WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

Любимова Анна Викторовна

Эпидемиологический надзор за инфекциями,

связанными с оказанием медицинской помощи,

в отделениях реанимации новорожденных

14.02.02. - эпидемиология

Автореферат

диссертации на соискание ученой степени

доктора медицинских наук

Санкт-Петербург

2011

Работа выполнена в Государственном образовательном учреждении высшего профессионального образования «Санкт-Петербургская государственная медицинская академия им. И.И. Мечникова» Министерства здравоохранения и социального развития Российской Федерации

Научный консультант:

заслуженный деятель науки РФ,

доктор медицинских наук, профессор Зуева Людмила Павловна

Официальные оппоненты:

Доктор медицинских наук,

профессор  Нечаев Виталий Владимирович 

Доктор медицинских наук,

профессор  Мукомолов Сергей Леонидович

Доктор медицинских наук,

профессор  Селькова Евгения Петровна 

Ведущая организация: Государственное образовательное учреждение высшего  профессионального  образования  "Кемеровская  государственная

медицинская академия» Министерства  здравоохранения и социального

развития Российской Федерации

Защита состоится «18» октября 2011 г в 10 часов на заседании диссертационного совета ДМ 208.086.03 при ГОУ ВПО «Санкт-Петербургская государственная медицинская академия им. И.И. Мечникова»

Министерства здравоохранения и социального развития Российской Федерации по адресу: Россия, 195067, Санкт-Петербург, Пискарёвский пр., д. 47.

С диссертацией можно ознакомиться в библиотеке ГОУ ВПО «Санкт-Петербургская государственная медицинская академия им. И.И. Мечникова»

Министерства здравоохранения и социального развития Российской Федерации

Автореферат разослан__________________2011 г.

Ученый секретарь

диссертационного совета

д.м.н., профессор  А.Г.Бойцов

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы

Профилактика инфекций беременных, родильниц и новорожденных составляют одну из приоритетных задач в области охраны материнства и детства. В 2006 г нуждались в реанимации и интенсивной терапии 43 012 новорожденных, для обеспечения этого было необходимо 5850 коек (Шарапова О.В., 2008). Российские медучреждения полностью перейдут на критерии живорождения Всемирной организации здравоохранения (ВОЗ) в 2012 году. В соответствии с критериями ВОЗ, выхаживанию подлежат младенцы, вес которых при рождении составляет более 500 граммов. По словам Министра здравоохранения и социального развития Российской Федерации Т.А.Голиковой, условия для выполнения международных рекомендаций будут созданы благодаря завершению к 2012 году строительства сети перинатальных центров, охватывающих регионы РФ. Всего в регионах России должно к 2012 году должно появиться 22 региональных и 2 федеральных перинатальных центра (http://medportal.ru/mednovosti/news/2010/08/17/newborns/).

По данным Stover B.H. из 50 отделений реанимации новорожденных (ОРН) частота инфекций, связанных с оказанием медицинской помощи (ИСМП), инцидентность составила 8,9 на 1000 пациенто-дней (Stover B.H. et al., 2001). Стоимость лечения новорожденных с ИСМП в ОРН ежесуточно составляет около 2500–3000 евро в Европе и 4000–5000 долларов в США (Венцелл Р. П., 1990).

Причинами высокой заболеваемости ИСМП пациентов ОРИТ являются высокая частота использования инвазивных методов диагностики и лечения, необходимость интенсивного ухода медицинским персоналом за пациентами, что увеличивает частоту как прямых, так и непрямых контактов. Тяжелое состояние пациентов увеличивает их восприимчивость к инфекциям.

Внедрение новых высокотехнологичных технологий выхаживания новорожденных в России повлекло за собой и высокую заболеваемость, и смертность от ИСМП. Такая ситуация требует изменения традиционных подходов к организации профилактики ИСМП в ОРН на основе детального изучения эпидемиологических особенностей и факторов риска ИСМП в отделениях данного профиля и создания системы эпидемиологического надзора за ИСМП в отделениях данного профиля.

Эпидемиологический надзор - это система постоянных комплексов наблюдений за динамикой эпидемического процесса (заболеваемостью, носительством, летальностью), факторами, влияющими на распространение внутрибольничных инфекций, а также анализ полученных данных с целью получения объективной информации о состоянии и тенденциях развития эпидемического процесса для обоснования рациональных мер борьбы и профилактики внутрибольничных инфекций [МУ Утв. Минздравом СССР от 02.09.87 г. №28-6/34].

Цель исследования

Разработать современную систему эпидемиологического надзора за инфекциями, связанными с оказанием медицинской помощи в отделениях реанимации новорожденных.

Задачи исследования

  1. Выявить причины высокой заболеваемости ИСМП пациентов ОРН.
  2. Разработать систему активного эпидемиологического наблюдения и микробиологического мониторинга с учетом особенностей ОРН
  3. Разработать методологию эпидемиологического анализа данных, полученных в результате эпидемиологического наблюдения и микробиологического мониторинга.
  4. Изучить факторы риска возникновения и развития ИСМП у пациентов ОРН и факторы, влияющие на возникновение эпидемиологического неблагополучия в ОРН в современных условиях
  5. Обосновать и разработать профилактические и противоэпидемические мероприятия  в ОРН и оценить их эффективность

Научная новизна

Впервые показано, что особенностью эпидемиологического надзора в отделениях реанимации является необходимость выявления и учета как манифестных форм инфекции, так и колонизации. Выявление и учет колонизации обеспечивает своевременную диагностику эпидемического неблагополучия.

Показано, что длительная циркуляция отдельных штаммов микроорганизмов осуществляется за счет приобретения им свойств госпитального штамма, в первую очередь вследствие приобретения генов, отвечающих за вирулентность.

Впервые обоснован комплекс профилактических и противоэпидемических мероприятий в отделении реанимации с учетом внутренних и внешних факторов риска развития инфекций, вызванных условно-патогенными микроорганизмами в современных условиях. Ключевыми моментами предотвращения возникновения ИСМП являются внедрение современных систем гигиены рук медицинского персонала, изоляционно-ограничительных мероприятий и рациональное применение антибиотиков. Внедрение системы эпидемиологического надзора привело к значительному снижению заболеваемости инфекциями, связанными с оказанием медицинской помощи и смертности пациентов от ИСМП, уменьшению экономических затрат вследствие  снижения затрат на лечение ИСМП и сроков пребывания пациентов в отделении реанимации.

Теоретическая значимость

В результате изучения проявлений и механизма развития эпидемического процесса ИСМП были выявлены ведущие нозологические формы ГСИ, основные возбудители и основные причины возникновения вспышечной заболеваемости в отделениях реанимации новорожденных.

Разработана система эпидемиологического надзора за ИСМП новорожденных в ОРН, включающая в себя программу эпидемиологического наблюдения и схему микробиологического мониторинга, и показана их диагностическая эффективность. Разработана методология проведения эпидемиологической диагностики в отделениях реанимации новорожденных.

Определены основные факторы, влияющие на интенсивность циркуляции микроорганизмов в отделении и, на возникновение манифестных форм инфекций.

Выявлено, что наличие генов вирулентности у штаммов показывают их госпитальное происхождение.

Впервые в России выявлена циркуляция ванкомицинрезистентных энтерококков в отделениях реанимации новорожденных.

Дано обоснование комплекса профилактических и противоэпидемических мероприятий в отделении реанимации с учетом внутренних и внешних факторов риска развития инфекций, вызванных условно-патогенными микроорганизмами в современных условиях.

Разработана методология внедрения мероприятий по улучшению качества гигиены рук медицинского персонала и оценки их эффективности.

Разработана тактика применения антибиотиков у новорожденных.

Практическая значимость

Внедрена система эпидемиологического надзора за ИСМП новорожденных в ОРН, включающая в себя программу эпидемиологического наблюдения и схему микробиологического мониторинга и дана оценка его эффективности.

Внедрение результатов проведенного исследования в практику позволяет обеспечить снижение заболеваемости и смертности от ИСМП и частоты колонизации пациентов эпидемиологически значимыми микроорганизмами, усовершенствование системы эпидемиологического надзора за ИСМП, повышение чувствительности и специфичности эпидемиологического надзора за ИСМП.

Внедрены в практику профилактические и противоэпидемические мероприятия в ОРН и проведена оценка их эффективности.

Положения, выносимые на защиту

  1. Высокая заболеваемость ИСМП пациентов ОРН обусловила необходимость разработки и внедрения современной системы эпидемиологического надзора в ОРН, основными компонентами которого являются эпидемиологическое наблюдение и микробиологический мониторинг.
  2. Эпидемический процесс в ОРН в современный период поддерживается за счет заносов эпидемически опасных микроорганизмов из акушерских стационаров, формирования и циркуляции мультирезистентных к антимикробным препаратам штаммов микроорганизмов, формирования госпитальных штаммов, обладающих генами вирулентности. Генетическое типирование позволяет своевременно выявить формирование последних.
  3. Разработанная нами система эпидемиологического надзора позволяет своевременно вмешиваться в эпидемический процесс, что приводит к снижению ущерба от вспышек ИСМП, возможности их купирования без закрытия отделения, снижению заболеваемости ИСМП и смертности от них.
  4. Основными компонентами профилактических мероприятий в ОРН являются внедрение современных технологий гигиены рук медицинского персонала, изоляционно-ограничительных мероприятий, мероприятий, направленных на профилактику инфицирования дыхательных путей и кровотока.

Внедрение результатов в практику

Результаты исследования используются в практической деятельности врачей анестезиологов-реаниматологов отделений реанимации новорожденных стационаров Санкт-Петербурга, родовспомогательных учреждений Кыргызской Республики.

Результаты работы использованы при подготовке документов:

  • Приказ Комитета по здравоохранению администрации Санкт-Петербурга от 17.03.1998 №95 «О совершенствовании профилактики внутрибольничных инфекций на этапах оказания медицинской помощи новорожденным»
  • Приказ Комитета по здравоохранению администрации Санкт-Петербурга и Центра Госсанэпиднадзора в Санкт-Петербурге от 10.03.1998 №86/80 «О совершенствовании системы профилактики внутрибольничных инфекций в стационарах Санкт-Петербурга»
  • Информационное письмо «Опыт организации вакцинации против вирусного гепатита В в Санкт-Петербурге» Утверждено первым зам. предс. Комитета по здравоохранению Администрации Спб Б.М.Тайцем 26.08.97
  • Рекомендации по мытью и антисептике рук. Перчатки в системе инфекционного контроля (руководство). Санкт-Петербург: Санкт-Петербургский учебно-методический центр инфекционного контроля, 2000.
  • Методические рекомендации «ВБИ. Меры профилактики» Методические рекомендации  (в помощь практикующей медицинской сестре), рассмотренные и одобренные Научно-координационным советом СПбГМА им. И.И. Мечникова, 2004.
  • Информационное письмо «Рациональное применение антимикробных  препаратов в период родов и в послеродовом периоде» утв. Первым заместителем Председателя КЗ Правительства СПб Жолобовым В.Е. 19.09.2006
  • Эпидемиология: учебник. Рекомендовано учебно-методическим объединением по медицинскому и фармацевтическому образованию вузов России в качестве учебника, 2008
  • Методические рекомендации «Организация эпидемиологического наблюдения за исходами хирургических вмешательств» утв. Первым заместителем Председателя КЗ Правительства СПб Жолобовым В.Е. 17.07.2008
  • СП 3.1.2485-09 Профилактика внутрибольничных инфекций в стационарах (отделениях) хирургического профиля лечебных организаций. Зарегистрировано в Минюсте РФ 20 марта 2009 года. Регистрационный № 13548  - М, 2009
  • СанПиН 2.1.3.2630-10 «"Санитарно-эпидемиологические требования к организациям, осуществляющим медицинскую деятельность" Зарегистрировано в Минюсте РФ 9 августа 2010 г. N 18094
  • Проект новой редакции национальной концепции «Профилактика инфекций, связанных с оказанием медицинской помощи»

Основные положения, изложенные в диссертации, внедрены в учебный процесс:

Результаты исследования внедрены  в учебный процесс студентов и курсантов на кафедре эпидемиологии с курсом эпидемиологии, паразитологии и хирургических инфекций ФПК ГОУ ВПО СПбГМА им.И.И.Мечникова Росздрава, кафедре анестезиологии-реаниматологии и неотложной педиатрии и кафедре анестезиологии-реаниматологии и неотложной педиатрии факультета повышения квалификации и профессиональной переподготовки ГОУ ВПО СПбГПМА Минздравсоцразвития России. Материалы используются в качестве методических материалов для проведения плановых семинаров для госпитальных эпидемиологов, организуемых городским организационно-методическим отделом клинической эпидемиологии Медицинского информационно-аналитического центра.

Апробация работы и публикации:

Основные положения, изложенные в диссертации доложены и обсуждены на: 1.        научно-практической конференции "Актуальные проблемы гнойно-септических инфекций" (Санкт-Петербург, 1994); 3 научной конференции "Актуальные вопросы клинической педиатрии, акушерства и гинекологии" (Киров, 1994); 2nd International Conference on Occupational Health for Health Care Workers «Pro Health care» (Stockholm, 1994); III международном микологическом симпозиуме "Патогенез, диагностика и терапия микозов и микогенной аллергии" (Санкт-Петербург, 1995); международной научно-практической конференции “Современная перинатология и перинатологические аспекты патологии детского возраста” (Санкт-Петербург, 1996); 2nd Nordic-Baltic Congress on Infectious Diseases «Prevention in Focus» (Riga, 1996); 25th International Congress on Occupational Health (Stockholm, 1996); национальном конгрессе по болезням органов дыхания (Новосибирск,1996); VII съезде Всеросийского эпидемиологов, микробиологов и паразитологов (Москва, 1997); ежегодной конференции American International Health Alliance (Atlanta, 1997); IFIC Global Network Conference on Safe and Unsafe Methods of Infection Control (Cambridge, 1997); Международном семинаре «Инфекционный контроль в перинатальном периоде» (Стокгольм, 1999); ежегодной конференции American International Health Alliance (Washington, 1999); VI Российско-итальянской научной конференции «Инфекционные болезни: диагностика, лечение, профилактика» (Санкт-Петербург, 2000);  4th Decennial Conference on Nosocomial and Health-care Associated Infections (Atlanta, 2000); международном семинаре "Infection Control and Biosafety" (Stockholm, 2001); I конференции Северо-Западного региона России с международным участием «Инфекционный контроль в лечебно - профилактических учреждениях» (Санкт-Петербург, 2000); 11th Annual Meeting of the Society for Healthcare Epidemiology of America (Toronto, 2001); Meeting on International Infection Control and Laboratory Training (Atlanta, 2001); ежегодной конференции American International Health Alliance (Washington, 2001); научной конференции с международным участием «Достижения отечественной эпидемиологии в ХХ веке. Взгляд в будущее» (Санкт-Петербург, 2001); Всероссийской научной конференции «Клинические перспективы в инфектологии» (Санкт-Петербург, 2001); 41st Interscience Conference on Antimicrobial Agents and Chemotherapy (Chicago, 2001); Международной научно-практической конференции «Инфекционный контроль в практике: трудности и перспективы» (Санкт-Петербург, 2001); 12th Annual Meeting of the Society for Healthcare Epidemiology of America (Salt Lake City, 2002); 5th Nordic-Baltic Congress on Infectious Diseases (Saint-Petersburg, 2002); International Conference «Ten Years of Health Systems Transition in Central and Eastern Europe and Eurasia» (Washington, 2002); конференции, посвященной 25-летию Детской городской больницы №1» (Санкт-Петербург, 2002);конференции «Госпитальная педиатрия в ХХI веке. Проблемы, пути развития» (Санкт-Петербург, 2003); конференции «Интенсивная терапия новорожденных» (Архангельск, 2003); III Российской научно-практической конференции «Современные проблемы эпидемиологии, диагностики и профилактики внутрибольничных инфекций (Санкт-Петербург, 2003); конференции  “Деятельность медицинских центров государственных учреждений здравоохранения Санкт-Петербурга” (Санкт-Петербург, 2003); российской научно-практической конференции «Узловые вопросы борьбы с инфекцией» (Санкт-Петербург, 2004); российской научной конференции «Педиатрия: из 19 в 21 век» (Санкт-Петербург, 2005); межрегиональной научно-практической конференции «Сепсис: вопросы клинической патофизиологии, эпидемиологии, диагностики и интенсивной терапии» (Кемерово, 2006); 7-nd Nordic Baltic Congress on infections diseases "Current challenges and new opportunities" (Riga, 2006); конференции  с международным участием Балтийской сети Инфекционного контроля «Инфекционный контроль – задача общая» (Псков, 2006); международном симпозиуме по больничной гигиене (Санкт-Петербург, 2006); четвертой научно-практической конференции «Внутрибольничные инфекции в стационарах различного профиля, профилактика, лечение осложнений» Москва, 13 – 14 апреля  2006г; 3 Международной Германо-Российская Конференции Форума Кох-Мечников посвященная 100-летнему юбилею «Кох-Мечников: современные тенденции в инфекционной патологии» Санкт-Петербург, 19-20 ноября 2007; Конференции «Профилактика ВБИ в отделениях реанимации» Санкт-Петербург, 20 ноября 2008; Международной Конференции «Стратегия подавления мультирезистентных микроорганизмов» Санкт-Петербург, 7 ноября 2008; 10th IFIC Congress, Vilnius, Lithuania 8 - 11 October, 2009; Международной междисциплинарной конференции  «Преждевременные роды». Санкт-Петербург, 31 мая - 2 июня 2010г.; Global Congress of Maternal and Infant Health Barcelona 22-26 Oct 2010; III Всероссийском образовательном конгрессе «Анестезия и реанимация в акушерстве и неонатологии» Москва 2010 24-26 ноября; Всероссийской научно-практической  конференции “Актуальные вопросы  развития дезинфекционной службы в целях обеспечения санитарно-эпидемиологического благополучия населения” 18-19 мая 2011 года.

Диссертационная работа апробирована на расширенном заседании кафедры эпидемиологии с курсами эпидемиологии и паразитологии и хирургических инфекций ФПК и проблемной комиссии «Эпидемиология и профилактика инфекционных и неинфекционных заболеваний» ГОУ ВПО СПбГМА им.И.И.Мечникова Росздрава.

По результатам работы опубликовано 82 научных работы, в том числе 13 в изданиях, рекомендованных ВАК.

Личный вклад

Определение целей и задач, разработка системы эпидемиологического надзора, эпидемиологические исследования, обработка материала, разработка, внедрение и оценка эффективности профилактических и противоэпидемических мероприятий были полностью выполнены автором. Эпидемиологическое наблюдение в ДГБ №1 проводилось совместно с госпитальным эпидемиологом Н.М.Хрусталевой.

Объем и структура работы

Диссертация изложена на 274 страницах машинописного текста, иллюстрирована 108 рисунками и 14 таблицами и 3 схемами, состоит из введения, главы «Материалы и методы», 4 глав собственных исследований, заключения, выводов и списка литературы. Список литературы включает 101 источник, в том числе 24 работ отечественных и 77  - зарубежных авторов.

Содержание работы

Материалы и методы

Диссертация выполнена на кафедре эпидемиологии с курсом эпидемиологии, паразитологии и хирургических инфекций ФПК Государственного образовательного учреждения высшего профессионального образования Санкт-Петербургская Государственная Медицинская Академия им. И.И.Мечникова.

Сбор данных и внедрение результатов работы проводилось на базах:

  • Отделения реанимации и интенсивной терапии Детской Городской больницы №1 (далее ДГБ №1). Новорожденные поступают в отделение из родильных домов и других стационаров для хирургической и терапевтической помощи.
  • Отделения реанимации и интенсивной терапии Детской Городской больницы №17 св. Николая Чудотворца (далее ДГБ №17). Больница отделение реанимации и интенсивной терапии новорожденных на 24 койки. Новорожденные поступают в отделение из родильных домов и других стационаров для терапевтической помощи. Отделение специализируется на выхаживании новорожденных с экстремально низкой массой тела.

Исследование проводилось в течение 20,5 лет – с 1991 года по 2011 год в несколько этапов (рис. 1).




разработка схемы

микробиологического

мониторинга


внедрение гигиены рук


1991

1992

1993

1994

1995

1996

1997

1998

1999

2000

2001


 ретроспективный анализ, расследование вспышек

проспективное наблюдение

анализ эффективности мероприятий

разработка мер по купированию вспышек

внедрение изоляционно-ограничительных мероприятий и мер, направленных на профилактику ИКР и ИНДП

внедрение мер по оптимизации применения антибиотиков

2002

2003

2004

2005

2006

2007

2008

2009

2010

2011

проспективное наблюдение

генетическое типирование 

Рис.1. Этапы диссертационного исследования.

Общий объем проведенного исследования представлен в таблице 1.

Таблица 1.

Общий объем исследования

Характер собранных материалов/Учреждения

ДГБ 17

ДГБ 1

Всего

Количество историй болезни, изученных ретроспективно

432

1130

1562

Количество пациентов, находящихся под проспективном наблюдением

5354

6497

11851

Количество микробиологических исследований клинического материала

52889

46765

99654

Из них положительных:

16017

16045

32062

Количество микробиологических исследований смывов с объектов внешней среды

3180

618

3798

В исследовании использовались метод эпидемиологического обследования очагов, методы оперативного и ретроспективного анализа, описательные и аналитические методы эпидемиологической диагностики, микробиологические и статистические методы.

Обоснование необходимости внедрения эпидемиологического надзора в отделениях реанимации новорожденных

С этой целью проанализированы причины высокой заболеваемости и смертности пациентов ОРН до внедрения эпидемиологического надзора в ДГБ №1 за период с 1993 по 1997 гг. и в ДГБ №17 за период 1993-1998 гг. За этот период было расследовано 9 вспышек ИСМП. При расследовании вспышек использовались метод эпидемиологического обследования очагов, ретроспективный анализ, описательные методы эпидемиологической диагностики, микробиологическое обследование объектов внешней среды, микробиологическое обследование медицинского персонала. В этот же период была разработана схема микробиологического мониторинга.

С 1999 по 2010 гг. в ОРН ДГБ №1 и №17 проводилось проспективное эпидемиологическое наблюдение и микробиологический мониторинг. За этот период было расследовано и купировано 8 вспышек. Проспективное наблюдение дало возможность использовать аналитические методы исследования.

Для установления эпидемиологических связей использовались изучение профилей антибиотикорезистентности, биотипирование по методу Оддса-Эбота и электрофорез белковых экзопродуктов грибов рода Candida, серотипирование, фаготипирование. С 2008 года для более точного установления эпидемиологических связей использовались методы генетического молекулярного типирования. Генотипы резистентности ванкомицинрезистентных энтерококков (VRE) определяли амплификацией фрагментов генов устойчивости энтерококков к ванкомицину (vanA, vanB, vanC1 и vanC2/3). Реакции проводили согласно методике Dutka-Malen S. и соавт. (Dutka-Malen S. et. al. 1995). В качестве положительного контроля амплификации кассеты ванкомицин-резистентности vanA был использован штамм Enterococcus faecium SMI Ekkr148 из коллекции Шведского института контроля за инфекциями.

Культуры A.baumannii были подвергнуты генетическому типированию методом RAPD-ПЦР (Соломенный А.П. и др. 2004). Дополнительно была проведена идентификация  фрагментов гена кальций-связывающего токсина rtx, локализованного на острове патогенности pA18 (Iacono M. et.al. 2008). Для амплификации данного гена нами были сконструированы следующие праймеры (Таблица 2).

Таблица 2.

Олигонуклеотидные праймеры и условия амплификации фрагмента гена rtx.

Наименование

Последовательность (5’-3’)

размер ПЦР - продукта

T отжига (С)

RTX_F

tccagcctgcgtatcttttaccgt

535

59

RTX_R

tggcgaagcagggaatgacacc

Разработка схемы микробиологического обследования

На данном этапе были проведены и проанализированы результаты микробиологических исследований. Для определения диагностической ценности микробиологического обследования слизистой оболочки полости рта новорожденных, были проанализированы результаты 244 одномоментных микробиологических исследований слизистой оболочки полости рта и смывов из трахеобронхиального дерева от 99 пациентов; смывов с кожи - 794 одномоментных микробиологических исследований кожи и слизистой оболочки полости рта от 156 пациентов. Для определения необходимой кратности микробиологического обследования пациентов ОРН были проанализированы результаты 954 микробиологических исследований клинического материала от 205 пациентов с января 1991 года по октябрь 1993 года. Для определения диагностической значимости микробиологического обследования объектов внешней среды были проанализированы результаты 2308 исследований смывов из внешней среды. Использовались описательные методы эпидемиологической диагностики, определялись чувствительность, специфичность, прогностическая значимость положительного и отрицательного результатов диагностического теста.

Разработка системы эпидемиологического наблюдения в ОРН

Методологической основой работы явились эпидемиологические методы, включающие в себя ретроспективный анализ и проспективное наблюдение. Были разработаны основные компоненты эпидемиологического наблюдения.

Начиная с 1998 года все новорожденные обследовались микробиологически согласно разработанной схемы. Рутинное исследование клинического материала от больных и его исследование проводилось согласно приказа МЗ СССР №535 от 22.04.1985г. «Об унификации микробиологических (бактериологических) методов исследования, применяемых в клинико-диагностических лабораториях лечебно- профилактических учреждений». Проводилось определение антибиотикочувствительности выделенных микроорганизмов диско-диффузионным методом к следующим антибиотикам: к ампициллину, гентамицину, цефотаксиму, цефтазидиму, имипенему определялась чувствительность Гр- микроорганизмов; к ампициллину, гентамицину, цефотаксиму, цефтазидиму, цефазолину, оксациллину, эритромицину, ванкомицину – Гр+ микроорганизмов.

Определение чувствительности микроорганизмов к дезинфектантам проводилось по методике Е.И. Гудковой с белковой защитой в нашей модификации (с использованием штампа-репликатора).

При анализе микробиологических данных использовалась компьютерная программа Whonet (версия 5.4).

Сбор данных о соблюдении медицинским персоналом гигиены рук

Методы наблюдения

Рандомизированное наблюдение за соблюдением гигиены рук медицинского персонала лицами, не работающими в данном стационаре (Метод 1). Наблюдение проводилось лицами, имеющими высшее медицинское образование, но не работающими в данном стационаре (интерны) дважды в неделю за двумя койками в течение 3 часов подряд. Койки, за которыми будет проводиться наблюдение, и часы наблюдения выбирались случайным образом. Система наблюдения была адаптирована нами из системы, предложенной Pittet и Harbarth (Pittet D. et. al., 1999,  Pittet D. et. al., 2000, Harbarth S. et.al. 2002). При наблюдении учитывались следующие действия персонала по гигиене рук – мытье рук с мылом и обработка рук безводным антисептиком, только мытье рук с мылом, только обработка рук антисептиком, мытье рук только водой (без мыла), отсутствие гигиены рук. Проведение гигиены рук учитывалось отдельно до и после инвазивных манипуляций, до и после не инвазивных манипуляций, после снятия перчаток, после контакта без перчаток для разных категорий медицинских работников – врачи, постовые сестры, процедурные сестры, респираторные тераписты. Наблюдение проводилось с 15 декабря 1999 года по 30 июня 2000 года в течение 258 часов. Всего было оценено 1115 эпизода для проведения гигиены рук в ДГБ №1 и 1011 эпизодов в ДГБ №17.

Наблюдение за соблюдением гигиены рук медицинского персонала сотрудниками больницы (Метод 2). Наблюдение проводилось сестрой по инфекционному контролю и госпитальным эпидемиологом в течение 10 дней в феврале, апреле и июне 2000 года и в марте и апреле 2001 года. При наблюдении учитывались те же действия персонала по гигиене рук, что и в методе 1. Но в отличие от метода 1, показания для гигиены рук не группировались, и каждая манипуляция учитывалась отдельно.  Сотрудники отделения не были оповещены о проводящемся наблюдении. Всего под наблюдением находилось 485 манипуляций.

Анкетирование медицинского персонала

Было проведено анонимное анкетирование персонала перед первым вмешательством и через год после него. В обоих случаях персоналу предлагалось ответить, считают ли они необходимым мытье рук с мылом и/или обработку рук антисептиком при перечисленных манипуляциях и всегда ли они это соблюдают.

Учет количества использованного антисептика

До обеспечения антисептиком каждого реанимационного места количество использованного антисептика рассчитывалось по данным получения антисептика ОРН из больничной аптеки. После обеспечения антисептиком каждого реанимационного места ежедневно учитывался расход антисептика около каждого реанимационного места и около раковины в каждом боксе. Количество использованного антисептика рассчитывалось в мл на 1 пациенто-день для каждого периода.

Сбор данных для разработки тактики применения антибиотиков

Для выбора тактики применения антибиотиков при поступлении новорожденных в ОРН из акушерских стационаров, нами бал проведен анализ спектра микроорганизмов и их антибиотикорезистентности, выделенных при поступлении из клинического материала 1196 новорожденных, поступивших в ОРН ДГБ №1 и ДГБ №17 в течение 2000 года и штаммов, выделенных из клинического материала 823 новорожденных, поступивших в ДГБ №17 на первые сутки жизни в 2001-2005 годах.

Анализ этиологии колонизации новорожденных в зависимости от возраста поступления включал результаты микробиологического обследования 2081 новорожденного.

Мероприятия, направленные на оптимизацию применения

антибиотиков.

Проведен анализ антибиотикорезистентности микроорганизмов, выделенных из клинического материала 744 пациентов ОРН в возрасте первых 3 суток жизни при поступлении и 879 новорожденных в возрасте старше 3 суток при поступлении (2001-2004 гг.).

Анализ этологии колонизации пациентов в зависимости от длительности пребывания в отделении реанимации включал результаты 7947 микробиологических исследований клинического материала новорожденных, проведенных в течение 2001-2005 годы.

Анализ утилизации антибиотиков проводился с расчетом следующих показателей: удельный вес пациентов, получавших антибиотики или конкретный антибиотик; среднее количество применяемых антибиотиков на 1 пациента; средняя длительность применения всех антибиотиков и конкретных антимикробных препаратов; показатель общей длительности применения антибиотиков/ на 1000 пациенто-дней.

Для статистической обработки данных использовались программы Statcalc (версия 6), WinPepi (версия 4,07), SPSS (версия 13,0).

Результаты работы и их обсуждение

Разработка системы эпидемиологического надзора в ОРН

Обоснование необходимости внедрения эпидемиологического надзора в отделениях реанимации новорожденных

Ретроспективный анализ, проведенный за 1991-1994 гг., показал высокую заболеваемость ИСМП в ОРН. Частота инфекций нижних дыхательных путей (ИНДП) составила 29,7 на 100 пациентов, генерализованных инфекций – 10,3 на 100 пациентов. В этиологической структуре преобладали Гр- микроорганизмы: P.aeruginosa – 30,6%, K.pneumoniae – 11,6%, Acinetobacter sp. – 8,3%. Как прямая или косвенная причина смерти, ИСМП были выявлены с частотой 7,2 на 100 пациентов в ДГБ №1 и 8,9 на 100 пациентов в ДГБ №17. Нозологическая структура осложнений была одинаковой в обоих отделениях. Преобладали ИВЛ-ассоциированные пневмонии (62,5%), у 24,2% новорожденных при патологоанатомическом исследовании были выявлены генерализованные формы инфекций. Отделения в этих больницах закрывались по 5 раз для купирования вспышек внутрибольничных инфекций. Такая ситуация требует изменения традиционных подходов к организации профилактики ИСМП в ОРН на основе детального изучения эпидемиологических особенностей и факторов риска ИСМП в отделениях данного профиля.

Вспышечная заболеваемость в ОРН занимает от 20 до 80% от всей внутрибольничной заболеваемости. Нами был проведен анализ вспышек, возникших в различных отделениях реанимации новорожденных акушерских стационаров и детских больниц (Таблица 3) .

Таблица 3.

Основные эпидемиологические характеристики вспышек.

Показатели

P.aeruginosa

Candida sp.

K.pneumoniae

S. marcescens

Продолжительность

8 мес.

10 мес.

5 мес.

15 мес.

инцидентность

44,7 на 100 поступивших

16,4 на 100 поступивших

28,2 на 100 поступивших

6,9 на 100 поступивших

Максимальная инцидентность

58,3 на 100 поступивших

34,6 на 100 поступивших

67,5 на 100 поступивших

21,6 на 100 поступивших

летальность

40%

28%

21,7%

27%

Нами были установлены основные причины развития вспышек, которые  были общими как для разных возбудителей, вызвавших вспышки, так и в разных учреждениях, в различные периоды времени. Основными причинами являлись отсутствие адекватных профилактических и противоэпидемических мероприятий, отсутствие эпидемиологического наблюдения и микробиологического мониторинга, несвоевременная диагностика инфекций, высокая частота заносов инфекций из родильных домов. Летальность при возникновении ИСМП, вызванных P.aeruginosa, составила 45,2% среди недоношенных, и  23,1% среди доношенных детей (OR=2,75 95% ДИ 0,57-14,8; p=0,15). В период 1993-1999 гг. нами были отмечены наибольший риск возникновения внутрибольничного кандидоза (заболеваемость 32,9 на 100 поступивших) и высокая летальность (52,2%) у пациентов, родившихся с экстремально низкой массой тела (OR=4,8 95% ДИ 2,3-9,9; p=0,000006 и  OR=9,8 95% ДИ 1,7-106,2; p=0,005 соответственно).

Нами было установлено, что предвестником возникновения эпидемического неблагополучия является рост внутрибольничной колонизации пациентов (коэффициент корреляции 0,79) (рис.2).

Рис. 2. Динамика частоты колонизации и частоты манифестных инфекции у пациентов реанимации новорожденных, вызванных S.marcescens с сентября 1996 г. по март 1997 г.

Именно поэтому, в ОРН необходимо слежение не только за возникновением манифестных форм инфекций, но и за циркуляцией микроорганизмов. Это потребовало разработки и внедрения микробиологического мониторинга.

Разработка схемы микробиологического обследования

Результаты анализа данных микробиологического обследования пациентов показали, что на 4 сутки пребывания в отделении у 35,8% пациентов происходит смена микрофлоры в клиническом материале, на 6-9-е сутки более чем у 50% пациентов результаты посева клинического материала не были идентичны предыдущим. В дальнейшем смена микрофлоры наблюдалась к 14, 22 и 28 суткам пребывания. С целью ранней диагностики заносов было введено микробиологическое обследование пациентов при поступлении в больницу. Это дало возможность правильно оценивать эпидемическую обстановку в родильных домах, своевременно назначать противоэпидемические мероприятия и корректировать эмпирическую антибиотикотерапию.

Поскольку в отделениях реанимации преобладают инфекции, связанные с инвазивными устройствами (ИВЛ-ассициированная пневмония, катетер-ассоциированные инфекции кровотока, катетер-ассоциированные инфекции мочевого тракта) наиболее целесообразно исследовать клинический материал из тех биотопов, которые подвергаются воздействию инвазивного устройства. Нами было показано, что обследования таких биотопов, как кожа, слизистая оболочка полости рта, имеют низкую диагностическую значимость. Учитывая эти данные, мы рекомендовали проводить микробиологическое обследование по следующей схеме: посевы крови, кала, смыва из трахеобронхиального дерева, желудочного содержимого, мочи  на 1-е, 4-е, 8-е сутки и еженедельно после первой недели жизни или по клиническим показаниям. Данная схема вошла в приказ «О совершенствовании профилактики внутрибольничных инфекций на этапах оказания медицинской помощи новорожденным», который был утвержден Комитетом Здравоохранения Администрации г. Санкт-Петербурга (№95 от 17.03.1998) и является обязательной по настоящее время.

Разработка системы эпидемиологического наблюдения в ОРН

Помимо внедрения схемы микробиологического обследования в отделениях реанимации необходима система эффективного эпидемиологического наблюдения.

Сбор данных

При организации эпидемиологического наблюдения учитывалось следующее: оно должно проводиться за всеми пациентами, поступившими в ОРН, и быть организовано по типу проспективного, т.е. данные должны собираться ежедневно. Нами был определен основной перечень данных, которые необходимо собирать в рамках программы эпидемиологического наблюдения. Информация, собираемая о каждом пациенте, должна включать: дату рождения, учреждение, где родился ребенок, массу тела при рождении, дату поступления в ОРН, местоположение в ОРН, дату выписки из ОРН и исход, результаты микробиологических исследований, диагноз ИСМП, дату возникновения инфекции, антимикробную терапию в родильном доме, при поступлении в ОРН, в период пребывания в ОРН. В случае выявления ИСМП или колонизации, к возникшим в ОРН, необходимо относить все случаи, возникшие через 72 часа после поступления. В период проспективного наблюдения необходимо проводить ежедневный учет следующих лечебно-диагностических манипуляций: количество пациентов в отделении, из них количество пациентов, находящихся на ИВЛ, с мочевым катетером, с желудочным зондом, с центральным венозными катетерами. Данные необходимо собирать по следующим весовым (масса тела при рождении) категориям: менее 1000 г, 1000-1499 г, 1500-2499 г, 2500-3499 г, 3500 г и более.

Эпидемиологический анализ

Собранные данные формируются в базу данных, пользуясь которой проводиться эпидемиологический анализ следующим образом:

•        Постоянный текущий анализ, целью которого является оценка эпидемической ситуации за короткие промежутки времени (один день, несколько дней), в случае ее ухудшения проведение эпидемиологической диагностики и назначение или коррекция на основании ее результатов противоэпидемических мероприятий. В первую очередь необходима оценка ежедневной ситуации в ОРН. В первую очередь оцениваются обстоятельства, объединяющие пациентов, у которых был выделен одинаковый возбудитель – откуда поступили пациенты, их местоположение в отделении, из какого клинического материала был выделен возбудитель, его антибиотикочувствительность. При выделении из клинического материала пациента антибиотикорезистентных штаммов микроорганизмов или выявлении манифестной формы инфекции, к данному пациенту назначаются изоляционно-ограничительные мероприятия. Постоянный текущий анализ позволяет:

  • Выявить быстро возникающие кластеры инфекций
  • Выявить пути и факторы передачи инфекции, а также, при возможности, и источник инфекции
  • Своевременно назначать адекватные противоэпидемические мероприятия, тем самым предотвратить дальнейшее распространение инфекции

•        Периодический текущий анализ, целью которого является оценка эпидемической ситуации за небольшие промежутки  времени (недели, месяцы). Проведение периодического анализа позволяет выявить постепенное изменение эпидемической ситуации, которое трудно диагностировать при анализе коротких промежутков времени и которое, как правило, связано с действием нескольких факторов. Периодический текущий анализ позволяет:

  • Своевременно выявить ухудшение эпидемической ситуации
  • Выявить внутренние и внешние факторы риска, связанные с возникновением вспышки
  • Своевременно разработать и внедрить адекватные противоэпидемические мероприятия, тем самым предотвратить дальнейшее распространение инфекции
  • При проведении текущего анализа используются описательные методы эпидемиологии. При расследовании вспышек должны применяться аналитические методы исследования, такие как когортное исследование, т.к. наблюдение охватывает все популяцию, подвергающуюся факторам риска.

Система текущего эпидемиологического анализа позволяет на постоянной основе контролировать эпидемическую ситуацию в ОРН. Как показал опыт, отказ от такой системы приводит к ухудшению эпидемической ситуации (рис. 3).

Рис. 3. Частота внутрибольничного инфицирования и летальных исходов в период проведения текущего эпидемиологического анализа (период 1-  6 мес.) и без него (период 2 - 6 мес.)

Частота инфицирования микроорганизмами, представленными ни рисунке увеличилась с 10,6 на 100 пациентов до 29,3 на 100 пациентов. Смертность от ИСМП в 1 период составила 0,6 на 100 поступивших, во 2 период – 4,2 на 100 поступивших (p=0,0004).

•        Ретроспективный анализ, целью которого является разработка профилактических и противоэпидемических мероприятий на основании эпидемиологического анализа данных, полученных в ходе проведения эпидемиологического наблюдения. Оценка тенденций развития эпидемического процесса проводится, главным образом, с помощью анализа многолетней динамики. С этой целью по годам оценивается частота различных проявлений инфекции – колонизации и/или манифестных проявлений инфекции, а также  утилизации инвазивных устройств, антибиотиков и антисептиков и т.д.

Разработанная нами система эпидемиологического надзора включала, анализ тенденций развития эпидемического процесса, факторов риска развития ИСМП и эффективности внедряемых мероприятий. На основании данных эпидемиологической диагностики были разработаны профилактические мероприятия.

В общем виде схему эпидемиологического надзора в ОРН можно представить следующем образом (рис. 4):

Рис. 4. Структура системы эпидемиологического надзора в ОРН.

Проспективное эпидемиологическое наблюдение и микробиологический мониторинг проводились в ОРН больниц с 1999 года. Это позволило своевременно выявлять эпидемиологические неблагополучия, выявлять причины его появления (Таблица 4), вмешиваться в эпидемический процесс, что привело к снижению ущерба от вспышек ИСМП, возможности их купирования без закрытия отделения, снижению заболеваемости ИСМП и смертности от них.

Таблица 4.

Причины возникновения вспышек в ОРН, в которых были внедрены эпидемилогическое наблюдение и микробиологический мониторинг

Год

Этиология

Причины

1999

K. pneumonia

Увеличение нагрузки на персонал, перебои с обеспечением антисептиком для рук

2001

S.aureus

Большое количество заносов из роддомов

2002

K.pneumonia; C.diversus

Увеличение поступления пациентов с экстремально низкой массой тела, большое количество заносов из роддомов, вероятное формирование госпитального штамма, недостаточное количество расходных материалов

2003

S.aureus

Большое количество заносов из роддомов, увеличение нагрузки на персонал

2004

K.pneumonia

Нерациональное применение антибиотиков (переход на цефалоспорины в качестве стартовой схемы)

2006

S.epidermidis

Нерациональное применение антибиотиков (резкое увеличение использования антибиотиков резерва), появление источников инфекции среди персонала

2008

A.baumannii

Большое количество заносов из роддомов, недостатки в дезинфекции некритических объектов внешней среды

2011

A.baumannii

Формирование госпитального штамма, отсутствие текущего эпидемиологического анализа

В качестве примера снижения ущерба от возникновения вспышек можно привести сравнение вспышек K.pneumoniae, возникших в 1994 и 2002 гг (Таблица 5).

Таблица 5.

Основные эпидемиологические показатели при вспышках, вызванных K.pneumoniae, возникших в 1994 и 2002 гг.

Показатели

1994 год

2002 год

Инцидентность (на 100 поступивших)

28,2

15,3

Смертность

16 пациентов – смерть (11 генерализованной инфекции 5 пневмоний)

Ни одного случая смерти или генерализованной инфекции

Методы купирования

Закрытие отделения

Изоляционно-ограничительные мероприятия

Разработка, внедрение и оценка эффективности профилактических и противоэпидемических мероприятий.

Ранняя диагностика заносов в отделения реанимации новорожденных и профилактика их распространения

Анализ многолетней динамики частоты инфекций и колонизации при поступлении и в период пребывания пациентов в ОРН показал, что эпидемическая ситуация в отделении во многом зависит от частоты заносов инфекции в отделение. Так коэффициент корреляции между частотой колонизации, выявленной при поступлении (занос) и частотой внутрибольничной колонизации для K.pneumoniae составляет 0,99, A.calcoaceticus – 0,91, энтерококков – 0,66, E.coli – 0,61. Анализ частоты случаев колонизации новорожденных при поступлении в отделение в зависимости от сроков поступления показал, что пациенты, поступившие более чем на 3 сутки жизни, более чем в 60% случаев оказывались колонизированными условно-патогенными микроорганизмами. Микробиологическое обследование при поступлении, контактная изоляция пациентов, выделяющих эпидемически опасные штаммы и поступивших на 4 сутки жизни и более, позволило в 2 раза снизить внутрибольничное распространение микроорганизмов, заносы которых ранее вызывали крупные внутрибольничные вспышки.

Организация работы в ОРН

Успех работы по профилактике ИСМП зависит от организации работы. Для ухода за новорожденными должно иметься достаточное количество персонала для того, чтобы было возможно соблюдать все профилактические меры. В качестве примера можно привести вспышку K.pneumoniae. При увеличении нагрузки на постовых сестер увеличивалась частота внутрибольничной колонизации новорожденных K.pneumoniae (коэффициент корреляции 0,8).

В ОРН было проведено разделение медицинского персонала, отвечающего за определенные специфические разделы работы: постовые сестры, аптечные сестры, процедурные сестер, респираторные тераписты, служба обработки аппаратуры, молочные сестер, санитарский пост. Благодаря такому разделению функций между различными категориями медработников уменьшается риск передачи инфекции из-за последовательного выполнения грязных и чистых процедур руками одного и того же медицинского персонала, а также риск ошибок при проведении высокотехнологичных процедур.

В штат была введена должность сестры по инфекционному контролю. Сестра по инфекционному контролю является незаменимым помощником при сборе данных по программе эпидемиологического наблюдения. Наличие опыта работы, знание техники проведения медицинских манипуляций дает возможность участвовать в разработке эпидемиологически безопасных алгоритмов проведения манипуляций, проводить обучение персонала. Постоянный контакт с медицинским персоналом позволяет информировать об эпидемиологической ситуации в отделении и об эпидемической опасности конкретного пациента, назначать и контролировать изоляционно-ограничительные мероприятия.

Внедрение современных технологий гигиены рук медицинского

персонала

Адекватная гигиена рук медицинского персонала - ключевой момент в профилактике перекрестной инфекции. Для улучшения соблюдения требований по гигиене рук медицинского персонала нами были проведены многомерные вмешательства. Они включали обучение медицинского персонала правилам и технике гигиены рук, обеспечение каждого реанимационного места дозатором с безводным антисептиком, изучение правильности выполнения рекомендаций по обработке рук для каждой манипуляции, выявление и устранение причин, препятствующих обработке рук, анонимное анкетирование персонала. Главный акцент был сделан на необходимость обработки рук безводным антисептиком сразу после контакта с пациентом. Данные мероприятия позволили увеличить частоту гигиенической антисептики рук с 0% до 30% до проведения манипуляций и с 0% до 58% после манипуляций в ДГБ №1 и с 3% до 34% до проведения манипуляций и с 0% до 39% после манипуляций в ДГБ №17. Частота внутрибольничной колонизации снизилась с 28,1 до 7,6 на 1000 пациенто-дней, а ИСМП – с 11,9 до 4,1 на 1000 пациенто-дней. Сравнение частоты соблюдения гигиены рук среди различных категорий медицинских работников существенных различий не выявил.

Еще одним немаловажным вопросом является вопрос, чем вытирать руки. Из 50 полотенец, исследованных нами, 5 оказались контаминированными: с 2 была выделена P.aeruginosa, с 2 – Enterococcus sp., с 1 – C.albicans. Введение одноразовых полотенец  позволило снизить частоту ИСМП (колонизаций) в 1,4 раза, а соотношение Занос/ВБИ – в 1,7 раз.

Изоляционно-ограничительные мероприятия

Для профилактики внутрибольничного инфицирования нами были разработаны показания для проведения изоляционно-ограничительных мероприятий. Такие микроорганизмы, как P.aeruginosa (индекс манифестации 32%) и K.pneumoniae (индекс манифестации 28%) значительно чаще вызывали манифестные формы инфекций, по сравнению с другими микроорганизмами (p=0,03). Помимо вида микроорганизма, большую роль играет и антибиотикочувствительность микроорганизмов, которыми колонизированы пациенты. Так, частота распространения S.epidermidis, устойчивого гентамицину и цефатоксиму, в 3 раза выше, по сравнению с чувствительным, а K.pneumoniae - в 4 раза. Таким образом, с целью ограничения распространения эпидемически опасных штаммов, необходимо применение изоляционно-ограничительных мероприятий к пациентам, имеющим колонизацию или инфекцию, вызванную ими. Они включают в себя строгое закрепление среднего медицинского персонала, обслуживающего данных пациентов, оборудования для их обслуживания. Любой контакт с пациентом осуществлялся в одноразовых перчатках и фартуках, обязательная обработка рук антисептиком после любой манипуляции и контакта с объектами внешней среды, окружающей пациента.

Оптимизация применения антибиотиков

Проведенный нами анализ этиологии колонизации и чувствительности к антибиотикам штаммов, выделенных из клинического материала пациентов, поступивших в ОРН в первые сутки жизни показал, что новорожденные с равной частотой колонизированы E.coli, S.aureus, Klebsiella sp. и энтерококками. Данные микроорганизмы были выделены от каждого четвертого поступившего. За 5 лет только у 1,9% пациентов выделена резистентная к ампициллину и гентамицину микрофлора. Резистентность к цефатоксиму была более высокой за счет устойчивости к нему энтерококков. При переходе в качестве стартовой схемы на цефалоспорины, частота выделения грибковой флоры и антибиотикорезистентных бактерий увеличивалась до 45,6%. Увеличение частоты назначения цефотаксима при поступлении в ОРН с 30% до 70% пациентов, привело к росту частоты выделения резистентных к нему штаммов K.pneumoniae от 6% до 37%. Ограничение применения этого препарата помогло снизить частоту выделения антибиотикорезистентных штаммов до 9%. Поэтому, в качестве стартовой схемы антибиотикотерапии и профилактики, нами был рекомендован ампициллин или его комбинация с гентамицином.

Мероприятия, направленные на оптимизацию применения

антибиотиков

Коррекция применения антибиотиков в отделении проводится на основании следующих данных: анализа частоты колонизации антибиотикорезистентными штаммами, антибиотикорезистентности выделенных микроорганизмов, утилизации антибиотиков. Для оптимизации применения антибиотиков в отделении нами были разработаны следующие мероприятия: доклад на общебольничных конференциях результатов анализа этиологии колонизации пациентов поступающих в ОРН и влиянии стартовой схемы антибактериальной терапии и в период пребывания в ОРН на антибиотикорезистентность выделенных микроорганизмов, выпуск информационных бюллетеней об утилизации антибиотиков, строгий контроль назначения антибиотиков резерва. Вмешательства, направленные на снижение применения антибиотиков широкого спектра действия позволили снизить потребление антибиотиков резерва с 566 до 165 суточных доз/1000 пациенто-дней.

Профилактика инфекций нижних дыхательных путей

В отделениях реанимации инфекции нижних дыхательных путей (ИНДП) являются лидирующей нозологической формой ИСМП. Внедрение следующих мероприятий позволило снизить частоту инфицирования нижних дыхательных путей:

  • для увлажнения воздуха используется только стерильная вода
  • для санации трахеобронхиального дерева используются отсосные катетеры и стерильная вода однократного применения
  • вакуумными отсосами оборудовано каждое реанимационное место
  • санация проводится в чистых перчатках однократного применения
  • перед и после проведения интубации и санации персонал обрабатывает руки безводным антисептиком
  • разработаны и внедрены алгоритмы интубации и проведения санации трахеобронхиального дерева новорожденных
  • дыхательные контуры подвергаются дезинфекции высокого уровня

После введения этих мер, частота колонизации НДП P. aeruginosa снизилась с 17,2 до 1,2 на 100 пациентов, K.pneumoniae – с 11,3 до 5,4, Candida sp. – с 9,8 до 1,5, E.coli – с 7 до 2,6 и S.pneumoniae – с 3,2 до 0,07.

Профилактика инфекций кровотока

Практические рекомендации по профилактике развития инфекций кровотока (ИКР) основываются на знании современных эпидемиологических тенденций развития этих заболеваний. Для снижения риска развития ИКР нами были внедрены следующие мероприятия:

  • отказ от венесекций
  • катетеризация центральных вен методом пункции
  • введение в штат процедурных медицинских сестер, ответственных за постановку и уход за катетерами
  • постановка катетера в стерильной одежде, стерильных перчатках
  • внедрение гигиенической антисептики рук и использования стерильных перчаток при любых манипуляциях, связанных с катетерами

Также разработаны и внедрены алгоритмы приготовления внутривенных растворов в специально оборудованном для этого помещении, оснащенном шкафом с ламинарным потоком воздуха или в отдельном чистом помещении. Все растворы для парентерального введения готовит специально обученная медицинская сестра.  Внедрение этих рекомендаций позволяет значительно снизить частоту инфекций кровотока с 7 до 0,3 на 100 пациентов.

Мероприятия, направленные на снижение распространения

антибиотикорезистентных штаммов и купированию вспышек ИСМП

На особом месте стоят противоэпидемические мероприятия при купировании вспышек. Несмотря на то, что каждая вспышка носит уникальный характер, при купировании следует выполнять ряд общих мероприятий:

  • Поперечное одномоментное микробиологическое обследование всех пациентов для выявления всех источников инфекции. Помимо клинического материала дополнительно исследуются смывы с кожи и слизистой оболочки полости рта
  • Микробиологическое обследование объектов внешней среды
  • Доведение информации о сложившемся эпидемическом неблагополучии и необходимых мероприятиях для его купирования до персонала отделения и администрации больницы
  • Когортная изоляция инфицированных пациентов «вспышечными» штаммами (с манифестными формами и колонизированных)
  • Проведение всех манипуляций у всех пациентов (инфицированных и неинфицированных) в одноразовых перчатках и фартуках
  • Контроль применения антибиотиков
  • Ежедневная обработка кожи новорожденных 1% водным раствором хлоргексидина

Купирование вспышек разной этиологии требует проведение дополнительных мероприятий. При локализации вспышек, вызванным микроорганизмом, источником инфекции которого, с большой вероятностью может оказаться персонал (S.aureus, S.epidermidis, стрептококки группы А), необходимо обследование и санация персонала. При вспышках, вызванных неферментирующими Гр- микроорганизмами, особое внимание следует уделять объектам внешней среды, методам их обеззараживания. При вспышках, вызванных возбудителями ОРЗ, большую роль как источник инфекции могут играть родственники пациентов. Поэтому следует усилить меры по предотвращению заносов инфекции в стационар.

Кроме того, расследование вспышек помогает лучше понять механизм формирование эпидемического процесса. Так, сравнение двух вспышек, вызванных A.baumannii, показало (Таблица 6):

Таблица 6.

Основные эпидемиологические показатели при вспышках, вызванных мультирезистентными негоспитальным штаммом A.baumannii (вспышка 1) и госпитальным штаммом A.baumannii (вспышка 2).

Показатель

Вспышка 1

Вспышка 2

Заболеваемость на 100 пациентов

5,1

7,6

Колонизация на 100 пациентов

8,9

5,2

Заболеваемость на 1000 пациенто-дней

2,8

9,0

Колонизация на 1000 пациенто-дней

4,9

6,3

% манифестных форм

25

59,1

Летальность (%)

0

25

Генетическое типирование методом RAPD-PCR в сочетании с определением интегрона 1 класса штаммов, выделенных при вспышке 1, показало, что они идентичны и были представлены единственным интегрон-негативным клоном. Отсутствие у штамма интегрона свидетельствует о его внебольничном происхождении. Все изученные культуры, выделенные при вспышке 2, отнесены к одному RAPD-типу (RAPD-тип 1) и были rtx-позитивны. Это свидетельствует о том, что данный штамм обладает поверхностным сцепленным протеином, связанным с RTX кальций-связывающим цитотоксином. Данный ген является ответственным за вирулентность и резистентность штамма. Расследование вспышки 2 показало, что первый случай колонизации нижних дыхательных путей был выявлен 08.10.2010 - возбудитель был выделен из смыва из трахео-бронхиального дерева у новорожденной К, которая поступила в ОРН 20.09.2010 на третьи сутки жизни. До этого случая (апрель-октябрь) все случаи колонизации A.baumannii были вызваны штаммами, чувствительными к антибиотикам. В этот же период времени в отделении циркулирует P.aeruginosa, устойчивая к  аминогликозидам, цефалоспоринам, карбепенемам, фторхинолонам, чувствителен только к полимиксину. Можно предположить, что приобретение A. baumannii произошло путем экстрахромосомного развития резистентности.

Таким образом, в ОРН, при одновременной циркуляции разных Гр- микроорганизмов, возможно быстрое формирование госпитального штамма за счет приобретения негоспитальным штаммов генов, ответственных за антибиотикорезистентность и вирулентность. Вспышки, вызванные госпитальным штаммом, приводят к большей заболеваемости и смертности, по сравнению с негоспитальным.

Ванкомицинрезистентные энтерококки пока не вызывают вспышечной заболеваемости, но их появление может вызвать ряд проблем. Во-первых, к трудностям антимикробной терапии, поскольку VRE также резистентны к многим другим антибиотикам (напр. аминогликозидам и ампициллину). Кроме того, ген ванкомицин-резистентности (VAN A ген), возможно, может передаваться другим Гр+ микроорганизмам, таким как S.aureus. Поэтому крайне важно отслеживать инфицирование VRE не только клинического материала, но кожи и слизистых. Наш опыт показал, что проведение периодических поперечных исследований с исследованием колонизации кожи и слизистой оболочки полости рта VRE, дополнительно к микробиологическому мониторингу, позволяет идентифицировать циркуляцию VRE и рекомендовать соответствующие мероприятия. Нами была проведена серия таких иследований в 2 отделениях ОРН. При первом обследовании превалентность инфицированности VRE составила соответственно 13,6 [95% ДИ=3.6-32.8] и 16,7 [95%ДИ=5,5-35,5]. Инфекция дыхательных путей, связанная с искусственной вентиляцией легких выявлена у 1 из обследованных пациентов. Генетическое типирование показало, что выделенные штаммы VRE принадлежали к 3-м разным клонам. Наиболее распространенным был клон 1 (584312) (рис. 4). Данный клон отличался от других наличием гена поверхностного протеина (esp), который отвечает за вирулентность, адгезию и способность к образованию биопленок. Клон 2 и клон 3 не имели гена поверхностного протеина (esp).

ДГБ №1

Пост 1

Пост 2

Пост 3

Пост 4

Клон 1 (584321)

Клон 1 (584321)

Клон 1 (584321)

Клон 2 (584423)

Пациент С.

Пациент Б.

Пациент А.

Пациент К.

Весы

Пациент Кт.

Весы

Процедурный стол

ДГБ №17

Пост 1

Пост 2

Клон 1 (584321)

Клон 3 (584323)

Пациент А.

Пациент Р.

Пациент Ш.

Процедурный стол

Форма м/c

Рис.4. Пространственная характеристика распространения различных клонов VRE.

Таким образом, штаммы, имеющие ген esp имеют преимущественное распространение в условиях лечебного учреждения.

После первого поперечного обследования администрации отделений было рекомендовано проведение строгой контактной изоляции пациентов, инфицированных VRE. В отделении, где были выполнены строгие меры контактной изоляции, новых случаев колонизации новорожденных VRE выявлено не было. В отделении, где эти меры выполнены не были, выявлены 2 новых случая колонизации новорожденных VRE (превалентность составила 8,3 на 100 пациентов). Выделенные штаммы относились к клону 1. Таким образом, наличие у штаммов VRE гена esp свидетельствует о приобретении микроорганизмом свойств госпитального штамма, которые способствуют длительной его циркуляции в отделении.

Внутрибольничная колонизация VRE опасна также возможностью выноса данного штамма микроорганизма за пределы стационара, что может привести к риску внебольничного распространения VRE. Наши исследования показали, что после перевода новорожденного из отделения реанимации в течение 2 недель происходит реколонизация ванкомицинчувствительными энтерококками.

Результаты внедрения разработанных профилактических и

противоэпидемических мер

Гр – микроорганизмы являются наиболее значимыми в этиологии ИСМП новорожденных. Внедрение разработанных нами, на основании результатов эпидемиологической диагностики, мероприятий, позволило, в первую очередь, снизить циркуляцию данных микроорганизмов в ОРН. Так, этиологическая структура микроорганизмов, выделенных от пациентов отделения реанимации новорожденных, при поступлении в отделение за 9 лет изменялась незначительно. В то время как в период пребывания в отделении доля Гр- микроорганизмов и грибов снизилась с 60% до 25%.

Одним из индикаторных показателей здоровья население является показатель младенческой смертности. До внедрения современной системы эпидемиологического надзора в ОРН, ИСМП играли одну из ведущих причин смертности. Переход на критерии мертворождения и живорожденности, рекомендованные Всемирной Организацией Здравоохранения, повлекло за собой увеличение пациентов с низкой и экстремально низкой массой тела. Именно эта группа пациентов является группой риска развития ИСМП. В период с 2001 по 2010 годы в ОРН удельный вес пациенто-дней новорожденных детей с экстремально низкой массой тела (менее 1000 гр.) возрос с 20% до 58%.

Рис 5. Динамика поступления пациентов с экстремально низкой массой тела (ЭНМТ до 1000 г) при рождении и смертности пациентов ОРН от ИСМП.

Несмотря на это, смертность от инфекций прогрессивно снижалась. Если в 90-е гг. прошлого века смертность от ИМСП колебалась от 12 до 4 на 100 пациентов ОРН, то в последующем ее удалось снизить до 0.

Выводы

  1. Основными причинами высокой заболеваемости ИСМП (частота инфекций нижних дыхательных путей составила 29,7 на 100 пациентов, генерализованных инфекций – 10,3 на 100 пациентов) являлись отсутствие эпидемиологического наблюдения и микробиологического мониторинга, несвоевременная диагностика инфекций, высокая частота заносов инфекций из родильных домов, отсутствие адекватных профилактических и противоэпидемических мероприятий.
  2. Вспышки ИСМП в современный период с высокой заболеваемостью и летальностью, а также длительная циркуляция штаммов, обусловлены приобретением ими госпитальных свойств, прежде всего за счет увеличения вирулентности. Так, штамм A.baumannii, вызвавший вспышку с летальностью 25%, обладал геном с RTX с кальций-связывающего цитотоксина, а ванкомицинрезистентные энтерококки – esp геном.
  3. Особенностью эпидемиологического наблюдения в отделениях реанимации, в отличие от отделений другого профиля, является необходимость выявления и учета не только манифестных форм инфекции, но и колонизации. Рекомендовано проводить микробиологическое обследование пациентов ОРН по следующей схеме: посевы крови, кала, смыва из трахеобронхиального дерева, желудочного содержимого, мочи (при наличии инвазивных устройств) на 1-е, 4-е, 8-е сутки и далее еженедельно.
  4. Эпидемиологический анализ должен включать: анализ текущей эпидемической ситуации в отделении, анализ развития эпидемической ситуации в отделении, анализ тенденций развития эпидемического процесса, анализ факторов риска развития ИСМП. Это позволяет своевременно выявлять эпидемическое неблагополучие, факторы, повлекшие его возникновение, оценивать проводимые мероприятия по его купированию, определять факторы риска развития внутрибольничных инфекций и проводить анализ эффективности внедряемых мероприятий. При отсутствии текущего эпидемиологического анализа инцидентность ИСМП возросла с 10,6 на 100 пациентов до 29,3 на 100 пациентов (p<<0,01), а смертность от ИСМП с 0,6 на 100 пациентов до 4,2 на 100 пациентов (p=0,0004).
  5. Основными причинами возникновения эпидемического неблагополучия в современный период являются высокая частота использования инвазивных манипуляций, увеличение количества новорожденных с экстремально низкой массой тела, циркуляция микроорганизмов с множественной антимикробной устойчивостью, приобретение штаммами госпитальных свойств с увеличением вирулентности, нерациональное применение антибиотиков, низкое соблюдение гигиены рук, высокая нагрузка на медицинский персонал.
  6. Частота распространения антибиотикорезистентных штаммов выше, по сравнению с антибиотикочувствительными. Так, частота распространения S.epidermidis, устойчивого гентамицину и цефатоксиму, была в 3 раза выше, по сравнению с чувствительным, а K.pneumoniae - в 4 раза. Наиболее неблагоприятной является внутрибольничная колонизация Klebsiella pneumoniae (индекс манифестации 28%) и Pseudomonas aeruginosa (индекс манифестации 32%), поскольку среди колонизированных пациентов данными микроорганизмами достоверно чаще возникали манифестные формы инфекций p=0,03).
  7. Низкая масса тела является важным фактором риска возникновения манифестных форм инфекций, но не является фактором риска колонизации новорожденных УПМ.
  8. Для внедрения гигиены рук необходимо не только бесперебойное обеспечение средствами для гигиены рук, но и проведение многомерных мультидисциплинарных вмешательств по улучшению качества гигиены рук. Внедрение данных мероприятий увеличило частоту гигиенической антисептики рук с 0% до 30% до проведения манипуляций и с 0% до 58% после манипуляций в одном ОРН, и с 3% до 34% до проведения манипуляций и с 0% до 39% после манипуляций в другом ОРН. Частота внутрибольничной колонизации снизилась с 28,1 до 7,6 на 1000 пациенто-дней, а ИСМП – с 11,9 до 4,1 на 1000 пациенто-дней.
  9. Внедрение мероприятий профилактики инфекций нижних дыхательных путей и инфекций кровотока позволило снизить частоту ИСМП в ОРН. После введения этих мер, частота колонизации нижних дыхательных путей P. aeruginosa снизилась с 17,2 до 1,2 на 100 пациентов, K.pneumoniae – с 11,3 до 5,4, Candida sp. – с 9,8 до 1,5, E.coli – с 7 до 2,6 и S.pneumoniae – с 3,2 до 0,07; частоту инфекций кровотока с 7 до 0,3 на 100 пациентов.
  10. Для эмпирической терапии новорожденных при поступлении в ОРН рекомендованы ампициллин или комбинация с гентамицином. Увеличение частоты назначения цефотаксима при поступлении в ОРН с 30% до 70% пациентов, привело к росту частоты выделения резистентных к нему штаммов K.pneumoniae от 6% до 37%. Ограничение применения этого препарата помогло снизить частоту выделения антибиотикорезистентных штаммов до 9%.
  11. Для коррекции применения антибиотиков в период пребывания в ОРН необходим постоянный микробиологический мониторинг, анализ структуры и динамики выделяемых микроорганизмов и их антибиотикорезистентности в каждом ОРН. Кроме того, необходим анализ и коррекция применения антибиотиков в зависимости от конкретной эпидемической обстановки в отделении. Вмешательства, направленные на снижение применения антибиотиков широкого спектра действия позволили снизить потребление антибиотиков резерва с 566 до 165 суточных доз/1000 пациенто-дней.
  12. Внедрение протокола применения антифунгальных средств позволило снизить смертность от внутрибольничного кандидоза с 5,5 до 0,5 на 100 новорожденных.
  13. Внедрение современной системы эпидемиологического надзора в отделениях реанимации позволило снизить частоту ИСМП (с 40 на 100 пациентов до 5,6 на 100 пациентов), а также смертность от ИСМП (с 12 на 100 пациентов до 0 на 100 пациентов).

Практические рекомендации

  1. Внедрение системы профилактических и противоэпидемических мероприятий требует изменения организации работы медицинского персонала. Должно соблюдаться адекватное соотношение среднего медицинского персонала и пациентов, целесообразно выделение медицинского персонала, отвечающего за определенные специфические разделы работы, введение в штат должность сестры по инфекционному контролю.
  2. Микробиологический мониторинг в отделениях реанимации новорожденных должен включать в себя не только обследования по клиническим показаниям, но и микробиологического обследования пациентов на рутинной основе по разработанной схеме. Целесообразно проводить микробиологическое обследование пациентов, имеющих инвазивные устройства в 1-е, 4-е, 7.-е сутки после поступления и далее через каждые 7 дней.
  3. Для идентификации циркуляции ванкомицинрезистентных энтерококков следует проводить периодические поперечные микробиологические обследования клинического материала пациентов, а также смывов с кожи и слизистой оболочки полости рта
  4. В ОРН должно быть организовано постоянное эпидемиологическое наблюдение. Информация, собираемая о каждом пациенте должна включать: дату рождения, учреждение, где родился ребенок, массу тела при рождении, дату поступления в ОРН, местоположение в ОРН, результаты микробиологических исследований, диагноз ИСМП, дату возникновения инфекции, антимикробную терапию (наименование антибиотика, даты его назначения и отмены). Для корректного сопоставления данных, необходимо выбрать соответствующие знаменатели для расчета показателей. С этой целью ежедневно должны собираться следующие данные: количество пациентов в отделении, из них количество пациентов, находящихся на ИВЛ, с желудочным зондом, с центральным катетером, с мочевым катетером. В отделениях для новорожденных все эти факторы должны учитываться для разных весовых категорий.
  5. При проведении текущего анализа необходимо учитывать следующие основные факторы: эпидемическая ситуация в учреждении (отделении), откуда поступил пациент; клинический материал, из которого выделен патоген; местоположение инфицированных пациентов в отделении.
  6. При проведении текущего анализа используются описательные методы эпидемиологии. При расследовании вспышек, должны использоваться аналитические методы исследования, такие как когортное исследование.
  7. Для внедрения гигиены рук необходимо бесперебойное обеспечение средствами для гигиены рук. Средства для гигиены рук должны находиться в непосредственной близости от пациента. Внедрения гигиены рук предусматривает проведение многомерных мультидисциплинарных вмешательств по улучшению качества гигиены рук. Необходимо проводить систематическую оценку частоты соблюдения требований гигиены рук медицинским персоналом.
  8. Изоляционно-ограничительные мероприятия должны применяться к пациентам с манифестной формой инфекций; пациентам, колонизированным штаммами микроорганизмов с множественной антибиотикорезистентностью; новорожденным, поступающим из учреждений (отделений), в котором выявлено эпидемическое неблагополучие.
  9. В отделениях с высоким риском перекрестного инфицирования и высокой восприимчивостью пациентов, таких как отделения реанимации новорожденных, контактные меры предосторожности должны использоваться при контакте с любым пациентом.
  10. Для профилактики инфицирования нижних дыхательных путей должны быть внедрены следующие мероприятия:
  • для увлажнения воздуха необходимо использовать только стерильную воду
  • для санации трахеобронхиального дерева необходимо использовать отсосные катетеры и стерильную воду однократного применения
  • вакуумными отсосами должно  быть оборудовано каждое реанимационное место
  • санация должна проводиться в чистых перчатках однократного применения
  • перед и после проведения интубации и санации необходимо обрабатывать руки безводным антисептиком
  • применение алгоритмов интубации и проведения санации трахеобронхиального дерева новорожденных
  • дыхательные контуры должны быть, либо одноразовыми, либо подвергаться дезинфекции высокого уровня
  1. Для профилактики инфекций кровотока должны быть внедрены следующие мероприятия:
  • отказ от венесекций
  • катетеризация центральных вен методом пункции
  • введение в штат процедурных медицинских сестер, ответственных за постановку и уход за катетерами
  • постановка катетера в стерильной одежде, стерильных перчатках
  • внедрение гигиенической антисептики рук и использование стерильных перчаток при любых манипуляциях, связанных с катетерами
  • приготовления внутривенных растворов в специально оборудованном для этого помещении, оснащенном шкафом с ламинарным потоком воздуха
  1. При купировании следует выполнять ряд общих мероприятий:
  • поперечное одномоментное микробиологическое обследование всех пациентов для выявления всех источников инфекции. Помимо клинического материала дополнительно исследуются смывы с кожи и слизистой оболочки полости рта
  • микробиологическое обследование объектов внешней среды
  • доведение информации о сложившемся эпидемическом неблагополучии и необходимых мероприятиях для его купирования до персонала отделения и администрации больницы
  • Когортная изоляция инфицированных пациентов (с манифестными формами и колонизированных «вспышечными» штаммами)
  • проведение всех манипуляций у всех пациентов (инфицированных и неинфицированных) в одноразовых перчатках и фартуках
  • контроль применения антибиотиков
  • ежедневная обработка кожи новорожденных 1% водным раствором хлоргексидина
  1. В качестве стартовой антибактериальной терапии необходимо применять ампициллин или его комбинацию с гентамицином.
  2. Коррекция применения антибиотиков в отделении проводится на основании следующих данных: анализа частоты колонизации антибиотикорезистентными штаммами, антибиотикорезистентности выделенных микроорганизмов, утилизации антибиотиков.
  3. Антифунгальные препараты должны применяться в следующих случаях:
  • С лечебной целью: при подтвержденной кандида-инфекции,
  • С профилактической целью: пациентам, у которых из клинического материала были выделены грибы рода Candida, даже при отсутствии клинической картины инфекции, новорожденным с массой тела менее 1500 г (на 7 сутки жизни), пациентам, получающим массивную антибактериальную терапию препаратами широкого спектра действия.

Список научных работ, опубликованных по теме диссертации

  1. Любимова А.В. Нозокомиальный кандидоз в отделении интенсивной терапии педиатрической клиники / О.З. Караев, В.В. Власюк, Т.С. Богомолова, М.М. Волкова, Е.В. Пронина, А.В.Любимова // Тезисы докладов XII конгресса Польского дерматологического общества. – Гданьск, 1992. - С. 89-90.
  2. Любимова А.В. Организация эпидемиологического надзора за внутрибольничными инфекциями в отделении реанимации новорожденных / А.В. Любимова // Медико-биологические проблемы адаптации: сб. науч. тр. – СПб: СПбГМА, 1994. - С. 50-54.
  3. Любимова А.В. Оценка резистентности к антибиотикам и дезинфектатнтам Candida albicans, циркулирующих в отделениях реанимации новорожденных / В.В. Павлов, А.В.Любимова, С.Р.Еремин // Проблемы санитарно-эпидемиологического благополучия населения: сборник научных трудов – СПб: СПбГМА им. И.И.Мечникова, 1996. – Ч. 2 - С. 97-99
  4. Lubimova A.V. Elaboration of nosocomial infection surveillance and control programme on the basic of ecological approach. / L.P. Zueva, Eremin S.R., A.V. Lyubimova, R.H. Yafaev // 2-nd Nordic Baltic Congress on infections diseases "Prevention in Focus". - Riga, 1996 - P. 80-81
  5. Любимова А.В. Опыт применения бакпрепаратов для лечения дизбактериоза в реаниматологической практике / С.З. Поляков, А.В.Любимова, Т.Е. Кирчикова // Современная перинатология и перинатологические аспекты патологии детского возраста: мат. международной науч.-практ. конф.- СПб, 1996. -  Ч. II. - С. 23-24
  6. Любимова А.В. Эпидемиология госпитального кандидоза в отделении реанимации новорожденных / Л.П. Зуева, Л.П. Горобец // Там же. - С. 8-10
  7. Любимова А.В. Возможности применения комбинированных методов типирования С.albicans для установления эпидемиологических связей / Г.К. Дегтева, А.В.Любимова, Л.П. Зуева // Журнал микробиологии, эпидемиологии и иммунобиологии - М, 1997. - № 1. - С. 27-30
  8. Любимова А.В. Вспышка внутрибольничного кандидоза в гематологическом отделении / А.В.Любимова, Л.П. Зуева, Т.С. Соколова // Там же. - М, 1997. - № 1. - С. 31-33
  9. Lubimova A.V. Occupationally accquired nosocomial infections / S.R. Eremin, E.S. Tregubova, A.V. Lyubimova, R.H. Yafaev // 25-th International Congress on occupational Health. Stockholm. - 1996. - P. 158
  10. Любимова А.В. Кандидоз органов дыхания у детей до 1 года. Варианты течения, тактика терапии и профилактики / Е.В. Пронина, А.В. Любимова // Национальный конгресс по болезням органов дыхания. - Новосибирск, 1996. – С.13
  11. Любимова А.В. Эпидемиологический надзор за внутрибольничными инфекциями в отделениях реанимации новорожденных / А.В. Любимова, Л.П. Зуева, С.Р.Еремин, Б.М. Тайц // Эпидемиологический надзор. Теория, методы и организация: сборник статей. - СПб-Москва-Кемерово, 1997. - С. 167-172
  12. Любимова А.В. Организация инфекционного контроля в отделениях интенсивной терапии и реанимации новорожденных / А.В. Любимова, С.Р.Еремин, Л.П. Зуева и др. // Методические рекомендации. – СПб, 1997. – 21 с. Утверждены первым зам. предс. Комитета по здравоохранению Администрации Спб Б.М.Тайцем 17.03.97
  13. Lyubimova A.V. Hospital infection control in Russia: current situation and prospects for future development / S.R. Eremin, L.P. Zueva, A.V. Lyubimova et.al. // The IFIC Global Network Conference on safe and unsafe methods of Infection control. - 1997. -  Cambridge, United Kindom. - P. 34
  14. Любимова А.В. Основы инфекционного контроля. // Л.П. Зуева, С.Р.Еремин, Е.П. Ковалева. и др. / Практическое руководство / под редакцией Е.А. Бурганской – Вашингтон, 1997. – 429 с.
  15. Любимова А.В. Опыт применения бактериофага пиоцианеус для купирования синегнойной инфекции в отделении реанимации новорожденных / А.В. Любимова, С.Р.Еремин, Л.С. Гретченко // Материалы VII Съезда Всероссийского о-ва эпидемиологов, микробиологов и паразитологов. — М., 1997. — Т. 2. — С. 180—181.
  16. Любимова А.В. Стандарты инфекционного контроля для стационаров / Л.П. Зуева, С.Р. Еремин, А.В. Любимова, Г.И. Маркович // Методические рекомендации. – СПб, 1997. –13 с. Утверждены первым зам. предс. Комитета по здравоохранению Администрации СПб Б.М. Тайцем 20.06.97
  17. Любимова А.В. Эпидемиологические особенности госпитальных инфекций в отделениях реанимации новорожденных // О.В. Платошина, А.М. Герман / Медико-биологический конгресс. - СПб, 1997. - Tezis/03/3005.txt
  18. Любимова А.В. Современные методические подходы к организации учета и регистрации внутрибольничных инфекций // С.Р.Еремин, А.В. Любимова, Г.И. Маркович / Там же. - Tezis/03/3008.txt
  19. Любимова А.В. Оценка здоровья новорожденных в раннем неонатальном периоде в зависимости от состояния плаценты / А.В. Любимова, И.Г. Техова, А.С. Рудницкий, Д.Е. Еремина, Н.А. Павлова // Проблемы санитарно-эпидемиологического благополучия населения северо-западного и других регионов Российской Федерации: тезисы докл. науч. конф. – СПб, 1997. –  С.118
  20. Любимова А.В. Эпидемиология и профилактика гнойно-септических инфекций / Л.П. Зуева, Р.Х. Яфаев, С.Р.Еремин, Е.Н. Колосовская, А.В. Любимова, О.В. Платошина // Методические рекомендации. - СПб., 1997 – 26 с.
  21. Любимова А.В. Организационные и методические принципы контроля за инфекциями в стационарах / Тайц Б.М., Л.П. Зуева, О.В. Платошина, С.Р.Еремин, А.В. Любимова, Маркович Г.И. // Инфекционный контроль в лечебно-профилактических учреждениях: сб. науч. тр. / под ред. Зуевой Л.П. – СПб: СПбГМА им. И.И. Мечникова, 2000. – С. 15-20
  22. Любимова А.В. Результаты внедрения инфекционного контроля в отделении реанимации новорожденных / А.В. Любимова, Н.М. Хрусталева, Любименко В.А., С.В. Шулаева, П.Б. Коренев // Там же.– С. 33-35
  23. Любимова А.В. Состояние вопроса эпидемиологического наблюдения в Санкт-Петербурге / Л.П. Зуева, А.В. Любимова, А.М. Герман, О.В. Платошина, С.Р.Еремин // Там же. – С.49-51
  24. Любимова А.В. Учет и регистрация госпитальных инфекций: проблемы и пути решения / Там же. – С. 56
  25. Любимова А.В. Вспышка, вызванная Serratia marcesens в отделении реанимации новорожденных / А.В. Любимова, Н.М. Хрусталева, В.А. Любименко, Е.Н. Колосовская, А.В. Сидорчук, В.В. Бондарев // Там же. – С .87-88
  26. Любимова А.В. Влияние мер инфекционного контроля на антибиотикорезистентность // А.В. Любимова, Н.М. Хрусталева, А.В. Любименко, О.Т. Морозова, Ю.В. Горелик / Клиническая микробиология и антимикробная терапия. – 2000. - Т. 2, Прил. 1. - С. 26
  27. Любимова А.В. Рекомендации по мытью и антисептике рук. Перчатки в системе инфекционного контроля / С.Р. Еремин, К.Д. Васильев, И.Г. Техова, А.В. Любимова, Е.С. Трегубова, С.М. Браун // Рекомендации по мытью и антисептике рук. Перчатки в системе инфекционного контроля / под ред. Л.П.Зуевой. - СПб: Санкт-Петербургский учебно-методический центр инфекционного контроля, 2000. – 20 с.
  28. Любимова А.В. Оценка тактики применения антибиотиков у рожениц, имеющих факторы риска инфекции, вызванной стрептококками группы В / Т.О. Романова, А.В. Любимова, Н.А. Балукова // Вестник СПб ГМА им. И.И. Мечникова СПб, 2001. - № 2-3. - С. 216-217
  29. Любимова А.В. Анализ этиологии колонизации и антибиотикорезистентности культур, выделенных у новорожденных при поступлении в отделение реанимации новорожденных / А.В. Любимова, В.А. Любименко, А.М. Пулин, С.В. Шулаева, Н.М. Зубарева, С.М. Браун // Достижения отечественной эпидемиологии в ХХ веке. Взгляд в будущее: материалы науч. конф. с международным участием, посвященная 80-летию со дня рожд. академика В.Д. Белякова. – 2001. –С. 296.
  30. Любимова А.В. Сравнительный анализ применения и расходов на антимикробные препараты в отделении реанимации новорожденных у пациентов с внутрибольничной колонизацией и без нее / А.В. Любимова, Н.Л. Каткова, Н.М. Хрусталева, С.В. Шулаева // Клинические перспективы в инфектологии: материалы Всероссийской научной конференции. – СПб, 2001. – С. 164
  31. Lyubimova A.V. Use of alcohol handrub decreased transmission of Klebsiella pneumoniae (KPN) with minimal effect on overall compliance / S.M. Brown, A.V. Lyubimova, N.M. Khrustalyeva, S.V. Shulaeva, L.P. Zueva, D. Goldmann // Там же. – P. 89
  32. Lyubimova A.V.  Antibiotic Usage and Antimicrobial Resistance in a Neonatal Intensive Care Unit in the Former Soviet Union / A.V. Lyubimova, S.M. Brown, N.M. Khrustalyeva, S.R. Eremin, S.V. Shulaeva, L.P. Zueva // [abstract K-1238]. In: Abstracts of the 41st Interscience Conference on Antimicrobial Agents and Chemotherapy. - Chicago, 2001. – P .419
  33. Любимова А.В. Опыт внедрения инфекционного контроля в детской многопрофильной больнице // Н.М. Хрусталева, А.В. Любимова, С.В. Шулаева / Сборник научных трудов, посвященный 25-летию Детской городской больницы №1. - CПб, 2002 – C. 18-22
  34. Lyubimova A.V. Evaluating Hospital-Wide Anti-Microbial Use With Serial Point-Prevalence Studies / G. Kurtsikashvili, S. Eremin  S. Brown, A. Lyubimova, E. Tsertsvadze, M. Ghadua // In: Final Program of the 12th Annual Meeting of the Society for Healthcare Epidemiology of America. - Salt Lake City, 2002. - P. 42
  35. Lyubimova A.V. Introduction of Modern Infection Control in a Tertiary Care Neonatal Intensive Care Unit in Russia // A. Lyubimova, N. Khrustalyova, S. Brown, S. Shulaeva, V. Lyubimenko,  S. Eremin / Там же. – P. 48
  36. Lyubimova A.V. Incidence of Surgical Site Infections and Antibiotic Usage in Pediatric Surgery at a Tertiary Care Hospital in St.Petersburg, Russia / N. Khrustalyova, L. Zueva, P. Korenev, M. Kuchinskiy, S. Eremin // Там же. - P. 79
  37. Lyubimova A.V. Use of alcohol-based hand rub and quality improvement interventions to improve hand hygiene in a Russian neonatal intensive care unit // S. Brown , A.V. Lyubimova, N. Khrustalyeva, S. Shulaeva, I. Techova // J. Infection control and hospital epidemiology. 2003. -  V.24, N.3. - P. 172-179
  38. Любимова А.В. Эффективность внедрения в ЛПУ системы инфекционного контроля / Н.М. Хрусталева, Л.П. Зуева, А.В. Любимова, В.А. Любименко, С.В. Шулаева // Главная медицинская сестра.  – М, 2002. - №8. - С. 85-89
  39. Любимова А.В. Разработка и внедрение системы инфекционного контроля, оценка её эффективности в отделении реанимации новорожденных / А.В. Любимова, Н.М. Хрусталева, Л.П. Зуева, В.А. Любименко, С.В. Шулаева // Сборник докладов и тезисов.II Съезд межрегиональной ассоциации общественных объединений анестезиологов и реаниматологов северо-запада. – Архангельск, 2003. – С. 212-213
  40. Любимова А.В. Профилактика кандидоза в отделении реанимации новорожденных / А.В. Любимова // Там же. – С.213-214
  41. Любимова А.В. Применение изоляционно-ограничительных мероприятий в отделении реанимации новорожденных для контроля распространения антибиотикорезистентных микроорганизмов / А.В. Любимова, А.М. Пулин // Там же. – С. 215-216
  42. Любимова А.В. Политика применения антимикробных средств в отделении реанимации новорожденных / А.В. Любимова, А.М. Пулин, А.А. Цветкова, С.З. Поляков, Г.Р. Рубин, Т.С. Курчикова // Там же. – С. 214-215
  43. Любимова А.В. Частота возникновения инфекций в области хирургического вмешательства и применение антибиотиков в детской хирургии / А.В. Любимова, С.Р. Еремин, Н.М. Хрусталева, П.Б. Коренев, М.П. Кучинский, Е.М. Поляков // Там же. - С. 17
  44. Любимова А.В. Госпитальные инфекции в лечебно-профилактических учреждениях России и Санкт-Петербурга / Л.П. Зуева, А.В. Любимова, Г.И. Сухомлинова, Е.Н. Колосовская, И.Г. Техова, А.М. Герман // Опыт внедрения системы  инфекционного контроля в лечебно-профилактических учреждениях: сб. науч. тр. / под ред Зуевой Л.П. – СПб: СПбГМА им. И.И. Мечникова, 2003. - С. 17-23
  45. Любимова А.В. Стандарты инфекционного контроля – методическая база системы контроля за инфекциями внутри лечебно-профилактических учреждений / Л.П. Зуева, С.Р. Еремин, Г.И. А.В. Любимова, Сухомлинова, Е.Н. Колосовская, О.В. Парков // Там же. - С. 23-31
  46. Любимова А.В. Разработка и внедрение системы инфекционного контроля в родильном доме и оценка ее эффективности / Е.Б. Мясникова, Л.П. Зуева, Е.Н. Колосовская, И.Г. Техова, А.В. Любимова, Е.В. Соусова // Там же. - С. 70-91
  47. Любимова А.В. Успехи внедрения системы инфекционного контроля в отделениях реанимации новорожденных / А.В. Любимова, Л.П. Зуева., С.Р. Еремин, Н.М. Хрусталева, В.А. Любименко, А.М. Пулин // Там же. - С. 91-129
  48. Любимова А.В. Основные направления внедрения системы инфекционного контроля в акушерском стационаре / Е.Б. Мясникова, Л.П. Зуева, И.Г. Техова, Е.В. А.В. Любимова, Соусова, Б.И. Асланов // Современные проблемы эпидемиологии, диагностики и профилактики внутрибольничных инфекций: материалы 3-й Российской научно-практической конференции с международным участием – СПб, 2003. - С. 35-37
  49. Любимова А.В. Повышение качества оказания медицинской помощи в акушерском стационаре за счет внедрения стандартов инфекционного контроля / А.В. Любимова // Там же. - С.214-216
  50. Любимова А.В. Гигиена рук медицинского персонала / С.Р. Еремин, А.В. Любимова // Там же. - С.252-253
  51. Любимова А.В. Основы инфекционного контроля: Практическое руководство / П. Экерман, М Бракман, Л.П. Зуева, Е.Н. Колосовская, С.Р. Еремин, А.В. Любимова и др. // Основы инфекционного контроля: Практическое руководство/Американский международный союз здравоохранения. – Пер. с англ., 2-е изд. – М.: Альпина Паблишер, 2003. – 478 с.
  52. Любимова А.В. Рекомендации по мытью и антисептике рук. перчатки в системе инфекционного контроля / Л.П. Зуева, К.Д. Васильев, С.Р. Еремин, А.В. Любимова, И.Г. Техова, Е.С. Трегубова // Практическое руководство. - СПб, 2004. – 38 с.
  53. Любимова А.В. ВБИ. Меры профилактики / Л.П. Зуева, С.Р. Еремин, А.В. Любимова, И.Г. Техова, Е.В. Соусова // Методические рекомендации  (в помощь практикующей медицинской сестре), рассмотренные и одобренные Научно-координационным советом СПбГМА им. И.И. Мечникова. –  СПб. Медицинский проект, 2004. –  64 с.
  54. Любимова А.В. Характеристика эпидемиологического процесса в отделении реанимации новорожденных / А.В. Любимова, Кудрявцев А.В., С.З. Поляков, А.М. Пулин // Педиатрия: из 19 в 21 век: материалы Российской научной конференции. – СПб, 2005. - С.117
  55. Любимова А.В. Инфекционный контроль в отделениях реанимации новорожденных / А.В. Любимова, Н.М. Хрусталева, С.В. Шулаева // Инфекционный контроль и биобезопасность: сборник материалов по программе обучения. - Стокгольм – СПб, 2005. – С.231-274.
  56. Любимова А.В. Разработка и внедрение системы инфекционного контроля, оценка ее эффективности в отделении реанимации новорожденных / Н.М. Хрусталева, А.В. Любимова, Л.П. Зуева, В.А. Любименко, С.В. Шулаева // Интенсивная терапия – Неонатология. – СПб, 2005. - №2. – С.74-78
  57. Любимова А.В. Эффективность системы инфекционного контроля в отделении реанимации новорожденных / А.В. Любимова, Л.П. Зуева, Е.М. Хрусталева, С.Р. Еремин // Эпидемиология, лабораторная диагностика и профилактика вирусных инфекций: материалы Российской научно-практической конференции. – СПб, 2005. - С.285-286
  58. Любимова А.В. Организация и результаты эпидемиологического наблюдения за хирургическими инфекциями в отделении реанимации новорожденных / Н.М. Хрусталева, А.В. Любимова, С.Р. Еремин // Сепсис: вопросы клинической патофизиологии, эпидемиологии, диагностики и интенсивной терапии: материалы межрегиональной научно-практической конф. - Кемерово, 2006. - С.75-76
  59. Любимова А.В. Проблемы рационального применения антимикробных препаратов в акушерской практике / А.В. Любимова, С.Р. Еремин, Е.Н. Квеквескири // Стационарзамещающие технологии: Амбулаторная хирургия. СПб, 2006. - № 1(21). - С.39-41
  60. Любимова А.В. Рациональное применение антимикробных  препаратов в период родов и в послеродовом периоде / Л.П. Зуева, А.В. Любимова, Е.Н. Квеквескири, Е.Н. Колосовская, И.Г. Техова // Информационное письмо. - СПб, 2006. – 30 с. утв. Первым заместителем Председателя КЗ Правительства СПб Жолобовым В.Е. 19.09.2006
  61. Lyubimova A.V. Overuse of broad-spectrum antibiotics and emergence of multiresistant Staphylococcus epidermidis in a neonatal intensive care unit / A. Lyubimova, A. Pulin, V. Levis // In: 7-nd Nordic Baltic Congress on infections diseases "Current challenges and new opportunities – Riga, 2006. – P.18
  62. Lyubimova A.V. Creating the first multi-hospital infection control team in Russia / A. Lyubimova, N. Khrustaleva, V. Leschinskaya // Там же. P.36
  63. Любимова А.В. Результаты рационального применения антимикробных препаратов в акушерской практике // А.В. Любимова, Л.П. Зуева, С.Р. Еремин, Е.Н. Квеквескири / Патология. - Ташкент, 2007. - №2. – С. 9 -11
  64. Любимова А.В. Разработка на международном уровне материалов для обучения медицинских работников вопросам инфекционного контроля / А. Гамбреус, Л.П. Зуева, И. Каллингс, У. Ридинг, А.В. Любимова, Т.Г. Иванова // Вестник Российской Военно-медицинской  академии. СПб, 2008. - №2 прил. часть I. - С.134-136
  65. Любимова А.В. Опыт использования дистанционного обучения в подготовке госпитальных эпидемиологов / Л.П. Зуева, И. Каллингс, А. Гамбреус, А.В. Любимова, Б.И. Асланов, Г.И. Сухомлинова // Там же. - С.150-151
  66. Любимова А.В. Организация эпидемиологического наблюдения за исходами хирургических вмешательств / Е.Н. Колосовская, Л.А. Кафтырева, М.Г. Дарьина, А.В. Любимова, А.В. Выгоняйлов, Б.И. Асланов // Методические рекомендации для врачей. - СПб, 2008. – 24с. утв. Первым заместителем Председателя КЗ Правительства СПб Жолобовым В.Е. 17.07.2008
  67. Любимова А.В. Исследование диагностической ценности результатов микробиологического обследования объектов внешней среды отделений реанимации новорожденных / А.В. Любимова, С.Р. Еремин // Вестник Российской Военно-медицинской  академии. СПб, 2008. - приложение №2 часть II. - С.488-489
  68. Любимова А.В. Факторы риска и купирование вспышки, вызванной мультирезистентным S. epidermidis в отделении реанимации новорожденных / А.В. Любимова, А.М. Пулин, Г.В. Рубин, Н.В. Сатосова // Там же. - С.494
  69. Любимова А.В. Внутрибольничные пневмонии / Эпидемиология: учебник // под  ред. проф. Зуевой Л.П. –  СПб.: Фолиант, 2008. – С. 627 – 634. Рекомендовано учебно-методическим объединением по медицинскому и фармацевтическому образованию вузов России в качестве учебника
  70. Любимова А.В. СП 3.1.2485-09 Профилактика внутрибольничных инфекций в стационарах (отделениях) хирургического профиля лечебных организаций / Л.П. Зуева, А.В. Любимова, Г.Ф. Лазикова, Н.В. Фролова, Т.И. Фролочкина, Н.А. Семина, Е.П. Ковалева и др. // Cанитарно-эпидемиологические правила. Зарегистрировано в Минюсте РФ 20 марта 2009 года. Регистрационный № 13548  - М, 2009 – 46 с.
  71. Любимова А.В. Госпитальные инфекции в отделении реанимации многопрофильного стационара / Е.В. Кучеренко, Л.П. Зуева, А.В. Любимова // Инфекции в хирургии. - СПб, 2008. - Том 6, №3. С.28 30
  72. Любимова А.В. Эпидемиология раннего неонатального сепсиса / А.В. Любимова, А.М. Пулин, Л.В. Широкова, М.В. Гайсина // Преждевременные роды: материалы международной междисциплинарной конференции. – СПб, 2010. – С.28
  73. Любимова А.В. Перспективы стратегии интенсивной терапии новорожденных детей с низкой и экстремально низкой массой тела / Ю.С. Александрович, В.И. Горбачев, А.М. Пулин, А.В. Любимова, Ж.Г. Кадышевич, А.Н. Кянгсеп // Сибирский медицинский журнал. Иркутск, 2010. - №7. С. 12-16
  74. Lyubimova A.V. An outbreak caused by a single clone of Acinetobacter baumani in two neonatal intensive care units / T. Smirnova, A. Lyubimova, A. Goncharov, A. Solomenny // Global Congress of Maternal and Infant Health Barcelona. - 2010. - Р.26
  75. Любимова А.В. Основные компоненты инфекционного контроля в отделении реанимации и интенсивной терапии новорожденных / А.В. Любимова, Л.П. Зуева, А.М. Пулин, Ю.С Александрович // Эферентная терапия СПб, 2010. - №3. С.91-97
  76. Любимова А.В. Вспышка Acinetobacter baumani в двух отделениях реанимации новорожденных, вызванная одним клоном / А.В. Любимова, А.Е. Гончаров, А.М. Пулин, Т.В. Смирнова, Г.Н. Иванов // Материалы III съезда военных врачей медико-профилактического профиля вооруженных сил России. – СПб, 2010. - С.135
  77. Любимова А.В. Вспышка острых респираторных заболеваний разной этиологии среди новорожденных в детской городской больнице / А.В. Любимова, Е.В. Матвеева, А.М. Пулин // Там же. - С.151
  78. Любимова А.В. Разработка стартовой схемы применения антибиотиков в отделении реанимации новорожденных / А.В. Любимова, Л.П.Зуева, Б.И. Асланов, А.Е. Гончаров // Профилактическая и клиническая медицина. СПб, 2011. - №.2., Т.2. - С. 61-63
  79. Любимова А.В. Обоснование мониторинга чувствительности к дезинфектантам микроорганизмов, циркулирующих в стационарах / Л.П. Зуева, Е.Н. Колосовская, А.В. Любимова, Б.И. Асланов, А.Е. Гончаров, Ю.С. Светличная // Дезинфекционное дело. М, 2011. - № 2. - С. 45-48
  80. Любимова А.В. Проблемы организации дезинфекционно-стерилизационных мероприятий в учреждениях здравоохранения. Пути решения / И.Г. Техова, М.Г. Дарьина, А.В. Любимова, А.В. Выгоняйлов, Б.И. Асланов, В.Ю. Хорошилов, Н.В. Сатососва, А.А. Долгий // Дезинфекционное дело. М. 2011. - № 3. - С.
  81. Любимова А.В. Микробиологический мониторинг в отделениях реанимации новорожденных / А.В. Любимова, Л.П. Зуева, А.М. Пулин, Н.В. Сатосова // Эпидемиология и иммунопрофилактика. М, 2011. - №4. С.
  82. Любимова А.В. Превалентность колонизации ванкомицинрезистентными энтерококками пациентов отделения реанимации новорожденных / А.В.Любимова, Л.П.Зуева, В.В.Колоджиева, А.Е.Гончаров // Эпидемиология и иммунопрофилактика. М, 2011. - №4. С.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.