WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

Федоренко Ольга Юрьевна

МЕХАНИЗМЫ ПРОТЕИНКИНАЗНОЙ РЕГУЛЯЦИИ НЕЙРОНАЛЬНЫХ КАЛИЕВЫХ КАНАЛОВ И ГЛУТАМАТНЫХ ТРАНСПОРТЁРОВ, РОЛЬ НЕЙРОСТЕРОИДОВ ПРИ ШИЗОФРЕНИИ

14.03.03 – патологическая физиология 14.01.06 – психиатрия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени доктора медицинских наук

Томск – 2010

Работа выполнена в Учреждении Российской академии медицинских наук научно-исследовательском институте психического здоровья Сибирского отделения РАМН Научные консультанты:

доктор медицинских наук, профессор Иванова Светлана Александровна доктор медицинских наук, профессор Семке Аркадий Валентинович Официальные оппонентны:

доктор медицинских наук, профессор, член-корреспондент РАМН Лишманов Юрий Борисович доктор медицинских наук, профессор Балашов Пётр Прокопьевич доктор медицинских наук Удут Елена Владимировна

Ведущая организация: Учреждение Российской академии медицинских наук научно-исследовательский институт физиологии Сибирского отделения РАМН

Защита состоится: «___»________2010 г. в «___» часов на заседании диссертационного совета Д 001.031.01 при Учреждении Российской академии медицинских наук научно-исследовательском институте фармакологии Сибирского отделения РАМН (634028, г. Томск, пр. Ленина, 3)

С диссертацией можно ознакомиться в библиотеке Учреждения Российской академии медицинских наук научно-исследовательского института фармакологии Сибирского отделения РАМН

Автореферат разослан: «_____» _______________ 2010 г.

Ученый секретарь диссертационного совета, доктор биологических наук Амосова Е. Н.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Исследование фосфатидилинозитол-4,5-бифосфат (PIP2)-опосредованных сигнальных путей представляет собой новое и быстро развивающееся направление в области клеточной сигнальной трансдукции [Hilgemann D. W. et al., 2001; Suh B. C., Hille B., 2005; Di Paolo G., De Camilli P., 2006]. На протяжении последнего десятилетия наблюдается бурное открытие PIP2-чувствительных мембранных транспортных белков, многие из которых являются ионными каналами и транспортёрами [Berridge M. J. et al., 1989; Ma L., et al., 1998; Yin H. L., Janmey P. A., 2003; Gamper N., Shapiro M. S., 2007].

Фосфоинозитидная модуляция мембранных белков в нейронах оказывает существенный эффект на нейрональную возбудимость и синаптическое трансмиттерное высвобождение. Особенности комплексных сигнальных механизмов, регулирующих мембранные белки, представляют собой интригующее множество задач для дальнейшего исследования [Gamper N., Shapiro M. S., 2007].

Многочисленные современные данные об участии киназных сигнальных путей в регуляции моноаминовых рецепторов и транспортёров раскрывают новую модальность передачи сигнала в мозге [Jacinto E. et al., 2006; GonzalezMaeso J. et al., 2008; Beaulieu J.-M. et al., 2009]. PIP2 образуется при фосфорилировании фосфатидилинозитол-4-фосфат-5-киназой тип 2 альфа (PIP5K2A) [Yin H. L., Janmey P. A., 2003; Rameh L. E. et al., 1997; Roth M. G. et al., 2004], в связи с чем её физиологическое и патофизиологическое значение в регуляции нейрональной активности является самым непосредственным. Недавно были получены доказательства ассоциации между мутацией (N251S)-PIP5K2A и шизофренией [Stopkova P. et al., 2003; Stopkova P. et al., 2005; Schwab S. G. et al., 2006;

Bakker S. C. et al., 2007; He Z. et al., 2007; Lang U. E. et al., 2007].

Шизофрения представляет собой тяжёлое психическое заболевание не установленной этиологии, склонное к хроническому течению, которым страдает приблизительно 1 % населения [Inta D. et al., 2009]. Несмотря на колоссальные усилия, затраченные на выяснение этиопатогенеза этого заболевания, фундаментальные нейробиологические процессы, ведущие к шизофрении, остаются до сих пор не до конца расшифрованными.

Дофаминовая теория шизофрении, основоположником которой является Арвид Карлсон, постулирует дисфункцию дофаминергической нейротрансмиттерной системы [Carlsson A., 1988]. Она основана на психодислептических эффектах дофаминовых агонистов [Wallis G. G. et al., 1949; Angrist B., Gershon S., 1977] а также на способности типичных антипсихотических препаратов, являющихся антагонистами дофаминовых рецепторов 2 (D2) лечить позитивные симптомы (бред, галлюцинации) шизофрении [Van Rossum J. M., 1966; Seeman P. et al., 1976; Creese I. et al., 1976]. Тем не менее, попытки объяснить заболевание исключительно в выражении дофаминергической дисфункции, оставляют много аспектов шизофрении неразрешёнными. Тот клинический факт, что D2блокада значительно менее эффективна при лечении негативных симптомов (таких как социальный аутизм, отсутствие мотивации или когнитивные изменения, включая дефицит внимания и рабочей памяти) указывает на вовлечение других, отличных от дофаминовых, механизмов [Inta D. et al., 2009].

Глутаматергическая гипотеза в изначальной форме постулирует, что гипоглутаматергические состояния и гипофункция NMDA рецепторов представляют основные элементы патофизиологии заболевания [Olney J. W., Farber N. B., 1995]. Недавно была предложена теоретическая модель изменений на уровне нейрональной сети, объясняющая когнитивные дефициты и негативные симптомы при шизофрении. Согласно этой концепции, дисфункции NMDA рецепторов, локализованных на парвальбумин-позитивных GABA-ергических интернейронах представляют собой ключевые элементы, определяющие как растормаживание глутаматергических нейронов, так и нарушения осцилляций мозга [Lewis D. A., Moghaddam B., 2006; Lisman J. E. et al., 2008]. В последнее время общий интерес к исследованиям глутаматергической системы при шизофрении многократно возрос в связи с успешными клиническими испытаниями антипсихотического вещества, действующего на метаботрофные глутаматные рецепторы [Patil S. T. et al., 2007].

Несмотря на противопоставление дофаминергических и глутаматергических механизмов в историческом аспекте, ни одна унитарная нейротрансмиттерная гипотеза не может полностью объяснить это комплексное гетерогенное заболевание [Inta D. et al., 2009].

Фактически, глутаматная и дофаминовая системы тесно взаимодействуют как в регуляции нормальной кортикальной активности, относящейся к познанию [Durstewitz D. et al., 2000; Seamans J. K., Yang C. R., 2004], во взаимодействиях между префронтальной корой, средним мозгом и стриатумом, имеющим отношение к шизофрении [Sesack S. R. et al., 2003], так и в контексте генетического риска заболевания [Tan H. W. et al., 2007]. Поэтому сейчас эти теории существуют не отдельно, а во взаимодействии, постулируя сбалансированность между ингибирующими дофаминергическими и ингибирующими глутаматергическими нейронами. Дефицит глутаматной трансмиссии может приводить к дофаминовой дисфункции, ассоциированной с шизофренией, и дофаминовые изменения, в свою очередь, могут усиливать дефицит глутаматной трансмиссии.

Недавно опубликованные доказательства тесной связи между функционированием KCNQ (Kv7) калиевых каналов и дофаминергической нейротрансмиттерной активностью возможно трансформировать в современные парадигмы болезненных состояний, таких как шизофрения, характеризующихся повышенной дофаминергической активностью. Базальная активность дофаминергических нейронов угнетается KCNQ (Kv7) каналами [Hansen H. H. et al., 2006;

Hansen H. H. et al., 2007], физиологическая роль которых заключается в стабилизации нейронального потенциала покоя [Jentsch T. J. et al., 2000; Vervaeke K.

et al., 2006; Hu H. et al., 2007]. Активация Kv7 каналов приводит к бимодальному ингибиторному эффекту на пресинаптическую дофаминергическую нейротрансмиссию в стриатуме, гиппокампе и коре, т.е. снижению как терминального синтеза, так и высвобождения дофамина [Mikkelsen J. D., 2004; Martire M.

et al., 2004, 2007; Hansen H. H. et al., 2006; Hansen H. H. et al., 2007].

Известно, что KCNQ каналы требуют для своего открытия PIP2, а их ингибирование в основном происходит при снижении мембранных уровней PIP[Delmas P., Brown D. A., 2005]. Модуляция KCNQ калиевых каналов может существенно влиять на дофаминергическую нейротрансмиссию при шизофрении [Gupta P. D. et al., 2004; Dalby-Brown W. et al., 2006]. Кроме того, модуляторы Kv7 каналов также влияют на высвобождение других нейротрансмиттеров, включая глутамат [Martire M. et al., 2004].

Многочисленные современные исследования сосредоточились на изучении молекулярных механизмов регуляции нейрональных транспортных систем, особенно нейронального глутаматного аминокислотного транспортёра EAAT3, связанного с нейрональной активностью, который вовлечён в патофизиологию шизофрении [Smith R. E. et al., 2001; McCullumsmith R. E., Meador-Woodruff J. H., 2002; Kim J. H. et al., 2005; Huerta I. et al., 2006; Deng X. et al., 2007;

Lang U. E. et al., 2007; Nudmamud-Thanoi S. et al., 2007].

Важная роль в нервной системе организма принадлежит нейростероиду дегидроэпиандростерону (ДГЭА). Многочисленные независимые исследования показали, что стероид и его сульфатный эфир (ДГЭАС) модулируют продолжительность жизни нейронов [Shin C. Y. et al., 2001; Kaasik A. et al., 2003; Kurata K. et al., 2004; Xilouri M., Papazafiri P., 2006], развитие мозга [Compagnone N. A., Mellon S. H., 1998], познание [Frye C. A., Lacey E. H., 1999; Migues P. V. et al., 2002], поведение [Nicolas L. B. et al., 2001; Fedotova J., Sapronov N., 2004;

Maayan R. et al., 2006], а также ассоциированы со многими психическими заболеваниями [Perez-Neri I. et al., 2008]. Эффекты ДГЭА и ДГЭАС на нервную систему опосредованы модуляцией нескольких нейротрансмиттерных систем, включая дофаминовую и глутаматную [Perez-Neri I. et al., 2008; Zheng P., 2009].

На молекулярном уровне нейроактивные стероиды могут присоединяться к внутриклеточным рецепторам и регулировать экспрессию генов. Также они действуют на уровне нейротрансмиттерных рецепторов и потенциал-зависимых ионных каналов, особенно GABAA, NMDA, AMPA, глициновых, серотониновых, никотиновых и мускариновых ацетилхолиновых рецепторов [Rupprecht R.

et al., 2001; Dubrovsky B., 2006; Strous R. D. et al., 2006], а также Ca2+, Na+, K+ и анионных каналов [Nakashima Y. M. et al., 1998; Nakashima Y. M. et al., 1999;

Kelly M. J. et al., 2002; Carrer H. F. et al., 2003; Todorovic S. M. et al., 2004;

Rbandi-Tonkabon R. et al., 2004; Pathirathna S. et al., 2005; Joksovic P. M. et al., 2007; Cheng Z. X. et al., 2008].

Результаты последних исследований подтверждают важную роль ДГЭА в патологии и лечении шизофрении [Pisu M. G., Serra M., 2004; Иванова С. А., Семке А. В., 2006; Marx C. E. et al., 2006; MacKenzie E. M. et al., 2007;

Morrow A. L., 2007].

В связи с тем, что очень сложно исследовать in situ молекулярные сигнальные пути, принимающие участие в регуляции нейрональных ионных каналов и транспортёров, традиционно используется Xenopus laevis ооцитная экспрессирующая модель. Сочетание биохимических, электрофизиологических и молекулярно-генетических методов, применяемых к единичному ооциту, создаёт исключительные условия для получения информации о биогенезе, структурно-функциональных отношениях и модуляции плазматических мембранных белков [Sthmer W., 1992; Tsiuriupa G. P, Pashkov V. N., 1994; Romero M. F., 1998; Sthmer W., 1998; Bezanilla F., Stefani E., 1998; Hilgemann D. W., Lu C., 1998; Kaneko S. et al., 1998; Stefani E., Bezanilla F., 1998; Sigel E., Minier F., 2005].

Кроме того, информативным методом изучения нейрональной активности является исследование уровня нейростероидов в сыворотке крови, поскольку они синтезируются как в мозге, так и на периферии [Friess E. et al., 2000;

Baulieu E. E. et al., 2001; Schumacher M. et al., 2000]. Более того, нейростероиды являются единственными гуморальными факторами, концентрация которых в плазме коррелирует с концентрацией в мозге [Ylmaz N. et al., 2007]. Поэтому нейростероидные аспекты нейрональной активности возможно тестировать по уровню нейростероидов в крови.

Судя по растущему списку PIP2-чувствительных ионных каналов и транспортёров [Suh B. C., Hille B., 2005], большинство из них, по крайней мере до некоторой степени, чувствительны к PIP2. Вместе с тем следует отметить, что функциональная активность PIP5K2A киназы и её мутантной формы (N251S)PIP5K2A, ассоциированной с шизофренией, в отношении нейрональных калиевых KCNQ каналов и глутаматных EAAT3 транспортёров не изучена.

Комплексного изучения динамики содержания нейростероида дегидроэпиандростерона сульфата у больных шизофренией в зависимости от клинических особенностей течения заболевания и применяемой терапии не было проведено.

В связи с вышеизложенным были сформулированы цель и задачи диссертационной работы.

Цель работы: Изучить механизмы протеинкиназной регуляции нейрональных калиевых KCNQ каналов и глутаматных EAAT3 транспортёров и содержание нейростероидов на модели ДГЭАC при шизофрении.

Задачи исследования:

1. Изучить функциональную регуляцию нейрональных KCNQ калиевых каналов нейрональной PIP5K2A киназой в Xenopus laevis ооцитной экспрессирующей системе.

2. Протестировать действие дифосфорилированных фосфоинозитидов на работу нейрональных KCNQ калиевых каналов в Xenopus laevis ооцитной экспрессирующей системе.

3. Исследовать влияние мутантной формы (N251S)-PIP5K2A киназы, ассоциированной с шизофренией, на активность нейрональных KCNQ калиевых каналов в Xenopus laevis ооцитной экспрессирующей системе.

4. Изучить функциональную регуляцию нейрональных глутаматных транспортёров EAAT3 нейрональной PIP5K2A киназой в Xenopus laevis ооцитной экспрессирующей системе.

5. Оценить влияние мутантной формы (N251S)-PIP5K2A киназы, ассоциированной с шизофренией, на активность нейрональных глутаматных транспортёров EAAT3 в Xenopus laevis ооцитной экспрессирующей системе.

6. Исследовать влияние дикого типа PIP5K2A киназы и мутантной формы (N251S)-PIP5K2A киназы, ассоциированной с шизофренией, на экспрессию EAAT3 белка на клеточной мембране человеческих эмбрионных почечных HEK293 клеток.

7. Изучить регуляцию KCNQ4 калиевых каналов KCNE субъединицами в Xenopus laevis ооцитной экспрессирующей системе.

8. Протестировать уровень сывороточного нейростероида дегидроэпиандростерон-сульфата у больных шизофренией.

Положения, выносимые на защиту:

1. Нейрональная PIP5K2A киназа является функциональным модулятором гетеромерных нейрональных калиевых KCNQ2/KCNQ3 и KCNQ3/KCNQканалов, в то время как гомомерные KCNQ2 и KCNQ5 подтипы нейрональных калиевых каналов не обладают чувствительностью к нейрональной PIP5K2A.

2. Выявлен новый механизм регулирования нейрональных глутаматных транспортёров EAAT3 нейрональной фосфатидилинозитол-4-фосфат-5-киназой (тип 2 альфа).

3. Мутация (N251S)-PIP5K2A, ассоциированная с шизофренией, вносит вклад в формирование дофаминергического-глутаматергического дисбаланса при шизофрении. Мутация (N251S)-PIP5K2A нарушает функциональную регуляцию нейрональных калиевых KCNQ каналов, что способствует повышенной дофаминергической нейротрансмиссии при шизофрении и препятствует нормальной функциональной регуляции нейрональных глутаматных транспортёров EAAT3, что играeт роль в нарушении метаболизма глутамата в мозге у больных шизофренией, носителей этой мутации.

4. Трёхмерная модель мутантной формы (N251S)-PIP5K2A демонстрирует изменение структурно-функциональной интегрированности каталитического домена киназы, ответственное за нарушение каталитической функции фермента.

5. Уровень сывороточного нейростероида ДГЭАС у больных шизофренией сопряжен с клиническим полиморфизмом, характеристиками течения заболевания и применяемой терапией.

Научная новизна исследования.

Впервые проведёно комплексное исследование функциональной регуляции нейрональной PIP5K2A киназой и её мутантной формы (N251S)- PIP5K2A, ассоциированной с шизофренией нейрональных KCNQ калиевых каналов и глутаматных EAAT3 транспортёров в Xenopus laevis ооцитной экспрессирующей системе. Обнаружено значительное увеличение амплитуды токов гетеромерных нейрональных KCNQ2/KCNQ3 и KCNQ3/KCNQ5 калиевых каналов при коэкспрессии с PIP5K2A, не сопровождаемое заметными изменениями в кинетике работы каналов (без сдвига потенциальной зависимости и изменёния временного цикла активации – дезактивации). Выявлено, что гомомерные KCNQ2 и KCNQ5 подтипы нейрональных калиевых каналов не обладают чувствительностью к нейрональной PIP5K2A.

Впервые обнаружено, что мутантная форма (N251S)-PIP5K2A киназы не оказывает стимулирующего эффекта на работу нейрональных гетеромерных KCNQ2/KCNQ3 и KCNQ3/KCNQ5 калиевых каналов. Обнаружено угнетающее действие мутантной киназы на KCNQ2 и KCNQ2/KCNQ3 токи.

Впервые показано, что дифосфорилированные фосфоинозитиды активируют гетеромерные нейрональные KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналы в Xenopus laevis ооцитной экспрессирующей системе неспецифическим образом.

Впервые выявлена модуляция экспрессии белка глутаматных EAATтранспортёров нейрональной PIP5K2A киназой и её мутантной формы (N251S)PIP5K2A, ассоциированной с шизофренией, на мембране Xenopus laevis ооцитов и в культуре человеческих эмбрионных почечных HEK293 клеток.

Доказано, что PIP5K2A является новым сигнальным элементом в регуляции активности EAAT3. Сравнительное изучение функциональной регуляции PIP5K2A и её мутантной формы (N251S)-PIP5K2A, ассоциированной с шизофренией, позволило выявить стимулирующий эффект PIP5K2A киназы на работу нейрональных глутаматных EAAT3 транспортёров в Xenopus laevis ооцитной экспрессирующей системе и нарушение этой функции у мутантной формы (N251S)-PIP5K2A.

Впервые показано, что дифосфорилированный фосфоинозитид PI(4,5)Pстимулирует электрогенный глутаматный транспорт в EAAT3 экспрессирующих Xenopus laevis ооцитах. Эффекты PIP2 и PIP5K2A-коэкспрессии на активность EAAT3 не являются кумулятивными.

Впервые построена трёхмерная модель мутантной формы (N251S)PIP5K2A, демонстрирующая нарушение структурно-функциональной интегрированности каталитического домена киназы.

Обнаружена модуляция ряда свойств KCNQ4 каналов KCNE субъединицами, включая зависимость активации от потенциала, амплитуду тока, ионную селективность и содержание белка в Xenopus laevis ооцитах.

Обнаружено снижение уровня сывороточного нейростероида ДГЭАС у больных шизофренией по сравнению с психически и соматически здоровыми лицами.

Впервые выявлены корреляции уровня ДГЭАС в сыворотке крови у больных шизофренией с длительностью заболевания, преобладанием негативной или позитивной симптоматики и проводимой фармакотерапией.

Впервые доказано, что снижение содержания нейростероида ДГЭАС до проведения фармакотерапии атипичным нейролептиком кветиапином является прогностически неблагоприятным признаком отвечаемости на терапию.

Практическая значимость.

В работе показаны выраженные функциональные нарушения регуляции нейрональных KCNQ калиевых каналов и глутаматных EAAT3 транспортёров мутантной, ассоциированной с шизофренией (N251S)-PIP5K2A киназой, объясняющие повышение мезенцефалического дофаминового потенциала действия у больных шизофренией (носителей этой мутации), а также нарушение метаболизма глутамата в мозге у больных.

Обнаружено снижение уровня сывороточного нейростероида ДГЭАС у больных шизофренией по сравнению с психически и соматически здоровыми лицами. Установлено, что группы пациентов, сформированные по принципу преобладания позитивной либо негативной симптоматики, существенно различаются между собой по уровню ДГЭАС в сыворотке крови. Показано восстановление концентрации ДГЭАС в сыворотке крови у больных резидуальной шизофренией после фармакотерапии атипичным нейролептиком кветиапином до нормальных значений.

Полученные данные могут быть использованы в качестве параклинических критериев для прогноза течения заболевания и применения обоснованной индивидуальной терапевтической тактики.

Получен патент на изобретение «Способ прогнозирования эффективности лечения резидуальной шизофрении атипичными нейролептиками» // Патент (РФ) №2006108350/15, опубл. Бюл. № 27 от 27.09.2007.

Основные результаты диссертационной работы включены в программу обучения врачей-ординаторов и аспирантов Учреждения РАМН НИИПЗ СО РАМН и в учебные программы для студентов, интернов, клинических ординаторов и врачей-психиатров кафедры психиатрии, наркологии и психотерапии Сибирского государственного медицинского университета. Результаты внедрены в клиническую практику и используются в клиниках НИИ психического здоровья, а также в Томской областной клинической психиатрической больнице.

Апробация работы. Материалы диссертации представлены на: the 7th World Congress of Biological Psychiatry (Berlin, Germany, 2001); the XIth Biennial Winter Workshop on Schizophrenia (Davos, Switzerland, 2002); Российсконемецком семинаре «Патофизиология психических расстройств» (Томск, 2006);

the 2nd International Congress of Biological Psychiatry (Santiago, Chile, 2007); XVII научной отчетной сессии НИИ психического здоровья СО РАМН «Актуальные вопросы психиатрии» (Томск, 2007); the 86th Annual Meeting of German Physiological Society (Hannover, Germany, 2007); Российско-Голландском симпозиуме «Schizophrenia in a Dutch-Siberian perspective», (Groningen-Rotterdam, Netherlands, 2007); XVIII научной отчетной сессии НИИ психического здоровья СО РАМН «Актуальные вопросы психиатрии» (Томск, 2008); the XIVth Biennial Winter Workshop on Schizophrenia and Bipolar Disorders (Montreux, Switzerland 2008);

Второй всероссийской конференции с международным участием «Современные проблемы биологической психиатрии и наркологии» (Томск, 2008); the 21th ECNP Congress (Barcelona, Spain, 2008); XIX научной отчетной сессии НИИ психического здоровья СО РАМН «Актуальные вопросы психиатрии» (Томск, 2009); the 88th Annual Meeting of the European Physiological Societies (Giessen, Germany, 2009).

Исследования поддержаны грантом INTAS YS Fellowship «Deranged regulation of the serum and glucocorticoid inducible kinase family and genetic basis of psychiatric disease» (2004–2006) / «Нарушение регуляции семейства сыворотко- и глюкокортикоид индуцируемых киназ и генетические основы психических расстройств» (Ref. No. 04-83-3764); государственным контрактом № 06/957 (2007) «Клинико-иммунологические, иммунофизиологические и молекулярно-биологические механизмы патогенетической терапии психических расстройств» в рамках подпрограммы «Психические расстройства» Федеральной целевой программы «Предупреждение и борьба с социально значимыми заболеваниями (2007–2011 гг.)».

Публикации. По теме диссертации опубликовано 24 печатные работы, в том числе 14 статей в центральных рецензируемых журналах, рекомендованных ВАК, получен патент на изобретение.

Объем и структура работы. Диссертация изложена на 270 страницах машинописного текста. Состоит из введения, обзора литературы, описания материалов и методов исследования, 4 глав результатов собственных исследований, заключения, выводов, библиографического списка, 3 приложений. Работа иллюстрирована 5 таблицами и 49 рисунками. Библиографический список включает 472 источника: 20 отечественных и 452 зарубежных авторов.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Исследование выполнено на базе Учреждения Российской академии медицинских наук НИИ психического здоровья СО РАМН (лаборатории клеточных и молекулярно-биологических исследований, руководитель лаборатории – д-р мед. наук, профессор С. А. Иванова; отделения эндогенных расстройств, научный руководитель – д-р мед. наук, профессор А. В. Семке) и института физиологии Тюбингенского университета (г. Тюбинген, Германия; директор института – профессор Флориан Ланг).

В настоящем исследовании использовались клинические (клинико-психопатологический и клинико-динамический), лабораторно-экспериментальные (генетические; биохимические; молекулярно-биологические; Xenopus laevis ооцитная экспрессирующая система; электрофизиологические) и статистические методы исследования.

Экспериментальная часть работы выполнена в институте физиологии Тюбингенского университета г. Тюбингена (Германия) в рамках договора о совместной научной деятельности. Схема эксперимента представлена на рис. 1.

Рис. 1. Схема эксперимента Материалом исследования являлась ооцитная экспрессирующая система Xenopus laevis. В работе использовали ооцитные экспрессирующие векторы pSGEM, pXOOM, pBluescript SK- и pTLN. Плазмидную ДНК из бактериальной культуры получали набором «Qiagen Plasmid Midi Kit» (QIAGEN, Германия).

Линеаризацию проводили ДНК рестрикционными ферментами NEB (New England BioLabs, Великобритания). Очистку линеаризованной ДНК осуществляли набором «Gel extraction kit». Синтез РНК in vitro выполняли набором «mMESSAGE mMACHINE kit» (Ambion, Великобритания) для T7 или sp6 РНКполимераз. РНК очищали при помощи колонок «Ambion’s NucAway Spin Columns». Измерение концентрации нуклеиновых кислот (ДНК или РНК) проводили спектрофотометрическим методом при 260 нм на спектрофотометре BioPhotometer (Eppendorf, Германия). Чтобы идентифицировать фракцию рецепторного белка, встроенного в плазматическую мембрану, поверхностные белки связывали с сульфо-NHS-LC-биотином (PIERCE, США) и затем изолировали «streptavidin-sepharose-mediated NeutrAvidin Biotin-Binding Protein» (PIERCE, США) преципитацией биотинил-КонА/белкового комплекса.

KCNQ4, KCNE4 и KCNE5 субклонировали в ооцитном экспрессирующем векторе pXOOM. В качестве рестрикционного фермента для линеаризации использовали XbaI («NEB», США). Очистку линеаризованной ДНК выполняли набором «QIAquick Gel Extraction Kit» («QIAGEN», Германия). Синтез кРНК из линеаризованных плазмид in vitro проводили набором «mMessage mMachine T7-polymerase kit» (Ambion, Великобритания).

KCNQ2 субклонировали в ооцитном экспрессирующем векторе pTLN. В качестве рестрикционного фермента для линеаризации использовали MluI (NEB, США). Очистку линеаризованной ДНК выполняли набором «QIAquick Gel Extraction Kit» (QIAGEN, Германия). Синтез кРНК из линеаризованных плазмид in vitro проводили набором «mMessage mMachine sp6-polymerase kit» (Ambion, Великобритания).

KCNQ3 и KCNQ5 субклонировали в ооцитном экспрессирующем векторе pSGEM. В качестве рестрикционного фермента для линеаризации использовали PacI («NEB», США). Для очистки линеаризованной ДНК использовали набор «QIAquick Gel Extraction Kit» (QIAGEN, Германия). Синтез кРНК из линеаризованных плазмид in vitro выполняли набором «mMessage mMachine T7polymerase kit» (Ambion, Великобритания).

KCNE1, KCNE2, KCNE3 субклонировали в ооцитном экспрессирующем векторе pSGEM. В качестве рестрикционного фермента для линеаризации использовали NheI (NEB, США). Для очистки линеаризованной ДНК использовали набор «QIAquick Gel Extraction Kit» (QIAGEN, Германия). Синтез кРНК из линеаризованных плазмид in vitro выполняли набором «mMessage mMachine T7-polymerase kit» (Ambion, Великобритания).

EAAT3 (EAAC1) субклонировали в ооцитном экспрессирующем векторе pBluescript SK- (Stratagene). В качестве рестрикционного фермента для линеаризации использовали NotI (NEB, США). Для очистки линеаризованной ДНК использовали набор «NucleoSpin Extract II» (MACHEREY-NAGEL, США). Синтез кРНК из линеаризованных плазмид был выполнен in vitro набором «mMessage mMachine T7-polymerase kit» (Ambion, Великобритания).

PI(4,5)P5K2A/pBluescript получили из немецкого ресурсного центра генетических исследований RZPD (Deutsche Ressourcenzentrum fr Genomforschung;

IRAKp961N0632Q, Регистрационный No. BC018034). ДНК была линеаризована с помощью BamHI (New England BioLabs, США). Для очистки линеаризованной ДНК использовали как набор «QIAquick Gel Extraction Kit» (QIAGEN, Германия), так и «NucleoSpin Extract II» (MACHEREY-NAGEL, США). In vitro синтез кРНК из линеаризованных плазмид выполняли набором «mMessage mMachine T7-polymerase kit» (Ambion, Великобритания).

Мутантную форму (N251S)-PIP5K2A получили двухступенчатой полимеразной цепной реакцией (ПЦР) с использованием следующих праймеров: прямой мутагенный праймер ATGACAACAGCAAGAAGGTC, обратный мутагенезный праймер GACCTTCTTGCTGTTGTCAT, прямой внешний праймер TCGGGAGCACGGCGGTGGA и обратный AGTACACCTCCTTCCTAGG.

В эксперименте с KCNQ каналами в каждый Xenopus ооцит инъецировали 4 нг KCNQ кРНК (0,2 мкг/мкл; 20 нл), либо 4 нг KCNQ РНК плюс 4 нг wtPIP5K2A РНК или 4 нг (N251S)-PIP5K2A РНК. В эксперименте с EAATтранспортёрами в каждый Xenopus laevis ооцит инъецировали 4 нг EAATкРНК (0,2 мкг/мкл; 20 нл), либо 4 нг EAAT3 РНК плюс 4 нг wt-PIP5K2A РНК или 4 нг (N251S)-PIP5K2A РНК, либо 4 нг EAAT3 РНК плюс 4 нг wt-PIP5K2A РНК и 4 нг (N251S)-PIP5K2A РНК.

На 4-й день экспрессированные на поверхности мембраны KCNQ калиевые каналы или EAAT3 транспортёры изучались стандартным двухэлектродным Voltage Clamp методом с использованием Turbo Tec 10CX (NPI, Tamm, Германия) усилителя, ITC-16 интерфейса, объединённым с pCLAMP 8.0 программным обеспечением (Axon Instruments Inc. /Molecular Devices, США) для получения и анализа данных. Активность KCNQ каналов тестировалась 3секундными импульсами в диапозоне от удерживающего потенциала –100 мВ к потенциалам между –120 мВ и + 60 мВ с 20 мВ интервалами и последующей генерацией импульсов обратно к –20 мВ. Значения амплитуды тока определялись в конце деполяризирующих импульсов и нормировались относительно среднего значения тока, генерируемого KCNQ каналами, экспрессированными в одиночку. В эксперименте с EAAT3 транспортёрами глутаматный ток индуцировали добавлением 2 мМ глутамата в перфузирующий ND96 раствор. Скорость перфузионного потока составляла 20 мл/мин. и полная замена перфузионного раствора достигалась в пределах 10 с. TEVC регистрацию выполняли при удерживающем потенциале –60 мВ. Данные отфильтровывали при 10 Гц и записывали с помощью Digidata A/D–D/A конвертера и Chart V.4.2 программного обеспечения для приёма, накопления и анализа данных (Axon Instruments).

Графический анализ и статистическая обработка результатов выполнялись с использованием Origin 6.0 программного обеспечения (Microcal, Германия).

Все эксперименты повторяли по крайней мере в 3 опытных сериях, во всех повторах получили качественно одинаковые результаты, представленные в виде M ± m со статистической значимостью p < 0,05.

Проведено комплексное клинико-биологическое обследование 182 пациентов, проходивших в 2004–2008 гг. курс стационарного лечения в отделении эндогенных расстройств НИИПЗ СО РАМН (научный руководитель – д-р мед.

наук, профессор А. В. Семке) и в Томской областной психиатрической больнице. Состояние пациентов на момент обследования соответствовало диагностическим критериям шизофрении, шизотипического расстройства и острого полиморфного психотического расстройства с симптомами шизофрении по Международной классификации болезней десятого пересмотра (МКБ-10. Разделы F20: «Шизофрения», F21: «шизотипическое расстройство», F23.1: «Острое полиморфное психотическое расстройство с симптомами шизофрении»).

Основную группу составили больные шизофренией и шизотипическими расстройствами в возрасте от 17 до 80 лет (средний возраст 47 ± 18 лет). По половозрастным характеристикам пациенты распределились следующим образом:

100 мужчин (55 %), средний возраст 45 ± 17 лет и 82 женщины (45 %), средний возраст 50 ± 19 лет.

Контрольную группу составили 103 соматически и психически здоровых лиц, соответствующих по полу и возрасту обследуемым больным, не имеющих хронических заболеваний и не состоящих на диспансерном учете, без признаков перенесенных острых инфекционных заболеваний на момент обследования, которые, по определению Р. В. Петрова и А. А. Михайленко (1990), «на момент обследования выполняли полный объем своих профессиональных обязанностей и вели привычный образ жизни». Отбор здоровых лиц проводили, используя углубленный опрос с помощью «Анкеты обследования здоровых лиц», разработанной совместно с Институтом физиологии Тюбингенского университета.

Вопросы, приведенные в анкете, позволяют при формировании группы контроля исключить лица с признаками нарушения психического и соматического здоровья.

У психически больных и здоровых лиц контрольной группы кровь для лабораторных исследований брали из локтевой вены, утром, натощак. Использовали сыворотку крови для проведения гормональных исследований и кровь с антикоагулянтом ЭДТА для выделения ДНК.

Концентрацию ДГЭАС и кортизола в сыворотке крови определяли методом твердофазного иммуноферментного анализа с использованием наборов реагентов «Алкор-Био» (Россия).

Статистическую обработку биохимических результатов провели с помощью компьютерной программы Statistica 6.0. В исследуемых выборках проверили, подчиняется ли функция распределения нормальному закону (критерий Шапиро – Вилка). В данном случае все выборки распределены не параметрически и при сравнении с контрольной группой независимы (для сравнения брали результаты исследований больных и здоровых людей), поэтому для проверки однородности двух независимых выборок использовали критерий Манна– Уитни для количественных данных, подчиняющихся не параметрическому закону. При сравнении количественных данных, полученных у больных резидуальной формой шизофрении до и после лечения атипичным нейролептиком кветиапином (зависимые выборки, так как речь идёт об одних и тех же больных шизофренией) использовали непараметрический критерий Уилкоксона.

Генотипирование проводили с использованием стандартных наборов «TaqMan® Assays-On-Demand» (Applied Biosystems) на приборе 7900HT Fast Real-Time PCR System (Applied Biosystems) на наличие полиморфизмов гена, кодирующего основной фермент синтеза дегидроэпиандростерона 17-гидроксилазу (CYP17A1): CYP17A1(ТС), CYP17A1(ТT), CYP17A1(CС). Для статистической обработки генетических данных использовали компьютерное программное обеспечение «R».

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ 1. Функциональная ассамблея KCNQ4 с KCNE – -субъединицами в Xenopus laevis ооцитах.

Для определения возможных функциональных эффектов различных KCNE на KCNQ4 калиевые каналы KCNQ4 были коэкспрессированы с индивидуальными субъединицами KCNE- в Xenopus laevis ооцитах. Функциональное тестирование проводили стандартным двух-электродным Voltage-Clamp методом. Экспрессия KCNQ4 каналов в ооцитах позволила регистрировать характерные KCNQ4-токи (рис. 2).

Коэкспрессия KCNQ4 с KCNE изменяла амплитуду тока. В то время как KCNE1, KCNE2 и особенно KCNE4 повышали калиевые KCNQ4 токи, KCNEсущественно снижал KCNQ4-токи, что подтверждает предыдущие наблюдения о подавлении KCNQ4 токов KCNE3 субъединицами в Xenopus laevis ооцитах Schroeder B. C. et al., 2000). Эффекты KCNE5 на амплитуды KCNQ4 токов были относительно умеренными (рис. 2). Таким образом, было показано, что KCNE субъединицы могут модулировать амплитуду KCNQ4 токов.

Рис. 2. Эффект коэкспрессии калиевого канала KCNQ4 с изоформами KCNE1, KCNE2, KCNE3, KCNE4 и KCNE5 на амплитуду тока KCNQ4 канала Потенциал половины максимальной активации KCNQ4 каналов составил V1/2 = 10,9 ± 0,8 мВ, угловой коэффициент k = 20,8 ± 0,7 (n = 14). Потенциальная зависимость смещалась соответствующими KCNE, преобразуясь в следующие значения: KCNQ4 – KCNE1: V1/2 = 1,9 ± 0,6 мВ, k = 18,2 ± 0,5 (n = 16); KCNQ4 – KCNE2: V1/2 = –6,9 ± 1,2 мВ, k = 14,0 ± 1,0 (n = 16), и KCNQ4 – KCNE5: V1/2 = 3,3 ± 0,9 мВ, k = 18,0 ± 0,8 (n = 12) (рис. 3). Наибольшие эффекты на потенциальную зависимость KCNQ4 были обнаружены при коэкспрессии с KCNE3 и KCNE4 (очень пологие кривые активации).

Рис. 3. Эффект коэкспрессии KCNQ4 с изоформами KCNE на амплитуду тока KCNQ4 канала, зависимость активации от потенциала и кинетики активации.

Примечание. А. Амплитуда пикового тока. Б. Амплитуда остаточного тока. Графики отражают М ± m (n = 58). Символы обозначают: Q4 – KCNQ4, Ex – KCNE изоформы KCNQ4 и KCNQ4 – KCNE1–5 меняли направление тока при потенциале от –70 до –80 мВ, то есть приблизительно как при калиевом потенциале реверсии. Исключение составили KCNQ4 – KCNE4 каналы, чьи токи меняли направление примерно при –30 мВ. Относительно положительный потенциал реверсии KCNQ4 – KCNE4 мог быть вызван изменением селективности. Чтобы проверить эту гипотезу, KCNQ4 экспрессировали в комбинации с соответствующими KCNE, и перфузировали ооциты растворами, содержащими 100 мМ одного из моновалентных ионов Li+, Na+, K+, Rb+ или Cs+. Используя сдвиг потенциалов реверсии по отношению к K,+ были рассчитаны относительные K+ проводимости для соответствующих видов ионов (рис. 4).

В то время как KCNE5 немного снижал относительную Rb+ проводимость, другие KCNE её не изменяли. Полученный ряд проводимостей выглядел следующим образом: K+ = Rb+ > Cs+ > Na+ = Li+. Тем не менее, в случае KCNQ– KCNE4 коэкспрессии, значения относительной селективности в направлении Cs+ > Na+ = Li+ были снижены. Эти данные показывают, что KCNE субъединицы модулируют не только амплитуду и кинетику тока, но также селективность каналов.

Рис. 4. Относительная селективность KCNQ4 каналов в отношении моновалентных ионов. Примечание. Данные представлены в М ± m (n = 16). Символы обозначают: Q4 – KCNQ4 и E1–5 – KCNE субъединицы KCNE субъединицы модулируют амплитуду KCNQ4 токов (рис. 2, 3), что может быть результатом различий в экспрессии каналов на поверхности мембраны. Чтобы исследовать эту возможность, KCNQ4 экспрессировали с индивидуальными KCNE – -субъединицами в Xenopus ооцитах и применили метод Western blotting. KCNE1–3 незначительно изменили количество KCNQ4, экспрессированного на плазматической мембране или в общем клеточном лизате (рис. 5). Тем не менее, KCNE4 и KCNE5 снижали KCNQ4 на плазматической мембране и в общем клеточном лизате (рис. 5).

В то время как KCNE4 является ингибитором для Kv1.1, Kv1.3 и KCNQ1, он оказывает активирующий эффект на KCNQ4 в ооцитах [Grunnet M. et al., 2003; Grunnet M. et al., 2005]. Тем не менее, KCNE4 может вызывать выраженный сдвиг вправо активационной кривой калиевого тока. Другие KCNE субъединицы не влияют на KCNQ4 селективность.

Несмотря на то, что коэкспрессия KCNE4 и KCNE5 заметно увеличивала амплитуду тока KCNQ4 каналов, это не приводило к увеличению экспрессии KCNQ4 на плазматической мембране. Возможно, KCNE4 и KCNE5 изменяют амплитуду тока единичного канала или вероятность открытия KCNQ4 подобно тому, как было показано для KCNE1 на KCNQ1 [Pusch M., 1998; Yang Y., Sigworth F. J., 1998].

Среди самых сильных эффектов KCNE субъединиц на потенциалзависимые каналы находятся модулирование KCNQ1 каналов KCNE1 субъединицами. KCNQ1 (KvLQT1, Kv7.1) каналы активируются и инактивируются относительно быстро, в то время как коассамблея KCNQ1 с KCNE1 (MinK, IsK) приводит к образованию медленно активирующих, неактивирующих, K+селективных каналов, активация которых происходит при более положительных потенциалах с повышенной проводимостью единичного канала [Barhanin J.

et al., 1996; Sanguinetti M. C. et al., 1996; Pusch M. et al., 1998; Tristani-Firouzi M., Sanguinetti M. C., 1998].

При инъекции KCNE1-РНК в ооциты эндогенные KCNQ1 -субъединицы формируют функциональные каналы с экзогенными KCNE1. Считается, что аффинность этих -субъединица – -субъединица взаимодействий относительно высокая и специфическая. Интересно, что коэкспрессия KCNE1 с KCNQ4 не стимулирует эти медленно активируемые каналы, предполагая, что аффинность KCNQ4 для KCNE1 даже выше, чем для KCNQ1.

Рис. 5. Экспрессия белка KCNQ4 в Xenopus laevis ооцитах. Примечание. А. Репрезентативный блот, демонстрирующий экспрессию KCNQ4 в ооцитах при коэкспрессии с H2O или с KCNE субъединицами. Белок KCNQ4 имеет молекулярный вес ~77 кДа. ПМ – плазматическая мембрана; О – общий белок. Б. Относительное содержание KCNQ4 белка плазматической мембраны. Интенсивность бэнда, экспрессированного на мембране белка, определена количественно с помощью компьютерной программы Scion image. Значения нормированы по отношению к интенсивности бэнда KCNQ4, экспрессированного в одиночку Несмотря на то, что прямое взаимодействие трансмембранных доменов KCNQ1 с KCNE1 было предсказано, точные молекулярные основы этих взаимодействий и даже приближённая локализация остались неоднозначными [Tai K. K., Goldstein S. A., 1998; Lerche C. et al., 2000; Chen H. et al., 2003а;

Chen H. et al., 2003б; Melman Y. F. et al., 2004; Panaghie G. et al., 2005].

Ничего не известно о молекулярных взаимодействиях, приводящих к функциональным изменениям других каналов. Принимая в расчёт высокую гомологию KCNQ1 и KCNQ4, KCNE субъединицы могут взаимодействовать внутри трансмембранного участка друг с другом.

Таким образом, выполненное исследование обнаружило модуляцию ряда свойств KCNQ4 каналов членами семейства KCNE -субъединиц, включая зависимость активации от потенциала, амплитуду тока, ионную селективность и содержание белка в Xenopus laevis ооцитах. Эта регуляция может иметь физиологическую и патофизиологическую значимость.

2. Влияние нативной PIP5K2A и мутантной, ассоциированной с шизофренией (N251S)-PIP5K2A на активность нейрональных KCNQ каналов.

Гомомерные нейрональные калиевые каналы KCNQ2 экспрессировали в одиночку или совместно с ферментом PIP5K2A. Коэкспрессия с PIP5K2A не приводила к существенным изменениям амплитуды тока при +50 мВ: для канала KCNQ2 прирост составил 7 % (p = 0,7) (рис. 6).

Рис. 6. Амплитуда тока гомомерных нейрональных калиевых KCNQ2 каналов, коэкспрессированных с PIP5K2A в Xenopus laevis ооцитах. Примечание.

А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 44). Чёрные кружки обозначают амплитуду тока KCNQ2 калиевых каналов, экспрессированных без PIP5K2A, белые – с PIP5K2A Гомомерные нейрональные калиевые каналы KCNQ5 экспрессировали в одиночку или совместно с ферментом PIP5K2A. Значительных изменений в амплитудах тока при +50 мВ также не было обнаружено: для канала KCNQ5 прирост составил 3 % (p = 0,8) (рис. 7).

Таким образом, KCNQ2 и KCNQ5 подтипы нейрональных калиевых каналов не обладают чувствительностью к PIP5K2A.

В случае коэкспрессии гетеромерных KCNQ2/KCNQ3 и KCNQ3/KCNQкалиевых каналов с PIP5K2A, амплитуды токов значительно возросли на 53 % (p = 0,0056) и на 115 % (p = 0,0006) соответственно по сравнению с амплитудами токов, генерируемых каналами, экспрессированными в одиночку (рис. 8, 9).

Обнаруженное увеличение не сопровождалось заметными изменениями в кинетике работы каналов (не было сдвига потенциальной зависимости и изменения временного цикла активации – дезактивации).

Рис. 7. Амплитуда тока гомомерных нейрональных калиевых KCNQ5 каналов, коэкспрессированных с PIP5K2A в Xenopus laevis ооцитах. Примечание. А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 63).

Чёрные кружки обозначают амплитуду тока KCNQ5 калиевых каналов, экспрессированных без PIP5K2A, белые – с PIP5K2A Рис. 8. Амплитуда тока гетеромерных KCNQ2/KCNQ3 калиевых каналов, коэкспрессированных с PIP5K2A в Xenopus laevis ооцитах. Примечание. А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 52). Чёрные кружки обозначают амплитуду тока KCNQ2/KCNQ3 калиевых каналов, экспрессированных без PIP5K2A, белые – с PIP5K2A Выявленное PIP5K2A-опосредованное увеличение амплитуды тока в гетеромерных KCNQ2/KCNQ3 и KCNQ3/KCNQ5 калиевых каналах может быть опосредовано присутствием KCNQ3 субъединицы в гетеромерном канальном комплексе. Для объяснения полученных результатов следует обратиться к следующим известным фактам.

Рис. 9. Амплитуда тока гетеромерных KCNQ3/KCNQ5 калиевых каналов, коэкспрессированных с PIP5K2A в Xenopus laevis ооцитах. Примечание. А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 42). Чёрные кружки обозначают амплитуду тока KCNQ3/KCNQ5 калиевых каналов, экспрессированных без PIP5K2A, белые – с PIP5K2A PIP киназы делятся на три подсемейства: тип I, II и III, согласно их сигнальной специфичности [Doughman R. L. et al., 2003]. Типы I и II PIP киназных подсемейств производят PI(4,5)P2 благодаря уникальным механизмам. Эти механизмы включают фосфорилирование PI(4)P с образованием PI(4,5)P2 (тип I киназ) [Anderson R. A. et al., 1999] или синтез PI(4,5)P2 путём утилизации PI(5)P (тип II киназ) [Rameh L. E. et al., 1997]. PI(4,5)P2 является ключевым липидным вторичным мессенджером, решающим для клеточной выживаемости и функционирования [Doughman R. L. et al., 2003].

PIP2 может связываться с KCNQ/M каналами и регулировать их конформацию, изменяя таким образом канальную активность [Delmas P., Brown D. A., 2005; Brown D. A et al., 2007]. Соответствующим образом KCNQ ток быстро падает до нуля, когда истощается уровень PIP2 [Suh B. C. et al., 2006].

Действительно, имеются данные о том, что PI(4,5)P2 напрямую связывается с KCNQ2/KCNQ3 каналами и регулирует вероятность открытия (Po) каналов [Zhang H. et al., 2003; Li Y. et al., 2005]. Заметное дивергентное сродство KCNQ каналов к PI(4,5)P2 может лежать в основе высокодифференцированной максимальной Po нейрональных гомомерных и гетеромерных KCNQ каналов [Li Y. et al., 2005]. В данной работе Li Y. с соавторами показали, что KCNQ(Kv7.3) имеет очевидное сродство примерно 2,6 мкМ, значение, в 200 раз превышающее очевидное сродство нейрональных KCNQ2 и KCNQ4 каналов (KCNQ2, EC50 = 205 мкМ и KCNQ4, EC50 = 215 мкМ) для короткой С-цепи PI(4,5)P2 аналогов. Присутствие KCNQ3 в гетеромерном KCNQ2/KCNQ3 канале придаёт повышенную PI(4,5)P2 чувствительность каналам (KCNQ2/KCNQ3, EC50 = 40 мкМ) [Li Y. et al., 2005].

PIP5-киназы образуют PI(4,5)P2, необходимый для активации М-каналов [Delmas P., Brown D. A., 2005]. С другой стороны, ингибирование М-каналов путём стимулирования mAChR происходит, главным образом, вследствие снижения PIP2 уровня на мембране [Delmas P., Brown D. A., 2005]. Возможно, mAChR стимуляция и активация PI(4)-киназ и PI(5)-киназ подобно PIP5K2A киназе представляют антогонистические модуляторы функционирования Мканалов, посредством которых мембранное содержание PIP2 представляет собой контролируемый переменчивый процесс [Suh B. C., Hille B., 2002].

KCNQ3 калиевые каналы экспрессируются в ооцитах слабо и поэтому не могут быть напрямую, как гомомерные каналы, тестированы на чувствительность к PIP5K2A киназе. Тем не менее, их функциональную активность можно оценить в комплексе гетеромерных каналов. Присутствие высоко PI(4,5)P2чувствительной KCNQ3 субъединицы в гетеромерных комплексах KCNQ2/KCNQ3 и KCNQ3/KCNQ5 может передавать чувствительностъ к PIP5K2A через продукцию PIP2 (метаболический продукт PIP5K2A киназы).

Таким образом, PIP5K2A является функциональным модулятором гетеромерных KCNQ каналов.

Чтобы установить, был ли обнаруженный стимулирующий эффект PIP5K2A киназы на активность KCNQ2/KCNQ3 и KCNQ3/KCNQ5 калиевых каналов следствием образования фосфатидилинозитол-4,5-бифосфата PI(4,5)P(прямого продукта PIP5K2A), а также изучить селективность гетеромерных канальных комплексов в отношении дифосфорилированных фосфоинозитидов, KCNQ2/KCNQ3 и KCNQ3/KCNQ5 гетеромерные калиевые каналы экспрессировали в ооцитах и затем в соответствующие ооциты инъецировали водорастворимые аналоги сигнальных молекул C6-PI(3,4)P2, C6-PI(3,5)P2 и C6-PI(4,5)P(4,6 нл, 100 мг/мл) за 30 – 60 мин. до регистрации.

Оба гетеромерных канала KCNQ2/KCNQ3 (PI(3,4)P2 = +128 %, p = 0,022, PI(3,5)P2 = +175 %, p = 0,016, PI(4,5)P2 = +142 %, p = 0,0005) и KCNQ3/KCNQ(PI(3,4)P2 = +83 %, p = 0,028, PI(3,5)P2 = +139 %, p = 0,041, PI(4,5)P2 = +106 %, p = 0,048) были активированы всеми тремя аналогами PI(4,5)P2 при +50 мВ (рис. 10, 11).

Из этого следует, что дифосфорилированные фосфоинозитиды активируют гетеромерные нейрональные KCNQ2/KCNQ3 и KCNQ3/KCNQ5 калиевые каналы в Xenopus laevis ооцитной экспрессирующей системе неспецифическим образом.

В данном исследовании подтверждается факт наличия чувствительности гетеромерных KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналов к PI(4,5)P2. Кроме того, обнаружено, что гетеромерные KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналы активируются всеми тремя PIP2 аналогами (рис. 11; 12). Полученные результаты совпадают с недавно опубликованными данными Suh B. C. с соавторами, которые показали, что повышенная продукция PIP2 увеличивает, а истощение PIP2 снижает KCNQ2/KCNQ3 токи [Suh B. C. et al., 2006].

Таким образом, аналогично данным по другим каналам и особенно по KCNQ2/KCNQ3, дифосфорилированные фосфоинозитиды активируют гетеромерные нейрональные М-каналы KCNQ2/KCNQ3 и KCNQ3/KCNQ5 в Xenopus laevis ооцитной экспрессирующей системе неспецифическим образом [Rohacs T. et al., 1999; Li Y. et al., 2005].

Рис. 10. Амплитуда тока гетеромерных KCNQ2/KCNQ3 калиевых каналов после инъекции водорастворимых аналогов C6-PI(3,4)P2, C6-PI(3,5)P2 и C6-PI(4,5)P2 в Xenopus laevis ооцитах. Примечание. А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 17). Чёрные кружки обозначают амплитуду тока KCNQ2/KCNQ3 калиевых каналов, экспрессированных в одиночку, белые кружки – с PI(3,4)P2, белые квадраты – с PI(3,5)P2, белые треугольники – с PI(4,5)PРис. 11. Амплитуда тока гетеромерных KCNQ3/KCNQ5 калиевых каналов, после инъекции водорастворимых аналогов C6-PI(3,4)P2, C6-PI(3,5)P2 и C6-PI(4,5)P2 в Xenopus laevis ооцитах. Примечание. А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 11). Чёрные кружки обозначают амплитуду тока KCNQ3/KCNQ5 калиевых каналов, экспрессированных в одиночку, белые кружки – с PI(3,4)P2, белые квадраты – с PI(3,5)P2, белые треугольники – с PI(4,5)PЭти данные указывают на то, что базальный уровень PI(4,5)P2 на плазматической мембране ооцитов недостаточно высок для насыщения активности KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналов. Поэтому повышение уровня PI(4,5)P2 путём прямого воздействия PI(4,5)P2 или продукцией PI(4,5)PPIP5K2A киназой стимулирует работу каналов. Теоретически образующийся PI(4,5)P2 вследствие активности PIP5K2A киназы мог не достигать KCNQ2/KCNQ3 и KCNQ3/KCNQ5 мембранных каналов и не оказывать на них стимулирующего эффекта вследствие разницы в локализации. В данной работе было показано, что PIP5K2A киназа способна увеличивать содержание внутриклеточного PI(4,5)P2 в контексте чувствительности KCNQ каналов.

Исходя из вышеизложенного, нейрональная PIP5K2A киназа является функциональным модулятором гетеромерных KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналов, в то время как гомомерные KCNQ2 и KCNQ5 подтипы нейрональных калиевых каналов не обладают чувствительностью к нейрональной PIP5K2A. Выявленное PIP5K2A-опосредованное увеличение амплитуды тока в гетеромерных KCNQ2/KCNQ3 и KCNQ3/KCNQ5 калиевых каналах может быть обусловлено присутствием KCNQ3 субъединицы в гетеромерном канальном комплексе. Кроме того, получены данные о том, что дифосфорилированные фосфоинозитиды активируют гетеромерные нейрональные М каналы KCNQ2/KCNQ3 и KCNQ3/KCNQ5 в ооцитной экспрессирующей системе неспецифическим образом.

Недавно получены веские доказательства ассоциации генетически изменённой PIP5K2A с шизофренией [Stopkova P. et al., 2003; Stopkova P. et al., 2005; Schwab S. G. et al., 2006; Bakker S. C. et al., 2007; He Z. et al., 2007]. Тем не менее, возможная функциональная роль этой PIP5K2A мутации не была выяснена. Для функционального тестирования мутантной формы (N251S)-PIP5K2A киназы KCNQ2 и KCNQ5 каналы экспрессировали в одиночку или совместно с (N251S)-PIP5K2A.

Совместная экспрессия гомомерного KCNQ2 калиевого канала и (N251S)-PIP5K2A киназы не имела стимулирующего эффекта на активность KCNQ2 канала. Наоборот, мутантная киназа значительно снизила амлитуду тока, генерируемого KCNQ2 каналом (–30 %, p = 0,004) при +50 мВ (рис. 12).

Рис. 12. Амплитуда тока гомомерных KCNQ2 калиевых каналов, коэкспрессированных с (N251S)-PIP5K2A в Xenopus laevis ооцитах. Примечание. А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 44). Чёрные кружки обозначают амплитуду тока KCNQ2 калиевых каналов, экспрессированных без (N251S)-PIP5K2A, белые символы – с (N251S)-PIP5K2A Не обнаружено увеличения амплитуды тока, генерируемого KCNQ5 каналом при экспрессии с мутантной формой (N251S)-PIP5K2A киназы, ассоциированной с шизофренией (–5%, p = 0,75) по сравнению с амплитудой тока, генерируемым KCNQ5 каналом, экспрессированным в одиночку при +50 мВ (рис. 13).

Рис. 13. Амплитуда тока гомомерных KCNQ5 калиевых каналов, коэкспрессированных с (N251S)-PIP5K2A в Xenopus laevis ооцитах. Примечание. А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 65). Чёрные кружки обозначают амплитуду тока KCNQ5 калиевых каналов, экспрессированных без (N251S)-PIP5K2A, белые символы – с (N251S)-PIP5K2A Так как wt-PIP5K2A киназа предположительно работает путём увеличения PIP2, то мутантная (N251S)-PIP5K2A может снижать PIP2 на мембране, приводя к пониженному току, индуцированному гомомерными каналами, имеющими чувствительность в 5 раз меньше, чем гетеромерные формы каналов [Li Y. et al., 2005]. Тем не менее, показано, что PI(4,5)P2 поддерживается в клетках на относительно постоянном уровне [McLaughlin S. et al., 2002]. Другим объяснением различной чувствительности может быть колокализация фермента, особенно в отношении гетеромерных каналов.

В эксперименте по коэкспрессии гетеромерного KCNQ2/KCNQ3 калиевого канала с (N251S)-PIP5K2A киназой обнаружен угнетающий эффект (N251S)PIP5K2A киназы на активность гетеромерных KCNQ2/KCNQ3 калиевых каналов (–26 %, p = 0,043) при +50 мВ (рис. 14).

Мутантная форма (N251S)-PIP5K2A киназы не оказывала стимулирующего эффекта на работу KCNQ3/KCNQ5 гетеромерных калиевых каналов (–19 %, p = 0,08) при +50 мВ (рис. 15).

Неспособность (N251S)-PIP5K2A активировать KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналы может означать, что мутация ведёт к снижению KCNQ активации у пациентов, страдающих шизофренией. Более того, обнаружено даже угнетающее действие мутантной киназы на KCNQ2 и KCNQ2/KCNQ3 токи.

Рис. 14. Амплитуда тока гетеромерных KCNQ2/KCNQ3 калиевых каналов, коэкспрессированных с (N251S)-PIP5K2A в Xenopus laevis ооцитах. Примечание.

А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 41). Чёрные кружки обозначают амплитуду тока KCNQ2/KCNQ3 калиевых каналов, экспрессированных без (N251S)-PIP5K2A, белые символы – с (N251S)-PIP5K2A Рис. 15. Амплитуда тока гетеромерных KCNQ3/KCNQ5 калиевых каналов, коэкспрессированных с (N251S)-PIP5K2A в Xenopus laevis ооцитах. Примечание.

А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m, n = 42). Чёрные кружки обозначают амплитуду тока KCNQ3/KCNQ5 калиевых каналов, экспрессированных без (N251S)-PIP5K2A, белые символы – с (N251S)-PIP5K2A KCNQ каналы подавляют базальную активность дофаминергических нейронов [Hansen H. H. et al., 2006] и снижение активности KCNQ каналов может значительно способствовать повышенной дофаминергической нейротрансмиссии при шизофрении [Dalby-Brown W. et al., 2006]. Было показано, что KCNQ2 каналы принимают участие в высвобождении дофамина из стриарных синаптосом крыс, индуцированном повышенными внеклеточными концентрациями К+ [Martire M. et al., 2007].

Данное высвобождение дофамина, индуцированное повышенными внеклеточными концентрациями К+, ингибировалось ретигабином, активатором мускаринрегулируемого тока, генерируемого KCNQ2 и KCNQ3 и предотвращалось блокаторами упомянутого тока тетраэтиламмонием и XE-991, которые увеличивали высвобождение дофамина, индуцированного повышенными внеклеточными концентрациями К+ и предотвращали ретигабин-индуцированное ингибирование высвобождения дофамина, индуцированное деполяризацией [Martire M. et al., 2007].

Подтверждая вышесказанное, было продемонстрировано, что активация KCNQ каналов ретигабином ингибирует возникновение нейронального потенциала действия и активность пикового потенциала мезенцефалических дофаминергических систем in vitro и in vivo, снижая активность внеклеточных уровней дофаминовых метаболитов in vivo, интерферируя с дофаминовой активностью [Hansen H. H. et al., 2006; Hansen H. H. et al., 2007] и блокируя возникновение нейронального потенциала действия дофаминергических нейронов в среднем мозге [Hansen H. H. et al., 2006]. Напротив, блокирование KCNQ каналов селективным блокатором XE-991 приводит к увеличенной дофаминергической нейрональной возбудимости в чёрной субстанции и вентральной тегментальной области [Hansen H. H. et al., 2006; Hansen H. H. et al., 2007; Koyama S., Appel S. B., 2006].

Нарушение активации KCNQ каналов дефектной (N251S)-PIP5K2A может повышать мезенцефалический дофаминовый потенциал действия у больных шизофренией, особенно после употребления вызывающих зависимость дофаминергических препаратов. Этот механизм может объяснять широко распространённую коморбидность шизофрении и лекарственной зависимости и объяснять вызванную лекарствами дофаминергическую дизрегуляцию и сопутствующие психотические симптомы [Lieberman J. A. et al., 1987; Lieberman J. A.

et al., 1989; Thirthalli J., Benegal V., 2006]. В соответствии с этим, было показано, что активация KCNQ каналов ослабляет центральные стимулирующие эффекты нескольких веществ (таких как кокаин, метилфенидат и фенилциклидин), модулирующих дофамин и вызывающих шизофренические симптомы [Hansen H. H. et al., 2006; Hansen H. H. et al., 2007]; таким образом, повышение уровней дофамина и метаболитов, а также локомоторная активность, вызванная кокаином, метилфенидатом и фенилциклидином, снижены при стимулировании KCNQ [Hansen H. H. et al., 2006; Hansen H. H. et al., 2007].

Индукция протоонкогена c-Fos в стриатуме обсуждалась в качестве механизма побочных экстрапирамидных эффектов, вызываемых главным образом типичными антипсихотиками [Bubser M., Deutch A. Y., 2002]. KCNQ антогонизируют галоперидол-индуцированную экспрессию c-Fos в стриатуме [Mikkelsen J. D., 2004], несмотря на блокирование нейронального потенциала действия дофаминергических нейронов в среднем мозге [Hansen H. H. et al., 2006]. Поэтому, специфическая фармакологическая активация этих каналов может улучшить позитивные симптомы шизофрении без пагубных побочных эффектов. Согласуются с этой гипотезой данные о том, что структурный аналог ретигабина, а именно флупиртин, ингибирует галоперидол-индуцированную каталепсию у крыс [Schmidt W. J. et al., 1997].

Чтобы выяснить, зависит ли эффект PIP5K2A и (N251S)-PIP5K2A от присутствия PI(4,5)P2, KCNQ2/KCNQ3 каналы экспрессировали в ооцитах, после чего клетки инъецировали водорастворимым C6-PI(4,5)P2 при наличии или отсутствии PIP5K2A или (N251S)-PIP5K2A. KCNQ2/KCNQ3 каналы были активированы PI(4,5)P2 только в случае отсутствия wt-PIP5K2A (KCNQ2/KCNQ3:

PI(4,5)P2 = +68 %; KCNQ2/KCNQ3 + (N251S)-PIP5K2A: PI(4,5)P2 = +60 %), в то время, как PI(4,5)P2 скавенджер PIP2-Grip только ингибировал KCNQ2/KCNQканалы в присутствие wt-PIP5K2A (KCNQ2/KCNQ3 + PIP5K2A: PI(4,5)P2 = –20 %) при +50 мВ (рис. 16).

Несостоятельность мутантной PIP5K2A киназы стимулировать KCNQ может быть результатом нарушения киназной активности. В качестве альтернативы, мистаргетинг киназы может привести к утрате функции. В этом случае продукт PI(4,5)P2 продуцировался бы функциональным киназным доменом в мутантной форме киназы, но этот продукт присутствовал бы тогда и в другом компартменте и не на плазматической мембране поблизости от KCNQ каналов.

Полученные данные о том, что KCNQ каналы, коэкспрессированные с PIP5K2A, но не с мутантной (N251S)-PIP5K2A, ингибируются PIP2 скавенджером PIP2-Grip, но не стимулируются в дальнейшем PI(4,5)P2 аналогом, указывают на то, что мутантная (N251S)-PIP5K2A не в состоянии увеличить уровни клеточных PIP2 (рис. 16). Эти данные убедительно доказывают, что отсутствие функциональной стимуляции (N251S)-PIP5K2A киназой является результатом нарушения активности мутантной фосфоинозитидной киназы.

Полученные результаты означают, что wt-PIP5K2A-опосредованная стимуляция KCNQ2/KCNQ3 каналов сопровождается образованием дифосфорилированных фосфоинозитидов PI(4,5)P2, в то время как мутантная (N251S)PIP5K2A киназа не в состоянии активировать каналы. Тем не менее, каналы могли быть активированы экзогенным PIP2, что согласуется с обнаруженным отсутствием активности мутантной (N251S)-PIP5K2A (рис. 16).

(N251S)-PIP5K2A модель была создана с использованием системы координат разрешённой кристаллической структуры близкородственной фосфатидилинозитол фосфат киназы тип II бета PIP5P2B (1BO1) (рис. 17).

В этой (N251S)-PIP5K2A модели Asn251 (аспарагин в 251 положении) расположен близко к Ile-Ile-Asp фрагменту (Ile-изолейцин, Asp-аспартатная кислота) каталитического домена. Можно ожидать, что Asn251 мутация снизит взаимодействия двух антипараллельных спиралей, в которых локализованы IleIle-Asp фрагмент и аминокислотный остаток Asn251.

Трёхмерная модель мутантной формы (N251S)-PIP5K2A предполагает, что взаимодействия двух спиралей могут быть разрушены (рис. 17). В самом деле, расстояния боковых цепей аминокислотных остатков N251 и Ile357 каталитического домена увеличены с 3 до 6, снижая вероятность прямых взаимодействий. Структурно-функциональная интегрированность каталитического домена нуждается во взаимодействии двух антипараллельных цепей, а мутация N251S может разрушать каталитический цикл, таким образом аннулируя стимуляцию М-каналов мутантной PIP5K2A. Результирующий скавенджерный эффект мог снизить уровень внутриклеточных PI(4,5)P2, что может объяснять нарушенную функцию KCNQ2 и KCNQ2/KCNQ3 каналов при коэкспрессии с (N251S)-PIP5K2A.

Рис. 16. Зависимость эффектов wt-PIP5K2A и (N251S)-PIP5K2A на амплитуду тока гетеромерных KCNQ2/KCNQ3 калиевых каналов от присутствия PI(4,5)P2 в Xenopus laevis ооцитах. Примечание. После экспрессии KCNQ2/KCNQ3 в одиночку или с wtPIP5K2A, или с мутантной (N251S)-PIP5K2A часть ооцитов за 30–60 минут до регистрации токов инъецировали 4,6 нл водорастворимого аналога PI(4,5)P2 (100 мг/мл) с последующей инъекцией 4,6 нл скавенджера PIP2-Grip. Результаты представлены в виде нормированных значений амплитуды тока (М ± m, n = 18) В заключение, было продемонстрировано, что PIP5K2A активирует нейрональные KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналы в Xenopus laevis ооцитной экспрессирующей системе. Эта регуляция нарушена у мутантной (N251S)PIP5K2A, ассоциированной с шизофренией, что может способствовать патофизиологическому процессу при этом заболевании. Более того, эта мутация может, по крайней мере теоретически, быть релевантной за неконтролируемую дофаминергическую инициацию в ряде случаев в ответ на дофаминергические препараты. Функциональная роль PIP5K2A и KCNQ при шизофрении может способствовать реализации новых более эффективных патогенетически направленных терапевтических стратегий.

Рис. 17. (N251S)-PIP5K2A модель. Примечание. Цифрами обозначены ключевые аминокислотные остатки в субстратно специфическом домене (1), каталитическом домене (2) и остатке Ser 251 (3) 3. Влияние нативной PIP5K2A и мутантной, ассоциированной с шизофренией (N251S)-PIP5K2A на активность нейрональных EAAT3 глутаматных транспортёров.

В Xenopus laevis ооцитах, экспрессирующих возбуждающий аминокислотный транспортёр EAAT3, глутамат (2 мМ) индуцировал направленный внутрь ток (Iглу), указывающий на электрогенное вхождение Na+ и глутамата (рис. 18, левый столбик). В неинъецированных Xenopus laevis ооцитах подобный ток не регистрировался (0,55 ± 0,10 % от тока в ооцитах, экспрессирующих EAAT3, n = 21). Таким образом, Xenopus laevis ооциты не экспрессируют эндогенные электрогенные глутаматные транспортёры.

В связи с тем, что данные о влиянии фосфатидилинозитол-4,5-бифосфата (PI(4,5)P2) на нейрональные EAAT3 глутаматные транспортёры в научной литературе полностью отсутствуют, и поскольку PI(4,5)P2 является прямым продуктом ферментативной деятельности PIP5K2A, было целесообразным, прежде всего, изучить влияние PI(4,5)P2 на работу EAAT3 глутаматных транспортёров.

Инъекция PI(4,5)P2 (4,6 нл) в Xenopus laevis ооциты, экспрессирующие EAAT3, приводила к значительному увеличению Iглу по сравнению с Iглу в ооцитах, экспрессирующих EAAT3 без инъекций PIP2 (рис. 18).

Таким образом, получены новые данные об увеличении активности нейрональных глутаматных транспортёров EAAT3 фосфатидилинозитол-4,5бифосфатом.

Рис. 18. Стимулирование электрогенного глутаматного транспорта в EAATэкспрессирующих Xenopus laevis ооцитах инъекциями PIP2. Примечание.

А. Репрезентативные регистрации токов. Б. Нормированные значения амплитуды тока (М ± m).

*** – p < 0,05 по отношению к току в Xenopus laevis ооцитах, экспрессирующих EAATАналогичный стимулирующий эффект был получен при коэкспрессии EAAT3 и PIP5K2A (рис. 19). Таким образом, PIP5K2A повышает активность EAAT3.

Рис. 19. Стимулирование электрогенного глутаматного транспорта в EAATэкспрессирующих Xenopus laevis ооцитах коэкспрессией PIP5K2A. Примечание.

А. Репрезентативные регистрации токов. Б. Нормированные значения значения амплитуды тока (М ± m). *** – p < 0,05 по отношению к току в Xenopus laevis ооцитах, экспрессирующих EAATНастоящее исследование открыло абсолютно новый механизм регулирования нейрональных глутаматных транспортёров EAAT3, захватывающих глутамат из экстраклеточного пространства, а именно стимуляцию EAAT3 фосфатидилинозитол-4-фосфат-5-киназой (тип 2 альфа).

Дальнейшая серия экспериментов была предпринята, чтобы выяснить, имеет ли мутантная форма (N251S)-PIP5K2A аналогичный стимулирующий эффект, каким обладает дикий тип PIP5K2A. Дополнительная экспрессия (N251S)-PIP5K2A в EAAT3-экспрессирующих Xenopus laevis ооцитах приводила к значительному снижению Iглу (рис. 20). Таким образом, в противоположность дикому типу PIP5K2A, мутантная (N251S)-PIP5K2A снижала активность EAAT3. Предполагается, что сниженная активность EAAT3 транспортёров задерживает захват глутамата в клетки.

Рис. 20. Снижение электрогенного глутаматного транспорта в EAAT3 экспрессирующих Xenopus laevis ооцитах коэкспрессией (N251S)-PIP5K2A. Примечание.

А. Репрезентативные регистрации токов. Б. Нормированные значения значения амплитуды тока (М ± m). *** – p < 0,05 по отношению к току в Xenopus laevis ооцитах, экспрессирующих EAATНарушенный клиренс возбуждающих нейротрансмиттеров способствует развитию нейротоксичности. Аналогичным образом, повреждённая функция EAAT3 транспортёров вовлечена в формирование шизофрении [Smith R. E. et al., 2001; McCullumsmith R. E., Meador-Woodruff J. H., 2002; Kim J. H. et al., 2005; Huerta I. et al., 2006; Deng X. et al., 2007; Lang U. E. et al., 2007;

Nudmamud-Thanoi S. et al., 2007].

Так как мутация (N251S)-PIP5K2A ассоциирована с шизофренией [Stopkova P. et al., 2003; Stopkova P. et al., 2005; Schwab S. G. et al., 2006; Bakker S. C. et al., 2007; He Z. et al., 2007], нарушение регуляции EAAT3 может способствовать патофизиологии этого заболевания.

Неспособность мутантной (N251S)-PIP5K2A стимулировать EAAT3 может объясняться нарушенной киназной активностью, приводящей к снижению образования PI(4,5)P2. Полученные данные не исключают других возможных объяснений ингибирующего эффекта (N251S)-PIP5K2A на EAAT3, в том числе более непосредственного влияния на EAAT3.

Дополнительные эксперименты были выполнены для того, чтобы определить, интерферирует ли (N251S)-PIP5K2A со стимулирующим эффектом дикого типа PIP5K2A. Как показано на рис. 21, коэкспрессия (N251S)-PIP5K2A в Xenopus laevis ооцитах, коэкспрессирующих дикий тип PIP5K2A и EAAT3 приводила к снижению Iглу до аналогичных низких уровней, наблюдаемых в Xenopus laevis ооцитах, коэкспрессирующих EAAT3 с (N251S)-PIP5K2A.

Рис. 21. Аннулирование стимуляции глутаматного транспортёра EAAT3 диким типом PIP5K2A в Xenopus laevis ооцитах коэкспрессией неактивной (N251S)-PIP5K2A.

Примечание. Результаты представлены в виде нормированных значений амплитуды тока (М ± m). *** – p < 0,05 по отношению к току в Xenopus laevis ооцитах, экспрессирующих EAATТаким образом, коэкспрессия (N251S)-PIP5K2A полностью изменяла стимулирующий эффект дикого типа PIP5K2A в отношении активности EAAT3.

Интересно, что (N251S)-PIP5K2A мутация не только нефункциональна сама по себе, но, очевидно, ингибирует функцию дикого типа PIP5K2A. Поэтому, по крайней мере теоретически, мутантная форма (N251S)-PIP5K2A может проявлять доминантный ингибирующий эффект и быть намного более эффективной, чем в случае простой утраты функции. Трансдоминантная ингибиторная активность (N251S)-PIP5K2A предполагает, что (N251S)-PIP5K2A киназа перемещается к клеточной мембране и каким-то образом вмешивается в функционирование дикого типа PIP5K2A или EAAT3.

Инъекция PIP2 в ооциты, экспрессирующие и EAAT3, и PIP5K2A не приводила к дальнейшему росту Iглу (рис. 22). По сравнению с ооцитами, экспрессирующими только EAAT3, ток увеличился примерно одинаково после коэкспрессии с PIP5K2A (на 41 ± 5 %, n = 40), после инъекций PIP2 (на 62 ± 16 %, n = 17), и после коэкспрессии PIP5K2A и дополнительной инъекции PIP2 (на 75 ± 13 %, n = 23). Таким образом, эффекты PIP2 и PIP5K2Aкоэкспрессии на активность EAAT3 не были кумулятивными.

Рис. 22. Стимулирование электрогенного глутаматного транспорта в Xenopus laevis ооцитах, экспрессирующих EAAT3 или коэкспрессирующих EAAT3 с (N251S)PIP5K2A инъекциями PIP2. Примечание. Серые столбики обозначают группы Xenopus laevis ооцитов, в которых дополнительно к экспрессии EAAT3 / EAAT3 + PIP5K2A / EAAT3 + (N251S)-PIP5K2A / EAAT3 + PIP5K2A + (N251S)-PIP5K2A инъецировался PI(4,5)P2. Результаты представлены в виде нормированных значений амплитуды тока (М ± m). *** – p < 0,05 по отношению к току в Xenopus laevis ооцитах, экспрессирующих EAAT3 без инъекций PIP2. ### – p < 0,05 по отношению к группе EAAT3 + PIP5K2A. ## – p < 0,05 по отношению к группам EAAT3 + PI(4,5)P2 и EAAT3 + PIP5K2A+PI(4,5)PУвеличение EAAT3 активности могло наблюдаться за счёт повышения содержания белка транспортёра на плазматической мембране. Чтобы проверить эту возможность, были выполнены иммуногистохимическое исследование и конфокальная микроскопия (рис. 23). Дикий тип PIP5K2A увеличивал экспрессию EAAT3 белка на плазматической мембране Xenopus laevis ооцитов, а неактивная мутантная форма (N251S)-PIP5K2A не обнаружила стимулирующего эффекта. Мембранная экспрессия EAAT3 в ооцитах, коинъецированных с EAAT3, PIP5K2A и (N251S)-PIP5K2A была аналогично низкой, как содержание EAAT3 белка на плазматической мембране Xenopus laevis ооцитов, экспрессирующих EAAT3 с (N251S)-PIP5K2A.

PIP5K2A киназа, по крайней мере частично, эффективна в отношении увеличения содержания белка транспортёра EAAT3 на клеточной мембране.

Известно, что фосфатидилинозитол-4,5-бифосфат (PIP2), образуемый PIP5K2A киназой, участвует в регуляции белков клеточной мембраны [Shyng S. L. et al., 2000; Delmas P., Brown D. A., 2005; Brown D. A. et al., 2007]. PIP5K2A стимулирует формирование PIP2 на плазматической мембране, который может служить якорем для EAAT3 содержащих везикул.

Рис. 23. Содержание EAAT3 белка на клеточной мембране Xenopus laevis ооцитов, экспрессирующих EAAT3 / EAAT3 + PIP5K2A / EAAT3 + (N251S)-PIP5K2A / EAAT+ PIP5K2A + (N251S)-PIP5K2A. Примечание. Масштабная линейка: 50 мк Чтобы протестировать, является ли PIP5K2A аналогично эффективной в клетках млекопитающих, были выполнены дополнительные исследования на человеческих эмбрионных почечных клетках (HEK293). Согласно результатам биотинилирования и последующего Western blotting (рис. 24), содержание EAAT3 белка на клеточной мембране было значительно выше в HEK293 клетках, трансфицированных PIP5K2A, чем в клетках, трансфицированных пустым вектором. Более того, содержание белка на клеточной мембране было значительно снижено трансфекцией (N251S)-PIP5K2A или PIP5K2A плюс (N251S)PIP5K2A.

Рис. 24. Содержание EAAT3 белка на клеточной мембране HEK293 клеток, трансфецированных EAAT3 / EAAT3 + PIP5K2A / EAAT3 + (N251S)-PIP5K2A / EAAT3 + PIP5K2A + (N251S)-PIP5K2A Таким образом, данные, полученные на HEK-293 клетках млекопитающих, подтверждают связь между PIP5K2A и нейрональным глутаматным транспортёром EAAT3, что распространяет результаты наблюдений за пределы Xenopus laevis ооцитной экспрессирующей системы.

В заключение, PIP5K2A является новым сигнальным элементом в регуляции активности EAAT3. Дикий тип PIP5K2A, но не мутантная форма (N251S)-PIP5K2A является потенциальным стимулятором EAAT3 активности и поэтому предположительно, может оказывать влияние на обратный захват клетками глутамата. Таким образом, инактивирующая мутация (N251S)PIP5K2A может играть роль в нарушении метаболизма глутамата в мозге у больных шизофренией, которые являются носителями этой мутации.

4. Особенности содержания дегидроэпиандростерона сульфата (ДГЭАС) в норме и при шизофрении.

Проведено изучение содержания ДГЭАС в сыворотке крови у 182 пациентов, страдающих шизофренией, с учётом половозрастных и клинических особенностей, а также применяемой терапии и у 103 физически и психически здоровых лиц.

Уровень сывороточного ДГЭАС у больных шизофренией был достоверно низким (1,781 ± 0,102 мкг/мл; 182 человека) по сравнению с группой психически и соматически здоровых лиц (2,355 ± 0,157 мкг/мл; р = 0,001; 103 человека).

При исследовании мужчин и женщин в группах пациентов и здоровых лиц обнаружились половые особенности содержания ДГЭАС в сыворотке крови. Мужчины обнаружили высокое содержание ДГЭАС по сравнению с женщинами и в группе контроля (2,926 ± 0,297 мкг/мл и 1,785 ± 0,124 мкг/мл соответственно, p < 0,05), и в группе пациентов (1,976 ± 0,143 мкг/мл и 1,522 ± 0,1мкг/мл соответственно, p < 0,001). Содержание ДГЭАС у здоровых мужчин (2,926 ± 0,297 мкг/мл) превышало те же показатели у мужчин, страдающих шизофренией (1,976 ± 0,143 мкг/мл, p < 0,05). Уровень гормона у женщин из контрольной группы (1,785 ± 0,124 мкг/мл) оказался выше, чем у пациенток (1,522 ± 0,135 мкг/мл, p < 0,05).

По результатам оценки клинических особенностей протекания шизофренического процесса пациенты были разделены на две подгруппы: с преобладанием позитивной либо негативной симптоматики. Выявлена достоверно низкая концентрация ДГЭАС у больных шизофренией с преобладанием негативной симптоматики (1,395 ± 0,106 мкг/мл) по отношению к здоровым лицам (2,042 ± 0,129 мкг/мл, p < 0,05). Уровень гормона у пациентов с преобладанием позитивной симптоматики не отличался от контрольных значений (2,355 ± 0,157 мкг/мл, p = 0,86). Интересно, что группы пациентов, сформированные по принципу преобладания позитивной либо негативной симптоматики, существенно различаются между собой по уровню ДГЭАС в сыворотке крови (2,355 ± 0,157 мкг/мл и 1,395 ± 0,106 мкг/мл соответственно, p < 0,001). Корреляции между низкими сывороточными концентрациями ДГЭАС и негативной симптоматикой, продолжительностью госпитализации и степенью тяжести заболевания [Strous R. D. et al., 2004] у больных шизофренией находят своё подтверждение в научной литературе [Goyal R. O. et al., 2004].

Поскольку сывороточный уровень ДГЭАС достоверно отличается у мужчин и женщин, проведена дополнительная оценка этого показателя у больных шизофренией с учётом как клинической картины (преобладание позитивной или негативной симптоматики), так и полового различия.

Пациенты мужского пола с преобладанием позитивной симптоматики не отличались статистически от мужчин контрольной группы по уровню ДГЭАС в сыворотке крови (2,373 ± 0,233 мкг/мл и 2,926 ± 0,297 мкг/мл соответственно, p = 0,185), в то время как мужчины, больные шизофренией с преобладанием негативной симптоматики (1,568 ± 0,138 мкг/мл), обнаружили достоверно низкий уровень гормона по сравнению со здоровыми мужчинами (2,926 ± 0,297 мкг/мл, p < 0,001).

Пациенты мужчины с преобладанием негативной симптоматики обладали статистически низким гормональным уровнем по отношению к мужчинам, больным шизофренией с преобладанием позитивной симптоматики (1,568 ± 0,138 мкг/мл и 2,373 ± 0,233 мкг/мл соответственно, p < 0,05).

Аналогичная картина наблюдалась при анализе данных, полученных в женских группах контроля и больных шизофренией с различной клинической картиной (преобладанием позитивной или негативной симптоматики).

Пациентки с преобладанием позитивной симптоматики (1,784 ± 0,1мкг/мл) не отличались статистически от женщин контрольной группы (1,785 ± 0,124 мкг/мл, p = 0,595) по уровню ДГЭАС в сыворотке крови, в то время как женщины, больные шизофренией с преобладанием негативной симптоматики, демонстрировали значимо низкие уровни гормона (1,094 ± 0,1мкг/мл, p < 0,05) по сравнению со здоровыми женщинами. Пациентки с преобладанием негативной симптоматики обладали значительно пониженным гормональным уровнем по отношению к женщинам, больным шизофренией с преобладанием позитивной симптоматики (p < 0,05).

Согласно результатам множественного сравнительного статистического метода Холма – Сидака, позволяющего делать как попарные сравнения, так и сравнения по отношению к контрольной группе, показатель внутрисывороточной концентрации ДГЭАС, коррелирующий с фактором наличия или отсутствия шизофрении, не зависит при этом от фактора половой принадлежности.

Следует особо подчеркнуть, что пациенты с преобладанием негативной симптоматики как в общей группе, так и при половом разделении, отличаются заметным снижением уровня ДГЭАС в сыворотке крови.

После обнаружения низкого уровня ДГЭАС в сыворотке крови у больных шизофренией был проведён дополнительный анализ данного показателя у пациентов в зависимости от длительности заболевания.

В группе мужчин больных шизофренией тенденция к снижению ДГЭАС наблюдается уже в течение первого года заболевания (2,645 ± 0,324 мкг/мл), но этот показатель статистически не отличается от контрольных значений (2,903 ± 0,280 мкг/мл, p = 0,553). Существенное уменьшение сывороточного ДГЭАС обнаружено в группе с продолжительностью заболевания от 1 года до 3 лет (1,980 ± 0,224 мкг/мл, p < 0,05) и в группе с продолжительностью заболевания более 3 лет (1,875 ± 0,162 мкг/мл, p < 0,001) по сравнению со здоровыми донорами.

В группе женщин больных шизофренией не более одного года наблюдалась тенденция к увеличению ДГЭАС (2,150 ± 0,300 мкг/мл) по сравнению с контрольными показателями здоровых женщин (1,771 ± 0,126 мкг/мл, p = 0,641). В группе женщин больных шизофренией от одного года до трёх лет обнаружено несущественное снижение ДГЭАС (1,592 ± 0,215 мкг/мл, p = 0,844) по отношению к контрольным значениям. Статистическое уменьшение сывороточного ДГЭАС выявлено в группе пациенток с продолжительностью заболевания более 3 лет (1,411 ± 0,134 мкг/мл, p < 0,05).

Таким образом, длительность шизофренического процесса коррелирует со снижением концентрации ДГЭАС в сыворотке пациентов. Полученные результаты согласуются с данными литературы [Oertel G. W. et al., 1974;

Tourney G., Erb J. L., 1979; Erb J. L. et al., 1982; Strous R. D. et al., 2004;

Ritsner M. et al., 2004; Ritsner M. et al., 2006; Maninger N. et al., 2009].

При сравнении контрольной группы мужчин с мужчинами больными шизофренией был также учтён возрастной фактор. В возрастной группе моложе лет концентрация ДГЭАС у пациентов (2,338 ± 0,221 мкг/мл) оказалась статистически ниже аналогичного показателя у здоровых мужчин (3,224 ± 0,2мкг/мл, p < 0,05).

Анализ данных, полученных в группе пациентов мужского пола, показал значительное снижение сывороточного ДГЭАС у лиц старше 50 лет (1,542 ± 0,140 мкг/мл) по сравнению с пациентами моложе 50 лет (2,338 ± ± 0,221 мкг/мл, p < 0,05).

При сравнении контрольной группы женщин с женщинами больными шизофренией не было обнаружено статистической разницы по содержанию ДГЭАС в сыворотке крови ни в первой, ни во второй возрастных группах. Концентрация ДГЭАС у женщин контрольной группы младше 50 лет составила 1,872 ± 0,137 мкг/мл, в то время как у пациенток того же возраста 1,742 ± 0,187 мкг/мл (p = 0,269).

В ранних работах по изучению ДГЭАС при шизофрении отмечали как повышенные [Oades R. D., Schepker R., 1994], так и чрезмерно низкие [Oertel G. W. et al., 1974; Tourney G., Erb J. L., 1979; Erb J. L. et al., 1982] сывороточные концентрации гормона.

Результаты последних лет также свидетельствуют о противоречивости результатов: как повышенные концентрации ДГЭАС в плазме и сыворотке у больных шизофренией, находящихся на лечении [Michel F. et al., 2005;

Gallagher P. et al., 2007; Ritsner M. et al., 2007], так и снижение сывороточных концентраций ДГЭАС у пациентов, проходящих лечение [Ritsner M. et al., 2006]. При анализе хронических случаев шизофрении у больных, находящихся на лечении в специализированном лечебном заведении, повышенные утренние сывороточные концентрации ДГЭАС и/или повышенные соотношения ДГЭАС/кортизол коррелировали с лучшей динамикой по аспектам памяти, показателей психоза и паркинсонических движений [Harris D. S. et al., 2001].

При изучении первого эпизода нелеченных пациентов, страдающих шизофренией выяснилось, что больные имели повышенные сывороточные концентрации как ДГЭА, так и ДГЭАС по сравнению с соответствующими контрольными лицами [Strous R. D. et al., 2004]. Было постулировано, что в первом эпизоде шизофренического психоза повышенные концентрации ДГЭАС служат протективным или компенсаторным фактором, и что концентрации ДГЭАС снижаются позже при хроническом течении заболевания [Strous R. D. et al., 2004]. В данном исследовании, в группе женщин, страдающих шизофренией менее одного года, обнаружена тенденция к увеличению сывороточной концентрации ДГЭАС, возможно, отражающая компенсаторные механизмы. Действительно, пациенты с более продолжительной длительностью заболевания как мужского, так и женского пола имели более низкие сывороточные концентрации ДГЭАС. Это согласуется с данными катамнестического наблюдения хронических пациентов, у которых сывороточные коэффициенты ДГЭА к кортизолу и ДГЭАС к кортизолу отрицательно коррелировали с продолжительностью заболевания [Ritsner M. et al., 2004]. В связи с тем, что упомянутые коэффициенты снижаются как с продолжительностью заболевания, так и с возрастом участников исследования (независимо от диагноза шизофрении), дифференцировать эти данные крайне сложно [Maninger N. et al., 2009].

Шизофрения является гетерогенным заболеванием с множественными симптоматическими профилями и коморбидностями. У больных шизофренией были обнаружены корреляции между низкими сывороточными концентрациями ДГЭА(С) и негативной симптоматикой [Goyal R. O. et al., 2004], расстройствами движения [Harris D. S. et al., 2001], большей продолжительностью заболевания и возрастом начала заболевания [Ritsner M. et al., 2004], продолжительностью госпитализации и выраженностью заболевания [Strous R. D. et al., 2004], когнитивными нарушениями [Harris D. S. et al., 2001, Silver H. et al., 2005], депрессией, раздражительностью, враждебностью [Ritsner M. et al., 2004] и тревожностью [Ritsner M. et al., 2007]. Эти корреляции предполагают, что вариабельность клинических особенностей может помочь объяснить противоречивые результаты между различными исследованиями больных шизофренией.

Способ прогнозирования эффективности фармакотерапии резидуальной шизофрении с использованием показателя концентрации дегидроэпиандростерона сульфата В связи с тем, что ДГЭАС играет важную роль в этиопатогенезе шизофрении и его содержание в организме изменяется в процессе лечения [Marx C. E.

et al., 2005], в нашем исследовании была предпринята попытка оценить динамику данного показателя при проведении терапии. С этой целью была отобрана группа пациентов с диагнозом резидуальная шизофрения.

Обследовано 20 пациентов с резидуальной шизофренией (6 мужчин и женщин; возрастной диапазон от 26 до 58 лет, средний возраст 43,5 ± 9,75 года;

диапазон длительности заболевания от 6 до 35 лет, средняя продолжительность заболевания 17,0 ± 7,42 лет). Среди выборки 19 человек (95 %) были инвалидами II группы по психическому заболеванию, 3 человека (15 %) имели постоянное место работы. У всех пациентов раньше диагностировали параноидную форму шизофрении.

Отбор пациентов производился по критериям МКБ–10 для резидуальной шизофрении. Кроме того, условием включения в группу была длительность шизофренического расстройства не менее пяти лет. Психопатологическая симптоматика описывалась согласно руководству «Оценочный перечень симптомов и глоссарий для психических расстройств» для МКБ–10. Каждый пациент до назначения фармакотерапии обследовался по психометрическим шкалам:

PANSS (оценка позитивной, негативной, общепсихопатологической симптоматики); AIMS (оценка патологических непреднамеренных движений); BAS (оценка акатизии по Барнсу); CGI (общее клиническое впечатление состояния до терапии и улучшения в течение терапии).

Для фармакотерапии применялся новый атипичный нейролептик кветиапин, являющийся производным дибензотиазепина. Продолжительность приема препарата составила шесть недель. Нейролептик применялся два раза в сутки (утро, вечер) независимо от приёма пищи. Суточная доза увеличивалась в течение первых четырёх дней: 1-й день – 50 мг; 2-й день – 100 мг; 3-й день – 200 мг;

4-й день – 300 мг. Начиная с пятого дня, доза препарата подбиралась индивидуально и варьировала от 200 до 400 мг/сут.

В связи с тем, что в литературе часто используются не только показатели ДГЭАС, но и информативные соотношения ДГЭАС / кортизол, был применён соответствующий коэффициент пересчёта концентрации ДГЭАС, предоставленный в инструкции к набору для определения уровня ДГЭАС в сыворотке крови.

Уровень ДГЭАС у больных резидуальной шизофренией был достоверно низкий (4,654 ± 0,352 мкмоль/л) по сравнению с группой психически и соматически здоровых лиц (6,058 ± 0,364 мкмоль/л; р < 0,05). После 6-ти недельного курса фармакотерапии атипичным нейролептиком кветиапином среднее содержание ДГЭАС вернулось к нормальным значениям 6,63 ± 0,494 мкмоль/л.

Содержание в сыворотке крови кортизола у больных резидуальной шизофренией до лечения атипичным нейролептиком кветиапином (543,52 ± 17,нмоль/л) статистически превышало контрольные значения (445,13 ± 21,нмоль/л; р < 0,05). После проведённой фармакотерапии наблюдалась тенденция к снижению концентрации кортизола у пациентов (485,35 ± 14,53 нмоль/л) в сторону показателей группы контроля.

Полученные данные подтверждаются данными зарубежной литературы о снижении уровня ДГЭАС у больных шизофренией [Oertel G. W. et al., 1974;

Tourney G., Erb J. L., 1979; Erb J. L. et al., 1982; Binello E. et al., 2003;

Strous R. D. et al., 2004; Ritsner M. et al., 2004; Ritsner M. et al., 2006; Maninger N.

et al., 2009].

Согласно работам M. Ritsner, уровень кортизола в сыворотке крови у больных параноидной шизофренией значительно повышается [Ritsner M. et al., 2004; Ritsner M. et al., 2005]. В проведённом исследовании уровень кортизола в сыворотке крови больных шизофренией повышен всего на 23 % по отношению к здоровым лицам. Возможно, что незначительное увеличение уровня кортизола в сыворотке крови больных резидуальной в отличие от параноидного типа шизофрении связанно с действием стресс-лимитирующих систем в организме [Ritsner M. et al., 2004; Ritsner M. et al., 2005].

Снижение концентрации ДГЭАС может быть связано с наличием общего предшественника прегнелона в системе синтеза гормонов кортизола и дегидроэпиандростерона [Гончаров Н. П. и соавт., 2006; Гончаров Н. П. и соавт., 2007].

Возможно, что снижение уровня ДГЭАС является следствием нарушения ГАМК-ергической системы при шизофрении [Бурбаева Г. Ш. и соавт., 2007].

После проведённой фармакотерапии атипичным нейролептиком кветиапином концентрация ДГЭАС увеличилась на 42 % по сравнению с его средним значением до лечения.

Вероятно, применение кветиапина, блокируя рецепторы серотонина и дофамина, восстанавливает нормальную работу глутаматергической и ГАМКергической системы, что приводит к возобновлению ингибирующего влияния на синтез кортизола и повышению уровня ДГЭАС [Мишунина Т. М. и соавт., 2001; Lieberman J. et al., 2005; Stroup S. et al., 2006].

Таким образом, в ходе проведённого исследования было показано, что в динамике терапии резидуальной шизофрении с использованием атипичного нейролептика наблюдается нормализация показателей концентрации кортизола и содержания ДГЭАС.

По результатам оценки эффективности проводимой фармакотерапии, оцениваемой по шкале CGI (общее клиническое впечатление состояния до терапии и улучшения в течение терапии через 6 недель применения нейролептика больные были разделены на две группы: у 15 больных отмечена высокая эффективность терапии (1 группа), у 5 человек (2 группа) – низкая (или незначительное улучшение).

Пациенты с высокой эффективностью лечения обнаружили увеличение концентрации ДГЭАС (5,434 ± 0,546 мкмоль/л) по сравнению с группой, слабо поддающейся терапии атипичным нейролептиком кветиапином (3,432 ± 0,1мкмоль/л; р < 0,05).

По содержанию кортизола в сыворотке крови больных резидуальной шизофренией до фармакотерапии достоверных различий получено не было, в группе среднее значение составило 528,83 ± 44,94 нмоль/л, во 2 группе 578,80 ± 74,53 нмоль/л.

Характерной особенностью группы больных с низкой эффективностью терапии являлось достоверное снижение соотношения ДГЭАС / кортизол (624 ± 78) по сравнению с группой с высокой эффективностью фармакотерапии (1040 ± 104; р < 0,05).

Кветиапин, обладая высоким аффинитетом к 5НТ2А рецепторам серотонина, может снижать синтез кортиколиберина в нейронах гипоталамуса [Мосолов С. Н. и соавт., 2003; Lieberman J. et al., 2005; Reznik I. et al., 2006;

Stroup S. et al., 2006]. Это приводит к уменьшению продукции адренокортикотропного гормона, который регулирует синтез гормонов коры надпочечников дегидроэпиандростерон-сульфата и кортизола. В отличие от кортизола, концентрация ДГЭА и ДГЭАС регулируется не только адренокортикотропным гормоном [Гончаров Н. П. и соавт., 2004; Гончаров Н. П. и соавт., 2006; Гончаров Н. П. и соавт., 2007].

Так как ДГЭАС оказывает ингибирующее влияние на ГАМК-ергическую систему и синергичное влияние на метаботропные рецепторы N-метил-Dаспартата, благотворно влияя на память и, действуя на и k опиоидные рецепторы, снижает синтез дофамина и серотонина [Обут Т. А. и соавт., 2003; Федотова Ю. О. и соавт., 2004; Роживанов Р. В., 2005]. Также у ДГЭАС отмечают способность снижать нейротоксический эффект кортизола на нейроны гипокампа [Tsutsui K. et al., 2003; Коломеец Н. С., 2007].

Всё это объясняет более успешную фармакотерапию у пациентов с высокой концентрацией ДГЭАС в сыворотке крови до начала лечения.

Таким образом, нами показано, что снижение содержания нейростероида ДГЭАС является прогностически неблагоприятным признаком. Дегидроэпиандростерон является ключевым звеном в биосинтезе всех стероидных гормонов и обладает собственными эффектами, особенно в ЦНС. Этот нейростероид оказывает нейропротективное и стресспротективное действие, защищая организм от пагубного воздействия высоких доз кортизола. В нашем исследовании показано, что информативным является не только определение уровня ДГЭАС, но и оценка соотношения концентраций ДГЭАС и кортизола, характеризующих состояние анаболических и катаболических процессов (стресслимитирующих и стрессреализующих систем) организма пациента и обуславливающих отвечаемость на фармакотерапию.

Полученные результаты относительно гормональных показателей до назначения фармакотерапии позволяет их рассматривать в качестве предикторов клинической эффективности проводимой терапии и использовать в качестве дополнительных параклинических методов обследования. Это позволило разработать и запатентовать «Способ прогнозирования эффективности фармакотерапии резидуальной шизофрении атипичными нейролептиками» (Патент (РФ) № 2006108350/15, опубл. Бюл. № 27 от 27.09.2007).

Разработанный нами способ прост в осуществлении и на основе определения дегидроэпиандростерона и кортизола позволяет прогнозировать до лечения эффективность предполагаемой терапии и целенаправленно проводить реабилитационные фармакологические мероприятия.

Таким образом, в результате проведённого исследования выявлены новые механизмы PIP5K2A протеинкиназной регуляции нейрональных KCNQ калиевых каналов и глутаматных EAAT3 транспортёров в Xenopus ооцитной экспрессирующей системе и нарушение этой регуляции у мутантной, ассоциированной с шизофренией, формы (N251S)-PIP5K2A. Кроме того, обнаружено снижение уровня сывороточного нейростероида ДГЭАС у больных шизофренией, особенно у пациентов с преобладанием негативной симптоматики по сравнению с психически и соматически здоровыми лицами. На основе выявленных нарушений и литературных данных нами построена гипотетическая схема участия протеинкиназных сигнальных путей и нейростероида ДГЭАС в патофизиологических процессах при шизофрении (рис. 24).

Рис. 24. Схема участия протеинкиназных сигнальных путей и нейростероида ДГЭАС в патофизиологических процессах при шизофрении ВЫВОДЫ 1. Нейрональная PIP5K2A киназа стимулирует функциональную активность гетеромерных нейрональных калиевых KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналов, в то время как гомомерные KCNQ2 и KCNQ5 подтипы нейрональных калиевых каналов не обладают чувствительностью к нейрональной PIP5K2A киназе.

2. Дифосфорилированные фосфоинозитиды активируют нейрональные гетеромерные KCNQ2/KCNQ3 и KCNQ3/KCNQ5 каналы в ооцитной экспрессирующей системе неспецифическим образом.

3. Мутация (N251S)-PIP5K2A, ассоциированная с шизофренией, нарушая функциональную регуляцию нейрональных калиевых KCNQ каналов, приводит к повышению дофаминергической нейротрансмиссии при шизофрении. В основе лежит угнетающее действие мутантной киназы на KCNQ2 и KCNQ2/KCNQтоки при отсутствии стимулирующего эффекта на работу KCNQ2/KCNQ3 и KCNQ3/KCNQ5 гетеромерных калиевых каналов. Разработана трёхмерная модель мутантной формы (N251S)-PIP5K2A, демонстрирующая изменение структурно-функциональной интегрированности каталитического домена, которое приводит к нарушению каталитической функции фермента.

4. Выявлен новый механизм регулирования функциональной активности нейрональных глутаматных транспортёров EAAT3 нейрональной фосфатидилинозитол-4-фосфат-5-киназой (тип 2-альфа) и продуктом ее ферментативной деятельности PIP2 (за счет повышения амплитуды глутаматного тока EAATтранспортёров и уровня их мембранной экспрессии).

5. Мутация (N251S)-PIP5K2A, ассоциированная с шизофренией, препятствует нормальной функциональной регуляции нейрональных глутаматных транспортёров EAAT3, что играeт роль в нарушении метаболизма глутамата в мозге у больных шизофренией, носителей этой мутации. Механизмом нарушения является снижение электрогенного глутаматного тока EAAT3 транспортёров и экспрессии белка EAAT3 на плазматической мембране в отличие от дикого типа киназы. Мутантная форма проявляет доминантный ингибирующий эффект по отношению к дикому типу PIP5K2A киназы.

6. Функциональная связь между нейрональными глутаматными транспортёрами EAAT3 и PIP5K2A киназой подтверждена на человеческих HEK2клетках. PIP5K2A значительно увеличивает экспрессию EAAT3 белка на клеточной мембране HEK293 клеток. Содержание EAAT3 белка на клеточной мембране значительно снижено при трансфекции (N251S)-PIP5K2A или котрансфекции PIP5K2A и (N251S)-PIP5K2A.

7. KCNE субъединицы являются регуляторами KCNQ4 калиевых каналов в отношении кинетики, ионной селективности, содержания белка и амплитуды тока в Xenopus laevis ооцитной экспрессирующей системе. Наибольшие эффекты на потенциальную зависимость KCNQ4 оказывают KCNE3 и KCNE4 субъединицы. В то время как KCNE1, KCNE2 и особенно KCNE4 повышают калиевые KCNQ4 токи, KCNE3 существенно их снижают. Показана возможность KCNE5 субъединиц снижать относительную Rb+ проводимость KCNQ4 калиевых каналов. KCNE4 и KCNE5 субъединицы значительно снижают количество белка KCNQ4 на плазматической мембране и в общем клеточном лизате.

8. Уровень сывороточного нейростероида ДГЭАС у больных шизофренией коррелирует с тяжестью шизофренического процесса, что подтверждается результатами множественного сравнительного статистического метода Холма – Сидака. У пациентов с преобладанием негативной симптоматики отмечена статистически достоверная низкая концентрация ДГЭАС по отношению как к пациентам с преобладанием позитивной симптоматики, так и к здоровым лицам.

9. Выявлены половые особенности концентрации ДГЭАС. Мужчины обладают более высоким содержанием ДГЭАС по сравнению с женщинами как в группе контроля, так и в группе пациентов. Концентрация ДГЭАС у мужчин больных шизофренией достоверно низкая по сравнению с тем же показателем у здоровых мужчин. Уровень гормона у пациенток с диагнозом шизофрения низкий по отношению к женщинам из контрольной группы.

10. Длительность заболевания коррелирует со снижением концентрации ДГЭАС в сыворотке пациентов. У мужчин больных шизофренией существенное уменьшение сывороточного ДГЭАС по сравнению со здоровыми донорами обнаружено при продолжительности заболевания более одного года. В группе женщин больных шизофренией статистическое уменьшение сывороточного ДГЭАС выявлено в группе пациенток с продолжительностью заболевания более 3 лет.

11. Фармакотерапия атипичным нейролептиком кветиапином повышает концентрацию ДГЭАС в сыворотке крови у больных резидуальной шизофренией до значений, нормальных для здоровых людей. На основе определения содержания концентрации ДГЭАС разработан способ прогнозирования эффективности фармакотерапии, при этом низкая концентрация нейростероида ДГЭАС до назначения нейролептика является прогностически неблагоприятным признаком отвечаемости на терапию.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Исследование метаболизма при шизофрении: различия в активности изоферментов лактатдегидрогеназы лейкоцитов, ассоциированные с полом / Жанков А. И., Теровский С. С., Кусков М. В., Логвинович Г. В., Самусев В. А., Федоренко О. Ю., Семке А. В., Семке В. Я., Жанкова В. И. // Бюллетень экспериментальной биологии и медицины. – 2001. – № 1 (Прил.1) – С. 88–90.

2. Leucocyte glycolysis in schizophrenic patients / Kuskov M., Zhankov A., Terovsky S., Fedorenko O. // The World Journal of Biological Psychiatry (World Federation of Societies of Biological Psychiatry). – 7-th World Congress of Biological Psychiatry, 1–6 July, 2001, Berlin, Germany. – P. 285.

3. The serum and glucocorticoid inducible kinase SGK1 and Na+/H+ exchange regulating factor NHERF2 synergize to stimulate the renal outer medullary K+ channel ROMK1 / Yun C. C., Palmada M., Embark H. M., Fedorenko O., Feng Y., Henke G., Setiawan I., Boehmer C., Weinman E. J., Sandrasagra S., Korbmacher C., Cohen P., Pearce D., Lang F. // Journal of the American Society of Nephrology. – 2002. – V. 13. – N. 12. – P. 2823–2830.

4. Distribution and conforma-tional stability of lactate dehydrogenase isoenzymes in peripheral blood leucocytes of schizophrenic patients / Fedorenko O. Y., Zhankov A. I., Terovsky S. S., Kuskov M. V. // Schizophrenia research. An International Multidisciplinary Journal. – Abstracts of the XI-th Biennial Winter Workshop on Schizophrenia – Davos, Switzerland, February 24 – March 1, 2002 – P. 155–156.

5. Regulation of cytosoloc pH and lactic acid release in mesangial cells overexpressing GLUT1 / Lang K. S., Mueller M. M., Tanneur V., Wallisch S., Fedorenko O., Palmada M., Lang F., Broer S., Heilig C. W., Schleicher E., Weigert C. // Kidney International. – 2003. – V. 64. – N. 4. – P. 1338–1347.

6. Апоптоз лейкоцитов и уровень дегидроэпиандростерона при шизофрении / Федоренко О. Ю., Семке А. В., Иванова С. А. // Патофизиология психических расстройств. – Томск: Изд. ГУ НИИ ПЗ ТНЦ СО РАМН, 2006. – С. 97–109.

7. Functional coassembly of KCNQ4 with KCNE-beta- subunits in Xenopus oocytes / Strutz-Seebohm N., Seebohm G., Fedorenko O., Baltaev R., Engel J., Knirsch M., Lang F. // Cell. Physiol. Biochem. – 2006. – V. 18. – N. 1–3. – P. 57–66.

8. Способ прогнозирования эффективности лечения резидуальной шизофрении атипичными нейролептиками / Иванова С. А., Семке А. В., Ракитина Н. М., Корнетова Е. Г., Федоренко О. Ю., Гуткевич Е. В. // Патент (РФ) № 2006108350/15, опубл. Бюл. № 27 от 27.09.2007.

9. Thyrotropin serum concentrations in healthy volunteers are associated with depression-related personality traits / Frey A., Lampert A., Dietz K., Striebich S., Locher C., Fedorenko O., Mhle R., Gallinat J., Lang F., Lang U. E. // Neuropsychobiology. – 2007. – V. – 56. – N. 2–3. – P. 123–126.

10. DHEA and cortisol in patients with residual schizophrenia / Ivanova S. A., Semke A. V., Fedorenko O. Yu., Loginov V. N., Kornetova E. G. // SANTIAGO, Chile: 2nd International Congress of Biological Psychiatry. – 2007. – P. 287.

11. Influence of atypical neuroleptic quetiapine on the serum dehydroepiandrosterone/cortizol ratio in schizophrenia / Fedorenko O. Y., Ivanova S. A., Loginov V. N., Semke A. V. // 20th ECNP Congress, Vienna, Austria, 13–17 October, 2007. – P. S433.

12. Schizophrenia-linked mutation in PIP5K2A fails to activate neuronal Mchannels in Xenopus oocytes / Fedorenko O., Strutz-Seebohm N., Henrion U., Ureche O., Seebohm G., Lang F. A., Lang U. E. // Psychopharmacology. – 2008. – V. 199. – N.1 – P. 47–54.

13. Нарушение функционирования мутантной, ассоциированной с шизофренией формы PIP5K2A киназы / Федоренко О. Ю., Ланг Ф., Иванова С. А., Семке В. Я. // Сибирский вестник психиатрии и наркологии. – 2008. – № 1. – С. 132–133.

14. Impared function of schizophrenia associated mutant PIP5K2A / Fedorenko O., Strutz-Seebohm N., Henrion U., Ureche O., Seebohm G., Lang U., Lang F. // Schizophrenia research. An International Multidisciplinary Journal.– Abstracts of the XIVth Biennial Winter Workshop on Schizophrenia and Bipolar Disorders – Montreux, Switzerland, 3–7 February, 2008 – P. 134–135.

15. Responses to antipsychotic treatment and DHEA levels in schizophrenic patients / Ivanova S. A., Fedorenko O. Yu., Semke A. V. // Schizophrenia research.

An International Multidisciplinary Journal. – Abstracts of the XIVth Biennial Winter Workshop on Schizophrenia and Bipolar Disorders – Montreux, Switzerland, 3–February, 2008 – N. 98. – P. 154.

16. Tardive dyskinesia and polymorphism of dopamine D3, serotonin 2A and 2C receptors in Russian psychiatric inpathients / Hadity A. F. Y. Al, Ivanova S. A., Pechlivanoglou P., Semke A., Fedorenko O., Kornetova E., Ryadovaya L., Brouwers J. R. B. J., Bruggerman R., Loonen A. J. M. // 21th ECNP Congress, Barcelona, Spain, 30 August – 3 September 2008. The Journal of the European College of Neuropsychopharmacology. – V. 18. – S. 4. – P. 429.

17. Влияние нативной PIP5K2A и мутантной, ассоциированной с шизофренией (N251S)-PIP5K2A на активность нейрональных EAAT3 глутаматных транспортёров / Федоренко О. Ю., Иванова С. А., Семке А. В. // Сибирский вестник психиатрии и наркологии. – 2009. – Т. 1. – № 52. – C. 14–16.

18. Влияние фосфатидилинозитол-4-фосфат-5-киназы (тип 2 альфа) на активность нейрональных KCNQ калиевых каналов в ооцитной экспрессирующей системе / Федоренко О. Ю., Иванова С. А., Семке В. Я. // Бюллетень СО РАМН.

– 2009. – Т. 2. – № 136. – С. 59–64.

19. Киназные сигнальные пути в действии психотропных препаратов при шизофрении / Федоренко О. Ю. // Сибирский вестник психиатрии и наркологии. – 2009. – Т. 4. – № 55. – С. 9–12.

20. Tardive dyskinesia and DRD3, HTR2A and HTR2C gene polymorphisms in Russian psychiatric inpatients from Siberia / Hadithy A. F. Y. Al, Ivanova S. A., Pechlivanoglou P., Semke A., Fedorenko O., Kornetova E., Ryadovaya L., Brouwers J. R. B. J., Wilffert B., Bruggeman R., Loonen A. J. M. // Progress in NeuroPsychopharmacology and Biological Psychiatry. – 2009. – N. 33. – P. 475–481.

21. PIP5K2A-dependent regulation of excitatory amino acid transporter EAAT3 / Fedorenko O., Tang C., Sopjani M., Fller M., Gehring E. - M., StrutzSeebohm N., Ureche O. N., Ivanova S., Semke A., Lang F., Seebohm G., Lang U. E.

// The 88th Annual Meeting of the European Physiological Societies, Giessen, Germany, March 22–25, 2009. – Acta Physiologica. – P. 303.

22. Полиморфизмы генов нейромедиаторного обмена у больных шизофренией с двигательными расстройствами / Иванова С. А., Федоренко О. Ю., Рядовая Л. А., Корнетова Е. Г., Рудиков Е. В., Семке А. В., Лунен А. // Сибирский вестник психиатрии и наркологии. – 2009. – Т. 5. – № 56. – С. 31–34.

23. PIP5K2A-dependent regulation of excitatory amino acid transporter EAAT3 / Fedorenko O., Tang C., Sopjani M., Fller M., Gehring E. - M., StrutzSeebohm N., Ureche O. N., Ivanova S., Semke A., Lang F., Seebohm G., Lang U. E.

// Psychopharmacology. – 2009. – V. 206 – N. 3. – P. 429–435.

24. Missense polymorphisms in three oxidative-stress enzymes (GSTP1, SOD2, and GPX1) and dyskinesias in Russian psychiatric inpatients from Siberia / Hadithy A. F. Y. Al, Ivanova S. A., Pechlivanoglou P., Semke A., Fedorenko O., Kornetova E., Ryadovaya L., Brouwers J. R. B. J., Loonen A. J. M. // Hum.

Psychopharmacol. Clin. Exp. – 2010. – V. 25. – N. 1. – P. 84–91.

СПИСОК УСЛОВНЫХ СОКРАЩЕНИЙ И ОБОЗНАЧЕНИЙ ДГЭА – дегидроэпиандростерон ДГЭАС – дегидроэпиандростерон сульфат ДНК – дезоксирибонуклеиновая кислота кРНК – комплементарная рибонуклеиновая кислота МКБ – международная классификация болезней О – общий белок ПМ – плазматическая мембрана ПЦР – полимеразная цепная реакция – англ. polymerase chain reaction РНК – рибонуклеиновая кислота AIMS – шкала патологических непроизвольных движений – англ. Abnormal Involuntary Movement Scale EAAT – транспортёр возбуждающей аминокислоты – англ. еxcitatory amino acid transporter (N251S)-PIP5K2A – мутантная форма (замена аспарагина на серин в 251 положении) фосфатидилинозитол-4-фосфат-5-киназы (тип 2 альфа) M-каналы – калиевые KCNQ (Kv7) каналы М-типа (угнетаются при стимулировании мускариновых ацетилхолиновых рецепторов) NEB – новые английские биолаборатории – англ. New England BioLabs NMDA – N-метил-D-аспарагиновая кислота – англ. N-methyl-D-aspartic acid PANSS – шкала позитивных и негативных синдромов – англ. Positive and Negative Syndrome Scale PIP2 – фосфатидилинозитол-4,5-бифосфат – англ. phosphatidylinositol-4,5- bisphosphate PIP2-Grip – скавенджер фосфатидилинозитол-4,5-бифосфата – англ. scavenger (улавливатель) PIP5K2A – фосфатидилинозитол-4-фосфат-5-киназы (тип 2 альфа) – англ. phosphatidylinositol-4-phosphate-5-kinase (type 2 ) TEVC – двухэлектродная фиксация потенциала – англ. Two Electrode VoltageClamping wt-PIP5K2A – дикий тип фосфатидилинозитол-4-фосфат-5-киназы (тип 2альфа) – англ. wild type phosphatidylinositol-4-phosphate-5-kinase (type 2 ).







© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.