещевого энцефалита Восточной Сибири / М.М. Верхозина, И.В. Козлова,
    Т.В. Демина, М. Газо и др. // Тихоокеанский медицинский журнал. – Владивосток, 2001. – № 2(7). – С. 118.
  8. Новая концепция природной генетической вариабельности вируса клещевого энцефалита / В.И. Злобин, С.И. Беликов, Ю.П. Джиоев, Т.В. Демина, И.В. Козлова и др. // Тихоокеанский медицинский журнал. – Владивосток, 2001. – № 2(7). – С. 75–78.
  9. Итоги молекулярно-эпидемиологических исследований клещевого энцефалита в институте эпидемиологии и микробиологии НЦ МЭ ВСНЦ СО РАМН (1988–2002) / В.И. Злобин, С.И. Беликов, Л.В. Мамаев, О.З. Горин, Ю.П. Джиоев, И.В. Козлова и др. // Бюллетень ВСНЦ СО РАМН. – 2002. – Т. 2, № 4. – С. 9–13.
  10. Молекулярная эпидемиология и генетическая характеристика урало-сибирского генотипа вируса клещевого энцефалита / И.В. Козлова, В.И. Злобин, М.М. Верхозина, Т.В. Демина и др. // Бюллетень ВСНЦ СО РАМН – 2002. – Т. 2, № 4. – С. 70–73.
  11. Молекулярно-эпидемиологическая характеристика региональной популяции вируса клещевого энцефалита Восточной Сибири / М.М Верхозина, В.И. Злобин,
    И.В. Козлова, С.И. Беликов и др. // Бюллетень ВСНЦ СО РАМН. – 2002. – Т. 2, № 4. – С. 46–49.
  12. Эпидемиология и профилактика иксодовых клещевых боррелиозов в Прибайкалье / Л.И. Черногор, Е.В. Арбатская, М.А. Хаснатинов, Г.А. Данчинова, О.В. Сунцова, М.О. Горина, Л.Б. Бадуева, В.А. Борисов, И.В. Козлова и др. // Бюллетень ВСНЦ СО РАМН. – 2002. – Т. 2, № 4. – С. 133–135.
  13. Генотипирование штаммов, выделенных от больных различными формами клещевого энцефалита в Восточной Сибири / И.В. Козлова, М.М. Верхозина, Н.В. Кулакова, В.И. Злобин и др. // Материалы расширенного пленума проблемной комиссии «Клещевой и другие вирусные энцефалиты» РАМН. – М., 2003. – С. 19–20.
  14. Генотипирование штаммов вируса клещевого энцефалита методом секвенирования фрагментов генома / Р.В. Адельшин, Е.А. Покорская, В.И. Злобин, М.М. Верхозина, И.В. Козлова и др. // Бюллетень ВСНЦ СО РАМН. – 2003. – № 7. – С. 12–13.
  15. Молекулярная эпидемиология клещевого энцефалита / В.И. Злобин, С.И. Беликов, Ю.П. Джиоев, Т.В. Демина, И.В. Козлова. – Иркутск: РИО ВСНЦ СО РАМН, 2003. – 272 с.
  16. Опыт работы по экстренной диагностике и профилактике клещевого энцефалита и иксодового клещевого боррелиоза в г. Иркутске / И.В. Козлова, О.З. Горин,
    В.И. Злобин, Г.А. Данчинова и др. // Материалы расширенного пленума проблемной комиссии «Клещевой и другие вирусные энцефалиты» РАМН. – М., 2003. – С. 63–64.
  17. Специфическое определение флавивирусов методом молекулярной гибридизации с синтетическими дезоксиолигонуклеотидными зондами / В.И. Злобин, В.В. Погодина, Д.А. Дрокин, М.Х. Газо, Н.Г. Бочкова, Ю.П. Джиоев, Т.В. Демина, С.И. Беликов, И.В. Козлова и др. // Вопросы вирусологии. – 2003. – №3. – С. 23–27.
  18. Изменения в структуре заболеваемости клещевым энцефалитом населения Иркутской области в 1993–2003 гг. / И.Г. Чумаченко, Л.А. Логиновская, О.Л. Богомазова, В.А. Борисов, К.А. Аитов, И.В. Малов, Г.А. Данчинова, И.В. Козлова // Бюллетень ВСНЦ СО РАМН. – 2004. – Т. 3, № 1. – С. 170–173.
  19. Клещевой риккетсиоз в Прибайкалье / К.А. Аитов, И.В. Малов, В.И. Злобин, В.М. Коган, И.В. Козлова // Бюллетень ВСНЦ СО РАМН. – 2004. – Т. 3, № 1. – С. 66–72.
  20. Клинические формы клещевого энцефалита в зависимости от инфицированности в различных регионах Иркутской области / В.А. Борисов, К.А. Аитов, И.В. Козлова, М.М. Верхозина и др. // Бюллетень ВСНЦ СО РАМН. – 2004 – Т. 3, № 1. – С. 92–95.
  21. Комплексная экстренная диагностика и специфическая профилактика природно-очаговых трансмиссивных клещевых инфекций в г. Иркутске / И.В. Козлова,
    М.М. Верхозина, М.А. Хаснатинов, С.Э. Дигас и др. // Бюллетень ВСНЦ СО РАМН. – 2004. – Т. 3, № 1. – С. 134–139.
  22. Генетическое типирование штаммов вируса клещевого энцефалита, выделенных в Республике Беларусь и на территории сопредельных государств / Р.В. Адельшин,
    В.И. Злобин, В.И. Вотяков, Л.П. Титов, Т.И. Самойлова, С.И. Беликов, М.М. Верхозина, Т.В. Демина, Ю.П. Джиоев, И.В. Козлова и др. // Здравоохранение. – Минск, 2005. – № 11. – С. 18–22.
  23. Клинико-лабораторная характеристика иксодового клещевого боррелиоза в Прибайкалье / Л.И. Черногор, Е.В. Арбатская, Г.А. Данчинова, И.В. Козлова и др. // ЖМЭИ. – 2005. – Т. 6. – С. 70–75.
  24. О роли дифференциальной диагностики и специфической профилактики клещевого энцефалита и других трансмиссивных инфекций (на примере г. Иркутска) / И.В. Козлова, М.М. Верхозина, М.А. Хаснатинов, С.Э. Дигас и др. // Труды Всероссийской научной конференции «Эпидемиология, лабораторная диагностика и профилактика вирусных инфекций». – СПб., 2005. – С. 208–211.
  25. Дифференциальная экспресс-диагностика и специфическая профилактика трансмиссивных клещевых инфекций в г. Иркутске / И.В. Козлова, М.М. Верхозина, М.А. Хаснатинов, С.Э. Дигас и др. // Современная ситуация и перспективы борьбы с клещевыми инфекциями в XXI веке : тез. Всерос. науч.-практ. конф., 14–15 февр. 2006 г. – Томск, 2006. – С. 67–69.
  26. Дифференциальная экспресс-диагностика и экстренная специфическая профилактика трансмиссивных клещевых инфекций в городе Иркутске / И.В. Козлова,
    В.И. Злобин, М.М. Верхозина, М.А. Хаснатинов // Бюлл. Сибирской медицины. – 2006. – Т. 5, прил. 1. – С. 154–160.
  27. Иксодовый клещевой боррелиоз: тактика клинико-эпидемиологического, лабораторного обследования и профилактика заболевания : метод. рекомендации. МР 3.2.002-06 / Г.А. Данчинова, И.В. Козлова, И.А. Шурыгина. – Иркутск, 2006. – 15 с.
  28. Методология дифференциальной экспресс-диагностики трансмиссивных клещевых инфекций / И.В. Козлова, М.М. Верхозина, М.А. Хаснатинов, С.Э. Дигас и др. // Современная ситуация и перспективы борьбы с клещевыми инфекциями в XXI веке : тез. Всерос. науч.-практ. конф., 14–15 февр. 2006 г. – Томск, 2006. – С. 69–71.
  29. Молекулярная эпидемиология клещевого энцефалита в европейской части России и некоторых странах Балтии, Восточной и Юго-Восточной Европы / Р.В. Адельшин, В.И. Злобин, С.И. Беликов, Ю.П. Джиоев, Т.В. Демина, М.Х. Газо, И.В. Козлова и др. // Эпидемиология и вакцинопрофилактика. – 2006. – № 2(27). – С. 27–34.
  30. Эпидемиологическая ситуация и профилактика клещевого энцефалита и других трансмиссивных клещевых инфекций в г. Иркутске / И.В. Козлова, В.И. Злобин,
    М.М. Верхозина, М.А. Хаснатинов и др. // Современная ситуация и перспективы борьбы с клещевыми инфекциями в XXI веке : тез. Всерос. науч.-практ. конф., 14–15 февр. 2006 г. – Томск, 2006. – С. 71–73.
  31. Актуальные аспекты изучения и профилактики клещевого риккетсиоза в Прибайкалье / И.В. Козлова, В.И. Злобин, М.М. Верхозина, С.Э. Дигас и др. // Бюллетень ВСНЦ СО РАМН. – 2007. – №3(55), прил. – С. 106–111.
  32. Клещевой риккетсиоз в Прибайкалье: современная эпидемиологическая ситуация и генетическая вариабельность возбудителя / И.В. Козлова, В.И. Злобин,
    М.М. Верхозина, С.Э. Дигас и др. // Эпидемиология и вакцинопрофилактика. – 2007. – № 6. – С. 16–22.
  33. Критерии риска инфицирования вирусом клещевого энцефалита лиц, покусанных клещами / И.В. Козлова, В.И. Злобин, М.М. Верхозина, О.В. Лисак и др. // Современные научные и прикладные аспекты клещевого энцефалита (К 70-летию открытия вируса клещевого энцефалита), 15–16 нояб. 2007 г. – М., 2007. – С. 58–60.
  34. Критерии риска инфицирования лиц, покусанных клещами и обоснование подходов к экстренной профилактике клещевого энцефалита и боррелиоза, основанной на результатах определения возбудителей / И.В. Козлова, В.И. Злобин, М.М. Верхозина, О.В. Лисак и др. // Бюллетень ВСНЦ СО РАМН. – 2007. – № 3(55), прил. – С. 106–111
  35. Молекулярная эпидемиология клещевого энцефалита / В.И.Злобин, М.М. Верхозина, Т.В. Демина, Ю.П. Джиоев, Р.В. Адельшин, И.В. Козлова и др. // Вопросы вирусологии. – 2007. – № 6. – С. 4–13.
  36. Применение молекулярно-генетических методов для изучения структуры штаммов вируса клещевого энцефалита / Л.С. Карань, Г.В. Маленко, Н.Г. Бочкова, Л.С. Левина, Г.П. Пиванова, Н.М. Колясникова, Е.Г. Гамова, А.Г. Трухина, В.И. Злобин,
    М.М Верхозина., И.В. Козлова и др. // Бюллетень СО РАМН. – 2007. – № 4(126). –
    С. 34–40.
  37. Проблемы профилактики трансмиссивных клещевых инфекций в условиях совмещенных природных очагов / И.В. Козлова, В.И. Злобин, М.М. Верхозина, О.В. Лисак и др. // Современные научные и прикладные аспекты клещевого энцефалита (К 70-летию открытия вируса клещевого энцефалита), 15–16 нояб. 2007 г. – М., 2007. – С. 60–61.
  38. Результаты рекогносцировочных исследований по моноцитарному эрлихиозу и гранулоцитарному анаплазмозу человека в Прибайкалье / И.В. Козлова, В.И. Злобин, М.М. Верхозина, В.А. Рар и др. // Бюллетень ВСНЦ СО РАМН. – 2007. – № 3(55), прил. – С. 112–116.
  39. Совершенствование методов экстренной лабораторной диагностики трансмиссивных клещевых инфекций в условиях сочетанных природных очагов Прибайкалья / О.В. Лисак, И.В. Козлова, М.М. Верхозина, Е.К. Дорощенко и др. // Бюллетень ВСНЦ СО РАМН. – 2007. – № 3(55), прил. – С. 131–135.
  40. Современные подходы к экстренной специфической профилактике клещевого энцефалита / И.В. Козлова, В.И. Злобин, М.М. Верхозина, Т.В. Демина и др. // Вопросы вирусологии. – 2007. – № 6. – С. 25–30.
  41. Эколого-генетический анализ региональной популяции вируса клещевого энцефалита в Восточной Сибири / М.М. Верхозина, В.И. Злобин, И.В. Козлова, Т.В. Демина и др. // Бюллетень СО РАМН. – 2007. – № 4(126). – С. 53–60.
  42. Экстренная диагностика и профилактика инфекций, передаваемых через укус клеща, в условиях совмещенных природных очагов / И.В. Козлова, В.И. Злобин,
    М.М. Верхозина, О.В. Лисак и др. // Современные научные и прикладные аспекты клещевого энцефалита (К 70-летию открытия вируса клещевого энцефалита), 15–16 нояб. 2007 г. – М., 2007. – С. 61–63.
  43. Экстренная специфическая профилактика клещевого энцефалита, основанная на результатах экспресс-исследования переносчика / И.В. Козлова, В.И. Злобин,
    М.М. Верхозина, О.В. Лисак, и др. // Современные научные и прикладные аспекты клещевого энцефалита (К 70-летию открытия вируса клещевого энцефалита), 15–16 нояб. 2007 г. – М., 2007. – С. 57–58.
  44. Экстренная диагностика и профилактика инфекций, передаваемых через укус клеща, в условиях совмещенных природных очагов / И.В. Козлова, В.И. Злобин,
    М.М. Верхозина, О.В. Лисак, В.А. и др. // Современные научные и прикладные аспекты клещевого энцефалита (К 70-летию открытия вируса клещевого энцефалита), 15–16 нояб. 2007 г. – М., 2007. – С. 61–62.
  45. Эпидемиологическая ситуация в отношении моноцитарного эрлихиоза и гранулоцитарного анаплазмоза человека в Прибайкалье (результаты рекогносцировочных исследований / И.В. Козлова, В.И. Злобин, М.М. Верхозина, В.А. Рар и др. // Эпидемиология и вакцинопрофилактика. – 2007. – № 5(36) – С. 42–46.
  46. Prevalence of Anaplasma and Ehrlichia in Ixodes persulcatus ticks and small mammals from different regions of Russia / V.A. Rar, N. N. Livanova, V.V. Panov, I.V. Kozlova et al. // IX International Jena Symposium on Tick-borne Diseases (formerly IPC) “Climate change and tick-borne diseases”, Jena, Germany, 15-17 March, 2007. – P. 51.

Научное издание

Козлова Ирина Валерьевна

НАУЧНОЕ ОБОСНОВАНИЕ И ПУТИ СОВЕРШЕНСТВОВАНИЯ ЭКСТРЕННОЙ ДИАГНОСТИКИ И ПРОФИЛАКТИКИ ТРАНСМИССИВНЫХ КЛЕЩЕВЫХ ИНФЕКЦИЙ В УСЛОВИЯХ СОЧЕТАННОСТИ ПРИРОДНЫХ ОЧАГОВ

Автореферат диссертации

Подписано в печать 12.01.08. Формат 60х84 1/16. Печать трафаретная.

Усл. печ. л. 2,9. Тираж 100 экз. Заказ 14.

ИЗДАТЕЛЬСТВО ИРКУТСКОГО ГОСУДАРСТВЕННОГО УНИВЕРСИТЕТА

664003, Иркутск, бульвар Гагарина, 36; тел. (3952) 24–14–36







© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.