WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

                1. Минушкина Лариса Олеговна

Генетические факторы  при гипертонической болезни: связь с особенностями течения, развитием осложнений, эффективностью терапии

14.00.06 – Кардиология

Автореферат

диссертации на соискание ученой степени

доктора медицинских наук

Москва, 2008 г.

    1. Работа выполнена на кафедре кардиологии и общей терапии ФГУ «Учебно-научный медицинский центр» Управления делами Президента РФ
    2. Научные консультанты:
    3. доктор медицинских наук, профессор         Сидоренко Борис Алексеевич

доктор биологических наук, профессор        Носиков Валерий Вячеславович

Официальные оппоненты:

Член-корр РАМН, профессор        Гогин Евгений Евгеньевич

Академик РАМН, профессор       Моисеев Валентин Сергеевич

Доктор биологических наук, профессор  Фаворова Ольга Олеговна

Ведущая организация: Федеральное государственное учреждение «Российский научно-исследовательский центр профилактической медицины» Федерального агентства по высокотехнологичной медицинской помощи

Защита диссертации состоится 15 сентября 2008 года в 14 часов на заседании диссертационного совета (Д 121.001.01) при ФГУ «Учебно-научный медицинский центр» Управления делами Президента Российской Федерации по адресу: 103875, Москва, ул.Воздвиженка,6.

С диссертацией можно ознакомиться в библиотеке ФГУ «Учебно-научный медицинский центр» Управления делами Президента РФ по адресу: 121359, Москва, ул. Маршала Тимошенко,21.

Автореферат разослан « » июня 2008 года

Ученый секретарь диссертационного совета,

доктор медицинских наук                М.Д.Ардатская

Список сокращений

ADRB1

ген бета1-адренорецептора

ACE

ген ангиотензин-превращающего фермента

AGT

ген ангиотензиногена

Amax

скорость позднего наполнения левого желудочка

APOB

ген аполипопротеина В

APOE

ген аполипопротеина Е

AT2R1

ген рецептора ангиотензиа 2 типа 1

CAT

ген каталазы

CYP11B2

ген альдостеронсинтетазы

CYP2D6

ген цитохрома 2D6

EDN1

Ген эндотелина 1

Emax

скорость раннего наполнения левого желудочка

GNB3

ген субъединицы 3 белка G

LPL

ген липопротеинлипазы

MTHFR

ген метилентетрагидрофалатредуктазы

NOS3

ген NO-синтетазы 3 типа

OR

относительный риск

PON1

ген пароксанзы 1

PON2

ген пароксаназы 2

PPARA

ген рецептора активатора пролиферации пероксисом типа альфа

PPARG2

ген рецептора активатора пролиферации пероксисом типа гамма 2

SOD2

ген супероксиддисмутазы митохондрий

АГ

артериальная гипертония

АД

артериальное давление

ГБ

гипертоническая болезнь

ГЛЖ

гипертрофия миокарда левого желудочка

ДАД

диастолическое артериальное давление

ИБС

ишемическая болезнь сердца

ИМ

инфаркт миокарда

ИММЛЖ

индекс массы миокарда левого желудочка

ЛЖ

левый желудочек

ММЛЖ

масса миокарда левого желудочка

МС

метаболический синдром

НД

различия недостоверны

НМК

нарушение мозгового кровообращения

САД

систолическое артериальное давление

ТИМ

толщина комплекса интима-медиа

ЧСС

частота сердечных сокращений

ВВЕДЕНИЕ

Артериальная гипертония (АГ) является независимым фактором риска развития различных сердечно-сосудистых заболеваний и их осложнений, таких как нарушение мозгового кровообращения (НМК) и  инфаркт миокарда (ИМ), и тем самым является одной из причин частой инвалидизации и смертности больных [Оганов Р.Г., 1997]. Повышенное артериальное давление (АД) имеет место в 35% случаев всех атеросклеротических сердечно-сосудистых заболеваний, в том числе в 49%  всех случаев сердечной недостаточности [Aрабидзе Г.Г. 1999]. Особенностью течения гипертонической болезни (ГБ), часто является бессимптомность или малосимптомность. В связи с этим, несмотря на простоту распознавания этого заболевания, оно часто не диагностируется длительное время, иногда вплоть до развития осложнений.  Своевременное проведение антигипертензивной терапии позволяет уменьшить число осложнений ГБ, смертность от ИМ, НМК, развитие застойной сердечной недостаточности.

К настоящему времени накоплено множество сведений, указывающих, что в развитии эссенциальной гипертонии наследственные факторы могут играть значительную роль. По данным Н.П.Бочкова 24-36% вариаций артериального давления определяется наследственными факторами, 11-20% - общесредовыми, а остальная часть – случайными средовыми факторами. Описана высокая конкордантность уровня АД среди монозиготных близнецов (60%) и дизиготных близнецов (36%) [Лильин Е.Т., 1994]. Имеются, кроме того, данные о накоплении случаев заболевания артериальной гипертонии в семьях и конкордантности уровней АД у кровных родственников [Ward R, 1990].

Попытки связать развитие ГБ с мутацией уникального гена или группы генов не увенчались успехом. Для наследования ГБ характерны ряд особенностей, подтверждающих его полигенный характер. Для изучения таких заболеваний часто используется подход с выделением так называемых генов-кандидатов. "Геном-кандидатом" называют ген, продукт экспрессии которого (фермент, гормон, рецептор, структурный или транспортный белок) может прямо или косвенно участвовать в развитии изучаемой болезни [Dzau, 1999]. Данные исследований, проводимых по принципу «случай-контроль» очень вариативны. Ассоциация тех или иных полиморфных маркеров с повышением АД, показанная в небольших и относительно изолированных популяциях (Финляндия, Сардиния) не всегда совпадает с теми данными, которые были получены в больших гетерогенных группах. Фиксируются существенные этнические и расовые различия в частотах встречаемости аллелей и генотипов. Генотип, преобладающий в одной популяции может оказаться минорным в другой. Это делает исследования для каждой этнической и популяционной группы уникальными и значимыми.

Одним из интересных направлений генетических исследований при ГБ является фармакогенетика. Реакция пациента на гипотензивную терапию индивидуальна и определяется целым комплексом демографических (возраст, пол), биохимических и физиологических механизмов. В ряде крупнейших фармакологических исследований удалось выявить существенные этнические различия в эффективности терапии [Ferdinand KC 2003, Dahlf B, 2002]. Определение генетических маркеров может помочь оптимизации индивидуального выбора лекарства в конкретной дозе у каждого больного [Evans WE, 2003].

Проведение комплексных генетических исследований ГБ, учитывающих генетические и средовые факторы, факт возможных этнических различий, в Российской популяции представляется актуальным.

Цель работы: изучить генетические факторы, связанные с особенностями течения, риском развития осложнений и эффективностью медикаментозной терапии у больных гипертонической болезнью. 

Задачи исследования:

1. Проанализировать особенности ГБ у больных с отягощенным семейным анамнезом.

  1. Выявить гены кандидаты, связанные с тяжестью артериальной гипертонии;
  2. Изучить ассоциацию полиморфизма генов-кандидатов со стадиями  ГБ;
  3. Исследовать генетические особенности группы больных с очень высоким дополнительным риском;
  4. Оценить влияние генов-кандидатов на развитие  поражения органов мишеней при ГБ;
  5. Сопоставить генетические факторы, влияющие на течение гипертонической болезни в различных этнических группах (на примере московской и якутской популяции);
  6. Изучить генетические аспекты индивидуальной чувствительности к гипотензивной терапии бета-адреноблокатором бетаксололом

НАУЧНАЯ НОВИЗНА РАБОТЫ

Впервые в русской московской популяции было проведено комплексное изучение генетических маркеров, ассоциированных с уровнем АД, развитием поражения органов-мишеней при ГБ, стадиями ГБ, особенностями семейного анамнеза. Сопоставлено влияние клинических и генетических факторов на течение ГБ. Впервые установлено, что у больных с отягощенным семейным анамнезом ГБ уровень АД ассоциирован с полиморфизмом генов AT2R1, NOS3, EDN1,  GNB3, PON1 а у больных без наследственной отягощенности – с полиморфизмом гена PPARG2. Выявлены генетические маркеры связанные с ранним началом ГБ - гены AT2R1 и GNB3. Наиболее интересные и новые данные были получены при изучении роли полиморфизма промотерной области гена AT2R1 у больных ГБ. Оказалось, что генотип АA полиморфного маркера  A(-153)G гена AT2R1 ассоциирован с тяжестью АГ, ранним началом ГБ развитием диастолической дисфункции миокарда, гипертонической нефропатии. Впервые показано, что развитие ГЛЖ  у больных с АГ ассоциировано с наличием в генотипе пациентов  аллеля 4а  полиморфного маркера 4a/4b гена NOS3. 

Впервые проведено сопоставление клинических особенностей и генетических маркеров у больных ГБ в русской московской и якутской популяциях. Впервые было показано, что имеются существенные различия в частотах аллелей и генотипов генов NOS3 и EDN1 у больных с ГБ в разных популяциях. Частота  генотипа Lys/Lys полиморфного маркера Lys198Asn гена END1 и аллеля 4a полиморфного маркера гена NOS3 была выше в группе больных ГБ  якутской национальности.

Впервые изучены фармакогенетические особенности бетаксолола в лечении артериальной гипертонии. Впервые установлено, что носители аллеля Pro полиморфного маркера Pro34Ser гена CYP2D6 более чувствительны к терапии бетаксололом. Применение препарата у этой группы больных вызывает более выраженное уменьшение ЧСС и снижение АД, чем у гомозиготных носителей генотипа Ser/Ser, что может быть связано с особенностями метаболизма препарата.

Практическая значимость

Исследование полиморфных маркеров разных групп генов, кодирующих элементы ренин-ангиотензиновой системы, антиоксидантной системы, системы эндотелия, регуляторных белков и рецепторов,  позволил выявить группы больных, у которых риск развития АГ, сердечно-сосудистых осложнений и поражения органов-мишеней является максимальным. Разработан методологический подход к комплексной оценке генетической предрасположенности к развитию осложнений ГБ. Обоснован необходимый минимум генетических маркеров, типирование которых необходимо для  выявления больных высокого риска. Этот набор включает  гены-кандидаты, показавшие ассоциацию с развитием ГБ и ее осложнений:  AT2R1, PPARG2, NOS3, SOD2, MTHFR, PON1 APOB, APOE, CYP11B2, EDN1 и GNB3.

Определение генотипа полиморфного маркера Pro34Ser гена CYP2D6 позволяет выделить группу лиц, в большей мере чувствительных к гипотензивной терапии бетаксололом. У носителей аллеля Pro полиморфного маркера Pro34Ser гена Cyp2D6 препарат вызывает более значимое уменьшение ЧСС и снижение АД, что дает основание для индивидуализации подбора дозы бетаксолола при лечении ГБ.

ОСНОВНЫЕ ПОЛОЖЕНИЯ, ВЫНОСИМЫЕ НА ЗАЩИТУ

1. Больные ГБ, имеющие отягощенный семейный анамнез, имеют более высокий уровень АД и более ранний дебют заболевания

2. Раннее начало ГБ ассоциировано с полиморфизмом генов AT2R1 и GNB3. У больных с отягощенным семейным анамнезом более высокий уровень АД связан с полиморфизмом генов EDN1, NOS3, PON1, GNB3 и AT2R1. У больных ГБ с неотягощенным семейным анамнезом высокий уровень АД ассоциирован только с полиморфизмом гена PPARG2.

3. У больных с разными стадиями  ГБ III отмечаются достоверные различия в частотах генотипов генов ApoE, MTHFR и SOD2.

4. Наличие у больных ГБ метаболического синдрома ассоциировано с носительством аллеля  Ala полиморфного маркера Pro12Ala гена PPARG2.

5. Развитие поражения органов-мишеней при ГБ ассоциировано с полиморфизмом генов AT2R1, CYP11B2, NOS3, APOB и MTHFR.

6. У больных ГБ якутской популяции чаще встречаются сердечно-сосудистые осложнения и поражения органов-мишеней при ГБ. Частоты генотипов генов NOS3 и EDN1 достоверно различаются у больных ГБ в якутской и московской популяциях.

7. Индивидуальная чувствительность к терапии бетаксололом у больных гипертонической болезнью вариабельна как по данным амбулаторного измерения АД, так и по данным инструментальных методов контроля. У носителей аллеля Pro полиморфного маркера Pro34Ser гена CYP2D6 терапия бетаксололом более эффективна, по сравнению с носителями генотипа Ser/Ser.

Внедрение. Основные положения и результаты исследования используются в практике обследования и ведения больных в Городской клинической больнице № 51 г. Москвы и в преподавательской работе на кафедре кардиологии и общей терапии ФГУ УНМЦ УД Президента РФ.

Апробация диссертации состоялась на научной конференции кафедры кардиологии и общей терапии ФГУ УНМЦ УД Президента РФ с участием сотрудников лаборатории молекулярной диагностики и геномной дактилоскопии ФГУП «ГосНИИ генетика» и врачей городской клинической больницы № 51 г. Москвы 10 апреля 2008 г.

Публикации. По теме диссертации опубликовано 46 работ.

Материалы диссертации доложены и представлены на Российском национальном конгрессе кардиологов, 2001-2006,  Российском национальном конгрессе ″Человек и лекарство″, Москва, 2005-2006, на всероссийской научно-практической конференции «Актуальные проблемы артериальной гипертонии), Москва 1999, Всероссийской научно-практической конференции «Современные возможности эффективной профилактики, диагностики и лечения артериальной гипертонии» Москва, 2001, Конгрессе кардиологов стран СНГ, Санкт-Петербург 2004 г., Международной конференции «Гипертония: от Короткова до наших дней», Санкт-Петербург, 2005 г., Конгрессе Европейского общества по изучению артериальной гипертонии, 2004-2007,  По материалам диссертации сделано 33 доклада.

Объем и структура диссертации. Текст диссертации изложен на 289 страницах, состоит из введения, 6 глав (обзор литературы, характеристика обследованных больных и методы исследования, результаты), выводов, практических рекомендаций и списка литературы из 68 отечественных и 291 зарубежных источников. Диссертация содержит 103 таблицы и 10 рисунков.

характеристика больных и методы исследования

2.1 Клиническая характеристика обследованных больных

В рамках данной работы всего было обследовано 617 больных (333 мужчины и 284 женщины), наблюдавшихся на кафедре кардиологии и общей терапии ФГУ «Учебно-научный медицинский центр» Управления делами Президента РФ.  Среди обследованных больных 213 больных страдали только АГ, остальные пациенты – сочетанием АГ и ИБС. У 137 больных АГ соответствовала 1 степени тяжести, у 195 – 2 степени и у 285  - 3 степени тяжести. 153 больных имели в анамнезе ИМ, 46 больных НМК, 287 больных - отягощенный семейный анамнез по АГ. Средний возраст составил 57,2±0,49 лет.  В обследованной группе было 108 больных с метаболическим синдромом, имеющих очень высокую степень дополнительного риска, у 88 - был сахарный диабет 2 типа, 20 имели нарушение толерантности к углеводам.  76 больных были якутами из якутской популяции, остальные принадлежали к русской популяции г.Москвы. У 81 больного проведена оценка взаимосвязи гипотензивной эффективности бета-адреноблокатора  бетаксолола с полиморфизмом гена CYP2D6 и ADRB1.

Для оценки влияния полиморфизма генов-кандидатов на ГЛЖ было обследовано 243 больных артериальной гипертонией. У 168 больных из данной группы было проведено исследование диастолической функции левого желудочка. У 138 больных была проанализирована взаимосвязь полиморфизма генов с эндотелиальной дисфункцией, у 93 – с гипертонической нефропатией, у 92 – с эндотелиальной дисфункцией.

Оценка семейного анамнеза проводилась на основе опроса больного с помощью стандартного опросника ВОЗ “Семейный анамнез”. Регистрировали наличие у родственников 1 степени родства (родители, родные братья и сестры, дети) наличие смерти от инфаркта миокарда или инсульта, перенесенные НМК или инфаркты миокарда, наличие артериальной гипертонии. Семейный анамнез считали отягощенным при наличии у больного 2–х или более пораженных родственников.

Эхокардиографическое исследование проводилось на ультразвуковом аппарате  ACUSON-128XP (Acuson, США). Определение конечного диастолического размера, ТМЖП и ТЗСЛЖ проводились в М-режиме на уровне хорд митрального клапана из парастернального доступа по длинной оси сердца. Верхней границей нормальных значений толщины стенок ЛЖ считали 1,1 см. ММЛЖ рассчитывались по формуле R. Devereux и N. Reichek, 1977. ИММЛЖ рассчитывали как отношение массы миокарда левого желудочку к площади поверхности тела,  к росту и к росту, возведенному в 2,7-ю степень.  Глобальную диастолическую функцию левого желудочка оценивали по трансмитральному кровотоку с применением импульсноволновой допплерэхокардиографии.

Цветовое дуплексное сканирование экстракраниальных отделов брахиоцефальных артерий  проводили на ультразвуковом аппарате ACUSON-128XP/10 (США) линейным датчиком с частотным диапазоном 5,5-7,5 МГц.  Толщину комплекса интима-медиа (ТИМ) измеряли по методике, предложенной P.Pignolli (1986). Сонную артерию лоцировали в перпендикулярной сосудистой стенке плоскости. Измерения проводили в противоположной от датчика стенке артерии, в участке стенки сосуда, в котором отсутствовала атеросклеротическая бляшка. При анализе учитывали максимальные значения ТИМ в каждом сегменте. Нормальным показателем ТИМ считали значение менее 1,1 мм.

Оценка сосудодвигательной функции эндотелия проводилась с помощью ультразвукового аппарата ACUSON-128XP (Acuson, США) линейным датчиком 5,5-7,5 МГц по методике описанной Celermajer D.S и соавт (1992). Проводилось измерение диаметра левой плечевой артерии и оценивалась степень вазодилятации в ответ на усиление кровотока и на нитроглицерин. Нормальной реакцией плечевой артерии условно принято считать ее расширение на фоне реактивной гиперемии на 10% и более от исходного диаметра. Меньшая степень вазодилятации или вазоконстрикция считается патологической реакцией.

Определение микроальбуминов в моче проводили иммунологическим, полуколичественным методом при помощи тест-полосок Микраль-тест II (Rosh Diagnostics GmbH). Для анализа использовали мочу, взятую у пациента, находящегося в состояния покоя (утренняя порция мочи). Концентрацию альбумина в моче менее 20 мг/л считали физиологической нормой.

Мониторирование АД проводилось с помощью монитора BPone (Сardiette, Италия). В дневное время интервал между измерениями АД составлял 15 минут, в ночное время – 30 минут.  Вычислялись средние значения АД за сутки, день и ночь. Вариабельность АД оценивалась по значению стандартного отклонения. Индекс времени рассчитывался как процент измерений, превышающих нормальный уровень АД (135/85 мм рт.ст. днем и 120/70 мм рт.ст. ночью).

Холтеровское мониторирование ЭКГ проводилось с помощью монитора Cardioclip24 (Венгрия). При мониторировании рассчитывались средние величины ЧСС за сутки, утренний период, день, ночь из усреднения 30-секундных интервалов. Оценивались минимальные и максимальные значения ЧСС за сутки.

Нагрузочный тест выполнялся на тредмиле по стандартному протоколу Брюса на тредмиле Cardiac Control. Тест проводился с одновременным мониторированием ЭКГ в 12-ти стандартных отведениях, регистрацией ЧСС и АД  по методу Короткова до, во время и после нагрузки. Нагрузочный тест прекращали, если возникали изменения сегмента ST и зубца Т; достигали заданной субмаксимальной ЧСС, повышении САД выше 240 мм рт.ст. или при появлении жалоб. Учитывали изменение уровня артериального давления, частоты сокращений сердца (ЧСС) и изменения показателей ЭКГ в течение всего теста, а также в течение отдыха до полного восстановления исходных показателей ЧСС и АД.

Для определения аллелей и генотипов генов-кандидатов проводили выделение геномной ДНК из венозной крови обследуемых методом фенол-хлороформной экстракции. Амплификацию полиморфных участков генов проводили на амплификаторе PHC-2 ("Techne", Великобритания). Определяли полиморфизм генов, кодирующих компоненты ренин-ангиотензиновой системы, участвующие в эндотелиальной регуляции сосудистого тонуса, регуляции процессов метаболизма, системы обмена и транспорта липидов и в  антиоксидантной защите. Использованные полиморфные маркеры и праймеры представлены в табл. 1. Агарозные гели окрашивали бромистым этидием, полиакриламидные – нитратом серебра.

Таблица 1. Изученные гены-кандидаты

Гены-кандидаты

Поли-морфные маркеры

Праймеры

Ангиотензиноген (AGT)

Met174Thr

Met235Thr

AGT1 (5’-gatgcgacaaggtcctg-3’) и

AGT2 (5’-cagggtgctgtccactggctcgc-3’).

Ангиотензин-превращающий фермент (АСЕ)

I/D

G7831A

АСЕ1 5’- ctggagaccactcccatcctttct -3’

АСЕ2 5’- gatgtggccatcacattcgtcagat -3’

ACE-P1 5'- ctcggcttgggacttcta -3' и

ACE-P2 5'- agagctggtccatcgtga -3'

Рецептор ангиотензина II типа 1(АТ2R1)

A1166C

A(-153)G

AT1R-L  5`- cctgcaccatgttttgaggttgagtgac -3’ и

AT1R-R5`-aaaataacaggacaaaagcaggctagggag -3’

  AT1- 5`-  tagcatgtccaataggaacaaatgagtgtc -3` и

AT2 5`-  caagaagcagcaacgcccctcact  -3’.

Эндотелиальная NO-синтетаза (NOS3)        

4a/4b

Glu298Asp

NOS3-VNTR1  5'- aggccctatggtagtgccttt -3' и

NOS3-VNTR2  5'- tctcttagtgctgtggtcat -3'.

NOS298L  5'- aaggcaggagacagtggatgga -3' и

NOS298R  5'- cccagtcaatccctttggtgctca -3'.

Альдостерон синтетаза CYP11B2

T-344C

C11F1 5'-caggaggagaccccatgtgac-3'
  C11R1   5'- cct cca ccc tgt tca gcc c -3'

Ген эндотелина 1 (END1)

Lys198Asn

EDN1.1F   5'-atg atc cca agc tga aag gct a -3'  

EDN1.1R   5'- cag ggc tct ccg tgg agg cta t -3'        

Ген β-субъединицы 3 изоформы протеина G  (GNB3)

С825Т

GNB3F+5500 5`– gtctgatccctgacccactt –3`

GNB3R+5500 5`– ccttacccacacgctcagac –3`

Ген β1-адренорецептора (ADRB1)

Gly389Arg

ADRB1F+389 5`– acc cca tca tct act gcc gc –3`

ADRB1R+389 5`– aca tcg tcg tcg tcg tcg tc –3`.

Ген цитохрома 2D6 (CYP2D6)

Pro34Ser

CYP2D6F+34 5`– tgc agc agg ttg ccc agc cc –3`

CYP2D6R+34 5`– ggg ctc ctc tgg aca cac ctg g –3`

5,10-метилентетрагидрофолат редуктаза  (MTHFR)

C677T

А1298С

МTHFR - 1 5’  –  tgaaggagaaggtgtctgcggga – 3’ и        

MTHFR – 2  5’  – aggacggtgcggtgagagtg -  3’

MTHFR-1 5’agatgtggggggaggagctgaccagtgcag – 3’ 

MTHFR- 2  5’ сaggccaggggcaggggatgaaccag -  3’

Ген рецептора активатора пролиферации пероксисом типа α (PPARA)

С24313G

PPARA-01 5'- aag tag gga cag aca gga cca gta -3'

PPARA-02 5'- aca atc act cct taa ata tgg tgg -3'

Ген рецептора активатора пролиферации пероксисом типа γ2 (PPARG2)

Pro12Ala

  PPARG2-01  5'- ctg gga gat tct cct att ggc -3'

PPARG2-02  5'- ctg gaa gac aac tac aag ag  -3'

Ген аполипопротеина B (APOB)

I/D

ApoB-L  5’-cagctggcgatggacccgccga -3’

ApoB-R  5’-accggccctggcgcccgccagca -3’

Ген аполипопротеина Е (APOE)

E2/E3/E4

ABE1F -  5'- acgcgggcacggctgtccaa -3' и

ABE2R -  5'- tcgcggatggcgctgaggc -3'

Ген липопротеинлипазы (LPL)

Ser477Ter

LPL- F  5`- catccattttcttccacaggg-3` и

LPL-R 5`- tagcccagaatgctcaccagact-3’

Ген супероксиддисмутазы митохондрий (SOD2)

Ala(–9)Val

SOD2-16F2  5'- ccagcaggcagctggcaccg -3' 

SOD2-16R2  5'- tccagggcgccgtagtcgtagg -3'

Ген каталазы (CAT)

T(–262)C

САТ262F  5’- agagcctcgccccgccggaccg -3’

CAT262R  5’- taagagctgagaaagcatagct -3’

Ген пароксоназы 1 типа (PON1)

Met55Leu

Gln192Arg

PON1ex3  5'- gatgtatagccccagtttcaagtg -3'

PON1ex3  5'- ccagtccattaggcagtatctcc  -3'

Ген пароксоназы 2 типа (PON2)

Ala148Gly

Cys311Ser

PON2-148-F 5'- cagtggaaatttttaaatttgaagcag -3' и

PON2-148-R 5'- tgacaggacaacccaccatagg -3'

PON2-311-F  5'- agggcttattgatgattgagtgaca -3' и

PON2-311-R  5'- ggctacagaacttccttggagaaca -3'

Статистическая обработка результатов проводилась с помощью стандартного статистического пакета программ SPSS 13.0.  Проводили анализ дисперсии распределения частотных показателей с оценкой стандартного отклонения, дисперсии, размаха, минимальных и максимальных значений, коэффициента асимметрии и коэффициента вариации. Для оценки нормальности распределения использовали тест Колмогорова-Смирнова. Сравнение дисперсии распределения между группами проводили с помощью теста Levene.  Для протяженных переменных рассчитывали средние величины и их ошибки. Для оценки достоверности их различия использовали тесты Mann–Whitney и Kruskal–Wallis. Дискретные величины сравнивали по критерию χ2 Pearson, коррекцию Yates применяли для таблиц сопряженности с 1-й степенью свободы (2х2). Когда  ожидаемое число наблюдений в любой из клеток таблицы сопряженности было менее 5, использовали точный критерий Fisher, указывали величину р для двухстороннего его варианта.

Правильность распределения частот генотипов определялось соответствием равновесию Харди-Вайнберга (pi2+2pipj+pj2=1) и рассчитывалась при помощи программного калькулятора Knud Christensen.

Оценка независимости влияния клинических и генетических показателей на особенности течения ГБ проводилась методом логистической регрессии. Для всех видов анализа статистически значимыми считали значения p<0,05

Результаты исследования

Особенности семейной гипертонии

Было обследовано 413 (229 мужчины и  184 женщины) больных гипертонической болезнью.  У 62 больных уровень АД соответствовал  1 степени тяжести, у 149 – 2 степени и у 202  – 3 степени тяжести. 153 больных имели в анамнезе ИМ, 46 больных – НМК. 211 больных имели отягощенный семейный анамнез. Средний возраст обследованных больных составил 60,3±0,59 лет.  У 62 больных был сахарный диабет 2 типа.

В обследованной группе 202 больных не имели отягощенного семейного анамнеза по гипертонической болезни и у 211 больных семейный анамнез оказался отягощенным. При сравнении основных клинических характеристик больных с отягощенным и не отягощенным семейным анамнезом оказалось, что больные с отягощенной наследственностью при сравнимой длительности заболевания на момент обследования были достоверно моложе (58.9±0.75 лет и 61,3±0.89 лет соответственно, р=0,017). ГБ у них дебютировала в более молодом возрасте (44,4±0,84 лет и 47,5±1,03 лет, р=0,013). В группе больных с отягощенным семейным анамнезом была выше доля больных с АГ 3 ст. тяжести (53,6% и 44,1% соответственно, р=0,018). Эти больные имели достоверно более высокий уровень САД (204,8±7,66 мм.рт.ст. и 187,0±2,04 мм.рт.ст., р=0,032) и ДАД (111,2±1,05 мм.рт.ст. и 107,3±1,17 мм.рт.ст., р=0,025). По другим клиническим характеристикам, уровню ренина и альдостерона, липидов, креатинина,  глюкозы крови, и наличию поражения органов-мишеней группы больных достоверно не отличались

Основываясь на полученных клинических различиях, был проведен анализ влияния генетических факторов на возраст начала ГБ и уровень АД.

Гены-кандидаты, ассоциированные с ранним началом ГБ

Под «ранним» началом ГБ понимали возникновение заболевания в возрасте менее 45 лет у мужчин и менее 55 лет у женщин. В обследованной группе было 243 больных с ранним началом ГБ и 170 больных с поздним началом ГБ. 

Больные с ранним началом ГБ имели достоверно большую длительность ГБ к моменту обследования (18,7±0,83 лет и 7,44±0,51 лет, р=0,0001), более высокие привычные (141,2±1,27 мм рт.ст. и 136,4±1,36 мм рт.ст., р=0,014) и максимальные значения САД (201,7±2,06 мм рт.ст. и  193,4±2,25 мм рт.ст., р=0,001) и привычные (86,3±0,69 мм рт.ст. и 81,5±0,75 мм рт.ст., р=0.002) и максимальные  (111,8±1,08 мм рт.ст. и 106,2±1,18 мм рт.ст., р=0,009) значения ДАД. Большая доля больных этой группы имела АГ 3 ст. тяжести (54,6% и 40,7%, р=0.02). Эта группа больных чаще имела отягощенный семейный анамнез (56,4% и 43,5%, р=0,043). Уровень холестерина (5,99±0,14 ммоль/л и 5,46±0,11 ммоль/л, р=0,014) и холестерина ЛНП (4,01±0,12 ммоль/л и 3,65±0,10 ммоль/л, р=0,026) у больных с ранним дебютом ГБ был достоверно выше. По частоте НМК, ИМ, СД, наличию ГЛЖ группы достоверно не различались.  В табл. 2 представлены частоты аллелей и генотипов генов, ассоциированных с ранним началом ГБ.

Таблица 2. Частоты аллелей и генотипов генов GNB3 и AT2R1 у больных ГБ с ранним и поздним началом заболевания

Больные с поздним началом ГБ (n=170) 

Больные с  ранним началом ГБ

(n=243)

р

OR [CI]

Полиморфный маркер  C825T гена GNB3

Генотипы

CC

CT

TT

92 (57,1%)

63 (39,1%)

6 (3,7%)

127 (53,6%)

84 (35,4%)

26 (11,0%)

НД

НД

0,005

2,65 [1,27-5,54]

Аллели

C

T

247(76,7%)

75 (23,3%)

338 (71,3%)

136 (28,7%)

НД

НД

Полиморфный маркер A(-153)G гена AT2R1

Генотипы

AA

AG

GG

41(36,6%)

59 (52,7%)

12 (10,7%)

73 (49,7%)

60 (40,8%)

14 (9,5%)

0,024

0,038

НД

1,67 [1,03-2,77]

Аллели

A

G

141 (62,9%)

83 (37,1%)

206(70,0%)

88 (30,0%)

НД

НД

При сравнении частот генотипов, изученных нами полиморфных маркеров, оказалось, что раннее начало ГБ ассоциировано с носительством генотипа ТТ полиморфного маркера С825Т гена GNB3 и  генотипа AA полиморфного маркера A(-153)G гена AT2R1 (табл. 2). Частоты аллелей и генотипов других полиморфных маркеров  достоверно не различались.

Ассоциация полиморфизма генов-кандидатов с тяжестью ГБ

Для оценки ассоциации генов-кандидатов с тяжестью АГ было обследовано 413 больных с ГБ.  Из них были сформированы 2 группы. В первую группу вошли больных с ГБ и АГ 1 и 2 ст., во вторую – больные с АГ 3 ст. Среди больных с АГ 3 степени  было больше женщин (50,9% и 38,4%, р=0,010), эти больные имели большую длительность ГБ (18,1±0,90 лет и 10,5±0,72 лет, р=0,001). Среди больных с АГ 3 ст. было больше пациентов с сахарным диабетом 2 типа (20,9% и 12,3%, р=0,01). По другим клиническим характеристикам группы достоверно не отличались

В табл. 3 представлены частоты аллелей и генотипов полиморфных маркеров генов, ассоциированных с более высоким уровнем АД. АД, соответствующее АГ 3 степени, было ассоциировано с носительством генотипа AA полиморфного маркера A(-153)G гена AT2R1, аллеля Ser полиморфного маркера Ser447Ter гена LPL, аллеля Ala полиморфного маркера Pro12Ala гена PPARG2, аллеля С полиморфного маркера А1298С гена MTHFR, генотипа СТ полиморфного маркера T(-262)C гена CAT. Генотип  Lys/Lys полиморфного маркера Lys198Asn гена EDN1 был защитным. Частоты аллелей и генотипов других полиморфных маркеров генов-кандидатов достоверно не отличались.

Для оценки независимости влияния клинических и генетических фак-торов на тяжесть течения ГБ был проведен регрессионный анализ (табл. 4).

Независимыми предикторами тяжелого течения  ГБ при многофакторном регрессионном анализе оказались длительность заболевания  и наличие в генотипе аллеля Ala полиморфного маркера Pro12Ala гена PPARG2. Защитным влиянием в отношении тяжести АГ обладало наличие в генотипе аллеля G полиморфного маркера A(-153)G гена AT2R1.

В группе больных, не имеющих отягощенного семейного анамнеза, достоверная ассоциация с уровнем АД  была выявлена только для  полиморфного маркера PPARG2 – более высокий уровень АД ассоциировался с носительством аллеля Ala (табл. 5). Частоты аллелей и генотипов других изученных генов-кандидатов достоверно не отличались.

Таблица 3. Частоты аллелей и генотипов полиморфных маркеров генов, ассоциированных с АГ 3 степени тяжести

Больные с АГ 1 и 2 ст. (n=211)

Больные с АГ 3 ст. (n=202)

р

OR

Полиморфный маркер A(-153)G гена AT2R1

Генотипы

AA

AG

GG

50 (31,1%)

90 (55,9%)

21 (13,0%)

76 (54,7%)

50 (36,0%)

13 (9,4%)

0,00003

0,00041

НД

2,62 [1.66-4,16]

0,45 [0,28-0,71]

Аллели

A

G

190 (59,0%)

132 (41,0%)

202 (72,6 %)

76 (27,4%)

0,0003

0,0003

1,82[1,30-2,55]

0,54 [0,39-0,77]

Полиморфный маркер Ser447Ter гена LPL

Генотипы

Ser/Ser

Ser/Ter

Ter/Ter

143 (74,1%)

47 (24,4%)

3 (1,6%)

158 (81,0%)

37 (19,0%)

НД

НД

НД

Аллели

Ser

Ter

333 (86,3%)

53 (15,7%)

353 (90,5%)

37 (9,5%)

0,041

0,041

1,51[1,01-2,34]

0,66 [0,42-0,99]

Полиморфный маркер Pro12Ala гена PPARG2

Генотипы

Pro/Pro

Pro/Ala

Ala/Ala

120 (71,4%)

45 (26,8%)

3 (1,8%)

103 (61,7%)

55 (32,9%)

9 (5,4%)

0,037

НД

НД

0,64 [0,41-0,98]

Аллели

Pro

Ala

285 (84,8%)

51 (15,2%)

261 (78,1%)

73 (21,9%)

0,016

0,016

0,64 [0,43-0,94]

1,87 [1,29-2,69]

Полиморфный маркер А1298С гена MTHFR

Генотипы

AA

AC

CC

54 (26,2%)

124 (60,2%)

28 (13,6%)

33 (17,7%)

119 (64,0%)

34 (18,3%)

0,036

НД

НД

0,61 [0,38-0,98]

Аллели

A

C

232 (56,3%)

180 (43,7%)

185 (49,7%)

187 (50,3%)

0,038

0,038

0.76 [0.58-0.99]

1.30 [1.02-1.78]

Полиморфный маркер  T(-262)C гена CAT

Генотипы

TT

TC

CC

37 (22,7%)

76 (46,6%)

50 (30,7%)

31 (24,2%)

74 (57,8%)

23 (18,0%)

НД

0,037

0,009

1,56 [1,01-2,48]

0.51 [0,29-0,86]

Аллели

T

C

150 (46,0%)

176 (54,0%)

106 (46,9%)

120 (53,1%)

НД

НД

Полиморфный маркер  Lys198Asn гена END1

Генотипы

Lys/Lys

Lys/Asn

Asn/Asn

92 (60,1%)

56 (36,6%)

5 (3,3%)

55 (48,7%)

55 (48,7%)

3 (2,7%)

0,041

НД

НД

0,63 [0,38-0.97]

Аллели

Lys

Asn

240 (78,4%)

66 (21,6%)

165 (73,3%)

61 (26,1%)

НД

НД

Таблица 4. Клинические и генетические факторы, независимо влияющие на тяжесть течения ГБ

Фактор

OR (однофакторный анализ)

р

OR (многофактор-ный анализ)

р

Мужской пол

1,9 [1,36-2,67]

0.001

НД

Длительность течения АГ

1,04  [1,03-1,06]

0.001

1,08 [1,04-1.12]

0,0001

Сахарный диабет 2 типа

1,81 [1,12-2,94]

0.016

НД

Аллель G полиморфного маркера A(-153)G гена AT2R1

0,55 [0,38-0,81]

0.002

0,46[0,27-0.76]

0,03

Aллель С полиморфного маркера А1298С гена MTHFR

1,43 [1,02-2,03]

0.039

НД

Аллель Ala полиморфного маркера Pro12Ala гена PPARG2

1,7 [1,09-2,63]

0.017

3,63 [1,67-7,91]

0.001

Аллель Lys полиморфного маркера  Lys198Asn гена EDN1

1,69 [1,00-2,85]

0.047

НД

Генотип Lys/Lys полиморфного маркера Lys198Asn гена EDN1

1,55[0,96-2,49]

НД

Генотип СС полиморфного маркера T(-262)C гена CAT

0,81[0.57-2,49]

НД

Аллель Ser полиморфного маркера Ser447Ter гена LPL

0,64[0,41-1,15]

НД

Таблица 5. Частота аллелей и генотипов полиморфного маркера Pro12Ala гена PPARG2 у больных с АД различной тяжести, не имеющих отягощенного наследственного анамнеза. 

АГ 1 и 2 ст. (n=113)

АГ 3 ст.

(n=89)

р

OR

Полиморфный маркер Pro12Ala гена PPARG2

Генотипы

Pro/Pro

Pro/Ala

Ala/Ala

56 (74,7%)

19 (25,3%)

0 (0%)

35 (53,8%)

25 (41.5%)

3 (4.6%)

0,021

НД

НД

0,42[0,21-0,86]

Аллели

Pro

Ala

131 (87,3%)

19 (12,7%)

95 (77,2%)

31 (22,8%)

0,013

0,013

0,57[0,24-0,82]

1,74[1,05-3,17]

При анализе ассоциации полиморфизма генов-кандидатов с тяжестью АГ в группе больных с отягощенным семейным анамнезом было выявлено, что более высокий уровень АД, соответствующий АГ 3 степени, был ассоциирован с носительством алелля Asn полиморфного маркера Lys198Asn гена EDN1, аллеля 4a полиморфного маркера 4a/4b гена, генотипа ArgArg полиморфного маркера  Gln192Arg гена PON1, аллеля Т полиморфного маркера С825Т гена GNB3 и генотипа АА полиморфного маркера A(-153)G гена AT2R1 (табл. 6). Частоты аллелей и генотипов других полиморфных маркеров в группах больных с разным уровнем АД  достоверно не отличались.

Таблица 6. Частоты аллелей и генотипов генов-кандидатов, ассоциированных с высоким уровнем АД у больных ГБ, имеющих отягощенный семейный анамнез. 

АГ 1 и 2 ст. (n=98)

АГ 3 ст.

(n=113)

р

OR

Полиморфный маркер A(-153)G гена AT2R1

Генотипы: AA

  AG

  GG

22(39,3%)

28 (50,0%)

6 (10,7%)

45 (63,4%)

20 (28,2%)

6 (8,5%)

0,005

0,009

НД

2,61 [1,29-5,34]

0,39 [0,19-0,81]

Аллели: A

  G

72 (64,3%)

40 (35,7%)

110(77,5%)

32 (22,5%)

0,015

0,015

1,19[1,10-3,30]

0,52[0,30-0,91]

Полиморфный маркер  C825T гена GNB3

Генотипы: CC

CT

  TT

54 (64,3%)

28 (33,3%)

2 (2,4%)

61 (51,7%)

44 (37,3%)

13 (11,0%)

0,05

НД

0,016

0,59 [0,34-1,05]

3,49[1,20-10,1]

Аллели: C

T

136(80,9%)

32 (19,1%)

166 (70,3%)

70 (29,7%)

0,01

0,01

0,57[0,36-0,89]

1,75 [1,11-2,76]

Полиморфный маркер Gln192Arg гена PON1

Генотипы: Gln/Gln

Gln/Arg

  Arg/Arg

47 (62,7%)

28 (37,3%)

0

62 (61,4%)

31(30,7%)

8 (7,9%)

НД

НД

0,01

6,14 [1,46-25,67]

Аллели: Gln

Arg

122(81,3%)

28(18,7%)

155 (76,7%)

47 (23,3%)

НД

НД


Полиморфный маркер 4a/4b гена NOS3

Генотипы:  4b/4b

  4а/4b

4а/4а

50 (50%)

44 (45%)

4 (5%)

34 (34,7%)

63(64,3%)

1 (1,0%)

0,01

0,002

НД

0,53[0,30-0,93]

2,23 [1,29-3,83]

Аллели:  4b

4a

144 (73,5%)

52 (26,5%)

131 (66,8%)

65(33,2%)

НД

НД

Полиморфный маркер  Lys198Asn гена END1

Генотипы: Lys/Lys

Lys/Asn

  Asn/Asn

32 (64,0%)

17 (34,0%)        

1 (2,0%)

17 (34,0%)

31 (62,0%)

2 (4,0%)

0,002

0,004

НД

0,30[0,13-0,66]

3,03[1,39-6.62]

Аллели: Lys

  Asn

81 (81,0%)

19 (19,0%)

65 (65,0%)

35 (32,0%)

0,008

0,008

2,24 [1,20-4,18]

Ассоциация полиморфизма генов-кандидатов со стадией ГБ

Был проведен анализ частот генотипов изученных нами генов кандидатов со стадией ГБ. Больные с ГБ различных стадий не отличались по полу, возрасту начала ГБ, индексу массы тела, наличию сопутствующего сахарного диабета, курения, уровню липидов и глюкозы крови. Больные с ГБ II и III стадий имели большую длительность заболевания на момент обследования (15,1±1,31 лет, 15,1±0,91 лет и 12,2±0,96 лет, р=0,040). В табл. 6 представлено сравнение частот генотипов, изученных генов-кандидатов, у больных с ГБ разных стадий.

Таблица 6. Частоты изученных генов-кандидатов у больных ГБ разных стадий

ГБ I стадии

ГБ II стадии

ГБ III стадии

р

OR

Полиморфный маркер Е2/Е3/Е4 гена АроЕ

Генотипы

Е2/Е2

Е2/Е3

Е2/Е4

Е3/Е3

Е3/Е4

Е4/Е4

6 (3,8%)

19 (11,9%)

5 (3,1%)

101 (63,5%)

25 (15,7%)

3 (1,9%)

5 (4,5%)

5 (4,5%)

6 (5,5%)

77 (70,0%)

13 (11,8%)

4 (3,6%)

16 (10,1%)

22 (13,8%)

9 (5,7%)

83 (52,2%)

27 (17,0%)

2 (1,3%)

0,029

0,47[0,29-0,78]

Полиморфный маркер  А1298С гена MTHFR

Генотипы

AA

AC

CC

37 (25,2%)

92 (62,6%)

18 (12,2%)

23 (25,6%)

55 (61,1%)

12 (13,3%)

20 (16,5%)

74 (61,2%)

27 (22,3%)

0,015

2,1[1,05-3,79]

Полиморфный маркер  Ala(-9)Val гена SOD2

Генотипы

AA

VA

VV

29 (26,1%)

64 (57,7%)

18 (16,2%)

12 (18,8%)

36 (56,3%)

16 (25,0%)

13 (14,4%)

50 (55,6%)

27 (30,0%)

0,006

2,20[1,13-4,28]

При анализе частот генотипов оказалось, что у больных с ГБ III стадии оказалась достоверно меньшей частота генотипа E3/E3 гена АРОЕ и выше доля генотипов содержащих аллели Е2 и Е4. Частота генотипа СС полиморфного маркера A1298C гена MTHFR и  частота носителей генотипа VV  полиморфного маркера Ala(-9)Val гена SOD2 также оказалась выше среди больных ГБ III стадии. Частоты генотипов других полиморфных маркеров достоверно не отличались.

При анализе частот генотипов изученных генов-кандидатов у больных, имеющих в анамнезе ИМ и НМК, оказалось, что у больных с НМК в анамнезе,  достоверно меньше частота генотипа Е3/Е3 гена АРОЕ (рисунок 1), а у больных с ИМ в анамнезе выше частота аллеля Val гена SOD2 (рисунок 2) и генотипа СС полиморфного маркера A1298C гена MTHFR (рисунок 3).

Рис. 1 Распределение частот генотипов полиморфного маркера Е2/Е3/Е4 гена АPOЕ у больных с НМК

Рис. 2 Распределение частот аллей и генотипов полиморфного маркера А1298С гена MTHFR у больных с ИМ

Рис. 3 Распределение частот аллей и генотипов полиморфного маркера Ala(-9)Val гена SOD2 у больных с ИМ

Изучение ассоциации метаболического синдрома с полиморфизмом генов-кандидатов

Среди больных с ГБ была выделена группа пациентов, имеющих наибольший риск сердечно-сосудистых осложнений. Это пациенты с МС, имеющие признаки инсулино-резистентности (сахарный диабет 2 типа или нарушение толерантности к глюкозе), висцеральное ожирение и АГ. В обследованную группу вошли 108 больных с МС. Пациенты с МС были старше (64.4±1.07 лет и 57.9±0.77 лет, р=0,002) в этой группе было больше женщин (56,5% и 31,3%, р=0,001), чаще выявлялась сопутствующая ИБС (94,4% и 81,8%, р=0,007). В этой группе больных была больше длительность АГ (17.7±1.30 лет и  12.7±0.82 лет, р=0,003). Уровень АД (максимального и привычного) достоверно не отличался. Уровень общего холестерина (6.54±0.17 ммоль/л и 5.09±0.86 ммоль/л, р=0,009), холестерина ЛНП (4.32±0.15 ммоль/л и 3.97±0.11 ммоль/л, р=0,041) и триглицеридов (3.08±0.19 ммоль/л и 2.18±0.12 ммоль/л, р=0,001) оказался выше у больных с метаболическим синдромом. По другим клиническим характеристикам группы достоверно не отличались.

В табл. 7  представлены частоты аллелей и генотипов генов-кандидатов, продемонстрировавших ассоциацию с метаболическим синдромом. Частоты аллелей других изучавшихся полиморфных маркеров генов-кандидатов в группах больных с и без метаболического синдрома достоверно не отличались.

Таблица 7. Гены-кандидаты, ассоциированные с развитием МС

Больные с АГ (n=198)

Больные с МС (n=108)

р

OR

1

2

3

4

5

Полиморфный маркер Pro12Ala гена PPARG2

Генотипы:  Pro/Pro

  Pro/Ala

Ala/Ala

76 (69,7%)

31 (28,4%)

2 (1,8%)

54 (57,4%)

38 (40,4%)

2 (2,14%)

0,047

0,049

НД

0,58[0.33-0,95]

1,69[1,04-3,016]

Аллели :  Pro

  Ala

183 (83,9%)

35 (16,1%)

146 (77,7%)

42 (22,3%)

НД

НД

Таблица 7 (продолжение).

1

2

3

4

5

Полиморфный маркер  А1298С гена MTHFR

Генотипы: AA

AC

  CC

27 (25,5%)

68 (64,2%)

11 (10,4%)

14 (15,1%)

60 (64,5%)

19 (20,4%)

0,05

НД

0,037

0,53 [0,26-0,95]

2,18 [1,01-4,74]

Аллели: A

C

122 (57,5%)

90 (42,5%)

88 (47,3%)

98 (52,7%)

0,026

0,026

0,66 [0,44-0,98]

1,50 [1,01-2,23]

Полиморфный маркер  T(-262)C гена CAT

Генотипы:  TT

  TC

  CC

24 (25,3%)

43 (45,6%)

28 (29,5%)

16 (27,6%)

33 (56,9%)

9 (15,5%)

НД

НД

0,03

0,46 [0,21-1,00]

Аллели: T

C

91 (47,9%)

99 (52,1%)

65 (56,0%)

51 (44,0%)

НД

НД

Полиморфный маркер Gln192Arg гена PON1

Генотипы:  Gln/Gln

  Gln/Arg

  Arg/Arg

55 (50,5%)

52 (47,7%)

2 (1,8%)

57 (65,5%)

24 (27,6%)

6 (6,9%)

0,02

0,003

НД

1,84 [1,05-3,25]

0,43 [0,24-0,76]

Аллели : Gln

  Arg

162 (74,3%)

56 (25,7%)

138 (79,3%)

36 (20,7%)

НД

НД

Полиморфный маркер Cys311Ser гена PON2

Генотипы: Cys/Cys

  Cys/Ser

Ser/Ser

21 (19,8%)

39 (36,8%)

46 (43,4%)

8 (9,4%)

34 (40,0%)

43 (50,6%)

0,035

НД

НД

0,44 [0,20-0,98]

Аллели: Cys

Ser

81 (36,5%)

131 (63,5%)

50 (29,4%)

120 (60,6%)

0,045

0,045

0,67 [0,44-0,99]

1,47 [1,01-2,25]

Полиморфный маркер 4a/4b гена NOS3

Генотипы: 4b|4b

4а\4b

  4а\4а

78 (45,3%)

87 (50,6%)

7 (4,1%)

25 (27,2%)

64 (69,6%)

3 (3,3%)

0,002

0,002

НД

0,46 [0,27-0,78]

2,16[1,29-3,60]

Аллели:  4b

  4a

243 (70,6%)

101 (29,4%)

114 (62,0%)

70 (38,0%)

НД

НД

Полиморфный маркер A1166C гена AT2R1

Генотипы: АА

  АС

  СС

40 (38,1%)

50 (47,6%)

15 (14,3%)

33 (46,5%)

35 (49,3%)

3 (4,2%)

НД

НД

0,024

0,33 [0,12-0,90]

Аллели

А

С

130 (61,9%)

80 (38,1%)

101 (70,1%)

43 (29,9%)

НД

НД

Для оценки независимости влияния клинических и генетических факторов на риск развития МС был проведен регрессионный анализ (табл. 8). 

При многофакторном анализе оказалось, что единственным фактором независимо и достоверно связанным с более высоким риском развития МС оказалось наличие в генотипе аллеля Ala  полиморфного маркера Pro12Ala  гена PPARG2.

Таблица 8. Клинические и генетические факторы, независимо влияющие на риск развития МС

Фактор

OR (однофакторный анализ)

р

OR (многофакторный анализ)

р

Мужской пол

2,8 [1,75-4,62]

0,0001

НД

Возраст

1,05  [1,03-1,08]

0,001

НД

Длительность АГ

1,04 [1,01-1,07]

0,007

НД

Аллель 4а полиморфного маркера 4a/4b гена NOS3

2,22 [1,28-3,85]

0,004

НД

Аллель Ala полиморфного маркера Pro12Ala гена PPARG2

1,59 [1,01-2,71]

0,047

1,75[1,11-3,02]

0,037

Полиморфизм генов-кандидатов и поражение органов-мишеней при ГБ

Изучение ассоциации генов-кандидатов с развитием гипертрофии миокарда левого желудочка

Среди обследованных больных артериальной гипертонией у 137 человек выявлена гипертрофия миокарда левого желудочка, у 106 пациентов признаков ГЛЖ не было. Пациенты с ГЛЖ были старше, женщин среди них было больше чем мужчин. Больные артериальной гипертонией с ГЛЖ имели большую длительность АГ (16,75±1,1 против 10,9±0,92 лет, p<0,001), более высокие цифры максимального САД, ДАД и привычного САД. Степень тяжести АГ у больных с ГЛЖ и без нее достоверно не отличалась. Больные с ГЛЖ чаще страдали ИБС, однако длительность ИБС у пациентов с ГЛЖ и без нее достоверно не отличалась. Больные с ГЛЖ достоверно не отличались индексу массы тела, наличию в анамнезе НМК, сахарного диабета, отягощенной наследственности, биохимическим параметрам.

Генотип 4b/4b полиморфного маркера 4a/4b гена NOS3 оказался протективным в отношении развития ГЛЖ. Наличие в генотипе аллеля 4а гена NOS3 увеличивало риск развития ГЛЖ (табл. 9).

Таблица 9.  Частота аллелей и генотипов полиморфных маркеров гена NOS3, у больных с наличием и отсутствием ГЛЖ

Нет ГЛЖ

n= 106

Есть ГЛЖ

n= 137 

р

OR

Полиморфный маркер 4a/4b гена NOS3

Генотипы

4b/4b

4b/4a

4a/4a

36 (53,7%)

30 (44,8%)

1 (1,5%)

38 (33,3%)

72 (63,2%)

4 (3,5%)

0,005

0,012

НД

0,43 [0,23-0,79]

2.10 [1,14-3,86]

Аллели

4b

4a

102 (76,1%)

32 (23,9%)

148 (64,9%)

80 (35,1%)

0,016

0,016

0,59 [0,37 – 0,93]

1,68 [1,07-2,62]

Для оценки независимости влияния клинических и генетических факторов на риск гипертрофии миокарда ЛЖ был проведен регрессионный анализ (табл. 10).

Таблица 10. Клинические и генетические факторы, независимо влияющие на риск развития ГЛЖ

Фактор

OR (однофакторный анализ)

р

OR (многофакторный анализ)

р

Мужской пол

2,59 [1,86-5,72]

0,0001

НД

Возраст

1,09  [1,02-1,14]

0,0001

1,09 [1,06-1,13]

0,001

Максимальный уровень САД

1,03 [1,01-1,06]

0,001

НД

Аллель 4а полиморфного маркера 4a/4b гена NOS3

2,32 [1,34-4,11]

0,008

2,23  [1,09-4,58]

0,028

При многофакторном анализе оказалось, что независимыми  предикторами риском развития ГЛЖ  у больных с АГ оказалось наличие в генотипе аллеля 4а  полиморфного маркера 4a/4b гена NOS3 и возраст больных.

Клинические и генетические предикторы диастолической дисфункции левого желудочка

У 168 больных в обследованной нами группе была изучена диастолическая функция левого желудочка, под которой понимали соотношение Е/А<1 при IVRT>80 мс. У 103 больных были выявлены признаки диастолической дисфункции. По основным факторам риска группы больных были сопоставимы. Больных с диастолической дисфункцией ЛЖ были старше (62,04±0,99 лет и 56,03±1,42 лет, р=0,001), имели более высокий уровень максимального(202,3±3,20 мм рт.ст. и  191,6±3,56 мм рт.ст., р=0,027)  и привычного (141,4±1,69 мм рт.ст. и 135,7±2,25 мм рт.ст., р=0,042) систолического АД  и триглицеридов (2,25±0,12 ммоль/л и 1,71±0,12 ммоль/л, р=0,004). По остальным клиническим характеристикам  и получаемой терапии достоверных различий между группами выявлено не было.

Таблица 11. Частота аллелей и генотипов полиморфных маркеров генов, ассоциированных с  диастолической дисфункцией ЛЖ

Больные с АГ без диастолической дисфункции ЛЖ (n=65)

Больные с АГ и диастолической дисфункцией ЛЖ (n=103)

р

OR

Полиморфный маркер A(-153)G гена AT2R1

Генотипы

AA

AG

GG

25 (40,3%)

29 (46,8%)

8 (12,9%)

23 (69,7%)

9 (27,3%)

1 (3,0%)

0,005

0,05

НД

2,23 [1,02-5,26]

0,31 [0,13-0,71]

Аллели

A

G

79 (63,7%)

45 (36,3%

55 (83,3%)

11 (16,7%)

0,003

0,003

2,55 [1,33-4,91]

0,39 [0,20-0,75]

Полиморфный маркер  А1298С гена MTHFR

Генотипы

AA

AC

CC

15 (37,5%)

24 (60,0%)

1 (2,5%)

16 (21,3%)

47 (62,7%)

12 (16,0%)

НД

НД

0,023

3,79 [1,13-12,69]

Аллели

A

C

54 (67,5%)

26 (32,5%)

79 (52,6%)

71 (47,4%)

0,02

0,02

0,54 [0,31-0,94]

1,83 [1,05-3,17]

Для оценки независимости влияния клинических и генетических факторов на риск развития диастолической дисфункции миокарда у больных с артериальной гипертонией был проведен регрессионный анализ (табл. 12).

Независимыми предикторами развития диастолической дисфункции миокарда оказались возраст пациентов, генотип АА  полиморфного маркера A(-153)G гена AT2R1 и  аллеля С полиморфного маркера А1298С гена MTHFR. Уровень САД оказывал влияние на развитие диастолической дисфункции, но это влияние не было независимым. Оба полиморфных маркера,  включенные в многофакторный анализ, были связаны с уровнем АД и степенью тяжести АГ.

Таблица 12. Клинические и генетические факторы, независимо влияющие на развитие диастолической дисфункции миокарда левого желудочка у больных с ГБ

Фактор

OR (однофакторный анализ)

р

OR (многофакторный анализ)

р

Возраст

1,05 [1,02-1,08]

0,001

1,06 [1,003-1,126]

0,039

Максимальное САД

1,01 [1,00-1,02]

0,033

НД

Привычное САД

1,02 [1,00-1,04]

0,045

НД

Генотип АА полиморфного маркера A(-153)G гена AT2R1

2,85 [1,32-6,17]

0,007

2,61 [1,09-6,26]

0,031

Aллель С полиморфного маркера А1298С гена MTHFR

2,4 [1,2-4,8]

0,013

3,45 [1,33-8,97]

0,011

Ассоциация атеросклероза сонных артерий у больных ГБ с полиморфизмом генов-кандидатов

Измерение толщины комплекса интима-медиа сонных артерий было проведено у  92 больных. 44 больных имели ТИМ менее 0,9 мм и у 48  больных было выявлено утолщение ТИМ. Больные, имеющие утолщение ТИМ сонных артерий были старше (62,6±1,28 лет и  53,6±1,65 лет, р=0,001) имели достоверно больший ИММЛЖ  (127,9±4,97 г/м2 и  107,0±3,06 г/м2 , р=0,001) и имели тенденцию к более высоким значениям САД (привычным и максимальным).

В табл. 13 представлены частоты аллелей и генотипов полиморфных маркеров, ассоциированных с увеличением ТИМ сонных артерий. Ассоциация была выявлена для генов AT2R1, APOB, APOE, PON1. Частоты аллелей и генотипов других изученных генов-кандидатов у больных с нормальной и увеличенной ТИМ сонных артерий достоверно не отличались.

Таблица 13. Частота аллелей и генотипов полиморфных маркеров генов, ассоциированных с  увеличением ТИМ сонных артерий


Больные с ТИМ<0,9 мм артерий (n=44)

Больные c ТИМ>0,9 мм (n=48)

р

OR

Полиморфный маркер A(-153)G гена AT2R1

Генотипы

AA

AG

GG

20(62,5%)

8 (25,0%)

4 (12,5%)

26 (81,2%)

6 (18,8%)

0

НД

НД

НД

Аллели

A

G

48 (75%)

16 (25%)

58(90,6%)

6 (9,4%)

0,016

0,016

2,97 [1,19-7,41]

0,33 [0,18-0,83]

Полиморфный маркер I/D гена АроВ

Генотипы

I/I

I/D

D/D

8 (16,7%)

38 (79,2%)

2 (4,2%)

20 (43,5%)

22 (47,8%)

2 (8,7%)

0,002

0,003

НД

3,83[1,58-9,28]

0,22 [0,12-0,65]

Аллели

I

D

54 (56,3%)

42 (43,7%)

62 (70,5%)

26 (29,5%)

0,03

0,03

1,83[1,01-3,83]

0,54[0,26-0,99]

Полиморфный маркер Е2/Е3/Е4 гена АроЕ

Генотипы

Е2/Е2

Е2/Е3

Е2/Е4

Е3/Е3

Е3/Е4

Е4/Е4

4 (9,5%)

6 (14,3%)

2 (4,8%)

22 (52,4%)

8 (19,0%)

0

0

2 (4,2%)

2 (4,2%)

36 (75%)

6(12,5%)

2 (4,2%)

0,04

НД

НД

0,02

НД

НД

0,11[0,01-0,81]

3,12[1,29-7,51]

Аллели

Е2

Е3

Е4

16(19,0%)

58(69,0%)

10 (12,0%)

4 (4,2%)

80 (83,3%)

12 (12,5%)

0,001

0,018

НД

0,05[0,03-0,10]

2,21[1,01-4,41]

Полиморфный маркер Cys311Ser гена PON2

Генотипы

Cys/Cys

Cys/Ser

Ser/Ser

8 (15,4%)

14 (26,9%)

30(57,7%)

4 (6,9%)

32 (55,2%)

22(37,9%)

НД

0,002

0,03

3,32[1,48-6,72]

0,45[0,22-0,96]

Аллели

Cys

Ser

30 (28,8%)

74 (71,2%)

40 (34,4%)

76 (65,6%)

НД

НД

Для оценки независимости влияния клинических и генетических факторов на увеличение ТИМ сонных артерий был проведен регрессионный анализ (табл. 14). 

Таблица 14. Клинические и генетические факторы, независимо влияющие на риск развития атеросклероза сонных артерий

Фактор

OR (однофакторный анализ)

р

OR (многофакторный анализ)

р

Возраст

1,1  [1,08-1,34]

0,001

НД

ИММЛЖ

1,03[1,01-1,05]

0,002

НД

Генотип АА полиморфного маркера A(-153)G гена AT2R1T

1,24[0,89-1,54]

НД

Генотип II гена  АРОВ

3,84 [1,01-14,8]

0.049

5,01  [1,08-23,2]

0,039

Генотип Е3|Е3 гена АРОЕ

1,35[0,20-9,01]

НД

Генотип Ser/Ser полиморфного маркера Cys311Ser гена PON2

0,83[0,37-1,84]

НД

При многофакторном анализе оказалось, что независимым  предиктором развития утолщения ТИМ сонных артерий  у больных с АГ оказался  генотип II  полиморфного маркера I/D гена APOB.

Нарушение эндотелиальной регуляции тонуса сосудов  и полиморфизм генов-кандидатов

Состояние эндотелиальной регуляции сосудистого тонуса было изучено неинвазивным методом у 138 больных. Наличие эндотелиальной дисфункции устанавливали при увеличении диаметра лучевой артерии в ответ на реактивную гиперемию менее, чем на 10%. Из всех обследованных больных с АГ признаки эндотелиальной дисфункции были выявлены у 105 больных. У 33 больных с АГ сосудодвигательная функция  была сохранена.  Больные, имеющие признаки нарушения эндотелиальной регуляции тонуса сосудов имели более низкий уровень холестерина ЛВП (1,01±0.029 ммоль/л и 1,16±0,065 ммоль/л, р=0,02), более высокий уровень привычного САД (137,5±1,62 мм рт.ст. и 133,3±2,50 мм рт.ст., р=0,048) и достоверно больший ИММЛЖ (150,5±4,33 г/м2 и 143,2±5,72 г/м2, р=0,036).  По другим клиническим характеристикам больные с сохраненной и нарушенной функцией эндотелия не отличались.

Таблица 15. Частота аллелей и генотипов полиморфных маркеров  генов, ассоциированных с нарушением эндотелиальной регуляции сосудистого тонуса.

Больные с сохрененной  эндотелиальной регуляцией тонуса сосудов (n=33)

Больные с нарушением  эндотелиальной регуляцией тонуса сосудов (n=105)

р

OR

Полиморфный маркер C-344T гена CYP11B2

Генотипы

СС

СТ

ТТ

8 (24,2%)

21 (63,6%)

4 (12,1%)

21 (21,0%)

49 (49,0%)

30 (30,0%)

НД

НД

0,031

2,54[1,03-6,24]

Аллели

С

Т

37(42,1%)

29 (57,9%)

91 (45,5%)

109 (54,5%)

НД

НД

Полиморфный маркер Met55Leu гена PON1

Генотипы

Met/Met

Met/Leu

Leu/Leu

7(58,3%)

3 (25,0%)

2 (16,7%)

28 (65,1%)

15(34,9%)

0

НД

НД

0,04

0,01[0,003-0,31]

Аллели

Met

Leu

17(70,8%)

7 (29,2%)

71(82,5%)

15 (17,5%)

НД

НД

Полиморфный маркер Ala148Gly гена PON2

Генотипы

Ala/Ala

Ala/Gly

Gly/Gly

5 (17,9%)

19 (67,9%)

4 (14,3%)

39 (42,4%)

44 (47,8%)

9 (9,8%)

0,014

0,049

НД

2,85[1,18-6,83]

0,45[0,18-0,98]

Аллели

Ala

Gly

29(51,8%)

27(48,2%)

122 (66,3%)

62 (33,7%)

НД

НД

Полиморфный маркер Cys311Ser гена PON2

Генотипы

Cys/Cys

Cys/Ser

Ser/Ser

8 (28,6%)

15 53,69%)

5 (17,9%)

14 (15,9%)

34(38,6%)

40 (45,5%)

НД

НД

0,007

3.16[1,32-7,54]

Аллели

Cys

Ser

31 (55,4%)

25(44,6%)

62 (35,2%)

114 (64,8%)

0,006

0,006

0,43 [0,23-0,80]

2,30[1,24-4,25]

Для оценки независимости влияния клинических и генетических факторов на риск развития нарушения эндотелиальной регуляции тонуса сосудов был проведен регрессионный анализ (табл. 16).

Таблица 16 Клинические и генетические факторы, независимо влияющие на риск развития нарушения эндотелиальной регуляции тонуса сосудов

Фактор

OR (однофакторный анализ)

р

OR (многофакторный анализ)

р

Привычное САД

0,98[0,95-1,01]

НД

ИММЛЖ

0,99[0,98-1,01]

НД

Уровень холестерина ЛВП

3,82[1,16-12,51]

0.027

4,34[1,05-18,75]

0,049

Генотип ТТ полиморфного маркера С-344Т гена CYP11B2

3,10 [1,04-9,61]

0.049

3,65  [1,09-13,81]

0,046

Генотип Leu/Leu полиморфного маркера Leu55Met гена PON1

1,94[0,66-5,73]

НД

Генотип  Ala/Ala полиморфного маркера Ala148Gly гена PON2

2,04[1,03-4,02]

0,039

НД

Генотип Ser311Ser полиморфного маркера Cys311Ser гена PON2

3,47[1,25-5,57]

0,014

НД

При многофакторном анализе оказалось, что независимыми  предикторами риска развития эндотелиальной дисфункции  у больных с АГ оказался  генотип ТТ  полиморфного маркера С-344Т  гена CYP11B2 и уровень холестерина липопротеинов высокой плотности.

Ассоциация гипертонической нефропатии с полиморфизмом генов-кандидатов

Для оценки поражения почек при ГБ  было обследовано 93 больных (52 женщины и 41 мужчина). Средний возраст больных – 58,3±1,12 лет, средняя длительность ГБ на момент обследования – 15,6±1,16 лет. Больные с симптоматической АГ и сахарным диабетом в исследование не включались.

В обследованной группе было 44 больных с микроальбуминурией и 49 больных без признаков поражения почек. У больных с микроальбуминурией оказался достоверно выше уровень систолического (141,6±1,03 мм рт.ст. и  134,5±1,84  мм.рт.ст., р=0,011) и диастолического (86,7±1,71  мм рт.ст. и 83,4±1,25  мм рт.ст., р=0,028) АД. По полу, возрасту, длительности заболевания, уровню гликемии группы достоверно не отличались. Больные с микроальбуминурией имели достоверно более высокий уровень холестерина крови (5,71±0,206 ммоль/л и 6,96±0,234 ммоль/л, р=0,020).

Таблица 17. Частоты аллелей и генотипов генов-кандидатов у больных ГБ  с наличием и отсутствием микроальбуминурии

Нет микроальбуминурии

n= 49

Есть микроальбуминурия

n= 44 

р

OR

Полиморфный маркер A(-153)G гена AT2R1

Генотипы

AA

AG

GG

18 (52,9%)

16 (47,1%)

0 (0%)

36 (85,7%)

2 (4,8%)

4 (9,5%)

0,031

0,031

НД

4,71[1,78-12,97]

0,20[0,07-0,56]

Аллели

A

G

52 (76,4%)

16 (22,6%)

74 (88,1%)

10 (11,9%)

Нд

Нд

Как видно из таблицы 17  у больных с наличием и отсутствием  микроальбуминурии достоверно отличались только частоты генотипов полиморфного маркера A(-153)G гена AT2R1. При проведении многофакторного регрессионного анализа оказалось, что независимыми факторами, связанными с развитием микроальбуминурии были уровень систолического АД и носительство генотипа АА полиморфного маркера A(-153)G гена AT2R1 (рис. 4).

Рис. 4. Независимые факторы риска развития микроальбуминурии у больных гипертонической болезнью

Опыт изучения этнических различий в  клинических и генетических особенностях течения ГБ

Нами было обследовано 76 больных - жителей Якутии якутской национальности, 116 больных ГБ - жителей Москвы русской национальности. Критерии включения больных с ГБ в московскую группу были одинаковы с якутской группой.  Больных ГБ жителей Якутии было 76 - 35 (46,1%) мужчин и 41 (53,9%) женщина. Средний возраст больных - 48,38±0,71 лет. Московская группа включала в себя 116 пациентов: 70 (60,3%) мужчин, 46 (39,7%) женщин. Средний возраст пациентов  48,57±0,68 лет был сопоставим с возрастом основной группы больных ГБ – жителей Якутии.

У больных якутской группы были изучены 3 полиморфных маркера: A7831G гена ACE, 4a/4b гена NOS3 и Lys198Asn гена EDN1 Основные клинические характеристики больных якутской и московской групп  представлены в табл. 18.

Московская и якутская группы были сопоставимы по возрасту, длительности ГБ и полу больных. В якутской группе оказалось при этом достоверно больше больных с 3-ей степенью ГБ  (84,2% против 59,5%; р=0,004). Якутские пациенты имели достоверно выше показатели максимального САД (193,58±2,53 против 186,35±2,75; р=0,012). В группе якутских больных было достоверно больше: перенесших НМК (13,1% против 2,5%; р=0,017), с мультифокальным атеросклерозом (28,9% против 17,2%; р<0,001), с сопутствующей ИБС (52,6% против 35,3%; р=0.048). В московской группе было достоверно больше курильщиков (р=0,029).

Сравнение основных эхокардиографических характеристик миокарда ЛЖ у больных московской и якутской группы представлено в табл. 19. Выявлено, что в московской группе достоверно большей оказалась ТМЖП (р=0,001). У якутских больных достоверно выше зарегистрированы показатели ФВ (70,54±0,69 против 59,22±0,74; р<0,001), Еmax (86,11±2,44 против 70,03±1,78; р<0,001). По показателям ММЛЖ и толщине задней стенки ЛЖ обе группы больных достоверно не различались.

Таблица 18. Клиническая характеристика якутской и московской  групп больных ГБ

Показатели

Якутская

группа

n =76

Московская

группа

n =116

р

Возраст, годы

48,38±0,71

48,57±0,68

НД

Пол (м/ж)

35/41

70/46

0,052

Индекс массы тела, кг/м2

29,13±0,51

30,35±0,51

НД

Индекс массы тела более 25 кг/м2

63(82,8%)

96(82,8%)

НД

I ст.

II ст.

III ст.

4(5,3%)

8(10,5%)

64(84,2%)

10(8,6%)

34(29,3%)

69(59,5%)

0,004

Длительность ГБ к моменту обследования, годы

12,08±0,92

10,41±0,80

НД

Сопутствующая ИБС

40(52,6%)

41(35,3%)

0,048

Сахарный диабет

8(10,5%)

11(9,5%)

НД

НМК в анамнезе

10(13,1%)

3(2,5%)

0,017

Наличие атеросклероза других локализаций

22(28,9%)

20(17,2%)

<0,001

Курение

13(17,1%)

34(29,3%)

0,029

Макс. САД,мм рт.ст.

193,58±2,53

186,35±2,75

0,012

Макс. ДАД,мм рт.ст.

113,55±1,49

110,57±1,51

НД

Привычное САД,

мм рт.ст.

135,63±1,33

137,21±1,64

НД

Привычное ДАД,

мм рт.ст.

87,22±1,03

86,33±0,91

НД

Таблица 19. Сопоставление якутской и московской групп больных ГБ по данным эхокардиографии

Показатель

Якутская группа (n=76)

Московская группа (n=114)

          1. р

ТЗС ЛЖ, см

1,00±0,02

1,11±0,01

0,001

ТМЖП, см

1,09±0,03

1,11±0,02

0,006

ФВ, %

70,54±0,69

59,22±0,74

<0,001

ММЛЖ, г

231,33±10,01

241,26±8,55

НД

ИММЛЖ, г/м2

127,83±4,96

120,10±3,78

НД

Emax, см/сек

86,11±2,44

69,39±1,98

<0,001

Amax, см/сек

84,19±2,59

70,03±1,78

<0,001

При анализе частот генотипов генов-кандидатов было выявлено, что ЛЖ в популяции Якутии ассоциирована с полиморфизмом гена NOS3 (рис. 5). Частоты аллелей и генотипов других полиморфных маркеров достоверно не отличались у больных с и без ГЛЖ. 

Рисунок 5. Распределение генотипов полиморфного маркера eNOS 4a/4b гена NOS3 у пациентов с ГЛЖ и без ГЛЖ

Сопоставление параметров диастолической функции миокарда с полиморфизмом изученных генов, выявило ассоциацию диастолической дисфункции с полиморфизмом гена ACE.  При сравнении основных допплерографических параметров у больных с различными генотипами полиморфного маркера G7831A гена ACЕ было выявлено, что больные, имеющие в генотипе аллель G имели достоверно более низкий показатель Е/А по сравнению с гомозиготными носителями аллеля А 1,01±0,036 против 1,20±0,69;  р=0,031). Частоты генотипов полиморфного маркера G7831A гена ACЕ у больных с нарушенной и сохраненной диастолической функцией ЛЖ  достоверно не различались.

При сопоставлении распределения частот генотипов полиморфного маркера G7831A  гена  ACE среди больных московской и якутской групп достоверных различий не выявлено: у якутов GG  -  27,1%; GA - 61,4%; AA - 11,5%; в московской группе GG – 41,7%; GA – 42,8%; AA – 15,5%. Частота генотипов полиморфного маркера Lys198Asn  гена EDN1 в якутской группе: Lys/ Lys – 74,3%, Lys /Asn и Asn/Asn – 25,7%; в московской  - Lys/ Lys – 46,1%, Lys /Asn – 53,9%, Asn/Asn – 0%,  р=0,007. Генотипы Lys/ Lys гена EDN1 встречались достоверно чаще в группе больных якутской национальности (рис.6). 

Рис. 6. Сопоставление распределения частот генотипов полиморфного маркера Lys198Asn гена EDN1среди больных ГБ  якутской и московской групп

В якутской группе частота носителей генотипов гена NOS3 распределилось следующим образом: 4а/4а - 1,5%; 4а/4в – 29,9%; 4в/4в – 68,7%. В московской группе это распределение было иным: 4а/4 а- 1,4%, 4а/4в – 51,9%; 4в/4в – 46,7%, (р=0,027) (рис. 7). Таким образом, по нашим данным, носители генотипа 4в/4в гена NOS3 достоверно чаще встречались среди группы больных ГБ якутской национальности.

Рис. 7. Сопоставление распределения частот генотипов полиморфного маркера 4a/4b гена NOS3 у больных ГБ московской и якутской группы

Изучение генетических аспектов индивидуальной чувствительности к бетаксололу

Протокол исследования

В исследование вошли больные ГБ с АГ соответствующей  1 и 2 степени тяжести. Продолжительность лечения составила 28 дней. Начальная доза бетаксолола составляла 10 мг/сут, при неэффективности (сохранении АД выше 140/90 мм рт.ст.) через 2 недели доза препарата удваивалась. Исходно проводилось взятие крови для генетического анализа, измерение АД, суточное мониторирование АД и ЭКГ и выполнялся нагрузочный тест на тредмиле. Нагрузочный тест и контроль АД, мониторирование АД и ЭКГ повторялись на 28 день терапии. Всего в обследованной группе было 35 мужчин и 46 женщин. 39 имели ГБ 1 степени тяжести и 42 больных – 2 степени тяжести. Средний возраст составил 52,2±1,22 года. Больные не имели сопутствующей ишемической болезни сердца и сахарного диабета, не переносили инфарктов миокарда и НМК.

Гипотензивная эффективность бетаксолола у больных ГБ

Бетаксолол в виде монотерапии был эффективен (т.е. позволил снизить АД ниже 140/90 мм рт.ст.) у 68 (83,9%) больных. В конце лечения 56 больных продолжали принимать препарат в дозе 10 мг/сут., 25 больных принимали бетаксолол в дозе 20 мг/сут.

В конце исследования отмечалось достоверное снижение и систолического и диастолического АД. САД снизилось на 11,8±2,47 мм рт.ст. (p=0,001), ДАД – на 7,8±1,68 мм рт.ст. (p=0,001). ЧСС в покое снизилась на 19,8±1,96 уд/мин р=0,0001. На фоне терапии бетаксололом отмечалось достоверное уменьшение САД, ДАД, ЧСС, измеренных как в покое, так и на фоне максимума нагрузки. Отмечалась тенденция к увеличению общего времени нагрузки. Достоверно уменьшилось время восстановления после нагрузочного теста.

Анализ параметров суточного мониторирования АД выявил достоверное снижение средних показателей САД, ДАД, ЧСС за сутки и в в течении дня. Достоверно уменьшились также индексы времени САД и ДАД за сутки и в дневное время. На фоне лечения бетаксололом не отмечено достоверного изменения суточного ритма АД и вариабельности АД.

При анализе влияния терапии бетаксололом на ЧСС по данным холтеровского мониторирования оказалось, что при однократном назначении в сутки достоверно уменьшает ЧСС за сутки (с 75,71±2.659 уд/мин до 61,10±1,630 уд/мин, р=0,0001), в дневное (с 82,14±2,980 уд/мин до 65,95±1,828 уд/мин, р=0,0001) ночное время (с 65,29±2,555 уд/мин до 56,14±1.903 уд/мин, р=0,0001) и в утренние часы (с 78,41±2,889 уд/мин до 64,06±1,655 уд/мин, р=0,001). Достоверно уменьшались и максимальные и минимальные значения ЧСС.

Отдельно нами была проанализирована дисперсия гипотензивного и отрицательного хронотропного эффекта бетаксолола. При среднем снижении САД на 11,8±2,47 мм рт.ст., у 19 больных не отмечено снижения САД на фоне терапии, у 5 больных, наоборот, отмечено очень выраженное снижение САД – на 30 и более мм рт.ст. Среднее снижение ЧСС 19,8±1,96 уд/мин. У 5 больных ЧСС на фоне приема бетаксолола не уменьшалась, а у 11 больных отмечалось выраженное уменьшение ЧСС на фоне лечения (на 30 и более уд/мин). Среднее уменьшение ЧСС за сутки по данным холтеровского мониторирования ЭКГ составило -15,2 уд/мин, при этом в группе снижение ЧСС колебалось от -3 уд/мин до -29 уд/мин. По данным СМАД среднее снижение САД за сутки составило -5,36 мм рт.ст. с размахом колебаний на 58 мм рт.ст., среднее снижение ДАД за сутки – на 6,27 мм рт.ст. с размахом 37 мм рт.ст..

Генетические аспекты индивидуальной чувствительности к бетаксололу

У больных в обследованной группе провели определение генотипов полиморфного маркера Gly389Arg гена ADRB1. Распределение частот генотипов оказалось следующим – Arg/Arg – 57 больных (70,4%), Arg/Gly – 19 больных (23,5%), Gly/Gly – 5 больных (6,2%). В обследованной группе оказалось 7 носителей генотипа Pro/Ser полиморфного маркера Pro34Ser гена CYP2D6, гомозиготных носителей аллеля Pro не было.

Исходные значения и  динамика САД, ДАД, ЧСС как в покое, так и при нагрузке у больных с разными генотипами полиморфного маркера гена Gly389Arg гена ADRB1 достоверно не отличались.

У носителей генотипа Ser/Pro полиморфного маркера Pro34Ser гена CY2D6 отмечалось достоверно более значимое уменьшение ЧСС на фоне лечения бетаксололом по сравнению с носителями генотипа Ser/Ser – в покое - -32.6±4.77 уд/мин и -18.4±2.01 уд/мин соотв. (р=0,023); на максимуме физической нагрузки - -30,1±3,05 уд/мин и - 24,0±2,59 уд/мин (р=0,043). У этих же больных отмечалось более выраженное снижение ДАД при максимальной нагрузке и более значимый прирост продолжительности нагрузки на фоне лечения.

У носителей генотипа Ser/Pro выявлено достоверно более выраженное снижение среднего САД в дневное время при лечении бетаксололом (рис. 8).

Рис. 8. Снижение среднего САД за день при СМАД на фоне лечении бетаксололом у больных с разными генотипами полиморфного маркера Pro34Ser гена CYP2D6

При этом отмечалось  более выраженное уменьшение ЧСС в дневное время и в утренние часы по данным холтеровского мониторирования ЭКГ (рис. 9).

Рис. 9. Снижение ЧСС при суточном мониторировании ЭКГ на фоне лечении бетаксололом у больных с разными генотипами полиморфного маркера Pro34Ser гена CYP2D6

Выводы

1. У больных ГБ с отягощенным семейным анамнезом заболевание начинается в более молодом возрасте и отличается более высоким уровнем АД. Раннее начало ГБ ассоциирован с носительством генотипа ТТ полиморфного маркера С825Т гена GNB3 и  генотипа AA полиморфного маркера A(-153)G гена AT2R1.

2. При многофакторном регрессионном анализе уровень АД  3 степени тяжести оказался ассоциирован с  длительностью заболевания и наличием в генотипе аллеля Ala полиморфного маркера Pro12Ala гена PPARG2 Защитным в отношении тяжести артериальной гипертонии было наличие в генотипе аллеля G полиморфного маркера A(-153)G гена AT2R1. У больных с отягощенным семейным анамнезом более высокий уровень АД был связан с носительством алелля Asn полиморфного маркера Lys198Asn гена EDN1, аллеля 4a полиморфного маркера 4a/4b гена NOS3, генотипа ArgArg полиморфного маркера  Gln192Arg гена PON1, аллеля Т полиморфного маркера С825Т гена GNB3 и генотипа АА полиморфного маркера A(-153)G гена AT2R1. У больных ГБ с неотягощенным семейным анамнезом высокий уровень АД оказался ассоциирован только с носительством аллеля Ala полиморфного маркера Pro12Ala гена PPARG2.

3. У больных с ГБ III стадии меньше частота генотипа Е3/Е3 полиморфного маркера Е2/Е3/Е4 гена АроЕ и выше частота  аллеля С полиморфного маркера А1298С гена MTHFR и аллеля Ala полиморфного маркера  Ala(-9)Val гена SOD2. Эти различия определяются меньшей частотой генотипа Е3/Е3 гена ApoЕ у больных с НМК и более высокой частотой аллеля С гена MTHFR и аллеля Val гена SOD2 у больных с ИМ в анамнезе.

4. Высокий риск развития МС ассоциирован с наличием в генотипе аллеля Ala полиморфного маркера Pro12Ala гена PPARG2.

5. В русской московской популяции у больных с ГБ развитие ГЛЖ ассоциировано с наличием в генотипе аллеля 4а  полиморфного маркера 4a/4b гена NOS3. Независимыми предикторами развития диастолической дисфункции миокарда оказались возраст пациентов, генотип АА полиморфного маркера A(-153)G гена AT2R1 и  аллель С полиморфного маркера А1298С гена MTHFR.

6. Увеличение ТИМ сонных артерий  у больных с ГБ ассоциировано с носительством генотипа II  полиморфного маркера I/D гена APOB.

7. Независимыми  предикторами риска развития эндотелиальной дисфункции  у больных с ГБ оказался  генотип ТТ  полиморфного маркера С-344Т  гена CYP11B2 и уровень холестерина липопротеинов высокой плотности.

8. Микроальбуминурия у больных ГБ ассоциирована с наличием в генотипе пациента аллеля А полиморфного маркера A(-153)G гена AT2R1

9. Больные ГБ якутской популяции отличаются более тяжелым течением заболевания и сопутствующими факторами риска от сопоставимых по возрасту и длительности ГБ больных – жителей Москвы. У больных ГБ – жителей Якутии отмечена большая частота носительства генотипа Lys/Lys гена EDN1 и генотипа 4b/4b гена NOS3 по сравнению с больными ГБ - жителями Москвы. При этом, по распределению частот генотипов полиморфного маркера G7831A гена ACE якутские и московские больные ГБ достоверно не различались

10. Аллель 4а полиморфного маркера eNOS4a/4в гена NOS3 ассоциирован с риском развития ГЛЖ у больных ГБ как в якутской, так и в московской популяции.  Аллель G полиморфного маркера G7831A гена ACE,  генотип Lys/Lys  полиморфного маркера Lys198Asn гена EDN1 и генотип 4в/4в гена NOS3 ассоциированы с формированием диастолической дисфункции левого желудочка I типа у больных ГБ – жителей Якутии, в то время как в московской популяции эти генетические маркеры с формированием диастолической дисфункции не связаны.

11. У больных с артериальной гипертонией 1 и 2 степени монотерапия бетаксололом эффективна в отношении снижения АД и уменьшения ЧСС, однако отмечается большая дисперсия эффективности препарата внутри группы. У больных, имеющих в генотипе аллель Pro полиморфного маркера Pro34Ser гена CYP2D6, терапия бетаксололом более эффективна, чем у гомозиготных носителей аллеля Ser, что может быть связано с низкой скоростью метаболизма препарата у этих больных. Не удалось выявить ассоциацию между генотипом гена ADRB1 и эффективностью гипотензивной терапии бетаксололом у больных ГБ.

Практические рекомендации

Изучение семейного анамнеза позволяет выявить группы лиц, у которых можно ожидать раннего начала ГБ, что требует более частого контроля АД.

Для больных с ГБ проведение генетического исследования может помочь выявить группы высокого риска развития поражения органов-мишеней и сердечно-сосудистых осложнений. Типирование полиморфных маркеров генов AT2R1, PPARG2, NOS3, PON1 EDN1 и GNB3 позволяет выявить группы больных с предрасположенностью к более тяжелому течению ГБ. Полиморфизм генов. SOD2, MTHFR и APOE позволяет выявить среди больных ГБ лиц с предрасположенностью к развитию сердечно-сосудистых осложнений.  Определение полиморфных маркеров генов APOB, CYP11B2, AT2R1, NOS3, MTHFR позволяет выявить больных, склонных к формированию поражения органов-мишеней.

При назначении в качестве гипотензивного препарата  бетаксолола необходимо учитывать большую вариабельность индивидуального ответа. Определение у больного генотипа полиморфного маркера Ser34Pro гена CYP2D6 позволяет отобрать больных, у которых терапия может быть более эффективна. У носителей аллеля Pro можно ожидать более выраженное уменьшение ЧСС и снижение АД на фоне лечения препаратом.

Список публикаций

1. Минушкина Л.О., Затейщиков Д.А., Сидоренко Б.А.. Генетические аспекты регуляции эндотелиальной функции при артериальной гипертонии. Кардиология, 2000 г., №3, С.69-77

2. Затейщиков Д.А., Минушкина Л.О., Кудряшова О.Ю., Чистяков Д.А.,  Носиков В.В., Цимбалова Т.Е., Баринов В.Г., Носенко Е.М., Седов В.П., Сидоренко Б.А. Дисфункция эндотелия: связь с полиморфизмом гена рецептора 1-го типа  ангиотензина II у больных ИБС Российский кардиологический журнал, 1999, №4 приложение, С.54

3. Затейщиков Д.А., Минушкина Л.О., Затейщикова А.А., Чистяков Д.А., Носиков В.В., Сидоренко Б.А..  Полиморфизм гена NO-синтазы и гипертрофия миокарда левого желудочка у больных артериальной гипертонией, Актуальные проблемы артериальной гипертонии. Материалы конференции Москва, 1999. С.121-124

4. Минушкина Л.О., Затейщиков Д.А., Затейщикова А.А., Чистяков Д.А., Носиков В.В., Седов В.П., Сидоренко Б.А., Полиморфизм гена NO-синтетазы: связь с сосудодвигательной функцией эндотелия у больных артериальной гипертонией. Сборник материалов итоговой научно-практической конференции Медицинского центра УД Президента РФ. Москва, 1999. С.96-97

5. Минушкина Л.О., Затейщикова А.А., Затейщиков Д.А., Носенко Е.М., Сидоренко Б.А., Седов В.П.. Семейная гипертония: связь с сосудодвигательной функцией эндотелия. Сборник материалов итоговой научно-практической конференции Медицинского центра УД Президента РФ. Москва, 1999. С.98-100

6. Затейщиков Д.А., Минушкина Л.О., Кудряшова О.Ю., Баринов В.Г., Цимбалова Т.Е., Носенко Е.М., Седов В.П., Сидоренко Б.А. Функциональное состояние эндотелия у больных артериальной гипертонией и ишемической болезнью сердца. Кардиология, 2000 №6 С38-41

7. Затейщикова А.А., Сидоренко Б.А. Воронько О.Е., Кудряшова О.Ю., Минушкина Л.О., Затейщиков Д.А., Носиков В.В. Полиморфные маркеры гена NOS3 и гипертрофия миокарда у больных с артериальной гипертонией. Материалы Всероссийской научно-практической конференции «Современные возможности эффективной профилактики, диагностики и лечения артериальной гипертонии» Москва, 2001 г, С.223.

8. Кудряшова О.Ю., Бабунова Н.Б., Минушкина Л.О., Затейщикова А.А., Затейщиков Д.А.,  Хотченкова Н.В., Бабков А.И., Носиков В.В., Сидоренко Б.А. Состояние ренин-ангиотензин-альдостероновой системы и полиморфизм гена ангиотензиногена у больных с артериальной гипертонией. Материалы Всероссийской научно-практической конференции «Современные возможности эффективной профилактики, диагностики и лечения артериальной гипертонии» Москва, 2001 г, С.41.

9. Минушкина Л.О., Бабунова Н.Б., Затейщикова А.А., Кудряшова О.Ю., Затейщиков Д.А., Носиков В.В., Сидоренко Б.А. Полиморфные маркеры гена ангиотензиногена у пациентов с артериальной гипертонией. Материалы Всероссийской научно- практической конференции «Современные возможности эффективной профилактики, диагностики и лечения артериальной гипертонии» Москва, 2001 г, С.43.

10. Зотова И.В., Минушкина Л.О., Затейщиков Д.А., Затейщикова А.А., Кудряшова О.Ю., Носиков В.В., Сидоренко Б.А.. Полиморфизм гена эндотелиальной NO-синтетазы и гипертрофия миокарда у больных с артериальной гипертонией. Материалы Российского национального конгресса кардиологов. Москва. 2001 г. С.148.

11. Минушкина Л.О., Затейщикова А.А., Кудряшова О.Ю., Затейщиков Д.А., Бабунова Н.Б., Носиков В.В., Хотченкова Н.В., Бобков А.И., Сидоренко Б.А. Полиморфизм гена ангиотензиногена у больных артериальной гипертонией: активность ренина и альдостерона. Материалы Российского национального конгресса кардиологов. Москва. 2001 г. С.256

12. Минушкина Л.О., Затейщиков Д.А., Затейщикова А.А., И.В. Зотова, Кудряшова О.Ю., Носиков В.В., Сидоренко Б.А. Полиморфизм гена эндотелиальной NO-синтетазы и гипертрофия миокарда у больных артериальной гипертонией. Кардиология 2002, №3 с.30-34

13. Бражник В.А., Горашко Н.М., Минушкина Л.О., Затейщиков Д.А., Затейщикова А.А., Носиков В.В., Сидоренко Б.А.. Полиморфные маркеры I/D и G7831A гена фермента, превращающего ангиотензин I, и  гипертрофия миокарда у больных артериальной гипертонией. Кардиология, 2003, №2, с.44-49.

14. Минушкина Л.О., Бабунова Н., Бражник В.А., Затейщиков Д.А., Носиков В.В., Сидоренко Б.А.. Ассоциация полиморфных маркеров гена метилентетрагидрофолатредуктазы с уровнем артериального давления. Кардиология СНГ 2003 г т.1 №1 с.190

15. Минушкина Л.О., Игнатьев И.В., Бражник В.А., Затейщиков Д.А., Носиков В.В., Сидоренко Б.А.. Полиморфный маркер Lys198Asn гена эндотелина 1: ассоциация с тяжестью течения артериальной гипертонии. Кардиология СНГ 2003 г т.1 №1  с.190.

16. Бражник В.А.,  Игнатьев И.В., Минушкина Л.О., Затейщиков Д.А., Затейщикова А.А., Носиков В.В., Сидоренко Б.А.. Полиморфный маркер С-344Т гена альдостеронсинтетазы и гипертрофия миокарда у больных артериальной гипертонией. Кардиология СНГ 2003 г т.1 №1 с. 36.

17. Бражник В.А.,  Игнатьев И.В., Минушкина Л.О., Затейщиков Д.А., Затейщикова А.А., Носиков В.В., Сидоренко Б.А.. Полиморфизм генов рецепторов активируемых пероксисомальным пролифератором и гипертрофия миокарда левого желудочка у пациентов с артериальной гипертонией. Кардиология СНГ 2003 г т.1 №1 с. 36.

18. Минушкина Л.О., Игнатьев И.В., Бражник В.А., Бабунова Н., Затейщиков Д.А., Носиков В.В., Сидоренко Б.А. Полиморфные маркеры генов EDN1, PPARG2 и MTHFR ассоциированы с тяжелым течением артериальной гипертонии. Кардиоваскулярная терапия и профилактика 2003 т2 №3, с.215-216.

19. Бражник В.А., Игнатьев И.В., Минушкина Л.О., Затейщиков Д.А., Затейщикова А.А., Носиков В.В., Сидоренко Б.А. Генетические аспекты гипертрофии миокарда левого желудочка у пациентов с артериальной гипертонией. Кардиоваскулярная терапия и профилактика 2003 т2 №3 с.46

20. Минушкина Л.О., Бражник В.А., Затейщиков Д.А., Игнатьев И.В., Носиков В.В., Сидоренко Б.А.. Генетические предикторы гипертрофии левого желудочка: играет ли роль полиморфизм генов ядерных рецепторов, активируемых пролифератором пероксисом. Кардиология, 2003, №12, с.71-75

21. Романова Т.А., Минушкина Л.О., Сидоренко Б.А.. Факторы риска и тяжесть ишемической болезни сердца у жителей Якутии: связь с полиморфизмом генов-кандидатов. Кардиология,  2003; 11: 40-41

22. Minouchkina l., Ignatiev I., Brazhnik V., Babunova N., Zateyshchikov D., Nosikov V., Sidorenko B. Association of the polymorphic markers of MTHFR, EDN1, CYP11B2, PPARA and PPARG genes with the severity of essential hypertension. Journal of Hypertension 2004, v.22, Suppl 2, p.S342.

23. Кудряшова О.Ю., Горашко Н.М., Бражник В.А.. Затейщиков Д.А., Минушкина Л.О., Носиков В.В., Сидоренко Б.А. Ассоциация полиморфных маркеров UD и  G7831A гена ACE с толщиной комплекса интима-медия и атеросклеротическим поражением сонных артерий у больных с артериальной гипертонией. Кардиоваскулярная терапия и профилактика, 2004 г, т.3, №4, С.263

24. Минушкина Л.О., Бабунова Н.Б., Затейщиков Д.А., Носиков В.В., Сидоренко Б.А. Полиморфный маркер А(-153)G гена рецептора ангиотензина II итипа 1: ассоциация с артериальной гипертонией. Кардиоваскулярная терапия и профилактика, 2004 г, т.3, №4, С.322

25. Минушкина Л.О., Петрова И.Р., Романова Т.А., Антипина В.В., Макарова Е.Р., Затейщиков Д.А., Носиков В.В., Сидоренко Б.А.. Гены ангиотензинпревращающего фермента, NO-синтетазы и эндотелина-1 и гипертрофия миокарда левого желудочка у больных гипертонической болезнью коренных жителей Якутии. Кардиология, 2005, №1, с.41-46.

26. Minouchkina L., Voronko O., Brazhnik V., Yakunina N., Zateyshchikov D., Nosikov V., Sidorenko B. 4A/4B polymorphism OF NOS3 gene and association with left ventricular hypertrophy Journal of Hypertension Volume 23, Supplement 2, June 2005, page S364

27. Minouchkina L., Babunova N., Zateyshchikov D., Nosikov V., Sidorenko B. Association of the A(-135)G polymorphism of AT2R1 gene with severity of essentisl hypertension. Journal of Hypertension Volume 23, Supplement 2, June 2005, page S370

28. Minouchkina L., Petrova I., Brazhnik V., Romanova T., Zateyshchikov D., Sidorenko B. Comparisons of the severity of essential hypertension and parameters of left ventricular hypertrophy in patients from Yakutsk and Moscow region Journal of Hypertension Volume 23, Supplement 2, June 2005, page S291

29. Minouchkina L.O.,  Voronko O.E., Babunova N.V.,  Brazhnik V.A., Yakunina N.Yu.,  Zateyshchikov D.A., Nosikov V.V., Sidorenko  B.A. Genetic predictors of left ventricular hypertrophy and diastolic dysfunction in patients with essencial hypertension. International congress “Hypertension from Korotkov to present days”. Saint-Petersburg 2005  Abstract book, p.87

30. Nosikov V.V., Minouchkina L.O., Ignatiev I.V., Brazhnik V.A., Babunova N.V.,  Zateyshchikov D.A., Sidorenko  B.A. Polymorphic markers of MTHFR, EDN1 CYP11B2, AT2R1, PPARA and PPARG2 genes and severity of essential hypertension. International congress “Hypertension from Korotkov to present days”. Saint-Petersburg 2005  Abstract book, p.97

31. Минушкина Л.О., Воронько О.Е., Бражник В.А., Бабунова Н.Б., Якунина Н.Ю., Затейщиков Д.А., Носиков В.В., Сидоренко Б.А. Генетические факторы риска развития гипертрофии левого желудочка и диастолической функции у пациентов с артериальной гипертонией. Кардиваскулярная терапия и профилактика, 2005, т.4 №4 (приложение) С.216.

32. Носиков В.В., Минушкина Л.О., Игнатьев И.В., Бражник В.А., Бабунова Н.Б., Затейщиков Д.А., Сидоренко Б.А. Генетическая предрасположенность к артериальной гипертонии. Кардиваскулярная терапия и профилактика, 2005, т.4 №4 (приложение) С.241.

33. Минушкина Л.О., Затейщиков Д.А., Сидоренко Б.А. Индивидуальная чувствительность к антигипертензивным препаратам: генетические аспекты Кардиология 2005;7:58—65

34. Zateyshchikov D. A., Nosikov V. V., Brovkin A. N., Minushkina L. O., Nikitin A.G., Sidorenko B.A. Relationship between clinical response to betaxolol (lokren) in Russian patients with essential hypertension and polymorphous markers of ADRB1, CYP1A1, CYP1A2 and CYP2D6 genes. Clinical Chemistry and laboratory medicine 2006 V.44, No8, p.A77-A78

35. Nosikov V. V., Zateyshchikov D. A., Babunova N.V., Minushkina L. O., Ignatiev I.V.,  Sidorenko B. A.. Genetic predisposition to arterial hypertension in Russian patients from Moscow city. Clinical Chemistry and laboratory medicine 2006 V.44, No8, p.A45.

36. Затейщиков Д.А., Минушкина Л.О., Савельева Е.Г.. Бетаксолол: вопросы и ответы. Фарматека, 2006, №8, с.43-46

37. Минушкина Л.О., Носиков В.В., Бражник В.А., Никитин А.Г., Бровкин А.Н., Чудакова Д.А., Шестаков А.Е., Воронько О.Е., Бабунова Н.Б., Затейщиков Д.A., Сидоренко Б.A. Генетическая предрасположенность к артериальной гипертонии Кардиоваскулярная терапия и профилактика 2006 т5 №6 приложение 1, с.236

39. Минушкина Л.О., Никитин А.Г., Савельева Е.С., Бровкин А.Н., Затейщиков Д.А., Носиков В.В. Ассоциация полиморфный маркеров генов ADRB1, CYP1A1, CYP1A2 и CYP2D6 с эффективностью терапии бетаксололом у больных с артериальной гипертонией. Кардиоваскулярная терапия и профилактика 2006 т5 №6 приложение 1, с. 237.

40. Zateyshchikov DA, Minushkina LO, Brovkin AN, Savel'eva EG, Zateyshchikova AA, Manchaeva BB, Nikitin AG, Sidorenko BA, and Nosikov VV Association of CYP2D6 and ADRB1 genes with hypotensive and antichronotropic action of betaxolol in patients with arterial hypertension. Fundam Clin Pharmacol, Aug 2007; 21(4): 437-43

41. Минушкина Л.О., Бражник В.А., Носиков В.В., Затейщиков Д.А.. Ассоциация полиморфного маркера A(-153)G гена AT2R1 с гипертонической нефропатией. Кардиоваскулярная терапия и профилактика 2007, 6 (5) с. 203-204

42. Минушкина Л.О., Савельева Е.Г., Затейщиков Д.А. Эффективность бетаксолола у больных артериальной гипертонией. Кардиоваскулярная терапия и профилактика 2007, 6 (5) с. 204

43. Минушкина Л.О., Никитин А.Г., Бражник В.А., Затейщиков Д.А., Носиков В.В., Сидоренко Б.А. Ассоциация полиморфных маркеров C24313G гена PPARA и Pro12Ala гена PPARG2 с развитием метаболического синдрома Материалы III Всероссийской научно-практической конференции «Актуальные вопросы диагностики и лечения метаболического синдрома» Москва 2006, с.82

44.  Минушкина Л.О., Затейщикова А.А., Затейщиков Д.А., Манхаева Б.Б., Савельева Е.Г., Бровкин А.В., Никитин А.Г.,. Носиков В.В, Сидоренко Б.А. Клиническая и инструментальная оценка эффективности бетаксолола у больных артериальной гипертензией: генетические аспекты индивидуальной чувствительности. Фарматека, 2007, 19: 68-73

45.  Минушкина Л.О., Затейщикова А.А., Затейщиков Д.А., Манхаева Б.Б., Савельева Е.Г., Кочкина М.С., Бровкин А.В., Никитин А.Г., Носиков В.В., Сидоренко Б.А. Генетические аспекты индивидуальной чувствительности к бетаксололу у больных артериальной гипертонией Кардиология 2008, №3: 20-26

46. Затейщиков Д.А., Минушкина Л.О., Преображенский Д.В.,.Алехин М.Н Обследование больных с артериальной гипертонией. Методические рекомендации под редакцией Сидоренко Б.А.. Москва, 2006. 48 с.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.