WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

 

На правах рукописи

Бургасова Ольга Александровна

Клинико-патогенетические аспекты поражений суставов возбудителями бактериальной природы, совершенствование лабораторной диагностики,

подходы к терапии

14.01.09 - инфекционные болезни

 

АВТОРЕФЕРАТ

Диссертации на соискание ученой степени

доктора медицинских наук

Москва 2011

Работа выполнена в Государственном  бюджетном учреждении высшего профессионального образования «Московский государственный медико-стоматологический университет» Министерства здравоохранения и социального развития Российской Федерации

Научные консультанты:

Академик РАМН,

доктор медицинских наук

профессор  Ющук Николай Дмитриевич

Заслуженный деятель науки РФ,

доктор медицинских наук

профессор  Ценева Галина Яковлевна

Официальные оппоненты:

Член-корр. РАМН,

доктор медицинских наук

профессор  Богомолов Борис Павлович

Доктор медицинских наук

профессор  Беляева Наталья Михайловна

Доктор медицинских наук

профессор Колобухина Людмила Васильевна

Ведущая организация:  ГБОУ ВПО « Первый Московский Государственный Медицинский Университет им. И.М.Сеченова» Минздравсоцразвития России

Защита состоится  «_____»____________20___г  в 12.00 часов на заседании диссертационного совета Д 208.131.01 в ФГБУ «НИИ вирусологии им. Д.И.Ивановского» Минздравсоцразвития России; по адресу 123098 г. Москва ул. Гамалеи д.16 

С диссертацией можно ознакомиться в библиотеке ФГБУ «НИИ вирусологии им.Д.И. Ивановского»  Минздравсоцразвития России

Автореферат разослан «_____»__________20____года.

Ученый секретарь диссертационного совета,

доктор медицинских наук  Бурцева Елена Ивановна

Общая характеристика работы

Актуальность проблемы

Многочисленными работами установлено, что при иерсиниозах  (иерсиниоз, псевдотуберкулез), урогенитальных  хламидиозах (УГХ) и Лайм-боррелиозе (ЛБ) в патологический процесс вовлекается ряд органов и систем, в том числе, суставы (Ющук Н.Д., 2003; Богомолов Б.П., 2000). Общим для этих инфекционных заболеваний является их повсеместное распространение, в том числе на территории Российской Федерации, и частое развитие поражений опорно-двигательного аппарата в виде артритов.

По данным Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека  псевдотуберкулезом в РФ за 2010 год заболели 2298 человек, иерсиниозом – 2572. При этом наиболее высокие показатели заболеваемости  иерсиниозами остаются в Сибирском регионе (24,5 %000), на Дальнем Востоке (8,32 %000) и Северо-Западном регионе (7,59 %000), включая С.-Петербург (Ценева Г.Я, 2011). Частота развития поражений суставов в различные периоды заболевания иерсиниозами варьирует. Так, в остром периоде частота  поражений суставов иерсиниозной этиологии составляет 14 – 97 % (Шурыгина И.А., 2003); при затяжном и хроническом течении заболеваний они встречаются реже - в 2,7 – 8 % случаев (Малов И.В., 1999); по данным отдельных авторов, суставы воявлекаются в патологический процесс в 5- 35 % (Taccetti G., 1994). При затяжном течении иерсиниозов артриты могут сочетаться с уретритом, конъюнктивитом, нодозной эритемой, реже миокардитом. Поражение опорно-двигательного аппарата при иерсиниозах зачастую носит длительный, стойкий характер и слабо поддается традиционной терапии (Шурыгина И.А.2003).

Известно, что  УГХ с декабря 1994 г. включен в группу инфекционных заболеваний, подлежащих обязательному статистическому учету, что подчеркивает медико-социальную значимость данной патологии. Однако  данные официальной статистики не отражают реальной частоты заболеваемости. Полагают, что в действительности истинная заболеваемость значительно превышает данные  статистики и имеет все признаки эпидемии. В мире ежегодно регистрируется около 100 млн. больных УГХ. По некоторым оценкам (Рищук С.В, Костючек Д.Ф., 2005) ежегодно в  Российской Федерации  УГХ заболевает от 1,5 до 2 млн. человек, при этом в большинстве случаев этиологический диагноз болезни не устанавливается. По данным «Эпинорт» за 2009 год, в Швеции показатель заболеваемости УГХ составил 406,2 %000. Хламидии являются этиологическими значимыми микроорганизмами целого ряда заболеваний, характеризующихся полиморфизмом клинических проявлений, в том числе C. trachomatis, обусловливает хламидийные реактивные артриты и выявляется у 75-95 % больных УГХ (Лобзин Ю.В., 2003).

Ареал распространения ЛБ достаточно широк. Известно, что в Российской Федерации в 2010 г. ЛБ заболели 7063 человека, при этом показатель заболеваемости составил 4,98 %000. Наиболее часто заболевание регистрируется в  Северо-Западном и Приволжском Федеральных округах, при этом показатель заболеваемости за 2010 год в отдельных областях составил 32,97 %000. По г. Санкт-Петербургу и Ленинградской области показатель заболеваемости в этот период сохранялся достаточно высоким и составил 8,82 %000 для взрослого населения. Поражение опорно-двигательного аппарата у больных развивается как при остром, так и при хроническом течении заболевания. В остром периоде ЛБ симптомы поражения опорно-двигательного аппарата (ОДА) встречаются у 2-8 % больных, тогда как в случаях развития хронического ЛБ частота суставного синдрома достигает 15-20 % (Лобзин Ю.В., 2007). При длительном течении ЛБ патологические изменения в суставах приводят к изменению связочного аппарата, развитию сгибательных контрактур и нередко инвалидизации больного. Следует отметить, что частота поражения ОДА зависит от территории, где распространен ЛБ. Так, в эндемичных районах США около 40% всех больных ЛБ имеют артрит, как основное клиническое проявление болезни.

Инфекции, обусловленные указанными возбудителями, характеризуются широким спектром клинических проявлений болезни (от стертого течения до ярко выраженных клинических форм инфекции с развитием осложнений). Перечисленные возбудители являются грамотрицательными бактериями. Особенностью их паразитирования является способность проникать и длительно сохраняться в клетках или фагоцитах хозяина. Внутриклеточное расположение бактерий защищает их от различных факторов, включая антитела и антибиотики, а также затрудняет их обнаружение в ходе лабораторного исследования, равно как и лечение вызываемой ими патологии. Кроме того, росту рецидивирующих и хронических форм вызываемых ими заболеваний способствует, в первую очередь, неунифицированный подход к диагностике, и поздние сроки обследования и лечения больных (Ценева Г.Я., 2006).  В этой связи, разработка дифференциально-диагностических критериев поражений суставов при этих широко распространенных инфекционных заболеваниях, равно как  и алгоритма обследования больных с использованием современных методов и средств, имеет важное социально-экономическое значение и может способствовать  улучшению диагностики в практическом здравоохранении.

Известно, что важное значение в развитии клинических  проявлений болезни, тяжести течения заболевания и осложнений имеют факторы патогенности возбудителя. Наиболее активно эти вопросы изучаются в отношении Y. pseudotuberculosis (E.Carniel et al., 1996; Чеснокова М.А., Климов В.Т., 2006; Кокорина Г.И., 2011). Однако связь конкретных генетических структур Y. pseudotuberculosis и других видов бактерий  поражением опорно-двигательного аппарата исследовано фрагментарно. Недостаточно изучены патогенетические механизмы формирования поражений суставов при данных заболеваниях.

Оценке роли цитокинов в развитии иммунного ответа при бактериальных инфекциях посвящено множество работ отечественных и зарубежных исследователей (Авдеев М.Г., 2003; Glickstein L., 2001). С целью определения критериев прогнозирования течения болезни важно учитывать некоторые показатели цитокинового звена иммунитета у больных псевдотуберкулезом, УГХ и ЛБ с поражениями суставов.

На данном этапе изучения иерсиниозов, УГХ и ЛБ нельзя признать эффективными существующие схемы лечения. Многие из них нуждаются в коррекции, так как они используются без учета особенностей взаимодействия возбудителя с клетками и тканями макроорганизма. В последние годы ведется поиск новых средств и методов терапии. Применение антибиотиков длительными курсами нередко обуславливает нежелательные побочные эффекты: развитие дисбактериозов, снижение устойчивости организма к инфекции, что в свою очередь усугубляет течение болезни и способствует персистенции возбудителя в организме больного. В этой связи важным направлением исследований является коррекция тактики лечения, в том числе установлению возможности включения в схемы иммунопрепаратов.

Таким образом, для решения вышеперечисленных задач требуется комплексный подход, разработка которого имеет важное теоретическое и прикладное значение для различных областей медицины, в том числе инфектологии, микробиологии, терапии, иммунологии, ревматологии, эпидемиологии.

Цель исследования

Установить клинико-патогенетические особенности поражений суставов при псевдотуберкулезе, урогенитальном хламидиозе и Лайм-боррелиозе, обосновать дифференцированный подход к обследованию и лечению больных.

Задачи исследования

1) Установить клинические особенности  поражений суставов  при псевдотуберкулезе, урогенитальном хламидиозе и Лайм-боррелиозе, обосновать дифференцированный подход  к обследованию 

2) Выявить  влияние биологических свойств Y. pseudotuberculosis на течение  псевдотуберкулезной инфекции с поражениями суставов на основе изучения генотипической характеристики  штаммов иерсиний, выделенных от больных.

3) Оценить эффективность современных методов этиологической диагностики и разработать алгоритм обследования  больных псевдотуберкулезом,  урогенитальным хламидиозом и Лайм-боррелиозом с поражениями суставов.

4) Определить значение иммунных нарушений в патогенезе поражений суставов при псевдотуберкулезе, урогенитальном хламидиозе и Лайм-боррелиозе на основе изучения цитокинового звена иммунного ответа.

5) Оценить эффективность влияния препарата «Бестим» на течение экспериментальной псевдотуберкулезной инфекции и возможность его применения у больных псевдотуберкулезной инфекции.

Научная новизна работы

1. Впервые на основе большого клинического материала с применением комплекса методов (микробиологических, молекулярно-генетических, иммунологических) определены механизмы поражения суставов некоторыми возбудителями бактериальной природы.

2. На основании сравнительного изучения клинических особенностей поражений суставов установлены различия и определены дифференциально-диагностические критерии поражений суставов в зависимости от вида возбудителя и его биологических (генетических) факторов.

3.. Впервые дана комплексная оценка эффективности современных методов диагностики, включая молекулярно-генетические, у больных с поражениями суставов бактериальной природы и предложена новая тактика обследования больных псевдотуберкулезом, урогенитальным и Лайм-боррелиозом с поражениями суставов.

4. Установлен характер иммунных нарушений у больных псевдотуберкулезом, урогенитальным хламидиозом и Лайм-боррелиозом с поражениями суставов на основе комплексного изучения цитокинового звена иммунитета, имеющий значение в прогнозе заболевания.

5. Выдвинуты и аргументированы подходы к терапии псевдотуберкулеза на примере экспериментальной  псевдотуберкулезной инфекции, дана оценка эффективности препарата «Бестим» и возможности его применения у больных псевдотуберкулезной инфекцией.

6. Предложенный алгоритм обследования больных псевдотуберкулезом, урогенитальным хламидиозом и Лайм-боррелиозом с поражениями суставов включает современные диагностические методы и дает возможность установить этиологию этих поражений на ранних сроках заболевания и назначить этиотропную терапию. 

7. Впервые дана оценка эффективности применения препарата «Бестим» в комплексной терапии экспериментальной псевдотуберкулезной инфекции и продемонстрирована возможность его применения у больных в клинике.

Практическая значимость.

  1. На основании сравнительного изучения клинических проявлений разработаны клинико-диагностические критерии поражений суставов у больных псевдотуберкулезом, урогенитальном хламидиозом и Лайм-боррелиозом.
  2. Разработан алгоритм обследования больных псевдотуберкулезом,  урогенитальным хламидиозом и Лайм-боррелиозом с поражениями суставов с применением современных методов диагностики (ПЦР и ИФА, иммунный блоттинг).
  3. Предложено генетипическое исследование изолированных культур от больных с поражениями  суставов, необходимое для прогнозирования течения болезни.
  4. Предложена усовершенствованная тактика этиопатогенетического лечения с включением в комплексную терапию больных псевдотуберкулезом препарата «Бестим» с целью профилактики развития осложнений в виде реактивных артритов. Полученные положительные результаты применения препарата у экспериментальных животных открывают перспективу использования препаратов данного типа у больных для лечения других бактериальных инфекций с поражениями суставов.

Положения, выносимые на защиту

  1. Предложенная тактика клинико-лабораторного обследования больных псевдотуберкулезом, урогенитальным хламидиозом и Лайм-боррелиозом с поражениями суставов, и разработанные дифференциально-диагностические критерии позволяют повысить эффективность этиологической диагностики артритов при инфекционных заболеваниях.
  2. Изучение влияния биологических свойств Y. pseudotuberculosis как одного из наиболее распространенных возбудителей, вызывающих поражения суставов, свидетельствует о существенной роли микроорганизмов в патогенезе этих поражений и открывает перспективы исследования факторов патогенности других бактерий, вызывающих артриты.
  3. Установленные клинико-диагностические критерии поражений суставов, обусловленные различными возбудителями, являются важным методологическим приемом при дифференциальной диагностике артритов.
  4. Выявленный характер изменений некоторых показателей цитокинового звена иммунитета свидетельствует о персистенции возбудителя, активности инфекционного процесса и обуславливает необходимость совершенствования терапии.

Внедрение результатов работы в клиническую практику и учебный процесс

Полученные результаты диссертационной работы и новые данные об иммуннопатогенезе, тактике диагностики поражений суставов бактериальной природы используются в учебно-педагогическом процессе на кафедре инфекционных болезней и эпидемиологии МГМСУ, кафедре инфекционных болезней ВМА им. С.М. Кирова, на лабораторных базах клинических больниц им. С.П. Боткина г. Москвы и г. Санкт-Петербурга, инфекционном центре ФГУ (442 Окружной военный госпиталь Лен. ВО) МО РФ, ФГУП «Гос. НИИ ОЧБ» ФМБА России С.-Петербурга, детского консультативно-диагностического центра  ФГУ «Национальный медико-хирургический центр им. Н.И. Пирогова МЗ РФ».

Тактика обследования больных псевдотуберкулезом, ХУГХ и ЛБ используется в научно-практических лабораториях: лаборатории бактериальных инфекций и лаборатории иммунологии НИИ эпидемиологии и микробиологии имени Пастера, г. Санкт-Петербург, бактериологическом отделении КДЛ ГКБ им. С.П. Боткина г. Москвы, клинической инфекционной больницы г.  Красноярска.

Полученные аналитические данные применяются при составлении лекционного материала для слушателей факультета постдипломного образования МГМСУ, слушателей факультета повышения квалификации врачей-бактериологов ГОУ ДПО СПб МАПО, слушателей цикла усовершенствования врачей на кафедре социальной педиатрии ФГУ «Национальный медико-хирургический центр им. Н.И. Пирогова МЗ РФ. Методические рекомендации «Псевдотуберкулез и иерсиниоз (эпидемиология, клиника, диагностика, терапия)» (СПб, 2005), «Иксодовые клещевые боррелиозы (этиология, эпидемиология, клиника, диагностика, лечение и профилактика)» (Москва, 2007),  Санитарно-эпидемиологические правила СП 3.1.7.2615-10 «Профилактика иерсиниозов» (Москва, 2010), Методическое пособие для врачей «Бестим» в клинической практике» (СПб, 2010), утвержденные на федеральном уровне, предназначены для практических врачей различных специальностей и научных работников, занимающихся проблемами иерсиниозов;), методы диагностики иерсиниозов, опубликованные в монографии «Иерсиниозы» (СПб, 2006), применяются в работе врачей практического здравоохранения.

Материалы диссертации представлены в «Руководстве по клинической лабораторной диагностике» (Раздел: Иерсиниозы) М. 2011.

Апробация работы

Материалы и основные положения работы апробированы на заседании кафедры  инфекционных болезней и эпидемиологии ГБУ ВПО «МГМСУ Минздравсоцразвития России» 25 ноября 2011 года; протокол апробации N 113; на заседаниях секции «Инфекционные болезни» Московского городского научного общества терапевтов (сентябрь 2007 г.), на заседании отделения Всероссийского научно-практического общества эпидемиологов, микробиологов и паразитологов им.  И.И. Мечникова в Санкт-Петербурге (11 апреля 2006 года), представлены в виде лекционного материала для врачей практического здравоохранения на кафедре инфекционных болезней ФПДО МГМСУ г. Москвы, в районной поликлинике г. Москвы С.-Западного АО, на цикле усовершенствования врачей на кафедре социальной педиатрии ФГУ «Национальный медико-хирургический центр им. Н.И. Пирогова МЗ РФ»; на конференциях: Российской научно-практической конференции, посвященной 110-летию кафедры инфекционных болезней ВМА им. С.М. Кирова (22-24 марта 2006 г.), II Всероссийской научно-практической конференции с международным участием в г. Санкт-Петербург (12-13 октября 2006 г.), Российской научно-практической конференции «Инфекционные болезни: современные проблемы диагностики и лечения» (3-4 декабря 2008), на I Всероссийском Конгрессе по инфекционным болезням (30 марта-1 апреля 2009 г.), на IV международной конференции «Идеи Пастера в борьбе с инфекциями» посвященной 85-летию СПб НИИЭМ им. Пастера и 120-летию Парижского института Пастера (г. Санкт-Петрбург, 2008 г.), на конференции «Идеи Пастера в борьбе с инфекциями» (г. Санкт-Петребург, 2007 г.), на II Ежегодном Всероссийском Конгрессе по инфекционным болезням (Москва, 29-31 марта 2010 г.), на VII Российском съезде инфекционистов «Новые технологии в диагностике и лечении инфекционных болезней» (Нижний Новгород, 25-27 октября 2006 г.), на научно-практической конференции «Современные аспекты эпидемиологического надзора и профилактики особо опасных и природно-очаговых болезней», посвященной 75-летнему юбилею ФГУЗ «Иркутский научно-исследовательский противочумный институт Сибири и Дальнего Востока» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (Иркутск, 22-24 сентября 2009 г.), на международной конференции «Развитие научных исследований и надзор за инфекционными заболеваниями», Санкт-Петербург (18-20 мая 2010г), на III Ежегодном Всероссийском Конгрессе по инфекционным болезням (28-30 марта 2011г.), на III всероссийской научно-практической конференции  с международным участием «Инфекции, обусловленные иерсиниями» (12-14 октября 2011 г., г. Санкт-Петербург).

По материалам диссертационной работы опубликовано 47 работ, из них: 1 монография, 4 работы в зарубежной печати, 17 работ в центральной печати (рекомендуемые ВАК издания), 4 учебно-методических издания.

Личное участие  автора в полученных результатах.

Основные результаты исследования получены  лично автором. Собраны, изучены и проанализированы данные по первичной медицинской документации, литературные данные.  Проведены клинические обследования и обследования в катамнезе пациентов  псевдотуберкулезом, урогенитальным хламидиозом и Лайм-боррелиозом, в том числе с  поражениями суставов на базах больницы им. С.П.Боткина г. Москвы и Санкт-Петербурга, выездных обследованиях на вспышках в Новом-Уренгое, ревматологических клиниках,  инфекционном отделении Суворовского госпиталя г. Санкт-Петербурга.

Комплексные лабораторные, экспериментальные и молекулярно-генетические  исследования выполнены в лаборатории бактериальных инфекций НИИЭМ им. Пастера под руководством д.м.н., профессора Г. Я. Ценевой (г. Санкт-Петербург). Составлены программы статистической обработки данных для их интерпретация, результаты исследований опубликованы и доложены на конференциях различного уровня, разработаны практические рекомендации. Материалы диссертационной работы внедрены в практику и входят в состав лекционных материалов для слушателей факультета повышения квалификации МГМСУ, ВМА им. Кирова  г. Санкт-Петербург.

Структура и объем диссертации

Диссертация изложена на 276 страницах  печатного текста и состоит из 2 разделов (введения, обзора литературы, материалов и методов  исследования, 5 глав собственных исследований), обсуждения результатов исследования, выводов, практических рекомендаций. Иллюстративный материал включает в себя 34 таблицы, 13 рисунков. Список литературы состоит из 360 наименований, в том числе, 143 отечественных и 217 иностранных источников.

Содержание работы

Материалы и методы исследования

Работа  выполнена на кафедре инфекционных болезней и эпидемиологии  ГБУ ВПО «Московский государственный медико-стоматологический университет» Минздравсоцразвития и в лаборатории бактериальных инфекций ФБУН Санкт-Петербургский НИИ эпидемиологии и микробиологии им. Пастера. Больные обследовались на базе ГУЗ ИКБ N 2 г. Москвы, больницы им. С.П. Боткина г. Москвы, ГИБ N 30 г. Санкт-Петербурга, 442 ОВКГ ЛенВО МО РФ г. Санкт-Петербурга. Отдельные фрагменты работы выполнены совместно с сотрудниками ФКУЗ НИПЧИ Сибири и Дальнего Востока Роспотребнадзора г. Иркутска,  института Пастера г. Парижа, ФГУП «ГосНИИ ОЧБ» ФМБА России г. Санкт-Петербурга, иммунологической лаборатории  НИЦ ВМА им. С.М. Кирова г. Санкт-Петербурга, бактериологической лаборатории  ГУЗ ГКБ им. С.П. Боткина г. Москвы, лаборатории молекулярной диагностики «Хеликс», г. Санкт-Петербурга.

Приношу глубокую благодарность  заслуженному деятелю науки РФ, президенту МГМСУ, заведующему кафедрой инфекционных болезней и эпидемиологии, академику РАМН, профессору Ющуку Николаю Дмитриевичу и заслуженному деятелю науки РФ, профессору Ценевой Галине Яковлевне за большую научно-консультативную помощь, оказанную при проведении  исследовательской работы.

Проведено комплексное клинико-лабораторное обследование 562 больных с диагнозами: псевдотуберкулез, урогенитиальный хламидиоз и Лайм-боррелиоз, находившихся на  амбулаторном и стационарном лечении в клиниках Центрального, Северо-Западного и Сибирского округов РФ..

Всем больным  псевдотуберкулезом проведено клиническое обследование (данные физикального осмотра и оценка жалоб пациентов) с последующей формулировкой основных клинических синдромов, степени их выраженности и диагноза. Анализ клинической картины и распределение больных псевдотуберкулезом по группам проводили в соответствии с классификацией псевдотуберкулеза Ющука Н.Д., Г.Н. Кареткиной с соавт. (1988).

Всем пациентам изучаемых групп проводили стандартное клинические исследование периферической крови, клинический анализ мочи, а также биохимическое исследование крови с целью дифференциальной диагностики определяли уровень мочевой кислоты, ревматоидный фактор, при необходимости – другие показатели.

1. Под нашим наблюдением находились больные с острым течением псевдотуберкулеза из трех вспышек в Северо-Западном регионе, Сибири и на Дальнего Востока РФ: 1-я вспышка (75 человек), 2-я (82 человека), 3-я (110 человек) в период с 2005 по 2008 год. Диагноз подтвержден бактериологическим выделением культуры Y. pseudotuberculosis серотипа О:1 во всех группах наблюдения.  Одновременно  проведено генотипирование выделенных штаммов, определение факторов вируленности иерсиний, что позволило дифференцировать все вспышки. Отдельную группу составили больные псевдотуберкулезом с затяжным и хроническим течением: 46 больных с артритами,  диагноз которым был подтвержден комплексом клинико-лабораторных методов и выделением культуры Y. pseudotuberculosis серотипа О:1 в 100 %  случаев.

В ходе исследования были проанализированы 452 истории болезни пациентов с диагнозом псевдотуберкулез. Выделенные от больных штамма Y. pseudotuberculosis были подобранны в результате длительного 10-летнего наблюдения, получены и изучены 132 штамма.

Для этиологического подтверждения диагноза “псевдотуберкулез” применяли комплекс прямых и непрямых методов подтверждения диагноза. В качестве прямых методов использовали «золотой стандарт» – бактериологический метод исследования: выделение и идентификацию иерсиний проводили в соответствии с Методическими указаниями МУ 3.1.1.2438-09 «Эпидемиологический надзор и профилактика псевдотуберкулеза и кишечного иерсиниоза» (Москва, 2009), «Определителем бактерий Берджи» (1997), учебным пособием «Микробиология» под редакцией В.И. Покровского (1999). Антигены возбудителя выявляли методом иммуноферментного анализа (ИФА), выполнявшегося по общепринятой методике в соответствии с инструкцией по применению «Тест-система иммуноферментная для выявления антигенов Y. pseudotuberculosis I серовара» (производство НИИЭМ им. Пастера). Применяли молекулярно-генетический метод ПЦР, позволяющий выявить  факторы патогенности иерсиний. В ПЦР исследовали материал от больных (кал, моча, смывы из зева, синовиальная жидкость, синовиальная оболочка), а также изолированные культуры иерсиний. Для выделения ДНК из клинического материала применяли комплект реагентов «ДНК-сорб-В» производства ФГУН «ЦНИИЭ» Роспотребнадзора. Лизаты бактериальных клеток референс-штамммов Y. pseudotuberculosis IP 33156 и Y. enterocolitica IP 1105, полученных из Национального референс-центра по иерсиниям (институт Пастера, Париж), являлись положительными контрольными образцами. Для получения лизатов бактерии выращивали на агаре Хоттингера, готовили взвесь концентрацией 108 м.к./мл в стерильной дистиллированной воде, 100 мкл взвеси кипятили 5 мин, центрифугировали при 10 тыс. об/мин 1 мин, использовали надосадочную фракцию. Использовали праймеры к хромосомным и плазмидным генам, кодирующим факторы вирулентности иерсиний (пр-во ООО «Синтол», Москва) (таблица 1). Реакционную смесь для проведения ПЦР  готовили с использованием стандартных реагентов производства «Fermentas» согласно прилагаемой инструкции:  2,5 мкл 10х Таq буфера с (NH4)2SO4, 2 мМ/мкл MgCl2, 0,2 мМ/мкл каждого дНТФ, 0,4 мкМ/мкл прямого и обратного праймеров, 0,625 U Таq-ДНК-полимеразы, с добавлением 4 мкл исследуемого образца до конечного объема 25 мкл. ПЦР проводили в программируемом термостате ТП4-ПЦР-01-«Терцик» производства ЗАО «НПФ ДНК-Технология», используя программу: 1 цикл 95 оС – 2 мин; 30 циклов 94 оС – 45 сек, 55 оС  – 45 сек, 72 оС – 45 сек; 1 цикл 72 оС – 10 мин. Для учета результатов ПЦР проводили электрофорез в 1,5 % агарозном геле при постоянном напряжении 75 В в ТВЕ буфере (0,9 М Tris, 0,9 М борная кислота,  20 мМ EDTA·Na2) с окрашиванием этидий бромидом и последующим фотографированием в проходящем УФ-свете.

Таблица 1.

Праймеры, использованные в ПЦР

Ген

Локализация

Праймер

последовательность 5’-3’

  на плазмидах

yad A

pYV

Forward CTTCAGATACTGGTGTCGCTGT

Reverse ATGCCTGACTAGAGCGATATCC

mucAB

pVM82

Forward TTACTTCTTGCGGGTATCGG

Reverse TGTCGTTTATGGCAAAGGG

  на хромосоме

irp2

HPI

Forward AAGGATTCGCTGTTACCGGAC

Reverse TCGTCGGGCAGCGTTTCTTCT

pilPQ

YAPI

Forward TATGTTGCTGGAGGCTCAG

Reverse GCGAACTATCAGCTATACG

ypmA/C

Forward CACTTTTCTCTGGAGTAGCG

Reverse ACAGGACATTTCGTCA

В сыворотке крови больных псевдотуберкулезом различными методами в динамике исследования определяли специфические антитела к антигенам иерсиний.  Методом РА выявляли антитела к корпускулярным антигенам Y. pseudotuberculosis серотипов О:1 и О:3 и наиболее распространенным серотипам Y. enterocolitica (О:3; О:9; О:4; О:5,27). Каждая серия антигена была стандартизирована в соответствии с МУ 3.1.1.2438-09 (пр-во НИИИЭМ им. Пастера). Реакцию проводили методом равных объемов. Исследование сыворотки крови больных проводили также методом РНГА с использованием лиофилизированных эритроцитарных диагностикумов производства ФГУП «Санкт-Петербургский научно-исследовательский институт вакцин и сывороток и предприятие по производству бактерийных препаратов»: псевдотуберкулезного – для выявления антител к Y. pseudotuberculosis О:1 серотипа, кишечноиерсиниозного – для выявления антител к Y. enterocolitica серотипов О:3 и О:9.  Для постановки ИФА использовали тест-системы «Иерсиниоз-ИФА-IgA», «Иерсиниоз-ИФА-IgG», «Иерсиниоз-ИФА-IgM» (пр-во ООО «Омникс», Санкт-Петербург), предназначенные для выявления антител классов A, M и G к белкам наружной мембраны (Yop E, YopM, YopH, YopD) возбудителей кишечного иерсиниоза и псевдотуберкулеза. Постановку и учет реакций осуществляли в соответствии с инструкцией по применению. Контрольную группу составили 63 больных ОКИ, ЛБ, инфекционным мононуклеозом, ОРВИ, краснухой, ХВГС и здоровые доноры - 50 человек. Для диагностики затяжных и хронических форм псевдотуберкулеза использовали также метод иммунного блоттинга с применением тест-систем «Anti-Yersinia enterocolitica ELISA (IgA, IgG)» (EUROIMMUN AG) и «recomWell Yersinia IgA, IgM, IgG» (MIKROGEN) (Германия). У той же группы больных проводили исследование показателей сывороточных цитокинов: ИЛ-1, ИЛ-2, ИЛ-6, ИФН-. Для определения цитокинов использовали наборы реагентов «ProCon IL-1», «ProCon IL-2», «ProCon IL-6», «ProCon IFN-» (OOO “Протеиновый контур”, Россия).

Для оценки эффективности  лабораторных методов, применяемых в практическом здравоохранении для диагностики ИИ, было проведено ретроспективное аналитическое исследование 320 историй болезни пациентов с установленным диагнозом иерсиниоз и псевдотуберкулез, которые были госпитализированы в больницу им. С.П. Боткина г. Санкт-Петербурга и 2 ИКБ г. Москвы в 2006-2009 гг.

2. Под нашим наблюдением находились больные хронической урогенитальной  хламидийной инфекцией, проходившие амбулаторное обследование и лечение на базе больницы им. С.П. Боткина г. Москвы, окружного военного госпиталя N 442 г. Санкт-Петербурга. У 41 больного урогенитальным хламидиозом был диагностирован реактивный артрит.  В работе использовали Международную классификацию УГХ МКБ-10. Всем пациентам в динамике заболевания было проведено комплексное клинико-лабораторное обследование и исследование концентрации провоспалительного цитокина TNF-, трансформирующего фактора роста TGF-1, а также супрессирующего цитокина IL-10

Для этиологического подтверждения диагноза УГХ использовали комплекс лабораторных методов: культуральный, молекулярно-генетический и иммуноферментный. C. trachomatis выделяли на перевиваемой культуре клеток McCoy с последующей идентификацией методом прямой иммунофлюоресценции с моноклональными антителами к видоспецифическому белковому антигену (препарат «Хламоноскрин-2» производства «Ниармедик» НИИЭМ им. Н.Ф. Гамалеи, РАМН). Специфические иммуноглобулины классов A, M, G определяли методом ИФА с диагностическими наборами ЗАО «Вектор-Бест», Россия. ДНК возбудителя определяли в ПЦР в формате реального времени (PCR-RT), позволяющем совместить амплификацию с одновременной детекцией накопления ее продуктов флюоресцентно-меченными зондами. Использовали наборы реагентов для амплификации ДНК C. trachomatis «АмплиСенс Chlamydia trachomatis-FL»  производства «ИнтерЛабСервис».

3. Третью группу составили больные ЛБ с острым течением (168 человек), проходивших стационарное лечение в больнице им. С.П. Боткина, г. Санкт-Петербург в период с 2005 года по 2009 год. Для анализа все больные были разделены на 2 группы: 1-я группа – больные с эритемной формой ЛБ (101 чел.); 2-я – с безэритемной формой ЛБ (67 чел.). Больные с Лайм-артритами составили группу из 40 человек, 23 из них проходили стационарное лечение. В работе использована классификация Л.Б. Лобзина Ю.В и соавт. (1996 г).

Для этиологического подтверждения диагноза ЛБ всем больным проводили определение  IgM и IgG к боррелиям в ИФА. Использовали тест-системы «ЛБ-ИФА-IgМ» (ФСП 42-0530-5323-04) и «ЛБ-ИФА-IgG» (ФСП 42-05330-5322-04) производства ООО «Омникс», г. Санкт-Петербург. Также проводили выявление антител класса IgM и IgG к боррелиям методом иммунного блоттинга.  Специфические антитела классов IgM и IgG в иммунном блоттинге определяли с помощью тест-систем «ЛБ-иммуноблот-IgM» и «ЛБ-иммуноблот-IgG» (ООО «Омникс», г. Санкт-Петербург), с использованием в качестве антигенов  набор рекомбинантных белков боррелий: p35, p41i, OspC, DbpA, OspA, p66 и в модификации – p41i,VLSE, OspC, DbpA, OspA, p66.

При проведении ПЦР для выделения ДНК из клинического материала применяли комплект реагентов «ДНК-сорб-В» производства ФГУН «ЦНИИЭ» Роспотребнадзора и «Набор реагентов для амплификации фрагмента гена p66 боррелий различных геномовидов (Borrelia burgdorferi sensu stricto, Borrelia afzelii, Borrelia garinii)» (производства ООО «Омникс», г. Санкт-Петербург). Исследование проводили на базе лаборатории молекулярной диагностики «Хеликс», г. Санкт-Петербург.

Контрольной группой в исследованиях служили: здоровые лица: всего 155 человек; больные ОРВИ, ОКИ, гепатитами, инфекционным мононуклеозом, синовитами, артритами; всего – 93 человека.

4. Поведены экспериментальные исследования  биологического материала у 24 больных гонартрозами и коксартрозами, проходивших хирургическое лечение (эндопротезирование коленного и тазобедренных  суставов) в травматологическом отделении ГКБ № 59 г. Москвы; у больных этой группы интраоперационно одномоментно в качестве материала для исследования были  отобраны синовиальная жидкость, синовиальная  и хрящевая ткань. Исследование проводили методом PCR-RT с набором реагентов «АмплиСенс Chlamydia trachomatis-FL» (производство «ИнтерЛабСервис») и путем выделения бактерий на перевиваемой культуре клеток McCoy.

5. C целью подтверждения влияния плазмидного спектра возбудителя на клинические проявления и тяжесть течения псевдотуберкулеза проведено изучение количественных показателей патогенности одноплазмидных (47 МДа) и двухплазмидных (47:82 МДа) штаммов Y. pseudotuberculosis и их влияния на морфофункциональные проявления псевдотуберкулеза. Проведено два опыта заражения белых мышей одноплазмидным Y. pseudotuberculosis (pYV с м.м. 47 МДа) и двухплазмидным Y. pseudotuberculosis (pYV с м.м. 47 МДа и pVM с м.м. 82 МДа). Для определения вирулентности (ЛД50) каждым штаммом заражали по 5 животных на каждую дозу (109, 108, 107, 106 микробных клеток).

6. Моделировали генерализованный инфекционный процесс у 160 белых беспородных мышей массой 14-16 г. Две группы опытных и контрольных животных заражали интрагастрально вирулентным штаммом Y. pseudotuberculosis 1 серотипа № 560, выделенным от больного. Штамм обладал комплексом факторов вирулентности (плазмида вирулентности иерсиний pYV, суперантиген YPM, плазмида pVM 82 МД) и характеризовался высокой вирулентностью. Доза заражения составляла 108 м.к./мл. В опытной группе определяли протективное влияние препарата «Бестим» на течение псевдотуберкулезной инфекции. В настоящее время препарат выпускается Гос.НИИ ОЧБ ( г.Санкт-Петербург) и широко применяется в клинической практике.

7.  Исследование показателей цитокинов у экспериментальных животных методом твердофазного ИФА (Наборы FlowCytomix (“Bender MedSystems”) проводили в лаборатории НИИ особо чистых препаратов ФМБА России г. Санкт-Петербурга. Дизайн проведенных клинико-лабораторных исследований представлен на рисунке1.

Рис. 1. Дизайн проведенных  клинических и экспериментальных исследований.

Результаты исследований обработаны методами вариационной статистики и корреляционного анализа с использованием коммерческих пакетов стандартизированных программ Statistica for Windows 6.0. Частично статистическая обработка результатов осуществлялась с помощью программы «Micrisoft Exel» (версия 7.0 для Windows98). Cтатистическая обработка результатов клинического исследования была выполнена с использованием параметрических методов анализа: вычисление средних величин (), ошибки средней величины (m), среднего квадратичного отклонения (σ ).

Различия между выборками, распределенными по нормальному закону, оценивались по параметрическому критерию Стьюдента  (t):

  t =,                            

где -x1 и -x2 – средние значения переменных шкалы отношений или процента выборок, которые сравниваются; S1 и S2 – соответственно показатели отклонений единичных значений от соответствующих им средних величин (процентов).

Оценку достоверности средних значений производили с помощью критерия Стьюдента (t) и Фишера (F). Значения достоверности коэффициента определяли по таблице критических точек двустороннего 1-критерия Стьюдента (77). Статистическую значимость различий в сравнительных выборках оценивали при помощи уровня значимости р < 0,05.

Для иммунологических показателей ввиду неоднородности выборок, отсутствия нормального распределения признаков, а также небольшого объема выборок был использован непараметрический критерий Вилкоксона (Манна-Уитни).

Результаты исследования и их обсуждение.

Перед началом исследований была проведена аналитическая работа с литературой по выявлению наиболее распространенных артритогенных возбудителей. Установлено, что ведущее место в спектре возбудителей занимают бактерии, из них наиболее часто поражения суставов обусловлены возбудителями инфекционных заболеваний: иерсиниямии, хламидиями, боррелиями.

Наши наблюдения (микробиологический и клинический мониторинг за  иерсиниозами в течение 10 лет) показали, что существует молекулярно-генетическая неоднородность штаммов Y. pseudotuberculosis, вызывающих развитие различных клинических вариантов течения псевдотуберкулеза.

В рамках оценки влияния биологических свойств Y. pseudotuberculosis на течение псевдотуберкулезной инфекции была изучена генетическая характеристика 132 штаммов, выделенных от больных псевдотуберкулезом из Центрального, Северо-Западного регионов России, Сибири и Дальнего Востока. Все изолированные от больных штаммы Y. pseudotuberculosis были исследованы методом ПЦР и ДНК-гибридизации. Изученные штаммы Y. pseudotuberculosis  по наличию  факторов вирулентностии разделены на 2  группы.

Таблица 2.

Генетическая характеристика штаммов Y. pseudotuberculosis в зависимости от наличия в них детерминант вирулентности (факторов  патогенности).

Генетические группы  Y.pseudotu-berculosis

  Факторы патогенности Y. pseudotuberculosis

YPMs HPI YAPI pYV 47  pYV 82

MDa MDa

Геногруппа 1

n =  95

+

-

  + 

+

+

Геногруппа 2

  n = 37

+

  --

  -

  +

  +

ПРИМЕЧАНИЕ: «+» – присутствие генетической детерминанты, «-» – отсутствие.

Проведенный молекулярно-генетический анализ штаммов клинического происхождения показал, что существует неоднородность штаммов в зависимости от  наличия факторов патогенности. Характерным для исследованных групп штаммов, является наличие суперантигена, наличие HPI (острова высокой патогенности), а отличием – наличие или отсутствие YAPI (адгезивного острова патогенности). Все выделенные штаммы  содержали  плазмиды  47 и 82 MDa.

Одновременно были изучены и проанализированы истории болезни и проведен сравнительный анализ основных клинических симптомов и синдромов у больных псевдотуберкулезом, обусловленным различными штаммами Y. pseudotuberculosis, детерминированными  хромосомными и плазмидными генами. 

Проведенный сравнительный анализ клинических проявлений псевдотуберкулеза  в группах больных псевдотуберкулезом, обусловленным Y. pseudotuberculosis с различной  генетической характеристикой штаммов, показал, что во 2 группе (штаммы, вызвавшие  заболевания в этой группе, не содержали в геноме «остров высокой патогенности») достоверно чаще (р <0.005) наблюдали развитие симптомов поражения  верхних дыхательных путей в виде гиперемии и болей в горле.

Вместе с тем, некоторые различия регистрировались при сравнении инфекционно-аллергических проявлений. Так, конъюнктивит и склерит был отмечен только у больных 1 группы, при этом склерит отмечался у 2.86 % пациентов, в то время как конъюнктивит – в  4.76 % случаев. При сравнении других инфекционно аллергических проявлений в виде яркого и типичного симптома псевдотуберкулеза – высыпаний – достоверных различий получено не было, и частота высыпаний в обеих группах практически была одинакова  и составляла 77 %.

Достоверные различия наблюдали и при сравнении частоты поражений органов РЭС: обращало на себя внимание, что вовлечение в патологический процесс печени достоверно чаще (р< 0.001) отмечалось у пациентов 1, нежели 2 группы, составляя, при этом, 58,1%.

При анализе  частоты  развития  поражений опорно-двигательного аппарата  в виде артралгий и артритов у больных 1 и 2 группы, установлено, что поражения опорно-двигательного аппарата одинаково часто отмечались в обеих группах: достоверных различий получено не было.

Таким образом, проведенный анализ клинических симптомов у больных, инфицированных штаммами двух различных генетических групп (отличающихся  друг от друга наличием адгезивного острова патогенности YAPI ), но содержащих обе плазмиды вирулентности, показал, что существует взаимосвязь между присутствием факторов патогенности псевдотуберкулезного микроба и клиническими проявлениями заболевания. Было отмечено, что у пациентов, заболевание которых было обусловлено штаммами Y. pseudotuberculosis, cодержащими YPMs, YAPI и плазмиды 45 82 MDa, и у пациентов, заболевание которых было обусловлено штаммами Y. pseudotuberculosis, не cодержащими YPMs, YAPI и плазмиды 45 82 MDa, не отличались друг от друга по частоте развития  поражений опорно-двигательного аппарата.

Учитывая разнообразие генетических вариантов иерсиний и многообразие клинических проявлений инфекции, были проведены исследования, позволяющие объяснить возможную взаимосвязь поражений опорно-двигательного аппарата с  наличием у псевдотуберкулезного микроба факторов патогенности,  их определяющих.

С целью определения частоты встречаемости поражений суставов, определения клинических особенностей, а также оценки влияния биологических (генетических) свойств Y. pseudotuberculosis на развитие поражений суставов, был проведен клинико-лабораторный анализ 267 случаев заболевания острым псевдотуберкулезом,  наблюдаемых при трех вспышках псевдотуберкулеза, зарегистрированных в Северо-Западном, Сибирском регионе и на Дальнем Востоке в период с 2006 по 2008 г.(156 мужчин [58,43 %] и 111 женщин [41,57%] в возрасте от 16 до 36 лет без сопутствующих тяжелых соматических заболеваний). Все вспышки были расшифрованы по данным эпидемиологического анамнеза – фактором передачи послужили салат из моркови либо  капусты. Диагноз был подтвержден выделением штаммов Y. pseudotuberculosis 1 серотипа и их генотипированием. В результате  проведенного генотипирования все больные были разделены на две группы: в 1-ой группе псевдотуберкулез был обусловлен двухплазмидными штаммами  Y. pseudotuberculosis (pYV42-45 MDa, pVM 82 MDa), во 2-ой – одноплазмидными (pYV42-45 MDa). Все изолированные штаммы имели суперантиген, но не имели «острова высокой патогенности» и «адгезивного острова патогенности».

Показано, что в настоящее время на территории Российской Федерации, а именно – в регионах Сибири и Дальнего Востока, а также Северо-Западного региона преобладают штаммы, содержащие 2 плазмиды вирулентности с молекулярной массой 45-47 МДа и 82 МДа.

Сравнительный клинико-лабораторный анализ всех эпидемических случаев заболевания  острым псевдотуберкулезом  показал, что заболевание во всех случаях были типичными и характеризовались развитием полиморфной клинической картины с явлениями интоксикации, экзантемой, катарально-респираторными симптомами, артралгиями, артритами, поражениями органов  желудочно-кишечного тракта. Данные об основных клинических проявлениях у больных с острым течением псевдотуберкулеза  суммированы и представлены  в таблице 3.

Таблица 3.

Частота основных клинических симптомов у больных псевдотуберкулезом, обусловленным двухплазмидными и одноплазмидными штаммами  Y. pseudotuberculosis

Клинические

симптомы

1-я группа

больных

(двух- пазмидный штамм)

2-я группа больных

(одноплазмидный штамм)

Достовер-

ность

различий

(p)

Вспышка N 1

n=75

Вспышка N 2

n=82

Вспышка N 3

n=110

Абс.

M± m

Абс.

%

M± m

Абс.

%

M± m

Пол

жен

40 

53,3±5,8

39

47,5±5,8

32 

29,1±5,2

1-2 >0,05

1:3 <0,001

муж

35 

46,7±5,8

43

52,4±5,5

78 

70,9±4,3

1:2 > 0,05

1-3 <0,001

Повышение

температуры

68 

90,6±3,4

82

100,0±4,7

22 

20,0±3,8

1-2:>0,05

1-3 <0,001

Головная боль

62 

82,6±4,4

80

97,5±1,7

10 

9,1±2,7

1-2 <0,01

1-3 <0,001

Катаральные

явления

63 

84,0±4,2

21

25,6±4,8

67 

60,9±4,7

1-2 <0,001

1-3 <0,001

Боли в животе

41 

54,6±5,7

56

68,3±5,1

25 

22,7±4,0

1-2 >0,05

1-3 <0,001

Тошнота, рвота

27 

36,0±5,5

35

42,7±5,5

17 

15,5±3,4

1-2 >0,05

1-3 <0.01

Артриты

23 

30,7±5,3

1

1,2±1,2

0±3,5

1-2 <0,001

1-3 <0,001

Артралгии

47

62,6±6,3

11

13,4±3,8

10

9,1±2,7

1-2 <0,001

1-3 <0,001

Экзантемы

55 

73,3±5,1

2

3,6±2,1

58 

52,7±4,8

1-2 <0,001

1-3 <0,01

Симптом «перчаток» и/или «носков»

15 

20,0±4,6

5

6,1±1,1

1

0,9±0,9

1-2 <0,01

1-3 <0,001

Шелушение

7

9,3±3,4

1

1,2±1,2

0±3,6

1-2 <0,001

1-3 <0,001

Увеличение

печени

17 

22,6±4,8

2

2,4±1,7

11 

10,0±2,9

1-2 <0,001

1-3 <0,001

Лимфоадено-патия

19 

25,3±5,0

10

12,2±3,6

5

4,5±2,0

1-2 <0,05

1-3 <0,001

Нарушения стула (в т.ч. диарея)

17 

22,6±4,8

26

31,7±5,1

6

5,5±2,2

1-2 >0,05

1-3 <0,01

ПРИМЕЧАНИЕ: 1-2 – клинические группы сравнения (по 1 и 2 вспышкам);

  1-3 – группы сравнения (по 1 и 3 вспышкам).

Проведенные нами исследования показали, что частота развития поражений суставов  в  значительной степени зависит от биологических свойств Y. pseudotuberculosis  и наличия в его геноме генов факторов патогенности. По нашим данным, поражения cуставов в виде артралгий при псевдотуберкулезной инфекции, вызванной Y. pseudotuberculosis 1 серовара, содержащей плазмиды pYV 45-48 MDa и pVM 82 MDa, достоверно чаще (p<0,001) наблюдались в 1 группе пациентов, составляя 62,6%±6,3 обследованных, нежели во 2 группе (13,4%±3,8 и 9,1%±2,7), где заболевание было обусловлено одноплазмидным штаммом Y. pseudotuberculosis (pYV 45-48 MDa). Столь высокая частота развития артралгий у больных псевдотуберкулезом, обусловленным двухплазмидными штаммами (pYV 45-48 MDa, pVM 82 MDa), по-видимому, объясняется ранним вовлечением в патологический процесс суставов и прогрессированием поражений опорно-двигательного аппарата при затяжном или хроническим течении псевдотуберкулеза и развитием артритов в 30,7±5,3% случаев.

Таким образом, наличие у Y. pseudotuberculosis плазмиды pVM 82 MDa, а также суперантигена утяжеляет клинические проявления заболевания, способствуя развитию поражений опорно-двигательного аппарата в виде артралгий  и  реактивных артритов.

Генотипирование штаммов Y. pseudotuberculosis, выделенных от больных, представляется крайне важным  в связи  с широкой распространенностью и циркуляцией  различных  штаммов на территории РФ. Проведение микробиологического мониторинга с генотипированием штаммов позволяет прогнозировать течение псевдотуберкулезной инфекции, определять частоту развития артритов, вырабатывать правильную лечебную тактику с применением этиотропной терапии.

Отдельную группу составили больные псевдотуберкулезом с затяжным и хроническим течением (46 больных с артритами); критериями включения в исследование  являлось: этиологически установленный диагноз, подтвержденный комплексом  лабораторных методов исследования; возраст пациентов от 16 до 48 лет; отсутствие тяжелых сопутствующих, а также аллергических и аутоиммунных заболеваний, артритов другой этиологии. Комплекс клинико-лабораторных методов, подтверждающих диагноз, складывался из выделения культуры Y. pseudotuberculosis 1 серотипа (100%  случаев), выявления  детерминант вирулентности Y. pseudotuberculosis методом ПЦР; обнаружение антител к иерсиниям методом ИФА и иммунного блоттинга.

В большинстве случаев (84.8%) артриты сопровождались гиперемией области сустава, припухлостью и болезненностью в области сустава, ограничением движения. Дополнительно степень активности воспалительного процесса в суставах условно оценивали по клиническим и лабораторным критериям (повышение СОЭ, СРБ). Активность воспалительных изменений в суставе у 84,5% больных была оценена как умеренная и выраженная, и лишь у 15.3% больных – как минимальная.

Проведенный анализ частоты поражения суставов у пациентов этой группы показал, что наиболее часто поражались суставы нижних конечностей и, в первую очередь, коленные (в 43,5±7,3 % случаев) и голеностопные (в 28,3±6,6 %); мелкие суставы кисти и лучезапястные суставы поражались с одинаковой частотой (26,1±6,5%); значительно реже поражались суставы стопы, у ряда больных в патологический процесс вовлекался пояснично-крестцовый отдел позвоночника. Установлено, что у пациентов с затяжным и хроническим течением псевдотуберкулеза поражение опорно-двигательного аппарата в 56,3 % случаев проявлялось по типу ассиметричного полиартрита. У 39,1 % пациентов с реактивными артритами заболевание протекало в виде олигоартритов. Полученные данные являются важными для дифференциальной диагностики, так как  показывают, что при псевдотуберкулезе артриты в большинстве случаев носят характер полиартрита, тогда как типичным для реактивного артрита является развитие олигоартрита.

Установлено, что у подавляющего большинства больных (89,1±4,6% случаев) развитие реактивных артритов сопровождалось повышением температуры до 38,0-39,0С.  У половины больных реактивными артритами заболевание протекало с наличием типичных симптомов псевдотуберкулеза: в частности, с экзантемой (56,5±7,3 % случаев) и симптомами поражения желудочно-кишечного тракта (52,2±7,4%), проявляющимися в виде тошноты и рвоты, болей в животе различной локализации; при этом симптомы энтерита проявлялись слабо. У этой категории больных в патологический процесс  достоверно чаще вовлекалась печень – гепатомегалия была отмечена в 78,3±6,13%  случаев.

Всем больным проводилась комплексная терапия: ограничение физической нагрузки, антибактериальная терапия (цефалоспорины, фторхинолоны, тетрациклины, аминогликозиды), нестероидные противовоспалительные и десенсибилизирующие препараты, в ряде случаев – физиотерапевтическое лечение с ограничением двигательной активности.

С целью установления клинических особенностей поражений суставов при урогенитальном хламидиозе и Лайм-боррелиозе был проведен сравнительный анализ клинической картины  поражений суставов при этих нозологиях с артритами при псевдотуберкулезе.

Под нашим наблюдением находился 41 больной УГХ с поражениями суставов; средний возраст больных составил 31±1,3 лет. Анализ клинической картины и распределение больных по группам проводились в соответствии с Международной классификацией УГХ – МКБ-10.

При сравнении клинической картины артритов при псевдотуберкулезе и УГХ установлено, что наиболее часто артриты при УГХ носили ассиметричный характер и в 71% случаев протекали по типу олигоартрита. Преимущественно поражались суставы нижних конечностей, что характерно для реактивных артритов. Так, коленные суставы вовлекались в патологический процесс в 65,8±10,3% случаев, голеностопные – в 56,1±10,8%. В большинстве случаев артриты сопровождались гиперемией, припухлостью и болезненностью в области сустава, нередко с ограничением движения в них, гипертермией (таблица 3). Активность воспалительных изменений в суставе у 23 пациентов (56,2 % случаев) была оценена как умеренная и выраженная, у 18 больных (43,8%) – как минимальная.

Анализ внесуставных проявлений при хламидийном артрите показал, что наиболее часто в процесс вовлекались глаза и развивался конъюнктивит и/или увеит и иридоциклит, отмечались паховая лимфоаденопатия, уретрит, цервицит.

Больные с ЛБ составили группу из 40 пациентов. В работе была использована классификация Лайм-боррелиоза Лобзина Ю.В. и др.(1996 г). Установлено, что при ЛБ у 43,5±7,3 % пациентов в патологический процесс вовлекались коленные суставы, реже – голеностопные (28,3±6,6 %). Достоверно чаще Лайм-артрит носил характер моноартрита, существенно реже протекал как олигоартрит с преимущественным поражением коленных и голеностопных суставов.

Таблица 4.

Частота поражения  суставов различной локализации при УГХ и псевдотуберкулезе

Локализация

поражений

(тип сустава)

Больные

Р

Достоверность различий

ХУГХ

n=41

псевдотуберкулез

n=46

N

M± m

N

M± m

  P (t)

Коленные

27

65,8±10,3

20

43,5±7,3

p>0,05 (t=1,83)

Голеностопный

23

56,1±10,8

13

28,3±6,6

P<0,05 (t=2,25)

Лучезапястный

6

14,6±7,6

12

26,1±6,5

p>0,05 (t=1,18)

Мелкие суставы кисти

12

12

26,1±6,5

p>0,05 (t=0,19)

Локтевой

8

19,5±8,6

6

13,0±5,0

p>0,05 (t=0,61)

Мелкие суставы стоп

14

34,1±10,3

4

8,7±4,2

P<0,05 (t=2,22)

Пояснично-крестцовый отдел

17

41,4±10,8

7

15,2±5,3

P<0,05 (t=2,29)

Ахилобурсит

16

39,0±10,6

-

Таблица 5.

Частота поражения  суставов различной локализации при ЛБ и псевдотуберкулезе

Локализация поражений

(тип сустава)

Больные

Р

Достоверность различий

ЛБ

n=40

псевдотуберкулез

n=46

N

M± m

N

M± m

  P (t)

Коленные

23

57,5+7,8

20

43,5±7,3

p >0,005

Голеностопный

17

42,5+7.8

13

28,3±6,6

P>0,005

Лучезапястный

1

2,5+2,4

12

26,1±6,5

P>0,005

Мелкие суставы кисти

5

12,5+5,2

12

26,1±6,5

P<0,001

Локтевой

2

5,0+3,4

6

13,0±5,0

P>0,005

Суставы стоп

-

-

4

8,7±4,2

P>0,005

Пояснично-крестцовый отдел

-

-

7

15,2±5,3

P<0,005

Ахилобурсит

  -

-

-

-

P<0,005

Плечевой

3

-

-

P>0, 005

Полученные сравнительные данные клинико-лабораторного обследования  больных псевдотуберкулезом, УГХ и ЛБ с поражениями суставов позволили нам выделить основные дифференциально-диагностические критерии артритов и использовать их  в алгоритме диагностики заболеваний с поражениями суставов.

Известно, что этиологическое подтверждение псевдотуберкулеза, урогенитального халмидиоза и Лайм-боррелиоза, протекающих с поражением суставов, не унифицировано, нередко эти заболевания не диагностируются, что приводит к несвоевременной этиотропной терапии и формированию затяжного и/или хронического течения заболеваний. С целью оценки эффективности современных методов этиологической диагностики и разработки эффективной тактики обследования этой категории больных было проведено клинико-лабораторное исследование больных псевдотуберкулезом с артритами с применением комплекса современных методов диагностики (рис. 3).

 

Рис. 3. Результаты лабораторного обследования больных псевдотуберкулезом с  поражениями суставов.

Рис. 3. Результаты  комплексного лабораторного обследования больных псевдотуберкулезом с РеА

Материалом для исследования  у больных псевдотуберкулезом служили: кровь, моча, кал, смывы из ротоглотки, синовиальная жидкость, полученные в динамике заболевания. Контрольную группу составили здоровые лица и больные ОРВИ, ЛБ, ОКИ, гепатитом, инфекционным мононуклеозом. Полученные результаты подтвердили высокую специфичность и чувствительность примененных тестов (рис. 4).

Рис. 4. Сравнение диагностической эффективности различных методов.

Y. pseudotuberculosis были выделены у 3 больных (6,5%) псевдотуберкулезом с  затяжным и хроническим  течением. С помощью ПЦР-диагностики этиология поражений суставов у больных псевдотуберкулезом была подтверждена в 39,1 % случаев. Эффективность диагностики существенно повышалась при исследовании синовиальной жидкости, реже синовиальной оболочки. Перспективным оказалось применение ИФА, обладающего высокой чувствительностью и специфичностью. Частота обнаружения антител класса IgG составила 73,9%, IgA – 10.9%. Исследование крови в динамике позволило проследить длительность обнаружения иммуноглобулинов различных  классов: так, у больных с РеА циркуляцию IgA регистрировали в сроки от 5 до 24 месяцев. Невысокий процент положительных находок IgA, по-видимому, обусловлен непродолжительной циркуляцией их в крови, обусловленной коротким периодом полураспада.

Материалом для исследования от больных УГХ с поражениями суставов служили кровь, соскобы из уретры, цервикального канала, синовиальная жидкость, синовиальная оболочка. Группу контроля составили здоровые лица, больные ревматоидным артритом, травматическим артритом, иерсиниозом. Полученные результаты комплексного исследования представлены на рисунках 5, 6. В большинстве случаев у больных реактивными артритами при УГХ IgA к C. trachomatis обнаруживались в титрах от 1: 16 до 1: 32, IgG, напротив, у 75,6 % пациентов обнаруживались в более высоких титрах – от 1:128 до 1:256. У 3 пациентов были выявлены антитела IgA (в титре 1:16) и IgG (в диагностическом титре 1:512) к С. pneumoniae. При исследовании соскобов уретры методом ПИФ частота положительных находок хламидий составила 9,8%. При исследовании этого же биологического субстрата культуральным методом получены положительные ответы в  29,3 % проб, а при исследовании соскоба цервикального канала – в 14,6%. При исследовании синовиальной жидкости и биоптатов синовиальной оболочки методом ПЦР хламидии были обнаружены у 24,4% больных реактивными артритами. Таким образом, максимальное число положительных результатов было получено при исследовании соскобов уретры.

Известно, что воспалительный процесс в суставе может привести к развитию  тяжелых поражений, в отдельных случаях приводящих к деструктивным изменениям – остеоартрозам, требующим эндопротезирования суставов. Нами впервые проведены исследования материала от 24 больных гонартрозами, проходивших хирургическое лечение (эндопротезирование суставов) в 8 травматологических отделении 59 ГКБ г. Москвы. У этой группы больных интраоперационно были взяты пробы материала для исследования: синовиальная жидкость, синовиальная оболочка и хрящевая ткань. Исследование проводили методом PCR-RT тест-системой «АмплиСенс Chlamydia trachomatis-FL» и культуральным – на перевиваемой линии клеток McCoy. В результате исследования биоптатов синовиальной оболочки  в 4 случаях  выявлены C. trachomatis. Эти данные  могут свидетельствовать о длительной персистенции хламидий в полости сустава и возможной их этиологической роли в формировании гонартрозов.  Полученные результаты открывают перспективу дальнейших исследований для совершенствования тактики терапии больных остеоартрозами с учетом результатов исследований на до- и послеоперационном этапе.

Этиология артритов у больных ЛБ в 85% случаев  была подтверждена обнаружением иммуноглобулинов классов IgM и IgG к боррелиям методом ИФА; в иммунном блоттинге положительные результаты получены в 94% случаев обнаружением иммуноглобулинов класса IgG. При этом, методом ПЦР этиология артритов была подтверждена лишь в единичных случаях. Полученные данные комплексного обследования больных псевдотуберкулезом, урогенитальным хламидиозом и Лайм-боррелиозом явились основой алгоритма обследования больных с поражениями суставов (рисунок 7).

Рис. 7. Алгоритм обследования больных с поражениями суставов

Для  характеристики иммунных нарушений в патогенезе поражений суставов при псевдотуберкулезе, УГХ и ЛБ было проведено изучение цитокинового звена иммунитета у больных артритами с затяжным и хроническим  течением. В сыворотке крови больных  псевдотуберкулезом с реактивными артритами исследовали уровень IL-1, IL-2, IL-6, IFN-; в сыворотке крови 21 больного УГХ с реактивным артритом – TGF-1, TNF- . IL-10;  у  23 больных Лайм-артритом исследовали IFN-, IL-1, IL-2, IL-4, IL-8 в динамике инфекционного процесса.. Контрольную группу составили 55 практически здоровых лиц в возрасте от 18 до 30 лет..

При анализе показателей цитокинов у больных псевдотуберкулезом получено статистически достоверное (p<0,001) повышение уровня провоспалительных цитокинов: IFN- (30,7±2,7 пкг/мл), IL-6 (75,3 ±7,1 пкг/мл) и сохранение их на высоком уровне у  больных с артритами, что подтверждает ведущую роль суперантигена иерсиний и плазмиды pVM 82 MDa в патогенезе артритов при псевдотуберкулезе (рис. 8). 

Рис. 8. Показатели сывороточных цитокинов у больных псевдотуберкулезом (пкг/мл).

В группе больных артритами хламидийной этиологии установлены нарушения соотношения супрессорных цитокинов (повышенные показатели TGF-1 (12201,8±555,6  пкг/мл), сочетающиеся с низким уровнем IL-10 (0,7±0,2 пкг/мл) при р < 0,001 (рис. 9). 

Для Лайм-артритов (рис. 10) характерно сохранение повышенных показателей IL-8 (29,17 ± 1,46 пкг/мл) на фоне достоверно высоких (р<0,05) уровней цитокинов, определяющих развитие гуморального ответа: IL-4 (143,61+5,36 пкг/мл) и IL-2 (164,43+4,85 пкг/мл).

C целью подтверждения влияния плазмидного спектра возбудителя на клинические проявления и тяжесть течения заболевания было проведены опыты на мышах с одноплазмидными (47 МДа) и двухплазмидными (47:82 МДа) штаммами Y. pseudotuberculosis. Проведено два опыта заражения белых мышей одноплазмидным Y. pseudotuberculosis  (pYV с мол. массой 47 МДа)  и  двухплазмидным Y. pseudotuberculosis

Рис. 9. Показатели сывороточных цитокинов у больных УГХ с артритами (пкг/мл).

Рис. 10. Показатели сывороточных цитокинов у больных Лайм-боррелиозом (пкг/мл).

(pYV с мол. массой 47 МДа и pVM с мол. массой 82 МДа). Показано, что инфекционный процесс, обусловленный двухплазмидным штаммом, по данным морфологических изменений протекал более тяжело и сопровождался генерализацией иерсиний в органы и ткани. Установлено, что наибольший показатель вирулентности, по LD50 равный 1,9х106 м.кл., определен у двухплазмидного варианта Y. рseudotuberculosis; при этом у 85,0±8,0% экспериментальных животных наблюдалась гибель в сроки от 5 до 15 суток от начала заражения. При заражении одноплазмидным штаммом Y. pseudotuberculosis гибель белых мышей наступала на 10-11 сутки; погибло 8 мышей (40,0±10,0%; t=3,12, р 0,05). От выживших животных на 21 сутки выделен возбудитель псевдотуберкулеза со средней степенью вирулентности, по LD50 равной 7,9106 м.кл. У животных, зараженных двухплазмидным штаммом, отмечались более выраженные морфологические изменения в органах: деструктивные изменения в кишечнике, большие размеры инфильтратов в печени, появление инфильтрации нейтрофилами в красной пульпе селезенки, отсутствие образования реактивных центров в белой пульпе селезенки. По-видимому, тяжелое течение экспериментальной псевдотуберкулезной инфекции влечет за собой развитие ряда осложнений, в том числе и поражений суставов.

До настоящего времени продолжается поиск эффективных средств и методов лечения больных псевдотуберкулезом. Надо полагать, что это связано как с недооценкой патогенеза болезни, представления о котором в настоящее время изменились, так и с широким выбором антибактериальных средств для лечения. В предварительно проведенной работе была оценена чувствительность к антибиотикам штаммов иерсиний (8 культур). Определение чувствительности микроорганизмов к антибиотикам проводили методом серийных разведений и дискодиффузионным методом согласно МУК 4.12.1890-04 (Москва, 2004).  Исследовали чувствительность к следующим антибиотикам: цефаклор, цефтазидим, левомицетин, гентамицин, ципрофлоксацин, цефуроксим, цефотаксим, амикацин, имипенем. Установлено, что 6 культур Y. enterocolitica чувствительны ко всем этим антибиотикам; 1 культура Y. pseudotuberculosis 1 серотипа – устойчива к гентамицину, амикацину, цефтазидиму; 1 культура Y. frederiksenii устойчива к цефтазидиму, левомицетину, ципрофлоксацину, цефуроксиму, цефотаксиму, амикацину. Приведенные собственные данные, а также данные литературы указывают на наличие лекарственной устойчивости у ряда штаммов Y. pseudotuberculosis,  вызывающих тяжелое течение псевдотуберкулеза с генерализацией инфекционного процесса, протекающего, как правило, на фоне сниженной резистентности организма. В этой связи, одной их актуальных задач исследования явился поиск наиболее эффективных подходов в лечебной тактике, в том числе с использованием препаратов, обладающих иммуностимулирующей биологической активностью.

Дана оценка эффективности применения препарата «Бестим» при экспериментальной псевдотуберкулезной инфекции с учетом сравнительной количественной  оценки диссеминации  Y.  pseudotuberculosis в органы и ткани животных. (Препарат «Бестим» разработан для патогенетической терапии хронических инфекционных заболеваний, сертифицирован, разрешен к применению, успешно применяется в лечении ряда инфекционных заболеваний).

В рамках модели генерализованного инфекционного процесса у 120 белых беспородных мышей массой 14-16 г опытная и контрольная группы животных заражались интрагастрально высоковирулентным штаммом Y. pseudotuberculosis 1 серотипа № 560, выделенным от больного псевдотуберкулёзом и обладавшим комплексом факторов патогенности (плазмидой вирулентности иерсиний pYV, суперантигеном YPM, плазмидой pVM 82 МД); доза заражения составляла 108 м.к./мл. Использование указанной дозы заражения обосновано на данных предварительных опытов моделирования псевдотуберкулезной инфекции, проводимого в рамках испытания других иммунобиологических препаратов, а также препарата «Бестим» при пробных экспериментах при введении Y. pseudotuberculosis в дозах 5107, 108, 109 м.к./мл. Животным опытной группы (50 мышей), начиная с 3-х суток от момента заражения, ежедневно вводили внутрибрюшинно препарат «Бестим» (1,0 мкг/кг) в течение пяти дней. У опытных и контрольных (70 мышей) животных в динамике инфекционного процесса на 3, 6, 9, 14, 21 сутки бактериологическим методом исследовали пробы печени, селезенки, мезентериальных лимфатических узлов, тонкого кишечника. По количеству выросших колоний (КОЕ), рассчитанных на грамм исследуемого органа мыши, оценивали накопление возбудителя в органах, длительность персистенции в них и, соответственно, протективный эффект «Бестима». Оценку действия препарата «Бестим» проводили в динамике инфекционного процесса с морфологической визуальной оценкой органов и тканей (увеличение органов, наличие некротических образований в печени и селезенке и увеличение лимфоидных образований в кишечнике), кроме того, протективный эффект препарата оценивали по количеству размножившихся бактерий на каждом сроке исследования, длительности выживания и частоте гибели опытных и контрольных животных.

Результаты эксперимента свидетельствуют, что у мышей контрольной группы на 3 сутки после заражения высоковирулентным штаммом развивался мезаденит с транслокацией возбудителя из кишечника в паренхиматозные органы, в которых происходило интенсивное размножение бактерий (таблица 8). На 3 сутки у экспериментальных животных отмечались выраженный энтероколит, абсцедирующий мезаденит, генерализация инфекции, милиарные очаги в печени и селезенке. Концентрация иерсиний в кишечнике составляла 3,2105 КОЕ/г, в паренхиматозных органах – 1,0103, 5,4103 КОЕ/г (в печени и селезенке соответственно), что достоверно (p<0.001) превышало КОЕ в опытной группе. Отмечена гибель единичных животных (8 мышей). К 6 суткам выраженность инфекционного процесса в этой группе животных существенно возросла. Микробиологически к этому сроку количество КОЕ иерсиний у животных увеличилось в лимфатических узлах в 31 раз, в печени – в 17 раз, в селезенке – в 33 раза. Морфологически отмечались: прогрессирующая генерализация инфекции, гнойный мезаденит, милиарные и сливные абсцессы – преимущественно, в печени. Гибель животных к этому сроку составляла 30%. К 9 суткам патологический процесс начинал постепенно ослабевать, в мезентериальных лимфоузлах концентрация иерсиний уменьшалась до 6,9104 КОЕ/г, однако, оставалась достоверно высокой (p< 0,0002); в других органах существенно не изменялась. В печени и селезенке отмечались единичные абсцессы. Гибель животных составила 20 %.

Таблица 8.

Множественность Y. pseudotuberculosis в органах мышей *

при интрагастральном заражении.

Исследуемый

орган

Сутки

от момента заражения

КОЕ/г органа

у животных

опытной группы

(Y. ps.+ Бестим)

Среднее значение в группе (КОЕ/г)

КОЕ/г органа

у животных контрольной группы

(Y. ps.)

Среднее значение в группе (КОЕ/г)

Коэффициент достоверности (р)

в группе

Печень

3

0

0

1000

83075

< 0,001

Селезенка

0

5400

Лимфоузел

0

5900

Кишечник

0

320000

Печень

6

1800

10200

17000

171750

0,003

Селезенка

13000

180000

Лимфоузел

0

180000

Кишечник

26000

310000

Печень

9

3500

4350

33000

155500

0,0002

Селезенка

10000

180000

Лимфоузел

2100

69000

Кишечник

1800

340000

Печень

14

0

0

53000

58250

< 0,001

Селезенка

0

180000

Лимфоузел

0

0

Кишечник

0

0

Печень

21

НО

НО

0

НО

НО

Селезенка

0

Лимфоузел

0

Кишечник

0

ПРИМЕЧАНИЕ: 1. *  – множественность возбудителя в органах по результатам

  количественного бактериологического исследования.

  2. НО – не определялось

В опытной группе животных, получавших препарат «Бестим» в течение 3 дней, наблюдался слабовыраженный инфекционный процесс. К шестым суткам выраженных изменений внутренних органов не обнаруживалось (отмечались небольшое увеличение лимфатических узлов и селезенки, единичные гранулемы в печени и селезенке), иерсинии высевались в достоверно (p<0,003) меньших концентрациях по сравнению с контрольными животными: в печени – до 1,8103 КОЕ/г, в кишечнике – 2,6104 КОЕ/г. Лимфатические узлы на этом сроке были свободны от иерсиний, гибели мышей не отмечалось.

К 9 суткам у опытных животных, получавших пятидневный курс «Бестима», выраженность инвазии и размножения иерсиний в органах была существенно слабее по сравнению с контрольной группой. Иерсинии высевались из паренхиматозных органов в концентрации 103 – 104 КОЕ/г, из кишечника – 1,8103 КОЕ/г, что с высокой степенью достоверности( p<0,0002) отличалось от контрольной группы.

На 14 сутки у опытных животных иерсинии не высевались, морфологических изменений во внутренних органах не обнаруживалось. Напротив, у животных контрольной группы инфекционный процесс продолжался и сопровождался обнаружением высоких концентраций иерсиний в печени и селезенке: на уровне 5,3104 и 1,8105 КОЕ/г соответственно. 

Таким образом, полученные результаты свидетельствуют о защитном влиянии препарата «Бестим» при экспериментальной псевдотуберкулезной инфекции, проявляющемся ограничением диссеминации Y. pseudotuberculosis в органы и ткани у 80-90% мышей, сокращением сроков развития (на 6 дней) патологического процесса, предотвращением гибели животных. Проведенный эксперимент продемонстрировал возможность применения препарата «Бестим» в клинической практике.

Выводы

1. При бактериальных инфекциях поражения суставов являются частой  патологией, обуславливая ряд особенностей клинического течения. При псевдотуберкулезе поражение суставов наблюдалось в 30,7±5,3 % случаев, при  ЛБ – в 12,5 %, при УГХ – в 11,04 %. Артриты  при псевдотуберкулезе отличает формирование ассиметричных полиартритов с преимущественным поражением коленных (43,5±7,3 %) и голеностопных (28,3±6,6 %) суставов, мелких суставов кисти и лучезапястных (по  26,1±6,5 %) суставов. При УГХ – ассиметричные олигоартриты отмечались у 71% больных с преимущественным поражением коленных, голеностопных суставов (65,8±10,3 % и 56,1±10,8 % случаев соответственно). Артриты при ЛБ проявлялись в виде ассиметричных  моно- или  олигоартритов с преимущественным поражением коленных и голеностопных суставов (57,5±7,8 % и 42,5±7,8 % случаев соответственно).

2.  Установлена зависимость частоты развития поражений суставов и тяжести течения болезни от биологических (генетических) свойств возбудителя. Развитие поражений суставов у больных достоверно (p<0,001) чаще (в 30,7 ±5.3 % случаев) возникает под влиянием псевдотуберкулезного микроба, содержащего две плазмиды – pYV и pVM 82 MDa – и суперантиген YPM. Моделирование псевдотуберкулезной экспериментальной инфекции подтверждает связь тяжелого течения патологического процесса и наличия у возбудителя плазмиды pVM 82 MDa и суперантигена YPM.

3. Определены различия в частоте  установления этиологии артритов различными методами. При псевдотуберкулезе подтверждение диагноза методом ИФА установлено обнаружением антител класса IgM в 28,3 % случаев, IgG – в 73,9 %,  IgА – в 10,9 % . Длительно сохраняющиеся диагностические уровни IgА и IgG с одновременным выявлением детерминант вирулентности свидетельствуют о персистенции возбудителя в организме. Использование ПЦР для диагностики псевдотуберкулезного артрита при исследовании синовиальной жидкости, синовиальной оболочки, копрофильтрата  эффективно в  39,1 % случаев. При УГХ наиболее информативным является ИФА для обнаружения IgА и IgG (26.8 % и 75.6 % случаев соответственно). С помощью культурального метода и ПЦР при исследовании синовиальной жидкости, синовиальной оболочки и соскобов уретры положительные результаты получены в 29 % и 32 %  случаев соответственно. Артриты  при ЛБ  подтверждаются обнаружением IgG (63 %) методами ИФА и иммунного блоттинга.

4. Выявлены иммунопатогенетические особенности течения артритов: длительно (до 2 лет)  сохраняющиеся титры IgG и IgA в крови больных с увеличением показателей в период обострения, обнаружение в эти сроки детерминант вирулентности в  биологических субстратах  свидетельствуют  о персистенции возбудителя и активности инфекционного процесса.

5. Установлены изменения в характере цитокинового ответа у больных  псевдотуберкулезом, УГХ и ЛБ с поражениями суставов. Изменения цитокинового статуса (повышенное содержание провоспалительных цитокинов IFN-, IL-6) подтверждает вывод о ведущей роли суперантигена и плазмиды pVM 82 MDa в патогенезе артритов при псевдотуберкулезе. Для артритов при УГХ установлены нарушения соотношения супрессорных цитокинов (повышенные показатели TGF-1, сочетающиеся с низким уровнем IL-10), для Лайм-артритов характерно сохранение повышенных показателей IL-8 на фоне повышенных уровней цитокинов, определяющих развитие гуморального ответа (IL-4 и IL-2).

6. Установлено, что штаммы Y. pseudotuberculosis, содержащие плазмиду вирулентности pVM 82 MDa, как правило (в 98 % случаев) вызывают генерализованную псевдотуберкулезную инфекцию у экспериментальных животных с тяжелыми морфологическими изменениями в органах и тканях; сроки гибели экспериментальных животных варьируют в зависимости от наличия плазмид рYV и pVM у инфицировавшего их штамма, наибольший показатель вирулентности и наибольший процент гибели животных определен у двухплазмидного варианта Y. pseudotuberculosis.

7. При моделировании псевдотуберкулезной инфекции на мышах показано протективное влияние препарата «Бестим», проявляющееся у 80-90 % животных ограничением диссеминации Y. pseudotuberculosis  в органы и ткани, сокращением сроков развития (на 6 дней) патологического процесса у опытных животных, предотвращением их гибели, что коррелирует с нормализацией показателей цитокинов у экспериментальных животных.

Практические рекомендации

Для повышения эффективности лабораторной диагностики, лечения и предупреждения формирования поражений опорно-двигательного аппарата псевдотуберкулезе, УГХ и ЛБ  целесообразно:

– внедрение современных методов диагностики: бактериологического с генотипированием выделенных штаммов,  молекулярно-генетического (ПЦР), серологического (ИФА и иммунный блоттинг);

– с учетом многообразия клинических форм псевдотуберкулеза, обусловленного разнообразием биологических свойств возбудителя, рекомендуется следующая тактика обследования больных псевдотуберкулезом с поражениями суставов:  в первые две недели от начала болезни – исследование кала, мочи, синовиальной жидкости  бактериологическим  методом, серологическое исследование сыворотки крови методом РНГА, РА; в течение всего периода болезни – исследование крови, синовиальной  жидкости методами ИФА и иммунного блоттинга на наличие IgG, IgA, других биологических субстратов (копрофильтрата, синовиальной жидкости, биоптатов синовиальной оболочки) – методом ПЦР на присутствие генов вирулентности иерсиний;

– для прогнозирования клинического течения псевдотуберкулеза важно проводить генотипирование штаммов, выделенных от больных в острый период заболевания;

– с целью совершенствования тактики обследования больных урогенитальным хламидиозом с поражениями суставов необходимо внедрить комплекс современных методов исследования различных биологических материалов: в течение всего периода болезни исследовать соскобы уретры, цервикального канала, синовиальной жидкости, биоптаты синовиальной оболочки культуральным методом с целью выделения C. trachomatis или C. pneumoniae; методом ПЦР в формате реального времени (PCR-RT) – для детерминант факторов патогенности; сыворотки крови, синовиальной жидкости – методом ИФА на наличие IgA, IgG;

– для повышения эффективности лабораторного обследования больных ЛБ с поражениями суставов целесообразно исследовать мочу, синовиальную жидкость, биоптаты синовиальной оболочки методом ПЦР для выявления ДНК Borrelia burgdorferi sensu lato; исследование сыворотки крови, синовиальной жидкости методом иммунного блоттинга и ИФА  для определения IgG и IgА;

– предлагаем алгоритм обследования больных инфекционной патологией с поражениями суставов: 1 этап – сбор клинических и эпидемиологических данных, 2 этап -  дифференциальная диагностика поражений суставов с проведением скринингового  биохимического исследования (с исследованием ряда показателей: СОЭ, СРБ, РФ, ssP, мочевой кислоты и др.), 3 этап – для установления этиологии поражений суставов применение ИФА, иммунного блоттинга, выявляющих антитела к иерсиниям, хламидиям, боррелиям; 4 этап – исследование биологических субстратов (крови, мочи, синовиальной жидкости, синовиальной оболочки, копрофильтрата, соскоба уретры, цервикального канала и др.) на наличие ДНК или РНК возбудителя, детерминанты вирулентности иерсиний  молекулярно-генетическими методами (ПЦР или ОТ-ПЦР); 5 этап – при необходимости, проведение дополнительных исследований (рентгенологического, МРТ,  сканирование и т.д.), позволяющих диагностировать деструктивные изменения в суставах.

– в комплексную диагностику поражений суставов бактериальной природы, в том числе для подтверждения активности процесса, целесообразно включение исследований цитокинов сыворотки крови: при псевдотуберкулезе – исследование провоспалительных цитокинов IFN-, IL-6, при УГХ – исследование соотношения супрессорных цитокинов, при Лайм-артритах – L-8, IL-4 и IL-2;

– тактика ведения больных артритами бактериальной этиологии при длительно сохраняющейся персистенции возбудителя, подтвержденной выделением возбудителя и/или обнаружением детерминант его вирулентности, а также сохраняющемся  диагностическом уровне IgG и IgA в течение длительного периода (до 2 лет), требует комплексного применения этиотропной терапии в течение 10-14 дней.

Список работ, опубликованных по теме диссертации.

  1. О.А. Бургасова. Сравнительная оценка различных  иммунологических реакций в диагностике псевдотуберкулеза / О.А.Бургасова, Л.Б.Куляшова, Г.Я.Ценева // Журн.микробиол и эпидемиологии.- 1996. 2 - С.48-51.
  2. Г.Я.Ценева. Псевдотуберкулез и иерсиниоз (эпидемиология, клиника, диагностика терапия). / Г.Я.Ценева, Г.И.Кокорина, Е.А.Воскресенская, О.А.Бургасова. В.В.Иванова, О.В.Тихомирова, М.К.Бехтерева, Т.И.Фролочкина // Методические рекомендации. Минздравсоцразвития.-. СПб. – 2005.- 49 с.
  3. Г.И.Кокорина.  Применение иммуноблота в диагностике затяжных форм иерсиниозов и изучении вопросов патогенеза. /  Г.И.Кокорина, О.А.Бургасова, Г.Я.Ценева // Клиническая лабораторная диагностика. 2006.- №  11. С.-47-50.
  4. А.В.Сварваль. Липополисахарид иерсиний и его биологическая активность / А.В.Сварваль, О.А.Бургасова, Г.Я.Ценева // Журнал микробиологии. 2006.- №  3 - С.100-104.
  5. Н.Д.Ющук. Актуальные вопросы клиники иерсиниозов. / Н.Д.Ющук.О.А.Бургасова // Иерсинии и иерсиниозы/ под ред. Г.Я.Ценевой.- СПб. – 2006.- С.85-115.
  6. Усков А.Н. Некоторые аспекты смешанной инфекции при сочетании иксодовых клещевых боррелиозов и псевдотуберкулеза./ Усков А.Н., Бургасова О.А // Иерсинии и иерсиниозы / под ред. Г.Я.Ценевой. – СПб. – 2006 – С.135-143.
  7. Ценева Г.Я. Современные возможности лабораторной диагностики псевдотуберкулеза и иерсиниоза./ Ценева Г.Я., Кокорина Г.И., Воскресенская Е.А., Бургасова О.А., Назаров В.Е. //  Иерсинии и иерсиниозы под ред. Г.Я.Ценевой. – СПб. – 2006. – С.143-167.
  8. О.А.Бургасова. Диффереренциальная диагностика иксодовых клещевых боррелиозов и псевдотуберкулеза. / О.А.Бургасова, Н.Е.Гринченко, А.Н.Усков // Мат-лы II Всеросс. науч.-прак. конф. с межд. уч. – СПб. – 2006.- С.49-51.
  9. О.А.Бургасова. К вопросу о поражении опорно-двигательного аппарата у больных иерсиниозами. / О.А.Бургасова [ и др.] // Матер-лы II Всеросс.науч.-практ. конф. с межд.уч.- СПб.- 2006. - C. 51-52.
  10. А.Н.Усков. Современные представления о диагностике клещевых инфекций / А.Н.Усков, О.А.Бургасова, Н.А.Гриинченко, Д.А.Супрун // Мат-лы росс. науч.-практ.конф., посвященной 110-летию кафедры инфекционных болезней ВМА им. С.М.Кирова «Инфекционные болезни: проблемы здравоохранения и военной медицины».- СПб.- 2006 – С.297-298.
  11. G.Tseneva. Laboratoire des infections bacteriennes respiratories / G.Tseneva, E.Voskresenskay, N.Kurova, L.Kraeva, G.Kokorina, E.Burgumelitchik, O.Burgasova. // RAPPORT D ACTIVITE DES DEPARTMENTS DE RECHERCYE EN 2006-2007.- Saint-Petersbourg.- р.13-15.
  12. О.А.Бургасова. Перспективные направления в диагностике артритов иерсиниозной этиологии  /  О.А.Бургасова, Е.А.Воскресенская, Г.Я.Ценева // Мат-лы  росс.науч.-практ. конф. «Инф.болезни: соврем.пробл.диагн. и леч.» - СПб.- 2008. –с.36-37.
  13. Лобзин Ю.В. Иксодовые клещевые боррелиозы (этиология, эпидемиология, клиника, диагносиика, лечение и профилактика) / Лобзин Ю.В., Усков А.Н., Ющук Н.Д., Бургасова О.А.,[ и др. ] //  Метод. реком. ФГОУ «ВУНМЦ Росздрава».- Москва. – 2007-  46 с.
  14. А.Н.Усков. Совреиенные представления о диагностике клещевых инфекций. / А.Н.Усков, К.Д.Байгеленов, О.А.Бургасова, Н.Е.Гринченко. // Сибирский медицинский журнал. 2008. - № 7. С. 148-152.
  15. О.А.Бургасова. Дифференциальная диагностика иксодовых клещевых боррелиозов с поражением суставов псевдотуберкулеза / О.А.Бургасова ,К.Д. Байгеленов , А.Н.Усков // Мат-лы Росс. науч.-практ. конф. «Инф.бол.: соврем. проб. диагн. и леч.».- 2008.- С.37-38.
  16. А.Н. Усков. Особенности иммуноцитокинового ответа у больных иксодовыми клещевыми боррелиозами с различными клиническими проявлениями / А.Н.Усков, О.А.Бургасова, Н.Е.Гринченко, К.Д.Байгеленов // Мат-лы Росс. науч.-практ. конф. «Инф.бол.: соврем. проб. диагн. и леч.».– 2008. – С. 237.
  17. О.А.Бургасова. Новое в диагностики затяжных форм иерсиниозной  инфекции / О.А.Бургасова, Г.Я.Ценева, Г.И.Кокорина // Мат. IVмежд. Конф. «Идеи Пастера в борьбе с инф.»,посв. 85-летию СПб НИИЭМ им. Пастера и 120 –лет. Париж. инст. Пастера. –  СПб.-2008- С. 95.
  18. О.А. Бургасова. Исследование иммуноцитокинов у больных псевдотуберкулезной инфекцией / О.А.Бургасова, И.А.Шурыгина, Г.Я.Ценева // Мат. IVмежд. Конф. «Идеи Пастера в борьбе с инф.»,посв. 85-летию СПб НИИЭМ им. Пастера и 120 –лет. Париж. инст. Пастера. -  СПб.-2008.- С. 89.
  19. О.А.Бургасова. Перспективные направления в диагностике артитов иерсиниозной этиологии. / О.А.Бургасова, Е.А.Воскресенская, Г.Я.Ценева, В.Б.Мусатов, Д.А.Супрун // Инфекционные болезни. 2009. - № 3. c.48-52.
  20. О.А.Бургасова. Влияние факторов патогенности Y. Pseudotuberculosis на развитие поражений опорно-двигательного аппарата в виде реактивных артритов // О.А.Бургасова, Е.А.Воскресенская, Г.Я.Ценева [ и др.]  // Инфекционные болезни. 2009. № 4 . С. 33-36
  21. О.А. Бургасова. Актуальные вопросы изучения этиологических и патогенетических аспектов реактивных артритов. / О.А.Бургасова, Н.Д.Ющук, Г.Я.Ценева // Эпидемиология и инфекционные болезни. 2009. № 5.- С.49 -52.
  22. О.А. Бургасова. Современные подходы к диагностике хронических болезней, обусловленных возбудителями природно-очаговых инфекций / О.А Бургасова., Н.Д. Ющук, Е.А. Воскресенская., Г.Я. Ценева., В.Б. Мусатов. // Журнал инфекционной патологии. – 2009. – т.16. – . 3 – С.79.
  23. О.А Бургасова. Влияние факторов патогенности псевдотуберкулезного микроба на развитие поражений опорно-двигательного аппарата // Бургасова О.А.,Чеснокова М.В., Климов В.Т. // Материалы I Всеросс. Конгр. по инф.бол..-Москва.- 2009- С.248.
  24. O. Burgasova. Contemporary methods of diagnostics of arthritis of yersinia pseudotuberculosis // Papers of the International Scientific Conference.- Hurgada – Perm.- 2009.- p. 117.
  25. О.А. Бургасова. Особенности содержания цитокинов в сыворотке крови больных иксодовыми клещевыми боррелиозами с различными клиническими проявлениями / О.А.Бургасова, А.Н.Усков, Н.Е.Гринченко, Г.Я.Ценева  //  Журнал микробиологии.- 2010. - № 3. -  С.67-71.
  26. О.А.Бургасова. К дифференциальной диагностике артритов псевдотуберкулезной и хламидийной этиологии / О.А.Бургасова, Н.Д.Ющук, Л.В.Погорельская, Г.Я.Ценева, Л.Б.Куляшова, Е.А.Воскресенская, И.П. Федуняк // Терапевтический архив.- 2010 -N 11.- С.53-57.
  27. Санитарно-эпидемиологические правила «Профилактика иерсиниозов» Федеральная служба по надзору в сфере защиты прав потребителей и благополучии человека.- СП 3.1.7.2615-10.-  2010. –  18 с..
  28. А.Н. Усков. Клещевой энцефалит, эрлихиоз, бабезиоз и другие актуальные клещевые инфекции в России. / А.Н.Усков, Ю.В.Лобзин , О.А.Бургасова // Инфекционные болезни. 2010.- Том 8.- N 2 С. 83-88.
  29. Г.Я Ценева. Иерсиниозы: распространенность, основные направления профилактики, как базовый компонент в формировании здоровья населения. / Г.Я, Ценева, О.А.Бургасова, Н.Д. Ющук  // Ежемесячный информационный бюллетень: Здоровье населения и среда обитания.- 2010.- С. 8-11. 
  30. О.А.Бургасова. Влияние «Бестима» на течение экспериментальной псевдотуберкулезной инфекции / О.А. Бургасова, Е.А.Воскресенская, Д.А.Супрун [и др.]  //  Мат-лы II Ежег. Всеросс. Конгр. по инфек. бол..- 2010.- С.55.
  31. О.А.Бургасова. Оптимизация диагностики реактивных артритов хламидийной этиологии / О.А.Бургасова // Мат-лы межд. конфер. «Развитие научных исследований и надзор за инфекционными заболеваниями».- СПб.- 2010.-– С.112.
  32. Воскресенская Е.А. Генетические особенности Yersinia pseudotuberculosis, клинические варианты течения псевдотуберкулезной инфекции и оптимизация ее диагностики / Воскресенская Е.А., Ценева Г.Я., Чеснокова М.В., Климов В.Т., Кокорина Г.И., Бургасова О.А // Мат-лы междунар. конф. «Развитие научных исследований и надзор за инфекционными заболеваниями».- СПб. – 2010 – С.92.
  33. Климов В.Т., Вирулентность и морфологические проявления в организме животных, инфицированных Yersinia pseudotuberculosis с различным плазмидным спектром. / Климов В.Т.,Чеснокова М.В., Бургасова О.А., Шурыгина И.А. // Журнал инфекционной патологии.- 2010 .- С. 78-79.
  34. Tseneva G.Ya. The Y. pseudotuberculosis infections in the Russian Federation. / Tseneva G.Ya., Chesnokova M.V., Voskresenskaya E.A., Klimov V.T., Kokorina G.I, Burgasova O.A, Sayapina L.V., Tirskikh K.A., Karimova T.V.  // 10th Inter. Symp. on Yersinia, Recife.- Brasil.- 2010 – P.101-102.
  35. Супрун Д.А. «Бестим» в клинической практике / СупрунД.А., Г.Я.Ценева, Е.А.Воскресенская, О.А.Бургасова  [ и др. ] // Методическое пособие для врачей.- СПб. - 2010- 15 с.
  36. Погорельская Л.В. Особенности поражения суставов хламидийной инфекцией. / Погорельская Л.В., Бургасова О.А. // Тез. докл. научно-практ.конф., посвященной 100-летию ГКБ им. С.П.Боткина «Актуальные вопросы организации лечебно-диагностического процесса в многопрофильной клинической больнице».-Москва.-2010.-С.218
  37. Г.Я. Ценева, Е.А.  Иерсиниозы./ Г.Я. Ценева, Е.А. Воскресенская, Н.Н. Курова, Л.А. Краева, Е.А. Богумильчик, Г.И. Кокорина, О.А. Бургасова, Г.И. Беспалова // Национальное руководство по клинической лабораторной диагностики. Книга в 2 т. Изд-во «ГЭОТАР-Медиа» - 2011 – Т.2.
  38. О.А.Бургасова. Цитокины у больных реактивными артритами хламидийной этиологии / О.А.Бургасова, Н.Д Ющук, Л.В. Погорельская // Материалы III Ежег. Всеросс. Конгр. по инф. бол.- Москва.- 2011.- том 9.- С. 60.
  39. Е.А.Воскресенская. Методы генетического типирования Yersinia pseudotuberculosis. / Е.А.Воскресенская, О.А.Бургасова // Инфекционные болезни.-2011.-том 9 № 2.- С.81-88.
  40. O.А. Бургасова. Протективное влияние препарата «Бестим» на течение экспериментальной псевдотуберкулезной инфекции. / O.А. Бургасова, Н.Д. Ющук, Е.А. Воскресенская, Г.Я. Ценева // Ежемесячный информационный бюллетень :Здоровье населения и среда обитания.-2011.- № 6. С.27-29.
  41. Т.В.Гома. Антитела к иерсиниям и сывороточные цитокины у больных диффузно-токсическим зобом с поражением сердечно-сосудистой системы. / Т.В.Гома, Д.Ю.Хамнуева, О.А.Бургасова, О.В.Колбасеева, В.Т.Климов // Инфекционные болезни. 2011.- том 9.- №.2. С.55-58.
  42. Г.И. Кокорина. Разработка тест-системы для серодиагностики иерсиниозов методом иммуноблота  /  Г.И.Кокорина, О.А.Бургасова, Г.П. Анискина, Н.Д. Ющук, Г.Я. Ценева // Эпидемиология и инфекционные болезни.- №. 4 .- С. 18-23.
  43. Сухина М.А. .Антогонистическая активность лактобацилл толстого кишечника / Сухина М.А.Бургасова О.А., Жуховицкий В.Г., Ющук Н.Д.// Журнал микробиологии и эпидемиологии. - 2012.- № 1.
  44. Ценева Г.Я.. Эпидемиологическая характеристика псевдотуберкулеза в России. /Ценева Г.Я.,Чеснокова М.В., Климов В.Т., Воскресенская Е.А., Кокорина Г.И., Бургасова О.А.  [ и др.] // Мат-лы  II Всеросс. науч.-прак. конфер. с межд.участ. « Инфекции, обусловленные иерсиниями».- СПб.-2011.-С.11.
  45. Бургасова О.А, Антагонистическая активность лактобацилл толстого кишечника в отношении патогенных иерсиний./ Бургасова О.А, Сухина М.А., Жуховицкий В.Г./ Мат-лы  II Всеросс. Науч.-практ.конф. с межд.учас. « Инфекции, обусловленные иерсиниями».-Санкт-Петербург – 2011.-  С.35
  46. М.Д. Шестакова. Абдоминальная форма иерсиниозов у детей и возможности лабораторной диагностики. / Е.А. Воскресенская, Г.И. Кокорина, О.А. Бургасова, Г.Я.  Ценева, Эрман Л.В // Журнал  Педиатрия.- 2012.- 2.
  47. G.Ya.Tseneva. Pseudotuberculosis in the Russian Federation. / G.Ya.Tseneva ,M.V.Chesnocova, V.T.Klimov,  O.A.Burgasova  [ et all ] // St Peterburg Pasteur Institute of Epidemiology and Microbiology. Yersinia. Springer UK – 2012.

Список сокращений

АлАТ – аланинаминотрасфераза

АсАТ – аспарагинаминотрансфераза

БКД – буферно-казеиново-дрожжевая среда

БНМ – белки наружной мембраны

БТШ – белок теплового шока

ДНК – дезоксирибонуклеиновая кислота

ИФА – иммуноферментый анализ

ЛА-Лайм – артрит

ЛБ-Лайм – боррелиоз

ЛПС – липополисахарид

МПА – мясо-пептонный агар

НПВП – нестероидные противовоспалительные  препараты

ОП – оптическая плотность

ОТ-ПЦР – полимеразная цепая реакция в обратной транскрипции

ПИФ – прямая иммунофлюоресценция

ПЦР – полимеразная цепная  реакция

РА – реакция агглютинации

РЭС – ретикуло-эндотелиальная система

РеА – реактивный артрит

РНГА – реакция непрямой гемагглютинации

РНК – рибонуклеиновая кислота

СВИ  – сыворотка к вирулентным иерсиниям

СЖ – синовиальная жидкость

СОЭ – скорость оседания эритроцитов

УГХ – урогенитальный хламидиоз

ФБР – фосфатно-буферный раствор

ФБС – фосфатно-буферная среда

ХУГХИ – хроническая урогенитальная  хламидийная инфекция

Ail – белок адгезии/инвазии

ELIFSA – иммуноферментный анализ

HLA- B 27 – антиген гистосовместимости

HPI (High Pathogenicity Island) – остров высокой патогенности иерсиний

Hsp – белок теплового шока

IF – интерферон

Ig – иммуноглобулины

IL – интерлейкины (цитокины)

Osp (outer-suface proteins) – белки поверхностной мембраны

pYM 82 MDa – плазмида вирулентности иерсиний

pYV 42 MDa – плазмида вирулентности иерсиний

PФ – ревматоидный фактор

ssP – маркер ревматоидного артрита

TNF-альфа – фактор некроза опухоли

Yad A – Yersinia adgehezin (иерсиниозной адгезин)

YAPI – адгезивный остров патогенности иерсиний

YPM – Yersinia pseudotuberculosis Mitogen (суперантиген иерсиний)

Yор (Yersinia outer membrane protein) – белки поверхностной мембраны иерсиний






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.