WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


МОСКОВСКИЙ ОРДЕНОВ ЛЕНИНА, ОКТЯБРЬСКОЙ РЕВОЛЮЦИИ И ТРУДОВОГО КРАСНОГО ЗНАМЕНИ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ имени М.В. ЛОМОНОСОВА Химический факультет

На правах рукописи

ПЫШНЫЙ ДМИТРИЙ ВЛАДИМИРОВИЧ

МОЛЕКУЛЯРНЫЕ ИНСТРУМЕНТЫ НА ОСНОВЕ СОСТАВНЫХ ОЛИГОНУКЛЕОТИДНЫХ КОНСТРУКЦИЙ

02.00.10 – биоорганическая химия

АВТОРЕФЕРАТ

диссертации на соискание учёной степени доктора химических наук

Москва – 2011

Работа выполнена в лабораториях бионанотехнологии и химии нуклеиновых кислот Учреждения Российской академии наук Институт химической биологии и фундаментальной медицины СО РАН, г. Новосибирск.

Официальные оппоненты:

доктор химических наук, академик РАН Мирошников Анатолий Иванович доктор химических наук Долинная Нина Германовна доктор химических наук, профессор Позмогова Галина Евгеньевна

Ведущая организация: Учреждение Российской академии наук Институт молекулярной биологии имени В.А. Энгельгардта РАН

Защита состоится « 25 » октября 2011 г. в 15.00 часов на заседании Диссертационного совета Д 501.001.41 по химическим наукам при Московском государственном университете имени М.В. Ломоносова по адресу: 119991, Москва, Ленинские горы, НИИ физико-химической биологии имени А.Н. Белозерского МГУ, аудитория 501.

С диссертацией можно ознакомиться в библиотеке химического факультета МГУ имени М.В. Ломоносова.

Автореферат разослан « » 2011 г.

Учёный секретарь Диссертационного совета, кандидат химических наук Смирнова И.Г.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность проблемы. Олигонуклеотиды – короткие синтетические фрагменты нуклеиновых кислот (НК) – широко используют в качестве молекулярных инструментов для изучения различных биохимических процессов, специфических зондов в системах НК-диагностики, а также ген-направленных биологически активных препаратов. Относительно недавно продемонстрирована возможность использования олигонуклеотидов в качестве строительных блоков при формировании наноструктур, обладающих заранее заданными геометрическими характеристиками. Столь обширные области применения обусловлены способностью олигонуклеотидов образовывать прочные двухцепочечные (дц) комплементарные комплексы. Современные возможности химии НК позволяют получать любые олигонуклеотидные последовательности и производные на их основе, что определяет необходимость разработки фундаментальных принципов выбора структуры синтетических НК-конструкций в строгом соответствии с целями и задачами исследований. Однако направленный выбор структуры олигонуклеотидов возможен лишь при наличии алгоритмов прогностического расчета физико-химических и/или субстратных свойств формируемых ими комплексов с НК. Такие алгоритмы могут быть разработаны при создании детализованных модельных описаний структурно-функциональных особенностей НКкомплексов. Известны (SantaLucia J., 2004, Owсzarzy D. et al., 2008) унифицированные термодинамические параметры образования отдельных элементов дцДНК, как комплементарных, так и несовершенных, в различных буферных растворах. Однако изменение типа комплекса, введение модифицированных компонентов (например, «скованных» НК (LNA), пептидил-НК (PNA), морфолино-НК) или формирование структуры, элементы которой не параметризованы с точки зрения энергетических эффектов, сокращают спектр возможных приложений даже этих хорошо изученных классов олигонуклеотидов, в том числе в присутствии НК-зависимых ферментов.

Таким образом, разработка любых новых типов производных или аналогов НК требует детального описания физико-химических и биохимических свойств вновь создаваемых молекулярных инструментов. С другой стороны, массив данных, накопленных за десятилетия после расшифровки структуры дцДНК, огромен, и рациональное использование этой информации может привести к созданию новых универсальных путей использования нативных олигонуклеотидных блоков в качестве компонентов оригинальных конструкций, сочетающих в себе функциональные характеристики природных НК. С этой точки зрения наиболее оптимальными являются составные олигонуклеотидные конструкции: тандемы, конкатемеры и мостиковые олигонуклеотиды (МО) с ненуклеотидными вставками в углеводно-фосфатном остове. Тандемы олигомеров или их «сшитые» аналоги, МО, формируют с адресной НКпоследовательностью комплексы без пробелов, составленные из нативных блоков и содержащие либо одноцепочечный (оц) разрыв, либо ненуклеотидное выпетливание. Изменяя структуру составных олигонуклеотидов, удается регулировать стабильность формируемых ими дуплексов, сохранять их способность выступать в качестве субстратов для различных НК-зависимых ферментов, создавать новые инструменты для гибридизационного анализа НК (Dirks R.M. et al., 2004), а также системы внутриклеточной доставки сиквенс-специфичных агентов (Simonova O.N. et al., 2006) и сборки генов (Gupta N.K. et al., 1968; Shabarova Z.A. et al., 1991). Известен ряд описаний феноменологических моделей образования составных НК-дуплексов (Asseline U. 1985; Shabarova Z.A. et al., 1991;

Walter A.E., et al., 1994), однако комплексной физико-химической характеризации таких молекулярных систем не проводили. Данное обстоятельство ограничивает потенциал использования составных олигонуклеотидов и сужает сферы их применений в ДНК-диагностике, разработке ген-направленных агентов, ДНК-архитектонике.

Целью данной работы являлось комплексное решение фундаментальной проблемы выявления строгой взаимосвязи структуры и физико-химических свойств с функциональной значимостью составных ДНК-комплексов на основе тандемных олигонуклеотидных конструкций, включая конкатемеры, и мостиковых олигонуклеотидов, содержащих ненуклеотидные вставки.

В ходе работы было необходимо решить следующие основные задачи:

1) разработать комплексный подход к исследованию пространственной структуры, физико-химических свойств составных комплексов олигодезоксирибонуклеотидов (кинетических и термодинамических параметров комплексообразования), образованных с участием нативных НК-компонентов и их производных, позволяющий выявлять структурные элементы, влияющие на эффективность формирования таких типов комплексов, как полностью комплементарных, так и содержащих мисматчи;

2) определить набор и величины унифицированных термодинамических параметров, обеспечивающих возможность прогностического расчета температуры плавления составных ДНК/ДНК-комплексов и термодинамических параметров (энтальпии H, энтропии S и свободной энергии G ) их формирования T в стандартных условиях (1 M NaCl, нейтральный pH), а также характера изменения данных величин при изменении состава буферных растворов;

3) систематически исследовать закономерности превращения составных олигонуклеотидных комплексов в реакциях, катализируемых ДНК-зависимыми ферментами (ДНК-лигазой фага Т4 и ДНК-полимеразой Thermus аquaticus), и разработать на основе выявленных закономерностей алгоритмы выбора структуры инструментов для молекулярно-биологического анализа и высокоселективных зондов, а также новые подходы к созданию систем ДНК-диагностики.

Научная новизна и практическая ценность работы Настоящая работа представляет собой первое систематическое исследование, направленное на изучение фундаментальных принципов формирования комплексов составных олигонуклеотидных конструкций с ДНК и их использование в качестве молекулярных инструментов в молекулярно-биологической и ДНК-диагностической практиках.

Впервые проведено системное исследование закономерностей образования составных комплексов олигодезоксирибонуклеотидов, направленное на изучение их пространственной структуры, кинетических и термодинамических параметров комплексообразования нативных НК-компонентов или их производных с ДНК. Определен характер влияния различных структурных элементов нуклеотидной и ненуклеотидной природы (ароматические и стероидные остатки, вставки на основе фосфодиэфиров олигоэтиленгликолей и олигометилендиолов и др.), наличие которых в составных конструкциях определяет эффективность формирования комплементарных и несовершенных комплексов.

Для тандемных комплексов и дуплексов на основе мостиковых олигонуклеотидов определены величины унифицированных термодинамических параметров, обеспечивающие возможность прогностического расчета температуры плавления их ассоциатов с ДНК, и предложен новый способ количественной оценки масштаба изменения термостабильности составных комплексов при варьировании концентрации противоионов в растворе. Разработана термодинамическая схема описания распределения равновесных форм при образовании конкатемерных ДНК-комплексов – перспективных систем усиления сигнала при гибридизационном анализе НК и систем доставки олигонуклеотидных агентов внутрь эукариотических клеток.

Систематически исследованы закономерности превращения составных олигонуклеотидных комплексов в реакциях, катализируемых ДНК-зависимыми ферментами (ДНК-лигазой фага Т4 и Taq ДНК-полимеразой). Определена зависимость эффективности превращения ДНК-субстратов от положения ненуклеотидной вставки в их составе. Показано, что, используя наборы олигонуклеотидных дуплексов на основе мостиковых олигонуклеотидов, можно определять топологию сайтов связывания фермента с ДНК-субстратом. Продемонстрировано, что комплексы на основе мостиковых и тандемных олигонуклеотидов проявляют повышенную чувствительность к нуклеотидным заменам, включая однонуклеотидные, в сайтах специфического связывания анализируемой ДНК. Предложены алгоритмы выбора структуры составных олигонуклеотидов и методы создания на их основе новых систем гибридизационного анализа ДНК в гомо- и гетерофазном вариантах. Разработан новый способ повышения эффективности гибридизационного анализа с участием ДНК-зависимых ферментов и составных олигонуклеотидов, обладающих пониженной комплексообразующей способностью, основанный на использовании в качестве анализируемых ДНК-объектов частично фрагментированных в мягких условиях и не требующих дополнительной очистки ДНК-ампликонов.

Апробация работы. Результаты работы были представлены на российских конференциях («Современные направления в химии нуклеиновых кислот», Москва, 2000; «Химическая биология», Новосибирск, 2005, 2006, 2009; VI конференции по биоинформатике регуляции генома и структуры, Новосибирск, 2008; VIII международной конференции по изучению узнавания в нуклеиновых кислотах (NACON-VIII), Шеффилд, Великобритания, 2010); на Менделеевском съезде по общей и прикладной химии, Санкт-Петербург, 1998, Москва, 2007; III Всероссийском биохимическом съезде, Санкт-Петербург, 2002; IV съезде Российского общества биохимиков и молекулярных биологов, Новосибирск, 2008; V симпозиуме «Химия и биология нуклеиновых кислот», Кембридж, Великобритания, 2003; российско-французских симпозиумах «Супрамолекулярные системы в химии и биологии», Москва, 2007, Страсбург, Франция, 2008; XV совещании по структуре и динамике биомолекул, Олбани, США, 2007; российско-европейском рабочем совещании «Репарация ДНК и эпигенетическая регуляция стабильности генома», Санкт-Петербург, 2008; на международных форумах по нанотехнологиям, Москва, 2008, 2009, 2010.

Публикации. По материалам диссертации опубликовано 53 работы, из них: обзора, 6 патентов, 44 научные статьи.

Структура и объем работы. Диссертация состоит из введения, обзора литературы, изложения результатов и их обсуждения, экспериментальной части, выводов и списка литературы. Работа изложена на 443 страницах, содержит 163 рисунка, 32 схемы и 62 таблицы. Библиография охватывает 532 публикации.

СОДЕРЖАНИЕ РАБОТЫ

1. Дуплексы на основе составных олигонуклеотидных конструкций (объекты исследования) Впервые тандемные системы были предложены в качестве сиквенсспецифичных агентов в работах проф. Зарытовой В.Ф. (Kutyavin I.V. et al., 1988).

Независимо, используя принцип взаимной стабилизации олигомеров при их гибридизации на прилегающих сайтах общей НК-матрицы, в лаборатории акад.

Мирзабекова А.Д. была развита концепция секвенирования ДНК при непрерывной стэкинг-гибридизации (Khrapko K.R. et al., 1989). Тандемы олигонуклеотидов были использованы и как зонды для анализа точечных мутаций в ДНК методом ферментативного лигирования (Landegren U. et al., 1989). Мостиковые олигонуклеотиды (МО), разработанные в ИХБФМ СО РАН при участии автора данной работы, сочетают в себе некоторые преимущества разобщенных наборов коротких олигонуклеотидов, объединяя их в одномолекулярную структуру ненуклеотидными вставками (^), которые облегчают контроль за поведением составной конструкции в исследуемой системе и позволяют направленно регулировать свойства мостиковых олигомеров. Наряду с тандемными системами и МО в последнее время наблюдается возрастание интереса к многокомпонентным НК-ассоциатам, например, к конкатемерным комплексам, которые формируются за счет взаимодействия «липких» концов дц-блоков НК. В работе представлены результаты первого систематического исследования закономерностей образования составных олигонуклеотидных комплексов (Схема 1): конкатемерных, тандемных и образованных мостиковыми олигонуклеотидами. Простые бимолекулярные дуплексы исследовали в качестве контрольных систем, позволяющих оценить влияние наличия оц-разрыва и/или различных модификаций на термическую стабильность отдельных компонентов составных комплексов. Наряду с нативными (немодифицированными) ДНК-комплексами в работе были исследованы и дуплексы, несущие различные остатки ненуклеотидной природы.

Схема 1.

Простые дуплексы Комплексы мостиковых олигонуклеотидов (контрольные) M M M.........................

..........

L1' L2' L1' L2' L3' L Тандемные комплексы M M Mh...................................

L L1 L2 LLLКонкатемерные комплексы M M M....................

L L - ненуклеотидная вставка ("мостик") - одноцепочечный разрыв N CH3 O OH N R OH +N R OH N + + N N X + + N R + +N H3CO N R H N R +N R PhzR N N -O N N PhnR Pho N N PhnR'' Phn1R Phn2R PhtR +NHPhkR OH NH H X Ant N N O H OCH+ N R Per H3C R Prl N Cl N N AcrR (X=R) H H + O OH O KerR Phn3R AcrR' (X=R') N CH3 OH O OH O O NH O OH Es Chol R Mit O O OH O CHO CH3 AnR NH O OH OH O O OH O N Rub O NH HO O COOH N N R = -NH(CH2)3NH- R '= -NH(CH2)5NH- Bu = -NH(CH2)3CH3 R'' = FluR O TFn PDn HN N DDn i O O O O P R O O S O-( O -Ni-^n-Ni+1- )n O ( )n O- O P O ( O )n O O O P P ^= n O- Ni+O P O O O O O O P ^n DEGn ( O O O O O O- O HEGn )n ( TEG n=1-5 n )n ( )n O O O P O O O O O O O Остатки полициклических ароматических соединений (ароматических углеводородов, азинов, производных антрахинона и др.) вводили на 5'-концевой фосфат олигонуклеотидов путем формирования фосфамидной связи и исследовали их влияние на термостабильность простых ДНК и тандемных дуплексов (Схема 1). В случае гибридизации встык остатки локализовали в точке контакта дуплексных структур. В качестве ненуклеотидных вставок в структуре МО выступали фосфодиэфирные остатки на основе олигометилендиолов и олигоэтиленгликолей различной длины (Схема 1). Стероидные остатки (эстрона или холестерина) присоединяли к концевым фосфатным группировкам непосредственно либо через линкер на основе -аланина (5'-Chol-С(O)CH2CH2-NH-). Строение производных подтверждали данными спектрофотометрии, MALDI TOF массспектрометрии и в ряде случаев при изучении пространственной структуры комплексов доказывали с помощью ЯМР-спектроскопии.

2. Термодинамическое описание эффективности образования составных олигонуклеотидных комплексов с ДНК Анализ структурных факторов, определяющих стабильность комплексов коротких олигонуклеотидов В соответствии с целью работы, направленной на установление фундаментальных принципов, определяющих взаимосвязь структуры как составных олигонуклеотидных дуплексов, так и отдельных нативных спиральных фрагментов в их составе, с их стабильностью и другими функциональными свойствами, на первом этапе исследования было необходимо отработать комплексный подход к физико-химической характеризации ДНК/ДНК-комплексов. Точное термодинамическое описание ДНК-комплексов позволяет выявлять энергетические вклады от формирования отдельных элементов структуры ДНК-компонентов и в дальнейшем составлять алгоритмы прогностического расчета гибридизационных свойств олигонуклеотидных конструкций, необходимых для рационального дизайна молекулярных инструментов на их основе.

Термодинамический анализ эффективности образования дуплексных структур олигодезоксирибонуклеотидами и их производными Для определения термодинамических параметров формирования всех олигонуклеотидных комплексов использовали усовершенствованный вариант метода термической денатурации, в рамках которого регистрацию кривых плавления НК-комплексов проводили на нескольких длинах волн (не менее 4-х в диапазоне 240-360 нм) при пошаговом переключении монохроматора оптического детектора уникальной установки, созданной на базе хроматографа «Милихром» (Эконова, Новосибирск). Это усовершенствование позволило:

1) использовать широкий диапазон суммарной концентрации олигонуклеотидных компонентов комплексов от 3·10-6 до 2·10-4 М;

2) проводить параллельную регистрацию оптического сигнала в диапазонах длин волн, характерных как для регистрации гипо(гипер)хромных эффектов, сопряженных с образованием(распадом) НК-дуплексов (от 240 до 290 нм), в том числе А/Т- и G/C-пар оснований (вблизи 260 и 280 нм, соответственно), так и для регистрации результирующих эффектов от взаимодействия хромофорных остатков ненуклеотидной природы с элементами дуплексов (от 300 до 360 нм);

3) регистрировать для одного образца несколько кривых плавления, профили которых пригодны для независимого расчета термодинамических параметров комплексообразования, и регистрировать опорный сигнал вне спектральной области реализации НК-специфичных переходов. Использование этих усовершенствований позволило повысить информативность и надежность данных, получаемых методом термической денатурации комплексов НК.

Эффективность образования простого бимолекулярного несамокомплементарного комплекса с участием олигонуклеотида или его производного при заданной ионной силе «a» характеризуется величиной равновесной константы комплексообразования (Ка ) и описывается в рамках модели двух состояний с р помощью уравнением (1), на основании которого температура плавления комплекса (Тпл) может быть представлена в виде уравнения (2):

O 2 Ga(T) O O Ka exp ,где GaO(T) Нa Т Sa (1) p (1 )2 CТ RT 1 НO a (2) O T Sa Rln(CT/4) пл A(T)A TB )(1)AssTB) (3) ( ( ds ds ss 1 НO (4) Tпл([Na]) SO R n ln([Na]) R ln(CT/4) O O O Ga(T)Gne(T)Gne(T), (5) O O где Gne(T) HO T SO и Ge(T) T R n ln([Na]) R = 1.987 кал/(моль·К); A(Т) – зависимость оптической плотности на выбранной длине волны () от температуры (кривая плавления); A B - не зависящие от температуры паi, i раметры, описывающие линейную зависимость оптической плотности отдельного дц- (i=ds) и оц- (i=ss) состояний от температуры; СТ – суммарная концентрация взаимодействующих олигонуклеотидов, взятых в стехиометрическом соотношении. Анализ проводили в приближениях Н(T), S(T)=const (Ср=0) и Н ([Na+])=const, S = а а S+R·n·ln([Na+]) (для 0.022 М [Na+]0.182 М). Символы «ne» и «e» отражают неэлектростатическую и электростатическую составляющие энергии взаимодействия.

Кривая плавления любого комплекса может быть описана в приближении «двух состояний» и задается выражением (3) (Petersheim M., et al., 1983). Применить данное приближение для описания комплексов НК возможно, если выполняется ряд требований: а) профили кривых термической денатурации комплексов хорошо описываются расчетными зависимостями A(Т), получаемыми с использованием уравнений (1)-(3); б) различие величин термодинамических параметров комплексообразования (Н и S), определяемых концентрационным методом из зависимости 1/Тпл vs ln(CТ/4) (2) и методом оптимизации (уравнения (1) и (3)), составляет менее 10 % (Xia T., et al., 1998); в) величины термодинамических параметров комплексообразования (Н и S), определяемые методом оптимизации кривых плавления, зарегистрированных на разных длинах волн (например, на 260 и 280 нм), близки между собой; г) взаимодействующие олигонуклеотидные цепи не формируют стабильных внутримолекулярных структур, регистрируемых методом термической денатурации и при анализе температурных серий спектров кругового дихроизма (КД) (Davis T.M., et al., 1998).

Исследование влияния ионной силы раствора на термостабильность ДНКкомплексов проводили при изменении концентрации ионов натрия от 0.022 до 1.022 М. Концентрация соли не оказывала существенного влияния на величину энтальпии комплексообразования, что согласуется с литературными данными для нативных олигонуклеотидных комплексов (Williams A.P., et al., 1989), поэтому принимали приближение Н° = Н°. Величина гипохромного эффекта в а спектральном диапазоне регистрации плавления дуплекса, в том числе и на длине волны, на которой регистрируется изменение спектральных свойств хромофорных остатков ненуклеотидной природы при диссоциации комплекса, также оказывается не зависящей от ионной силы буфера. Совокупность этих данных позволяет заключить, что ионная сила раствора влияет только на равновесное распределение оц и дц форм при комплексообразовании и не оказывает существенного влияния на структуру комплекса. Во всех случаях снижение ионной силы раствора приводит к падению термостабильности исследуемых комплексов, а в интервале концентрации ионов Na+ 0.022 - 0.182 М наблюдается линейная зависимость Тпл комплексов от log[Na+], что позволяет использовать модель конденсации противоионов (n) для определения электро- (G° ) и неe электростатической (G° ) составляющих в экспериментальных величинах своne бодной энергии формирования дуплекса с использованием выражения (5). В этом случае представляется возможным выделить эффекты, сопряженные с реализацией неэлектростатических (стэкинг, водородное связывание и др.) и электростатических (кулоновских) взаимодействий, обуславливающих результирующий вклад элементов структуры нативных и модифицированных комплексов в наблюдаемые термодинамические параметры образования исследуемого дуплекса.

Термодинамические эффекты (G°, Н° или S°), сопряженные с ввеТ дением в структуру исследуемого комплекса модификаций и с реализацией дополнительных, например, контактных, взаимодействий олигонуклеотида при гибридизации встык в тандемах, рассчитывали относительно величины термодинамического параметра, определенного для комплекса сравнения. В качестве комплексов сравнения выбирали нативные, в том числе и тандемные, или модифицированные дуплексы, не требующие параметризации их термодинамических эффектов: G° = G° (исследуемый комплекс) – G° (комплекс сравнения) (6).

Т Т Т Разработка схемы термодинамического описания равновесного формирования комплексов олигонуклеотидных тандемов на общей ДНК-матрице Термодинамический анализ взаимодействия олигонуклеотидов с ДНКматрицами при гибридизации встык с образованием комплексов матрица/(олигонуклеотид+олигонуклеотид(ы)) проводили на модельных системах трех типов (Cхема 1): гибридизации олигонуклеотидов с оц участком матрицы, образующей минишпильку (I), комплексообразование ДНК-матрицы и тандемов олигонуклеотидов, состоящих из двух (II) или трех (III) коротких олигомеров.

Первым этапом физико-химического анализа тандемного комплексообразования олигонуклеотидов (комплексы II и III типов) было построение математической модели, описывающей температурную зависимость эффективности формирования дуплексов. Схема 2.

K1 K2 KM + L1 ML1 M + L2 ML2 M + L3 MLK12K1 K12K2 K13KML2LML2L1 ML1 + L2 ML1LML2 + L1 ML1 + LK13K1 K2 KML3 + L1 ML1L3 ML3 + L2 ML2L3 ML2LML2 + LK12K13KK12K2 K13KML2L3 + L1 ML1L2L3 ML1L3 + LML1L2L3 ML1L2 + L3 ML1L2L, где Ki - равновесная константа «независимого» связывания i-го олигонуклеотида с соответствующим сайтом мишени; K12, K13- константы стэкинг-взаимодействия дуплексных участков центрального (L1) и фланкирующих его (L2 и L3) олигонуклеотидов.

Видно, что наряду с формированием полноразмерных тандемных комплексов протекает образование «независимых» дуплексных форм с заполнением лишь части мест в составном сайте связывания ДНК-матрицы с тандемом. В случае двух- или трехкомпонентных тандемов степень ассоциации одного из олигонуклеотидов (i) с соответствующим ему комплементарным участком матрицы может быть представлена лишь в неявном виде через его эффективную константу связывания Kiэфф:

i (j i )=0.5[2+n/(KэффCт ) - (2+n/(KэффCт ))2-4] (7), где i i n1 n+K2K12Cт(1-2)+K3K13Cт(1-3)+ K2K12K3K13Cт2(1-2)(1-3) n K1эфф = =K (1-1)2Cт n+K2Cт(1-2)+K3Cт(1 -3)+ K2K3Cт2(1-2)(1-3) n ;

n2 n+K1K12Cт(1-1)+K3Cт (1-3)+ K1K12K3K13Cт2(1-1)(1-3) n K2 эфф = =K (1-2)2Cт n+K1Cт(1-1)+K3Cт(1-3)+ K1K3K13Cт 2(1-1)(1-3) n ;

n3 n+K 1K 12Cт (1-1)+K 2C (1-2)+ K 1K 1 2K 2K 1 3C (1-1)(1-2) эфф т n т K = =K 3 (1 -3)2C n+K 1Cт (1-1)+K 2C (1-2)+ K 1K 2K 12C (1- 1)(1-2) т т n т , где i - степень связывания i-го олигонуклеотида с соответствующим сайтом мишени М (i=1 для центрального компонента тандема и i=2, 3 для фланкирующих олигонуклеотидов); n – число компонентов тандемной системы матрица+олигонуклеотиды; Ст – сумммарная концентрация компонентов системы матрица+олигонуклеотиды (для стехиометрической смеси олигомеров); в случае комплекса двухкомпонентного тандема M/(L1+L2) равновесную константу комплексообразования К3 третьего компонента L3 в уравнении (7) принимали за бесконечно малую величину.

Термодинамический анализ образования тандемных комплексов типа II и III можно провести при решении уравнения (7) только в численном виде, используя известные величины индивидуальных равновесных констант комплексообразования олигонуклеотидов и констант стэкинг-взаимодействия между дц участками тандемного комплекса. Аналитическое описание образования комплексов даже двухкомпонентных тандемов в общем случае затруднено, однако, при стехиометрическом соотношении компонентов L1+L2 и матрицы М можно определить некоторые закономерности комплексообразования. Суммарную степень ассоциации матрицы (М) в температурном интервале плавления тандемного комплекса М/L1L2 можно представить в виде суммы степеней ассоциации матрицы в тандемном комплексе М/L1L2 (т) и «независимых комплексах» М/Lи М/L2 с отдельными компонентами тандема L1 и L2 (н и н соответственно):

1 М = т + н + н.

1 Анализ схемы равновесного распределения форм для комплексов двухкомпонентных тандемов M/(L1+L2) (при стехиометрии компонентов) показывает, что выражение эффективности формирования «независимых» комплексов НКматрицы и компонентов тандема при его Тпл (т = 0.5) имеет вид:

0.5 0.н 1 н K2 K1 (1K12) 1 (1K12) K1 K и.

Отсюда следует, что при значительно различающихся гибридизационных свойствах олигонуклеотидов, например, при К2>>К1 (н 0, н 0.5), значение 1 суммарной степени связывания матрицы (в пределах участка связывания тандема) при температуре плавления тандемного комплекса оказывается близко к (М = т + н 1). В этом случае образование комплекса M/L1L2 будет обусловлено связыванием более слабого компонента тандема L1 с уже предформированным комплексом M/L2, а уравнение (7) упрощается до (8).

, K1K12 1 (8), 1 1 т 1 (1 )2 (1 1)2M2K1K12M0 2K1K12Mгде М0 – начальная концентрация матрицы М.

Важно отметить, что для описания тандемных комплексов I-типа, формируемых при гибридизации олигонуклеотида встык с предформированным стеблем стабильной минишпильки, может быть использовано выражение (8).

При близких гибридизационных свойствах олигонуклеотидов L1 и L(K1K2) эффективность их связывания с матрицей при Тпл тандемного комплекса одинакова и зависит только от эффективности кооперативного контакта (К12):

0.5, т 2н н н M 1 2 н .

1 1 KВ этом случае значения н уменьшаются от величины ~0.2 (при K12=1) до (при K12>>1). Следовательно, при реализации высокоэффективного кооперативного контакта (K12>>1) «независимым» связыванием компонентов тандема при его Тпл можно пренебречь (н 0). Тогда во всем температурном интервале комплексообразование именно тандемного комплекса будет определять степень ассоциации НК-мишени, что эквивалентно использованию схемы тримолекулярного равновесного процесса в рамках модели двух состояний:

Э фф K Эфф (9).

M L1 L2 ML1L2, где K K K K12 ((1 )3 M ) 1 2 M M Выявленные закономерности дают возможность на качественном и, при наличии характеристических параметров, на количественном уровне прогнозировать поведение тандемов или же проводить термодинамический анализ экспериментальных данных (например, кривых плавления), получаемых при использовании составных комплексов на основе тандемов олигонуклеотидов.

Разработка схемы термодинамического описания равновесного формирования комплексов олигонуклеотидных тандемов на общей ДНК матрице Мостиковые олигонуклеотиды (МО) являются аналогами олигонуклеотидных тандемов, компоненты которых ковалентно связаны ненуклеотидной вставкой. Термодинамический анализ комплексообразования олигонуклеотидных производных такого типа до начала данной работы был проведен лишь для случаев, имитирующих наличие в дцДНК апуринового/апиримидинового сайта и для ограниченного набора ненуклеотидных линкеров (например, Vesnaver G. et al., 1989). Разработка аналитической модели, описывающей образование дуплекса, в котором вставка соединяет примыкающие друг к другу на общей ДНКматрице дц-фрагменты, проведено в представленной работе впервые. В составе МО, содержащего, например, два нативных ДНК-фрагмента (а1(^n)а2), ненуклеотидный линкер (^ ) нарушает регулярность цепи ДНК, что может затруднять n сборку полноразмерной ДНК-спирали по модели «застежка-молния» и позволяет предположить поэтапную сборку модифицированного комплекса (Схема 3):

Схема 3.

a1 Y a1 a2 KaKaX.

a1 aX Y Z' Z ~ K12 a1 a. X Y X Y....

Z' Z Z'Z Z'Z ~ KaKaX M a2 M M.

Y Z' Z ~ Степень возмущения, вносимого вставкой, должна определяться длиной и конформационной подвижностью линкера, которым соединены олигонуклеотидные фрагменты а1 и а2, и находить отражение в величине константы К12, характеризующей эффективность формирования кооперативного контакта между двумя частями олигонуклеотида в составе дуплекса. Наличие промежуточных этапов при комплексообразовании МО, в общем случае, приводит к тому, что равновесная схема такого процесса не может быть представлена в рамках приближения двух состояний (оц либо дц). Следовательно, необходимо определить условия, при которых возможно описание таких комплексов при термодинамическом анализе в рамках метода термической денатурации комплексов НК. Нами показано, что эффективная константа равновесного связывания (Кэфф) олигомера М/а1(^n)а2 может быть представлена согласно выражению (10):

(10).

1 Kэфф = Ka1 Ka2 ( + + K12) Ka1 KaТогда степень ассоциации НК-мишени в составе полноразмерного комплекса М/а1(^n)а2 рассчитывается по (11):

1/ (T) = 1 + - 1 - 1 + эфф Kэфф CT K CT (11).

Анализ выражения (10) свидетельствует, что условием применимости модели двух состояний для описания комплексообразования МО является неравенствоK a1, K a2 >> 1/K12. В этом случае доля промежуточных форм M·a1 и М·астановится пренебрежимо мала, по сравнению с количеством полноразмерного дуплекса. Таким образом, для описания системы применимо приближение двух Kэфф = Ka1 Ka2 Kсостояний с величиной эффективной константы, равной, что позволяет рассматривать формирование комплекса МО по аналогии с комплексообразованием несамокомплементарных олигонуклеотидов.





Описание равновесной схемы образования конкатемерной структуры на основе двух олигонуклеотидов Формирование конкатемерной структуры на основе пары из двух олигонуклеотидов А и В возможно, когда в каждом из них имеются два типа фрагментов i и j, причем нуклеотидная последовательность фрагмента iА комплементарна фрагменту iВ, а jА - фрагменту jВ. Для обеспечения сборки конкатемерной системы необходимо, чтобы взаимокомплементарные фрагменты (как i, так и j) находились на одном и том же 5'- или 3'- конце в последовательностях А и B.

Рис. 1. Формирование конкатемерной структуры при ассоциации двух различных олигонуклеотидов (А и В). Ki(j)– равновесная константа образования дуплексного элемента фрагментами i (j) олигонуклеотидов А или В. Kk– константа образования кооперативного контакта между парами оснований вблизи оц-разрыва в двойной спирали ДНК.

На первом этапе комплексообразования олигонуклеотиды А и В формируют дуплекс ABjj (или ABii) с липкими концами jj (или ii) (Рис. 1, этапы 1 и 2). Образование этого и всех последующих комплексов происходит в приближении модели двух состояний, предполагающей отсутствие в системе альтернативных состояний олигонуклеотидов, кроме ассоциированных и свободных форм. На втором шаге происходит присоединение к комплексу ABjj (или ABii) еще одного олигонуклеотида (А или В) с образованием комплекса из трех олигонуклеотидов (Рис.

1, этапы 3а-4) и т.д. Здесь и далее мы считаем (в качестве приближения), что эффективности формирования кооперативного контакта в местах оц-разрывов между олигонуклеотидами А и В близки, т.е. для обоих стыков эффективность контактных взаимодействий имеет одинаковую равновесную константу Кк. Видно, что можно выделить четыре типа конкатемерных структур: AnBnii, AnBnjj, An+1Bnij, AnBn+1ij - где верхний индекс обозначает тип липких концов, а нижний (n=1,2,…) – количество молекул данного олигонуклеотида в комплексе.

Концентрация каждого типа конкатемерной структуры любой длины может быть выражена через концентрации свободных олигонуклеотидов А и В:

2n2 n [A Bii ] Kk Kin1K [A]n[B]n n n j 2n (12), [A B jj ] Kk KinK n1[ A]n[B]n n n j 2n1 n Bij ] Kk KinK [A]n1[B]n [An1 n j 2n1 n n n[A Bij ] Kk KinK j [A]n[B]nгде Ki, Kj, Kk - равновесные константы образования дуплексной структуры i-типа, j-типа и константа образования кооперативного контакта на стыке дуплексных структур i и j.

Уравнение материального баланса можно записать в виде суммы вкладов всех возможных полимерных структур и олигонуклеотидов в свободном состоянии. Например, для компоненты A оно будет выглядеть следующим образом:

jj (13).

[A]0 Bii ]n B ] n Bij ](n 1) Bij ]n [A] [A [A [A [A n n n n n1 n n nn1 n1 n1 nСходимость каждой суммы в уравнении (13) определяется условием:

Kk Ki K [A][B] 1 (14).

j При равенстве начальных концентраций олигонуклеотидов ([A]0=[B]0), проводя суммирование с использованием (12) и учитывая, что [A]=[B], получаем:

[A] [A]2(Ki K Kk Ki K ([A] [A](Kk 1)([A]2 Kk Ki K 2))) j j j (15).

[A]0 ([A]2 Kk Ki K 1)j Уравнение (15) описывает связь между равновесной концентрацией свободных олигонуклеотидов в системе ([A]), их начальной концентрацией ([A]0) и равновесными константами комплементарного (Ki, Kj) и кооперативного (Kk) взаимодействий между олигонуклеотидами. Видно, что в общем виде из уравнения пятой степени (15) нельзя получить аналитическую зависимость для [A], т.к.

оно не имеет решения в общем виде. Однако определить равновесную концентрацию олигонуклеотида А в свободном состоянии возможно, решая (15) численным методом при фиксированном значении начальной концентрации олигонуклеотидов и равновесных констант. Следует отметить, что в частном случае, когда отсутствует кооперативное взаимодействие между олигонуклеотидами, а стабильности комплексов i и j равны, т.е. выполняются условия Kk=1 и Ki =Kj=K, (15) значительно упрощается. В этом случае удается найти аналитическое выражение для концентрации олигонуклеотидов в свободном состоянии в зависимости от их начальной концентрации и равновесной константы формирования конкатемерного комплекса: [A] [B] 1 2[A]0 K 1 4[A]0 K (16).

2[A]0 K Такое упрощение позволяет проводить прогностический анализ эффективности формирования конкатемерных комплексов. Кроме того, отметим, что в этом приближении выражение для расчета Тпл в точности совпадает с таковым, применяемым для описания свойств обычного дуплекса, состоящего из двух несамокомплементарных олигонуклеотидов (2).

Таким образом, в работе проведен анализ схем равновесного образования всех заявленных типов составных олигонуклеотидных комплексов и определены условия применимости различных аналитических зависимостей для детального физико-химического исследования таких систем, с целью количественной характеризации энергетических эффектов от реализации различных взаимодействий между отдельными элементами структуры исследуемых комплексов, несущих остатки ненуклеотидной природы или без них.

Базы данных термодинамических параметров образования составных комплексов на основе нативных олигонуклеотидов и их производных Разработанные алгоритмы термодинамического анализа позволили выработать критерии выбора структуры модельных объектов, обеспечивающих возможность их детальной физико-химической характеризации с целью параметризации вкладов от формирования отдельных элементов структуры комплексов ДНК. В ходе работы был синтезирован широкий набор олигонуклеотидов и их производных, обеспечивающий возможность образования как всех типов изучаемых составных комплексов, так и соответствующих им контрольных дуплексов. Структуры модельных олигонуклеотидов подбирали таким образом, чтобы анализируемый набор комплексов содержал все возможные параметризуемые структурные элементы (нативные динуклеотидные шаги спирали, коаксиальные стыки, динуклеотидные шаги со вставкой, ближайшие соседи, мисматчи и т.д.), представленные неоднократно. Методом термической денатурации были определены величины энтальпии и энтропии комплексообразования созданных модельных олигонуклеотидов в стандартных буферных условиях (1 M NaCl, нейтральный pH) и/или в условиях с измененной ионной силой раствора. Кроме того, в базу данных включали представленные в литературе величины термодинамических параметров образования интересующих типов комплексов, определенные другими группами исследователей в результате систематических физико-химических исследований. В случае если компоненты комплексов формировали внутримолекулярные структуры (например, шпильки), их влияние на наблюдаемые энергетические параметры межмолекулярного связывания олигомеров учитывали с помощью специально разработанного алгоритма. Основные характеристики созданных баз данных термодинамических параметров (Н, S, G ) образования различных типов комплексов представлены ниже.

База данных для тандемных и контрольных простых комплексов олигонуклеотидов и их производных включает в себя данные о формировании более чем 200 немодифицированных тандемных комплексов, главным образом I-типа, в том числе 90 совершенных и 113 содержащих мисматч на стыке дуплексных структур. Дополнительно включено 17 наборов энергетических вкладов от формирования коаксиальных контактов между дцДНК, опубликованных ранее (SantaLucia J. et al., 2003). Представлены параметры для тандемных комплексов с одним или двумя коаксиальными контактами. Диапазон изменения величины G, характеризующей вклад коаксиального стэкинга в стабильность дуплекса:

0.8-4.8 ккал/моль. Кроме того, в данной базе данных представлены параметры, описывающие гибридизацию встык гептануклеотида и его производных, несущих 5'-концевые остатки лигандов, которые локализуются в тандемном комплексе вблизи оц-разрыва в дцДНК. Для этого набора модельных дуплексов определены параметры их образования в стандартных условиях (1 М NaCl, нейтральный рН) и при пониженной концентрации соли (до 22 мМ [Na+]). Более простых бимолекулярных комплексов охарактеризованы в качестве образцов сравнения, позволяющих определить энергетический эффект от реализации кооперативных контактов с различным составом взаимодействующих структурных элементов.

База данных для комплексов мостиковых олигонуклеотидов включает 375 наборов термодинамических параметров образования комплексов с участием нативных олигонуклеотидов (311) и МО (64) в стандартных условиях.

Длина комплексов варьирует от 4 до 20 пар оснований (п.о.). Использованы МО, в структуре которых присутствует одна или две ненуклеотидные вставки на основе фосфодиэфира диэтиленгликоля (DEG1, см. схему 2). Диапазон варьирования GC-состава: 0-100 % и 19-74 % для комплексов на основе нативных и мостиковых олигонуклеотидов, соответственно. Диапазон изменения свободной энергии комплексообразования G° : -3.6 – -24.6 ккал/моль.

Средняя представленность динуклеотидных шагов спирали каждого типа:

нативных – 314, модифицированных – 4.7 раза. Данная выборка дополнена представленными в литературе величинами термодинамических параметров комплексообразования нативных олигодезоксирибонуклеотидов (278 наборов) (Allawi H.T., et al., 1997; Doktycz M.J., et al., 1995; Tanaka F., et al., 2004).

Кроме того, в базу включены две дополнительные выборки параметров, характеризующих: 1) комплексообразование МО, в которых более 2-х модифицированных вставкой динуклеотидных шагов, и МО, несущих вставки, отличные от DEG1, или имеющих несколько подряд введенных вставок ( шт.) одного типа; 2) зависимость стабильности комплексов нативных (14наборов) и мостиковых олигонуклеотидов (124 набора) от ионной силы раствора ([Na+]: 0.001-1.024 М; [Mg2+] 0.25 мМ-0.3 М) при нейтральном значении pH. Всего представлено 160 дуплексов разного состава. Диапазон изменения GC-состава – 20-87 %; Тпл дуплексов – 12-89 С; концентрации олигонуклеотидов – 5·10-5-2·10-6 М. Базу данных формировали с использованием собственных данных и данных из литературных источников (Owczarzy R., et al., 2004; Nakano S., et al., 1999; и др.).

Термодинамический анализ энергетических эффектов от образования ДНК-комплексов проводили тремя основными способами, анализируя: 1) величины вкладов (например, G ) от введения в структуру дуплекса модифиТ цирующих остатков согласно уравнению (6) для ограниченных выборок комплексов; 2) полные величины термодинамических эффектов от комплексообразования с помощью метода множественной линейной регрессии с целью определения вкладов от формирования отдельных элементов дуплексов (модель ближайших соседей) в соответствии с их представленностью в систематически подобранных наборах охарактеризованных дцДНК; 3) экспериментальные величины с помощью метода поиска решения с целью определения параметров модели, описывающей физико-химические закономерности образования дуплексов. Последний способ использовали, когда аналитические зависимости описываемых величин не были линейно зависимыми от варьируемого параметра (например, Тпл vs [Na+]).

Определение унифицированных параметров коаксиальных взаимодействий оснований на стыке дуплексных структур проводили с помощью метода множественной линейной регрессии (МЛР), анализируя: 1) для совершенных комплексов – величины термодинамических эффектов, обуславливающих повышение термостабильности структуры при переходе от тупоконечного комплекса к тандемному (G = G (тандем) - G (простой дуплекс)); 2) для Т Т Т тандемных комплексов, содержащих мисматч вблизи оц-разрыва, – термодинамические эффекты, обуславливающие изменение термостабильности дуплексной структуры гибридизованного встык олигонуклеотида при переходе от совершенного тандемного комплекса к несовершенному (G = G (тандем Т Т несов.) - G (тандем сов.)). В последнем случае величины G рассчитывали, Т Т используя величины термодинамических параметров образования тандемных комплексов с участием одной и той же ДНК-матрицы, т.е. мисматч на стыке дуплексов создавали заменой основания в составной цепи тандемного дуплекса.

В результате анализа был выявлен набор структурных элементов тандемных комплексов, чье присутствие в составном дуплексе статистически знчимо влияет на наблюдаемую эффективность контактных взаимодействий при гибридизации олигонуклеотидов встык с предформированной дуплексной структурой.

Методом МЛР определены величины унифицированных термодинамических параметров (27 инкрементов), которые являются линейно независимыми и хорошо описывают эффективность реализации всех возможных кооперативных контактов в совершенных тандемных комплексах ДНК (Рис. 2). В число наиболее знчимых параметризованных элементов структуры комплексов входят: типов возможных динуклеотидов с оц-разрывом; 6 типов оснований в окружении никованного динуклеотида; 5'-фосфомоноэфирный остаток в нике; олигопуриновые тракты в разных позициях матричной цепи (2 шт.) и др. Полученные параметры с хорошей точностью описывают термодинамический эффект от образования всех исследованных типов коаксиальных контактов, в том числе и для тандемных систем, параметры которых не были включены в анализируемую методом МЛР выборку. Видно (Рис. 2), что характеристики контактных взаимодействий п.о. значительно отличаются от унифицированных энергетических вкладов, описывающих формирование динуклеотидных шагов нативной ДНКспирали (Allawi H.T., et al., 1997). Это указывает, что коаксиальное стэкингвзаимодействие принципиально отличается от комплементарного связывания оснований при формировании дц структур. В последнем случае значительный вклад вносит формирование водородных связей, в то время как при формировании контакта на стыке дуплексов основной вклад дает образование стопки оснований. Так, например, плохое перекрывание оснований одной цепи в составе 5' PR3'-шага не обеспечивает высокого термодинамического эффекта от реализации такого типа контактов между стыкующимися фрагментами тандемного дуплекса. Эффективное перекрывание оснований в случае реализации 5'RP3', как и 5' RR3'-контактов, делает взаимодействие оснований вблизи оц-разрыва в дцДНК наиболее энергетически выгодным (G до – 3.5 ккал/моль).

А -6 -5 -4 -3 -2 -1 Б 0 Go37(X*Y), ккал/моль -3.0 • Go37(экспер.), ккал/моль y = 0.972x - 0.0--2.R2 = 0.9n=-2 -2.-1.--1.--0.-0.GC AC TC CC GT AT TT CT GA AA TA CA GG AG TG CG Go37(расчет), ккал/моль X*Y или XY -• Рис. 2. (А) Корреляция экспериментальных величин свободной энергии образования коаксиального контакта в тандемных дуплексах и соответствующих величин, рассчитанных с помощью унифицированных термодинамических инкрементов. (Б) Зависимость унифицированных энергетических вкладов, возникающих при образовании коаксиального стэкинга фрагментов составного дуплекса (серые столбцы) или шага нативной спирали ДНК (черные столбцы) (Allawi H.T., et al., 1997), от типа пар оснований в соответствующем динуклеотидном шаге.

Термодинамический анализ всех возможных мисматчей на стыке дуплексных структур проводили, сопоставляя изменения величин энергетических параметров образования олигонуклеотидами (совершенным и с однонуклеотидной заменой) тандемных комплексов I-типа с одной и той же матрицей ДНК (Рис. 3). В результате обработки соответствующей базы данных с помощью метода МЛР определен набор из 32 унифицированных характеристик, среди которых по 12 инкрементов, описывающих все типы мисматчей (pY/Z, X/Z') в 3'- и 5'-позициях никованного шага дцДНК (5'-X•pY-3'/ZZ', где • - кооперативный контакт) (Рис. 3Б); 4 инкремента, определяющие тип динуклеотидного шага матричной цепи (5'-ZZ'-3') в составе контакта шага дцДНК: mRR, mRP, mPP или mPR; 1 инкремент, описывающий изменение типа шага никованной цепи 5'X•pY-3' с пурин-пиримидинового (RP) в стыке без мисматча на пиримидинпиримидиновый (PP) в мисматч-содержащем шаге – инкремент stRP_PP; 1 инкремент для исчезновения специфического совершенного контакта 5'-gA•pY3'/ZT при переходе к мисматч-содержащему шагу gX•pY-3'/ZT, где X=T, G, C, и дополнительные инкременты (2 шт.), характеризующие дестабилизирующий эффект любого мисматча на конце предформированной стабильной дуплексной структуры (например, шпильки) при контакте с ней менее стабильного дц фрагмента, не содержащего мисматч, или содержащего экспонированный к стыку концевой мисматч указанного типа.

Go (расчет), ккал/моль 37 А Б Go (мисматч), ккал/моль 37 N*pY/z X(/z')*pN y = 0.94x + 0.R2 = 0.Go (экспер.), ккал/моль G/a A/a C/a G/t T/t C/t A/c C/c T/c A/g G/g T/g 0 1 2 3 4 5 Рис. 3. (А) Корреляция экспериментальных и расчетных величин термодинамических эффектов (G ), характеризующих дестабилизацию тандемного комплекса при наличии мисматча на стыке дуплексных структур. (Б) Термодинамические инкременты G (мисматч) различных типов мисматчей в 3'- (N•pY/z) и 5'-положениях (X(/z')•pY) динуклеотидного шага с оц-разрывом. pY/z и X(/z') – некомплементарные пары, z и z' - основания матричной цепи.

Из представленных данных видно, что дестабилизирующие эффекты от мисматчей, расположенных с разных сторон от оц-разрыва ДНК, сопоставимы.

Минимальную дестабилизацию вызывают мисматчи G/A и G/G. Сравнительный анализ величин термодинамических эффектов, характеризующих эффективность дискриминации мисматчей, локализованных в различных частях дуплекса (концевой или внутренний участок), показал, что в среднем мисматч вблизи оцразрыва дестабилизирует дуплекс в бльшей степени, чем такой же мисматч на конце дц спирали, но в меньшей, чем внутренняя некомплементарная пара оснований. Для гибридизации встык нами не выявлено ни одного случая, когда мисматч-содержащие комплексы были бы более стабильны относительно совершенных дуплексов с близким нуклеотидным составом. В то же время, с использованием простых минидуплексов с нуклеотидным нависанием (4 п.о.), установлено, что концевые G/A-пары обеспечивают максимальную стабильность комплекса в серии: (pAGCGA)2>(pCGCGA)2>(pAGCTA)2.

Таким образом, проведенный комплексный анализ энергетических параметров образования коаксиальных стыков дцДНК указывает на то, что этот тип взаимодействия в тандемных системах относится к отдельному классу НК-НКвзаимодействий и без проведенной в данной работе параметризации не было возможности проводить прогностический расчет комплексообразующих свойств тандемов олигонуклеотидов.

Влияние 5'-концевых остатков азинов и других ароматических полициклических соединений на термодинамические параметры формирования простых и тандемных комплексов проводили с использованием производных гептануклеотида (Схемы 4 и 1). Было показано, что наличие на конце дуплекса Схема 4.

(DR)p5'CCAAACA /pTGTTTGGC полицикли5' pTGTTTGG----CGCGA ческой ароматической группы (DR) во всех GCGA ACAAACCpRD случаях вызывает значительную стабилизацию короткого дуплекса ДНК (7 п.о.). В зависимости от структуры ароматического остатка Тпл такого комплекса возрастает на 11-22 С. В случае гибридизации встык эффект от введения остатков не столь однозначен. Формирование кооперативного контакта (5'-G•pC-3'/GC) между немодифицированными дуплексами увеличивает Тпл гептануклеотидного дуплекса на ~12 С. Введение ароматических ненуклеотидных остатков в точку контакта дц структур может как несколько понизить (FluR, PhzR, PhoR, PhnR'', Ant), так и повысить (Rub, Mit, PhkR, PhniR) стабильность тандемного комплекса (для [Na+]=182 мМ). Максимальную дестабилизацию (-13 С) тандема вызывает остаток флуоресцеина FluR, который практически предотвращает контактные взаимодействия на стыке дцДНК (согласуется с Vasiliskov V.A., et al., 2001). Наиболее эффективно, из рассмотренных остатков, гибридизации встык способствовали производные антрахинона (Тпл до +7), а также поликатион на основе феназиния (PhkR) и аннелированные феназиниевые производные (PhniR, i=1-3).

Анализ термодинамических эффектов от введения различных группировок свидетельствует, что природа стабилизации ДНК ароматическими остатками существенно варьирует, что может быть установлено при рассмотрении относительных величин различных (H(DR), S(DR), неэлектростатических (ne) и электростатических (e) (кулоновских)) энергетических вкладов в наблюдаемую величину G (DR) взаимодействия группировки с ДНК. Исследование завиT симости термостабильности DR-модифицированных и контрольных (где DR – остаток n-бутиламина, имитирующий линкерную группу) комплексов от концентрации противоионов в растворе ([Na+]: 22-182 мМ) позволило разделить ne- и e-составляющие такого взаимодействия (Рис. 4).

Рис. 4. Величины неэлектростатической (ne) и кулоновской (e) составляющих сум2.марного термодинамическо- DDGo (37 oC) - DDGo (37 oC) ne e го эффекта, сопряженного с 1.введением DR-остатков в точку контакта дуплексных 0.структур ДНК G (DR) (относительно комплекса -0.бутиламинового производ-ного BupN7/pN16).

DDGo (DR) = DGo (DR)- DGo (Bu) i i i -1.Видно, что для подавляющего числа ароматических остатков существенный вклад в стабилизацию коаксиального стыка вносят благоприятные изменения в электростатических взаимодействиях, сопряженные с введением DR-группы.

Наибольший эффект такого типа оказывает PhkR-остаток, несущий три положительных заряда (Схема 1), два из которых расположены в остатках экзоциклических заместителей. Группировки, не несущие положительный заряд, интеркалируя между парами оснований в оц-разрыве, по-видимому, способны экранировать электростатическое отталкивание смыкающихся при гибридизации встык дц структур. Наиболее эффективная стабилизация тандемных комплексов является результатом реализации благоприятных для комплексообразования (G <0) ne- и e-составляющих наблюдаемого термодинамического эффекта от введения интеркалирующего остатка, наприСхема 5.

Mмер, остатка Rub. Таким образом, достичь 5' TTGAAGG---GGACCGC AACTTCCp PerN' pCCTGGCG N7Azh дополнительной стабилизации тандемных комплексов за счет введения на стыки дуплексов интеркалирующих остатков возможно только при условии эффективного взаимодействия остатка с каждым из контактируюM 5' pTGGA-GCTG щих спиральных фрагментов.

CGACp pN PhnRpN' ACCTp Структурные исследования тандемных комплексов проводили, используя три основных метода: 2Д-ЯМР спектроскопию, спектрополяриметрию кругового дихроизма M5' pTGGA-GCTG (КД) и компьютерное моделирование (AMpN'4 ACCTpCGACp pNBER). В качестве образцов изучали четыре pNEs EsN' ACCT CGACp EsEs тандемных комплекса, представленные на схеме 5.

Es = Структурные особенности локализации остатков перилена (Per) и арилазида (Azh) и их взаимодействие с гетероциклическими ккал/моль основаниями ДНК были изучены с помощью спектров КД. Сами по себе ненуклеотидные группировки не имеют хиральных центров и не должны проявляться в спектрах КД. Взаимодействие этих остатков с НК может приводить к появлению спектров индуцированного КД, которые являются характеристиками их ориентации относительно гетероциклических оснований (Lyng R., et al., 1987).

За поведением группировок следили, регистрируя температурные изменения в спектре КД для тандемного комплекса М14/N7Azh+PerN' (Рис. 5). С ростом температуры в процессе плавления тандемного ДНК-дуплекса полностью исчезает сигнал индуцированного КД в области 300-350 нм, в то время как отрицательные полосы в видимом диапазоне длин волн (400-460 нм) лишь несколько уменьшаются по амплитуде. Такое поведение этих полос может объясняться тем, что при плавлении дуплекса остаток перилена с коротким линкером теряет контакт с матрицей, сохраняя перекрывание (следовательно и индуцированную хиральность) с ближайшим к нему гетероциклическим основанием несущего его олигонуклеотида-адреса. Остаток Azh, напротив, имеет достаточную конформационную вариабельность и в процессе плавления теряет взаимодействие с ДНК.

Можно предположить, что остаток Per интеркалирует в ДНК дуплекс, а лабильная арилазидная группировка контактирует с ней со стороны одной из бороздок.

Методом термической денатурации с многоволновым режимом детекции показано, что остатки арилазида и перилена, как каждый отдельно, так и оба одновременно, взаимодействуют с дцДНК и существенно ее стабилизируют. При этом, по данным спектров КД, структура двойной спирали остается близкой к Вформе. С помощью компьютерного моделирования предложена трёхмерная структура такого тандемного комплекса, которая согласуется с полученными экспериментальными результатами (совместно с Ковалем В.В., ИХБФМ СО РАН) (Рис. 5).

15,55 C 5 C 7,x 0,-7,-15,200 300 400 5Длина волны Длина волны, нм Рис. 5. (Слева) Температурные изменения в спектре КД тандемного комплекса М14 /N7 pAzh+PerpN'. Шаг по температуре для каждого спектра составляет 10 °C. (Справа) Локализация сенсибилизирующего интеркалятора (Per) и фотоактивируемой группировки (Azh) в центральной части ДНК-тандема по данным компьютерного моделирования (вид со стороны ника).

Детально пространственную структуру тандемных комплексов изучили на примере трех модельных дуплексов, образованных парой тетрануклеотидов или их производных с общей октануклеотидной ДНК-матрицей. Исследовали изменение структуры составного комплекса при введении в место стыка дупСигнал КД, mdeg лексных участков интеркалирующей группировки (N-2-гидроксиэтил)феназиния (Phn) или пары гидрофобных остатков эстрона (Es)) (Схема 5). Оба типа модификации приводят к стабилизации тандемных дуплексов, однако природа этого эффекта не была ранее установлена. Конструирование данных модельных комплексов выполнено автором лично, структурные исследования были осуществлены Денисовым А.Ю. (ИХБФМ СО РАН) в группе проф. J. Chattopadhyaya (Университет г. Упсала, Швеция) и в НИОХ СО РАН.

А Б В Одноцепочечный разрыв Рис. 6. Пространственные структуры тандемных комплексов: (А) нативного M8/pN4+рN' (PDB ID: 1TAN) и (Б) модифицированного остатками эстрона M8/pN4Es+EsN' (PDB ID:

1ESS) и (В) феназиния M8/pN4+PhnRpN'.

Методом 2Д-ЯМР-спектроскопии и компьютерного моделирования с экспериментальными ограничениями для нативного тандемного комплекса и его модифицированных аналогов показано, что дуплексные участки принимают структуру, близкую к В-форме ДНК-спирали. Нативный комплекс малоотличим от классической спирали ДНК. Пары оснований в точке оц-разрыва сведены за счет стэкинг-взаимодействия. В результате конформация никованного динуклеотидного шага в спирали ДНК практически не отличается от нативного шага без повреждения. Наличие стероидных остатков существенно возмущает структуру тандемного комплекса. Сближаясь в пространстве, объемные гидрофобные группировки раздвигают пары оснований на стыке дуплексов на 5-9 . Результатом сведения остатков эстрона является изгиб и частичное расплетание спирали ДНК. Непосредственного контакта стероидных каркасов зарегистрировать не удалось, они остаются удаленными друг от друга на расстояние ~ 3 , соприкасаясь, по-видимому, своими сольватными оболочками, в которых молекулы растворителя структурированы вокруг гидрофобного неполярного ядра. Такого контакта оказывается достаточно для стабилизации тандемного комплекса за счет повышения эффективности кооперативного контакта между его модифицированными частями (Рис. 6).

Выявленная по данным спектров 2Д-ЯМР сеть контактов между необмениваемыми протонами в Phn-содержащем комплексе доказывает, что азиновый остаток интеркалирует непосредственно в место оц-разрыва цепи ДНК, что дополнительно подтверждается данными КД-спектрополяриметрии. Остаток Phn находится в непосредственном взаимодействии с нуклеотидами T5 (к которому присоединен краситель), С4 прилегающего тетрануклеотида и А12, находящегося в составе комплементарной последовательности ДНК-матрицы (Рис. 6). Остаток красителя располагается планарно относительно плоскости пары оснований T5·A12 (r=3.5-4 ) дуплекса, вытесняя при этом пару С4·G13 прилегающего дуплекса. Длинная псевдоось трициклической системы красителя находится под острым углом к псевдоосям этих пар. Ароматическая система остатка красителя перекрывается с пиримидиновыми основаниями T5 и С4 тетрамера, в меньшей степени - с основанием А12 и практически не контактирует с G13 цепи октамера. При этом основания T5 и С4 оказываются «стянутыми» в вертикальную стопку с большим перекрыванием их -систем с -системой остатка Phn; плоскости оснований противоположной цепи А12 и G13 смещены относительно друг друга по сравнению с их расположением в структуре немодифицированного комплекса. Очевидно, что именно такое расположение остатка красителя, обеспечивающее перекрестное взаимодействие феназиниевой группировки с парами оснований примыкающих встык дуплексов, и должно вызывать стабилизацию тандемного комплекса в целом, в большей степени влияя на стабильность Phnсодержащей тетрануклеотидной дуплексной структуры и, в несколько меньшей, на стабильность прилегающего к ней не модифицированного красителем дуплекса. Интеркаляция красителя проходит, вероятнее всего, со стороны большой бороздки спирали ДНК, вызывая излом дуплекса. Интеркаляционный характер встраивания Phn в ДНК подтверждается и данными КД-спектрополяриметрии.

Таким образом, результаты исследования структуры тандемных комплексов доказывают, что, как в случае формирования гидрофобной скрепки на стыке дуплексов, так и при интеркаляции азинового красителя в месте оц-разрыва, стабилизация тандемного комплекса происходит на фоне значительной реорганизации дц структуры относительно таковой для нативного тандемного комплекса.

При этом полученные данные продемонстрировали способность коротких олигонуклеотидов формировать в составе немодифицированных тандемных комплексов ДНК-спираль В-формы. Наличие оц-разрыва не вызывает существенных возмущений в пространственной организации ДНК-дуплексов. Разработанный системный подход к характеризации тандемных комплексов крайне информативен и обеспечивает получение достоверных и всесторонних сведений о структурно-функциональных особенностях изучаемых молекулярных объектов.

Термодинамический анализ формирования ДНК-дуплексов с участием мостиковых олигонуклеотидов С использованием большого набора модельных комплексов были исследованы эффекты, сопряженные с варьированием природы вводимой ненуклеотидной вставки (длина, гидрофобность) (см. схему 2); числа модифицируемых вставкой динуклеотидных шагов в ДНК-комплексе; числа введенных подряд вставок одного типа в пределах одного динуклеотидного шага; типа модифицируемого динуклеотидного шага; положения вставки в дуплексе. В результате была сформирована база данных термодинамических параметров образования широкого спектра комплексов МО в стандартных буферных условиях. Было доказано, что все исследованные комплексы могут быть описаны в приближении модели двух состояний, в соответствии со всеми критериями применимости данного приближения, представленными выше. Профили термической денатурации всех исследованных комплексов, характеристики которых были использованы в дальнейших анализах, имели монофазный переход из оц- в дц-состояние (Рис. 7).

3.4 1000/Tпл В 0.00.0Al/T А Al/T Б B A (DEG1) 1 M8/N4 4 М8/N4(DEG1)R R = 0.=0.4 3.2 270 нм 280 нм 260 нм 3.0.0М8/N8 M8/N = 0.R2R =0.3.0 -10 -11 -12 -13 -0 20 40 60 80 10 20 40 60 80 1Температура, oC ln(Cт/4) Температура oC Рис. 7. Расчетные (жирные черные) и экспериментальные (тонкие серые) дифференциальные кривые плавления комплексов мостиковых и нативных олигонуклеотидов: (А) 1 - CCTGGAGC/GCTCCAGG (M8/N8), 2 - CCTGGAGC/GCTC(DEG1)CAGG (M8/N4(DEG1)4); (Б) 3 - TCCTGGAGCT/AGCTCCAGGA (M10/N10), 4 - TCCTGGAGCT/AGCTC(DEG1)CAGGA (M10/ N5(DEG1)5). (В) Линейная зависимость обратной температуры плавления комплексов нативного (M8/N8) и мостикового (M8/N4(DEG1)4) олигонуклеотидов от логарифма суммарной концентрации олигонуклеотидных цепей, взятых в стехиометрическом соотношении.

Буфер: 1 М NaCl, 10 мМ фосфат натрия (рН 7.3), 0.1 мМ Na2ЭДТА.

В случае, когда было обнаружено, что компоненты комплексов формируют внутримолекулярные структуры, их вклад в наблюдаемые термодинамические параметры образования межмолекулярного комплекса учитывали в соответствии со специально разработанным алгоритмом. В результате было установлено, что введение ненуклеотидной вставки во внутреннюю часть дуплекса во всех случаях вызывает его дестабилизацию. Увеличение длины вставки и числа модифицированных динуклеотидных шагов в комплексе вызывает дополнительную дестабилизацию комплексов МО. Несколько подряд расположенных фосфодиэфирных остатков на основе гидрофобных диолов (например, декандиола DDi) не описываются этой тенденцией. По-видимому, гидрофобные взаимодействия между такими остатками снижают эффективную длину вставки, что симбатно снижает дестабилизирующий вклад от их введения. Кроме того, установлено влияние типа динуклеотидного шага, модифицированного, например, DEG1, на наблюдаемый термодинамический эффект вставки. Одновременное введение вставок в несколько разнесенных (>2 п.о.) в комплексе динуклеотидных фрагментов характеризуется аддитивным энергетическим вкладом.

Дополнительно методом «остановленной струи» было изучено влияние ненуклеотидных вставок разной длины на кинетику формирования ДНКдуплексов. Установлено, что введение вставки практически не влияет на константу скорости ассоциации комплексов. Однако диссоциация двойной спирали, сформированной с участием МО, протекает быстрее, чем это наблюдается для немодифицированного ДНК-дуплекса. Увеличение длины вставки является фактором ускорения распада дуплекса с ненуклеотидным выпетливанием. Если константа скорости диссоциации немодифицированного дуплекса M10/N(Рис. 7) при 25 °С составляет 3.3·10-4 с-1, то для дуплекса с относительно короткой вставкой M10/N5(DEG1)5 становится при этой же температуре в ~100 больше (3.7·10-2 с-1), а для дуплекса M10/N5(DEG3)5 с удлиненной вставкой увеличивается более чем в 3500 раз до величины 1.2 с-1.

Исследование структурных особенностей комплексов МО проводили методом спектрополяриметрии КД и с помощью анализа электрофоретической подвижности таких модифицированных дцДНК-структур в неденатурирующем геле (ПААГ 18%). По данным КД-спектров установлено (Рис. 8), что, как и следовало ожидать, введение в дцДНК ненуклеотидного выпетливания различной длины не приводит к глобальному изменению конформации двойной спирали.

Как и в случае контрольных комплексов, для дуплексов на основе МО профили КД-спектров соответствуют В-форме дцДНК. Это указывает на то, что наблюдаемая в результате введения ненуклеотидных остатков дестабилизация спирали ДНК является результатом локального возмущения ее структуры в сайте модификации. Об этом же свидетельствуют данные метода задержки в геле дуплексов с возмущением. Был проведен анализ электрофоретических подвижностей контрольного ДНК-дуплекса (32 п.о.) и его аналогов, несущих в центральной части разной длины выпетливания на основе исследуемых ненуклеотидных вставок или моно- и пентааденилатные выпетливания, для которых влияние на дуплексную структуру описано ранее (например, Dornberger U., et al., 1999).

Нами было показано, что подвижность в геле дуплексов с выпетливанием в центральной части заметно ниже, чем у дцДНК с такой же модификацией на ее конце или без нее. Это является следствием изгиба двойной спирали в сайте возмущения регулярной структуры. Для серии модельных дуплексов установлены величины углов отклонения спирали от линейной формы (). Показано, что для контрольных комплексов с аденилатными выпетливаниями определенные нами значения хорошо согласуются с данными структурных исследований, проведенных ранее. С увеличением длины ненуклеотидной вставки возрастает угол изгиба дцДНК. Длинные вставки на основе гидрофобных диолов изгибают спираль несколько меньше, чем гибкие олигоэтиленгликолевые выпетливания. Доказано, что степень дестабилизации дуплекса коррелирует с эффективностью его изгиба. Например, если DEG1-вставка дестабилизирует модельный дуплекс на 2.5 °C, отклоняя дуплекс от линейного на ~20°, то в случае модификации DEGизгиб достигает 60°, при этом Тпл комплекса снижается уже на ~6 °C. В целом для негидрофобных вставок, например на основе DEG-содержащих фосфодиэфиров, установлено, что термодинамический эффект от удлинения вставки имеет энтропийную природу и пропорционален логарифму числа дополнительных ковалентных связей, вносимых вставкой в углеводно-фосфатный остов МО.

Таким образом, продемонстрировано, что ненуклеотидные вставки, вызывая изгиб дцДНК, увеличивают скорость диссоциации двойной спирали, определяя природу снижения стабильности комплексов МО относительно нативных.

) 8 M10/N5(DEG8 1 Д M10/N10 В M10/N5(DEG )Г А Б В 4 0 -4 -4 -30 15 -8 --220 250 280 310 220 250 280 3220 250 280 3Рис. 8. Температурные серии КД-спектров нативного ДНК-дуплекса и двух дуплексов с ненуклеотидными вставками. Концентрация каждого из компонент комплекса 5·10-5 М в буфере 1 М NaCl, 10 мМ фосфат натрия (рН 7.3), 0.1 мМ Na2ЭДТА.

Определение унифицированных параметров для прогностического расчета стабильности комплексов МО с ДНК проводили с помощью метода множественной линейной регрессии (МЛР), используя сформированную базу данных, характеризующую свойства комплексов нативных и мостиковых олигонуклеотидов. Были получены унифицированные термодинамические параметры для расчета энергии формирования как нативных, так модифицированных DEG1-вставкой(ами) ДНК-дуплексов. В представленной работе параметризацию нативных комплексов проводили при использовании бльшего набора экспериментальных термодинамических характеристик, чем было использовано ранее (например, Allawi H.T., et al., 1997). Сопоставление величин термодинамических инкрементов, полученных нами и представленных в литературе, показывает хорошую корреляцию между этими параметрами, что указывает на отсутствие систематической ошибки в величинах термодинамических параметров комплексообразования, определенных нами и внесенных в общую базу данных. Кроме того, определены унифицированные параметры, количественно описывающие энергетические эффекты от введения ненуклеотидной вставки в любой динуклеотидный шаг ДНК спирали. Наибольшую прогностическую способность показал набор из 29 наборов инкрементов (G, Н и S) (13 для нативных и Т дополнительных унифицированных наборов для МО). Как и в случае нативных комплексов, полученный набор параметров позволяет проводить прогностический расчет величин свободной энергии комплексообразования МО. Более того, с их использованием возможно рассчитывать и Тпл нативных и DEG1содержащих дуплексов в стандартных условиях. Стандартное отклонение прогностического расчета термостабильности нативных и модифицированных комплексов составило менее 2 °C, как при рассмотрении комплексов, вошедших в ---· q [ ], градM ·cм базу данных, так и независимой выборки комплексов, параметры которых не использовали при определении унифицированных характеристик.

Эффективное использование олигонуклеотидов в лабораторной практике возможно, если существуют алгоритмы прогностического расчета стабильности формируемых ими дуплексов в различных буферных условиях, главным образом, в условиях с различной ионной силой растворов. В данной работе с целью определения особенностей комплексообразования нативных и мостиковых (для вставки DEG1) олигонуклеотидов в растворах, отличных от стандартных (1 M NaCl, нейтральный pH), была предложена новая оригинальная модель, учитывающая влияние противоионов на стабильность образуемых дуплексов. Расширенная модель конденсации противоионов предполагает, что экранирование отрицательных зарядов в олигонуклеотидной цепи происходит в результате насыщающего связывания катионов с фосфатными остатками (см. (17.1)-(17.4)).

Эффективность взаимодействия катионов с олигонуклеотидом, определяется состоянием, в котором находится цепь (оц или дц); числом сайтов связывания катионов в ДНК, зависящим от числа фосфатных остатков, находящихся вблизи конца цепи и внутри ее (вблизи G/C- и А/Т-пар, вблизи ненуклеотидной вставки).

Эфф K acc (17.1), A B AB Эфф K дц (17.2), AB nAB Na AB Nan AB Эфф Kоц (17.3), A kA Na ANak A Эфф K оц (17.4).

B kB Na B Nak B С использованием базы данных, характеризующей зависимость термостабильности комплексов ДНК от ионной силы растворов, определены параметры предложенной модели. Эта модель позволяет с высокой точностью проводить расчет стабильности комплексов олигонуклеотидов: средняя ошибка расчета Тпл составляет 0.7 и 1.0 оС, соответственно, а зависимость ошибки предсказания величин Тпл от GC-состава НК-компонентов и их длины отсутствуют (Рис. 9). В отличие от представленных в литературе, приведенное нами описание учитывает взаимодействие катионов как с оц-, так и с дц-состоянием НК, переход между которыми и определяет эффективность комплексообразования в системе. Полученное описание имеет наглядную физическую интерпретацию и позволяет проводить прогностический расчет стабильности НК-комплексов в широком диапазоне ионных сил раствора ([NaCl] = 0.01-1.024 M). Различное число катионов, связывающихся с фосфатными остатками в оц- и дц-состоянии, обусловлено различием их пространственной организации, что определяет неэквивалентность величин констант ассоциации катионов одновалентных металлов с ДНК. В дцсостоянии константа ассоциации катиона с сайтом НК практически в 2 раза выше, чем в оц-состоянии, что, вероятно, связано с повышенным электростатическим потенциалом вблизи НК-дуплекса из-за сближения в его составе двух отрицательно заряженных олигонуклеотидных цепей.

1y = 0.003x - 0.1А Б y = 0.997x + 0.226 R = 0.080 R = 0.997 ------0 20 40 60 80 1Температура плавления (эксперимент), °С 0 10 20 Число фосфодиэфирных остатков в цепи Рис. 9. (А) Корреляция экспериментальных и рассчитанных с помощью предложенной модели величин Тпл комплексов нативных и мостиковых олигонуклеотидов с ДНК. (Б) Зависимость ошибки расчета температуры плавления ДНК комплексов от длины олигонуклеотидов.

Данная модель позволяет описывать термостабильность ДНК-комплексов и в условиях конкурентного связывания противоионов с НК-компонентами, что продемонстрировано для случаев одновременного присутствия Na+ (от 1 мМ до 1 M) и Mg2+ (от 0.5 мМ до 0.3 M) в растворах (данные не приведены). Выявленные закономерности и параметризующие их величины легли в основу прототипа программного обеспечения, позволяющего проводить прогностический расчет термодинамических параметров образования комплексов нативных олигонуклеотидов и МО в различных буферных условиях. Алгоритм реализован в среде VB for Applications (Excel, Microsoft). Таким образом, в работе проведены комплексные исследования физико-химических закономерностей образования составных комплексов и получены данные, позволяющие проводить направленный выбор структуры зондов на основе тандемов олигонуклеотидов и МО. Кроме того, доказано, что выявленные закономерности применимы и для описания процесса образования конкатемерных структур, формирование которых проходит через этапы тандемного связывания олигомеров на общей матрице ДНК (данные не приведены). Наличие изгибающих дуплекс ненуклеотидных вставок в ДНКблоках конкатемерных структур ограничивает их длину, что доказано с помощью данных атомно-силовой микроскопии.

3. Тандемы коротких олигодезоксирибонуклеотидов как высокоселективные зонды при анализе точечных мутаций методом ферментативного лигирования Первоначально была определена эффективность дискриминации всех возможных типов одиночных мисматчей при лигировании тандемных комплексов с Температура плавления (расчет), °С помощью ДНК-лигазы фага Т4. Для этого использовали серию тандемных комплексов, образованных парой декануклеотидов, обеспечивающих высокую сте- C*pA C*pY X*pA пень ассоциации субстратных дуплексов в G--T G--T G--T условиях оптимальной работы фермента T/G T/T T/C G/G G/A G/T (25-37 оС). Установленные факторы дискриминации мисматчей вблизи оц-разрыва, как со стороны Р-компонента (донор 5'фосфата), так и ОН-компонента (донор 3'гидроксила) субстрата, включены в базу данных, характеризующую физикоГ 3’ CTAACTAACG--TCATCATATC химические свойства тандемных комплек5’ GATTGATTGX pYGTAGTATAG сов (например, см. Рис. 10).

Рис. 10. Типичный пример электроВ результате сравнительного анализа форетического анализа результатов эффективностей лигирования 96 несоверлигирования комплементарных и шенных комплексов установлено, что в несовершенных комплексов (20%среднем "ОН"-мисматчи дискриминируный денатурирующий ПААГ).

ются в 23 раза лучше, чем "P"-мисматчи. В Условия лигирования: 10 мин, 0.некоторых случаях несовершенные комед.акт. Т4 ДНК-лигазы.

плексы, содержащие несоответствия со стороны "P"-компонента, лигируются даже лучше, чем соответствующие комплементарные комплексы. Между значениями факторов дискриминации "ОН"- и "Р"-мисматчей наблюдается хорошая корреляция, которая нарушается только в случае 5 типов "ОН"-мисматчей: G/G, G/A, A/G, A/A (четыре R/R) и С/С. Наличие корреляции между факторами дискриминации неожиданно, т.к. "ОН"- и "Р"-мисматчи, скорее всего, должны влиять на разные этапы ферментативного катализа. В целом мисматчи типа R/P и гомо-P/P максимально дискриминируются как в случае "ОН"-, так и в случае "Р"-мисматчей. Возможным объяснением всплеска эффективности дискриминации R/R и С/С может являться тот факт, что пространственная структура дуплекса с несовершенными парами оснований такого типа наиболее сильно отклоняется от канонической структуры двойной спирали, т.е. комплементарной пары типа R/P, что и влияет на селективность ДНК-лигазы.

Таким образом, получены данные, необходимые для создания программного обеспечения, производящего выбор тандемов олигонуклеотидов, которые обеспечивают максимальную селективность при их использовании в качестве зондов для анализа полиморфных сайтов в ДНК методом лигирования олигонуклеотидов. Разработан алгоритм выбора структуры тандемов олигонуклеотидов, который был реализован на VB for Application (Excel, Microsoft), исходными данными для которого являются последовательности нормальной и мутантной матрицы, их концентрации и концентрации компонентов тандема – зонда, в сайте связывания которого располагается предполагаемая замена, и олигонуклеотидов-эффекторов, обладающих повышенной относительно зонда гибридизационной способностью. При этом необходима также информация о возможном диапазоне температур проведения анализа и о минимально допустимых степенях ассоциации комплекса зонда и эффектора с матрицей. Программа позволяет производить расчет комплексообразующих свойств двух- и трехкомпонентного тандемов, соответствующих анализируемым вариантам ДНК, и отбирать те из них, которые обладают высокими значениями селективности гибридизации для заданных концентрационных и температурных условий. Далее для выбранных тандемов определяют величины факторов дискриминации лигирования, соответствующие отношению скоростей ферментативного лигирования комплементарных и несовершенных комплексов. В результате алгоритм выводит структуры двух- и трехкомпонентных тандемов, структуры которых, согласно расчетам, имеют максимальную селективность как гибридизации, так и лигирования при заданной температуре и для интересующего участка ДНК, имеющего анализируемый полиморфный сайт.

Оптимизация схемы анализа точечных мутаций в ДНК методом ферментативного лигирования Величины энергетических вкладов от реализации коаксиальных взаимодействий в ДНК способны обеспечить значительное возрастание Тпл только коротких дуплексов. Поэтому далее была исследована возможность минимизации размеров тандемного комплекса с целью определения его оптимального строения, обеспечивающего высокоселективное лигирование составного зонда с помощью ДНК-лигазы фага Т4. Было установлено, что тандемный комплекс, в котором тетрануклеотидный зонд, фланкированный на общей ДНК-матрице парой олигомеров большей длины (например, октануклеотидов), является субстратом данного фермента (Рис. 11).

M 3' pNCGTAGTTCGTCGAGGTCCGTp pXAGC pCXGC pCAXC pCAGX A G T C A G C T A T G A [32P]GCATCAAG pTCCAGGCApN' pNpCAGC pNpXAGC pN4(t1), pN4(a1), pN4(g1) pN pCXGC pN4(t2), pN4(c2), pN4(g2) pNpCAXC pN4(t3), pN4(a3), pN4(c3) pCAGX pN4(t4), pN4(a4), pN4(g4) Рис. 11. Состав модельных тандемных комплексов (слева) и радиоавтограф электрофореза в 20%-ном денатурирующем ПААГ продуктов их лигирования pN8+pN4+pN' (справа). Условия лигирования: 25оС, 15 мин, 50 ед.акт. ДНК-лигазы фага Т4, олигонуклеотидные компоненты взяты в концентрации 10 мкМ каждого.

Определен порядок лигирования двух оц-разрывов в таком составном комплексе: лигирование разрыва со стороны Р-компонента происходит первым. Показано, что практически любой мисматч, формируемый в дуплексной части центрального тетрануклеотида, эффективно дискриминируется ДНК-лигазой. Это достигается как за счет значительной дестабилизации минидуплекса в случае образования несовершенного комплекса, так и за счет эффективной дискриминации мисматчей на этапе лигирования. Установлено, что за счет варьирования условий лигирования (например, ионной силы растворов) или за счет укорочеpCAGC pCAGC pCAGC pCAGC ния фланкирующих олигомеров (с окта- до гексануклеотидов) удается дополнительно повысить селективность лигирования трехкомпонентного тандема.

Разработка подходов к гетерофазному анализу однонуклеотидных несоответствий в ДНК при лигировании тандемов коротких олигонуклеотидов Учитывая высокую чувствительность системы анализа точечных мутаций в ДНК, основанной на использовании предложенных составных зондов, мы разработали два варианта новых подходов к созданию ДНК-диагностических тестсистем (Схема 6). Оба подхода приводят к фиксации сигнального продукта лигирования на твердотельном носителе, облегчая удаление избытка репортерных групп из системы и визуализацию специфичного продукта лигирования. В первом подходе один из компонентов тандема, фланкирующих тетрамерный минизонд, иммобилизовали на поверхность полиметакрилатных микрочастиц. Репортерную группу (например, остаток биотина) вводили в структуру второго фланкирующего олигомера. В присутствии комплементарной ДНК-матрицы и ДНКлигазы биотиновая метка фиксируется на твердотельном носителе и легко выявляется после отмывок, например, с помощью конъюгата стрептавидинщелочная-фосфатаза и хромогенных субстратов.

В рамках второго Схема 6.

подхода реакцию лигирования биотин-меченого подход I подход II M M 3' 3' тандема на матрице ана- CGTAGTTCGTCGAGGTCCGTp CGTAGTTCGTCGAGGTCCGTp П pGCATCAAG pTCCAGGCA- Bio pGCATCAAG pTCCAGGCA-Bio pCAGC П~pN8 pN8'Bio pCAGC лизируемого ДНК- П~pN8 pN8'Bio pNpNТ4 ДНК-лигаза ампликона проводили в промывочные процедуры 3' CGTAGTTCGTCGAGGTCCGTp растворе. Протяженный pGCATCAAGCAGCTCCAGGCA-Bio 3' CGTAGTTCGTCGAGGTCCGTp П~pN20Bio продукт лигирования в П pGCATCAAGCAGCTCCAGGCA-Bio П~pN20Bio иммобилизация на носитель составе комплекса с ДНКпромывочные процедуры аналитом наносили из pGCATCAAGCAGCTCCAGGCA-Bio реакционной смеси на капроновую мембрану и pGCATCAAGCAGCTCCAGGCA-Bio pGCATCAAGCAGCTCCAGGCA-Bio П иммобилизовали с помоокрашивание полимера щью УФ-облучения (2BCIP+NBT нм, ртутные лампы низП pGCATCAAGCAGCTCCAGGCA-Bio pGCATCAAGCAGCTCCAGGCA-Bio кого давления). Мембрану отмывали от избытка где П и - полимерные носители, Bio - биотин - конъюгат стрептавидин-щелочная меченого компонента фосфатаза, тандема, который не спо- BCIP+NBT- хромогенные субстраты.

собен удержаться на иммобилизованном ампликоне. Сигнальный продукт выявляли колориметрически.

Возможность практического использования обоих подходов к анализу однонуклеотидных полиморфизмов в ДНК-ампликонах была проверена с использованием различных модельных объектов. Доказано, что на основе предложенных прототипов тест-систем с высокой надежностью удается выявлять точечные мутации в ДНК, диагностически знчимые при генотипировании вирусов, наличии генетических заболеваний или при проведении популяционно-генетических исследований. Адекватность предложенных подходов доказана при сопоставлении результатов анализа с данными прямого секвенирования ДНК-образцов или при проведении параллельных тестов с помощью референс-методов, таких, как аллель-специфичный ПЦР и рестрикционный анализ.

Другие варианты использования тандемов коротких олигонуклеотидов, исследованные в работе Возможность создания составных праймеров для секвенирования ДНК давно привлекает внимание исследователей. Наличие библиотеки универсальных блоков на основе коротких олигонуклеотидов обеспечивает значительное сокращение затрат на анализ НК, когда требуется большой набор синтетических праймеров. В данной работе продемонстрировано, что составной праймер с участием тетрануклеотидов (рGTAA, рAACG, рACGG, рCCAG) и их 5'-феназиниевых производных способен заменить стандартную 16-звенную олигонуклеотидную затравку (GTAAAACGACGGCCAG) при секвенировании методом Сэнгера модельной оц ДНК рекомбинантного бактериофага M13HAV20 с использованием набора “Sequenase version 2.0” (Amersham). Только одна из рассмотренных комбинаций 5' нативных и модифицированных тетрамеров – PhnRрGTAA +PhnRрAACG+pACGG+ pCCAG – приводила к специфическому праймированию реакции секвенирования, позволяя определить последовательность фрагмента анализируемой ДНК. Полученные результаты указывают на то, что, осуществлять сборку праймеров любой сикСхема 7.

венс-специфичности, используя праймер адаптор ? ограниченный набор уникальных блоков на основе 256-ти тетраадаптор нуклеотидных последовательно- праймер стей, по-видимому, возможно.

Другое потенциальное приложение тандемов олигонуклеотидов основано на ДНК-лигазазависимом введении на концевые участки неизвестных последовательностей ДНК-фрагментов заданной структуры (Схема 7).

Обычно для таких целей используют дуплексы на основе протяженных олигомеров, содержащие оц нависание. Нависающий оцДНК фрагмент имеет вырожденную последовательность, которая позволяет связать выявляемую ДНК за счет гибридизации встык с предформированным дц фрагментом известной структуры.

После лигирования наличие пары концевых участков известной структуры дает возможность амплифицировать ДНК. Однако для обеспечения качественного протекания, например, амплификации с помощью ПЦР, требуется удаление избытка адапторной конструкции. Протяженные олигомеры-адапторы могут конкурировать с праймерами, снижая эффективность и специфичность ПЦР. Данное неудобство можно преодолеть, если в качестве одной из цепей адапторного дуплекса использовать тандем коротких олигонуклеотидов. Такая конструкция при низких температурах, т.е. в условиях лигирования ее с искомой ДНК, обладает достаточной стабильностью. Однако при повышении температуры до уровня, необходимого для протекания ПЦР, тандемный комплекс денатурирует, а его компоненты не могут конкурировать с праймерами за связывание с ДНК-матрицей. Кроме того, использование 3'-модифицированных компонентов предполагаемого адаптора исключает его неспецифическое превращение ДНК-зависимыми ферментами (ДНК-лигазой и ДНК-полимеразой). Следовательно, при использовании таких модифицированных адапторных структур появляется возможность ввести их на конец оцДНК-объекта и без разделения реакционной смеси (после реакции лигирования) перейти к этапу ПЦР. Подобная процедура существенно упрощает методику проведения анализа и снижает вероятность потери низкокопийных фрагментов ДНК в пуле неизвестных последовательностей, подлежащих идентификации.

Работоспособность предложенной схемы доказана.

4. Составные олигонуклеотиды как инструменты для направленного воздействия на НК-мишени и зонды для анализа ДНК Схема 8.

Относительно недавно Первая цепь - доставляемый сиквенс-специфичный олигонуклеотид было показано, что ис...........

.................................

пользование сложных Вторая цепь - олигонуклеотид-доставщик составных комплексов ДНК – конкатемерных Flu-R Flu-R Метка Flu-R дуплексов – в значи............................................

тельной степени споЛипофильный остаток Chol-L Chol-L собствует проникновению НК в клетки млеFlu-R Flu-R Flu-R копитающих. Мы ис.......................................................

следовали возможность дополнительного поОлигонуклеотид-стоппер Chol-L вышения эффективности проникновения таких мультиассоциатов в клетки млекопитающих за счет введения гидрофобных холестериновых остатков в олигонуклеотидный компонент, комплементарный антисенс-агенту (Схема 8). Такой олигомер выступает в роли доставщика, исключающего необходимость модификации сиквенс-специфичного агента и удерживающего его в комплексе. Остаток холестерина в виде аланинового эфира вводили по 5'-концевому фосфату олигомера-доставщика или стоппера путем формирования фосфамидной связи. Эффективное использование конкатемерных структур определяется в том числе и их стабильностью. Анализ физико-химических свойств комплексов проводили методом термической денатурации и с помощью электрофоретического анализа в неденатурирующих условиях. Было показано, что в действительности остаток холестерина не вызывает существенной дестабилизации дцДНК-ассоциата, хотя и снижает наблюдаемую кооперативность его плавления. Остаток стероида изменяет характер распределения модифицированного конкатемера по длине относительно нативного аналога.

В случае холестерин-содержащей структуры увеличивается доля укороченных форм, однако при этом наблюдается и некоторое увеличение высокомолекулярных ассоциатов, обладающих низкой электрофоретической подвижностью.

Формируемые структуры длиной до 1000 п.о. несут множество остатков стероида, что существенно упрощает их сорбцию на поверхности клеточной мембраны и повышает вероятность проникновения внутрь клетки. Действительно по данным флуоресцентной микроскопии и FACS-анализа уже после 30 мин инкубации конкатемера, содержащего в одной цепи остатки флуоресцеина, а в другой холестерина, клетки (НЕК293) эффективно флуоресцируют. Детальное рассмотрение биологических эффектов выходит за рамки данной работы, поскольку анализ биологической активности созданных конструкций проводили в ЛБНК ИХБФМ СО РАН под руководством проф. М.А. Зенковой.

Сравнение эффективности воздействия на НК-мишени сиквенсспецифичных агентов на основе нативных и мостиковых олигонуклеотидов Одним из механизмов подавления экспрессии генов, например, с помощью антисмысловых олигонуклеотидов, считается направленная модификация НКмишеней с помощью реакционноспособных производных или же расщепление мРНК в составе гибридных РНК/ДНК-дуплексов рибонуклеазами Н. Это обусловило необходимость исследования МО на способность выступать в качестве адресованных антисенс-агентов. Влияние ненуклеотидной вставки (фосфодиэфира 1,6-гександиола) в составе МО на его способность взаимодействовать с ДНК было оценено по эффективности модификации ДНКмишени алкилирующими производными МО. Если в условиях эффективного комплексообразования Схема Схема 9.

модификация ДНКмишени алкилирующим 3' степень 15 10 5 1 Тпл, оС M CGTAGTTCGTCGAGGTCCGTp[32] модификации производным нативного 5' RCl-pCAGCTCCAGGCA RClpN12 60% олигонуклеотида и МО * 5' RCl-pCAGCTCCAGGCA RClpN4^ 64% происходит по 5' RCl-pCAGCTCCA RClpN8 77% одинаковым сайтам ДНК, 5' RCl-pCAGC*TCCA RClpN4^ - <то, следовательно, оба олигомера образуют комплексы с одинаковой пространственной структурой.

Алкилирование было исследовано на модельной системе, где в качестве мишени выступал 5'-[32P]-меченый 20-звенный олигонуклеотид М, а RCl-содержащие реагенты были получены на основе 12- или 8-звенных мостиковых или нативных олигонуклеотидов, комплементарных участку в составе ДНК-мишени (Схема 9). В МО ненуклеотидная вставка на основе фосфодиэфира гексаметилендиола была на расстоянии четырех нуклеотидов от 5'-конца олигомеров (рN4^N4 и рN4^N8).

Алкилирование мишени М регистрировали гель-электрофорезом в денатурирующем 20%-ном ПААГ по появлению продуктов деструкции ДНК-мишени в местах модифицированных оснований после обработки реакционной смеси 10%ным водным пиперидином (G9, G12, G16 и G19) и пиперидин-стабильных аддуктов (С13, ~70% от общей степени модификации). В условиях эффективного комплексообразования, при 20оС, введение ненуклеотидной вставки практически не влияет на направленность и степень модификации мишени алкилирующим реагентом RClрN4^N8 (64%), несмотря на уменьшение гибридизационных свойств МО. Для всех алкилирующих производных олигомеров модификации подвергаются одни и те же сайты мишени. Реакционноспособные агенты на основе других составных конструкций, а именно тандемов коротких олигонуклеотидов, в том числе стабилизированных гидрофобными стероидными «скрепками», – также являются способными вызывать направленную модификацию ДНК.

Способность МО вызывать гидролиз РНК мишеней под действием РНКзы Н E.coli было исследовано на примере расщепления 20-звенного олигорибонуклеотида (rM – РНК-аналог олигомера М на схеме 10) в комплексах с комплементарным олигодезоксирибонуклеотидом (pN20) и его производными, содержащими гексаметилендиоловые и гексаэтиленгликолевые вставки, а также в ряде случаев дополнительный аденилатный остаток, соединенный с концом олигомера 3'-3'«инвертированной» межнуклеотидной связью. Первоначально было установлено, что все изученные производные способны формировать комплементарные комплексы. Все МО вызывали гидролиз РНК мишени, хотя и в несколько меньшей степени, чем протяженный нативный олигомер и трехкомпонентный тандем (pN8+pN4+pN8). Снижение эффективности ферментативного гидролиза РНК и числа гидролизуемых фосфодиэфирных связей вызывало и увеличение числа вставок, вводимых в олигонуклеотид, например, в случае использования производного N5^^N5^^N ^^N5 (где ^^ - HEG1-вставка). Кроме того, было установлено, что МО, несущие вставку вблизи 3'-конца, обладают повышенной относительно нативных олигонуклеотидов стабильностью к действию экзонуклеаз, например, фосфодиэстеразы змеиного яда (Crotalus atrox).

Таким образом, доказано, что составные олигонуклеотидные конструкции могут быть использованы для создания сиквенс-специфичных агентов НКнаправленного действия.

Мостиковые олигонуклеотиды – молекулярные зонды для исследования фермент-субстратного взаимодействия и аллель-специфичного анализа ДНК Ненуклеотидные вставки, введенные в углеводно-фосфатный остов олигонуклеотида, нарушают регулярность структуры олигомерной цепи, формируя выпетливание в составе комплекса мостикового олигомера. Это возмущает двойную спираль ДНК, вызывая ее изгиб. Повышенная доступность пар оснований в таком сайте для атаки молекулами воды приводит к увеличению скорости диссоциации модифицированной двойной спирали относительно нативной. Таким образом, имеющиеся физико-химические и структурные данные о комплексах ДНК, содержащих ненуклеотидные вставки-выпетливания, позволяют полагать, что дуплексы на основе МО могут выступать в качестве субстратов в ферментативных реакциях, и что влияние вставки должно определяться ее положением в субстрате ДНК. Однако субстратные свойства МО в реакциях ДНК-зависимых ферментов определяются не только и не столько термостабильностью их комплексов, сколько типом, размером и положением вставок. Таким образом, без систематических исследований невозможно предопределить особенности поведения комплексов МО в реакциях, катализируемых ДНК-зависимыми ферментами.

На примере широко используемых ферментов ДНК-лигазы фага Т4 и ДНКполимеразы Thermus аquaticus (Taq ДНК-полимеразы) было изучено влияние природы и положения ненуклеотидной вставки в составе субстратных комплексов на эффективность и селективность их ферментативного превращения. Исследования проводили с использованием наборов субстратных комплексов, в структуре которых варьировали положение ненуклеотидного остатка (Рис. 12).

Модификация ОН-компонента Б А матрица М1, М1m 100 70 5' 3' p CAGCTCCAGGCA GCATCAAG N12, N12^ *pNМодификация 0 Р-компонента матрица М2, М2m 3' 5' p GCATCAAG CAGCTCCAGGCA *pN8 pN12, pN12^ Рис. 12. Лигирование Т4 ДНК-лигазой олигонуклеотидов в составе нативных и модифицированных комплексов, отличающихся положением ненуклеотидной вставки относительно оцразрыва, задаваемого структурой мостикового додекануклеотида N12^. Степень лигирования олигонуклеотидов в комплексах (столбцы), несущих DEG1-вставку в различных положениях ОН- (А) и Р-компонента (Б) ДНК-субстратов (вставки справа). Температура плавления комплементарных комплексов, образованных соответствующим додекануклеотидом (N12, N12^) и матрицей 5'TGCCTGGACGTG3' (кружки).

Так, используя, например, два типа комплексов, в которых МО выступал в роли либо Р-компонента, либо ОН-компонента в ДНК-субстрате, было показано, что ДНК-лигаза является крайне чувствительной к наличию ненуклеотидных вставок в ряде положений ДНК. Находящиеся по разные стороны от оц-разрыва участки субстрата, в составе которых модификации ухудшают субстратные свойства тандемных комплексов, имеют разную протяженность. Это отражает «асимметричность» расположения зоны взаимодействия (от –5 до +7 нт.) Т4 ДНКлигазы с ДНК-субстратом относительно сайта лигирования (Рис. 12). Аналогичные закономерности по влиянию позиции вставки в праймерной и матричной цепи субстрата Taq ДНК-полимеразы позволили проанализировать топологию сайта связывания и для этого фермента. В специфическое взаимодействие с аминокислотными остатками этой ДНК-полимеразы вовлечены 8-9 и 5-7 нт. в матричной и Тпл, °С NN3^N4^N5^N6^N7^N8^N9^pNN2^N10^pN3^pN4^pN5^pN6^pN7^pN8^pN9^Степень лигирования, % pN2^pN10^праймерной цепях, соответственно. Таким образом, МО могут быть использованы в качестве доступных молекулярных инструментов для анализа белковонуклеиновых взаимодействий, с использованием которых критичные для распознавания позиции в ДНК могут быть определены с точностью до нуклеотида.

Селективность ферментативного превращения комплексов МО Наличие ненуклеотидной вставки в составе субстратных комплексов, образованных с участием МО, можно рассматривать как возмущение ДНК-структуры. В литературе представлены варианты повышения селективности действия некоторых ДНК-полимераз при использовании олигонуклеотидов, несущих модификацию, нарушающую регулярность спирали ДНК и располагающуюся непосредственно вблизи сайта каталитического превращения.

А Б M1 M1–1 M1–2 M1–3 M1–4 M1–5 M1–1100 12 N6^1 2 2 ^ 1 0 3 ^ 9 4 ^ 8 5 ^ 7 6 ^ 6 7 ^ 5 8 ^ 4 9 ^ 3 1 0 ^ Рис. 13. Анализ эффективности превращения ДНК-субстратов, нативных и модифицированных ненуклеотидной вставкой, под действием Т4 ДНК-лигазы (А) или Taq ДНКполимеразы (Б) в отсутствие одиночного мисматча или при его наличии в различных положениях комплексов ДНК (16 п.о. от 3'-конца праймера). Матрицы M1m (m: -1-6) обеспечивают в комплексах с нативным pN12 или модифицированными pN12^ додекамерами наличие одиночного мисматча в позициях от первой и до шестой п.о. относительно их 3'-конца.

Из представленных данных следует, что при использовании нативных олигонуклеотидов как ДНК-лигаза, так и Taq ДНК-полимераза оказываются достаточно селективными только тогда, когда несовершенная пара оснований находится вблизи лигируемого ОН-компонента или праймера соответственно, т.е. вблизи сайта ферментативного превращения (Рис. 13, см. М1-1 и М1-2). Для обоих ферментов по мере отдаления мисматча от 3'-конца ингибирующий эффект снижается. Совершенно иная картина наблюдается для комплексов на основе МО (Рис. 13).

Наличие ненуклеотидной вставки внутри сайта связывания фермента на ДНКсубстрате или на его границе приводит к значительному повышению селективности превращения. Например, факторы дискриминации мисматча (отношение выходов продукта реакции в совершенном и несовершенном комплексах), удаленного от сайта превращения (шесть нуклеотидов), при использовании зондов на основе мостикового олигомера N6^N достигают 8 при лигировании и 12 при его удли нении. В этом случае использование нативного зонда не обеспечивает надежной дискриминации однонуклеотидной замены в матричной цепи, а факторы дискриВыход полноразмерного продукта удлинения, % Степень лигирования, % ММ1-М1-М1-М1-М1-pNМ1-pN3^pN4^pN5^pN6^pN7^pN8^pN9^pN2^pN10^минации мисматча при лигировании и при полимеризации составляют 2.9 и 1.соответственно. Наличие ненуклеотидной вставки проявляется даже при дискриминации мисматчей, удаленных от сайта модификации в субстратном комплексе.

Так, эффективность дискриминации несовершенных пар оснований вблизи 3'конца удлиняемого олигомера резко возрастает при введении ненуклеотидного выпетливания в область связывания полимеразы. При этом вставка в пограничной позиции обеспечивает максимально высокую селективность действия фермента.

Следует отметить, что такой эффект удаленной вставки является результатом сочетания ее относительно низкого ингибирующего эффекта в составе совершенного субстратного комплекса (по сравнению со случаями использования модификаций в более близких к 3'-концу затравки положениях) и выраженного ингибирующего действия вставки в составе комплексов с мисматчем. Для комплексов МО, несущих вставку ближе к 3'-концу затравки, также наблюдается высокая селективность ферментативного удлинения, однако это происходит на фоне снижения их субстратных свойств (Рис. 13).

Гибридизационный анализ НК с помощью мостиковых олигонуклеотидов Для демонстрации Схема 10.

способности МО высту1) Сэндвич-гибридизация пать в качестве высокоселективных зондов при гибридизационном анализе ДНК были рассмотрены на модельных системах 2) 3) три способа выявления Ферментативное лигирование Ферментативное удлинение специфических последовательностей в гетерофазном варианте (Схема 10):

сэндвич гибридизация (формирование тандемного комплекса (иммобилизованный зонд+меченый зонд)/анализируемая ДНК); лигирование иммобилизованного и меченого олигонуклеотида на общей ДНК-матрице; мечение иммобилизованного на твердотельном носителе зонда при его ферментативном удлинении под действием Taq ДНК-полимеразы в комплексе с ДНК-матрицей. В серии сравнительных экспериментов было показано, что удлинение МО с помощью термостабильной Taq ДНК-полимеразы дает более воспроизводимые результаты анализа ДНК и обеспечивает более высокую чувствительность ее выявления. Наибольшая чувствительность выявления ДНК-ампликонов (~0.2 фмоль, 230 п.о.) была достигнута при проведении реакции минисеквенирования ДНК-матрицы, т.е. реакции матричного удлинения зонда-затравки в присутствии ограниченного набора нуклеозидтрифосфатов, например, dATP и модифицированного dTTP, несущего репортерный остаток биотина в С5 положении тимина. В этом случае удлинение зонда не приводит к значительной стабилизации комплекса удлиненного продукта с ДНК-аналитом относительно комплекса исходного зонда с ДНК, что позволяет при температуре, близкой к Тпл этих комплексов, обеспечивать мечение большого числа олигомеров-затравок в расчете на одну молекулу цепи анализируемой ДНК.

Этот подход – изотермическая амплификация гибридизационного сигнала, кратко описанный ранее (Dubiley S., et al., 1999), оказался приемлем как для гомофазного, так и для гетерофазного вариантов выявления специфических последовательностей ДНК.

В данной работе проведена детальная оптимизация изотермического мечения олигонуклеотидных зондов с помощью Taq ДНК-полимеразы. Предложена кинетическая схема, описывающая этот процесс. Полученные результаты (в сочетании с результатами физико-химического описания комплексов МО) легли в основу алгоритмов направленного выбора сиквенс-специфичных зондов на основе МО, что было нами использовано при разработке прототипа тест-системы для генотипирования вируса гепатита С (ВГС). В качестве анализируемой области генома вируса использовали 5'-нетранслируемый участок (5'-UTR), в составе которого выявлены генотип-специфичные области (Bukh J., et al., 1992). Выбран набор ВГС- и генотип-специфичных олигонуклеотидов, которые были синтезированы и иммобилизованы на капроновые мембраны в результате мягкого облучения УФсветом. Условия УФ-индуцированной иммобилизации тщательно оптимизировали с целью выявления факторов процесса и структуры зондов, обеспечивающих сохранность функциональных свойств последних. В результате было установлено, что введение короткого декатимидилатного домена на 5'-конец зондов-затравок через гибкий DEG-содержащий линкер значительно повышает эффективность фотоиндуцированной иммобилизации олигонуклеотидов на капроне. Доказано, что фиксированные таким образом на твердотельном носителе зонды способны связывать ДНК-аналит и превращаться под действием Taq ДНК-полимеразы. Одним из основных фактов, остававшихся без рассмотрения до этого, ограничивающих потенциал МО как зондов для гибридизационного анализа, является их пониженная способность к комплексообразованию. Это обстоятельство приводит к тому, что при наличии внутримолекулярных структур в анализируемой ДНК комплексообразующей способности таких зондов может оказаться недостаточно для связывания со специфическим сайтом, вовлеченным в формирование шпилечных структур. Решением этой проблемы может стать контролируемая фрагментация ДНК-аналита. Сокращение длины НК-фрагментов снижает вероятность образования ими прочных внутримолекулярных комплексов. В литературе описаны способы фрагментации ДНК, использование которых, однако, часто требует предварительной очистки аналита.

В данной части работы представлены результаты исследований по зависимости эффективности выявления специфической последовательности в составе ПЦРфрагмента ДНК от степени его статистической фрагментации. Фрагментацию ДНК осуществляли путем образования апуриновых или апиримидиновых сайтов (AP-сайтов) с последующей термической обработкой. Подобраны простые и воспроизводимые процедуры кислотной и ферментативной деструкции ДНК, не требующие дополнительной очистки анализируемой пробы перед проведением гетерофазного гибридизационного анализа. В первом варианте протокол фрагментации ДНК был основан на изменении pH реакционной смеси, содержащей ПЦРампликон. Значение pH образца изменяли до значения 2, добавляя расчетное количество раствора соляной кислоты (0.4 М). Полученную смесь выдерживали до 30 мин при 37 oС, что приводило к образованию апуриновых сайтов в ДНК. Фрагментацию пробы осуществляли термической обработкой (10 мин, 95 oC) после нейтрализации (до pH 7.0) раствора добавлением аликвоты 1 М раствора трис-OH.

Второй протокол основан на использовании дезоксиуридин-содержащей ДНК и урацил-ДНК-гликозилазы (UDG), обеспечивающей формирование апиримидиновых сайтов в структуре биополимера. Предварительно получали ДНКфрагмент, проводя ПЦР в присутствии определенного количества дезоксирибоуридинтрифосфата (dUTP). Степень фрагментации такой ДНК после обработки UDG определяется содержанием в ней dUMP-остатков и легко контролируется изменением относительного содержания dTTP и dUTP при наработке ДНКаналита.

Выявление фрагментированной ДНК-матрицы проводили с помощью отработанной схемы, основанной на ограниченном удлинении иммобилизованного зонда в комплексе с ДНК-пробой с помощью Taq ДНК-полимеразы. В качестве зондов использовали нативные олигонуклеотиды и их мостиковые аналоги в качестве высокоселективных зондов, обладающих пониженной гибридизационной способностью. Кроме того, важно отметить, что использование фрагментированной ДНК-пробы позволяет минимизировать контаминацию помещений лабораторий полноразмерным ампликоном.

dUTP Тип 2a Тип 1b Тип 3a H+ (мин) dTTP 30' 15' F 0.2 0.6 1.Сonst Сonst 1а, 2a 1b 1a 1b 2a 2a 2b 2b 3а 3a 3b 3b K1+ K1+ K2+ Рис. 14. Шаблоны и изображения капроновых мембран, содержащих иммобилизованные зонды, после проведения генотипирования ВГС (слева). Сравнение эффективностей выявления ОТ-ПЦР-фрагмента ДНК 5'-UTR-ВГС субтип 3а (F, 230 п.о.) после проведения его кислотной и ферментативной фрагментации или без них (справа).

Эффективность предложенных подходов апробировали при разработке прототипа тест-системы по генотипированию ВГС (Рис. 14). Капроновые полоски, несущие набор ВГС и генотип-специфичных зондов, вводили в реакцию минисеквенирования в присутствии Taq ДНК-полимеразы, ограниченного набора нуклеозидтрифосфатов, включая биотин-содержащий, и продукта ОТ-ПЦР ВГС (2п.о.), прошедшего процедуры контролируемой фрагментации или без них. Видно, что с использованием созданных систем параллельного анализа ДНК удается однозначно типировать ВГС по набору использованных маркерных последовательностей. При этом контролируются все стадии анализа: K1+ - отражает дееспособность системы генерации колориметрического сигнала; К2+ – функциональность меченого трифосфата и ДНК-полимеразы.

Таким образом, в результате проведенного комплексного исследования выполнены все поставленные фундаментальные задачи, касающиеся разработки молекулярных инструментов на основе составных олигонуклеотидных конструкций. Разработаны способы прогностического расчета термической стабильности ДНК/ДНК-комплексов, образованных с участием составных олигонуклеотидных зондов. Выявлены основные факторы структуры таких объектов, определяющие стабильность и субстратные свойства комплексов на их основе. Предложены оригинальные подходы к разработке ДНК-диагностических систем и биологически активных агентов, эффективность действия которых определяет использование именно составных олигонуклеотидных конструкций.

ВЫВОДЫ 1. Впервые установлены основные закономерности влияния нуклеотидного состава и модификаций различной природы в структуре олигонуклеотидов на эффективность образования ими составных олигонуклеотидных комплексов – тандемных, конкатемерных и содержащих мостиковые олигонуклеотиды (МО).

Показано, что ненуклеотидные остатки (стероидные и ароматические) в сайте одноцепочечного разрыва тандемных комплексов и ненуклеотидные выпетливания в составе комплексов МО/ДНК вызывают изгиб двойной спирали ДНК в сайте модификации. Для комплексов МО/ДНК установлено, что масштаб изгибной деформации ДНК-спирали и степень ее дестабилизации можно задавать, варьируя природу, размер и композицию ненуклеотидных вставок на основе фосфодиэфиров олигоэтиленгликолей и олигометилендиолов. Доказано, что наличие ненуклеотидной вставки в комплексах МО/ДНК приводит к увеличению скорости диссоциации дуплексной структуры. Выявлены основные элементы структуры ДНК-комплексов и модифицирующих остатков в их составе, определяющие стабильность составных олигонуклеотидных ДНК-дуплексов.

2. Разработаны методы термодинамического анализа составных олигонуклеотидных ДНК-комплексов, позволяющие определять энергетические эффекты от формирования отдельных элементов их структуры. Созданы базы данных, содержащие величины температур плавления (Тпл) и термодинамические параметры образования (энтальпии Н°, энтропии S° и свободной энергии G° ) тандемных комплексов, комплексов МО/ДНК и соответствующих контрольных дцДНК-структур, включающие энергетические характеристики как экспериментально определенные, так и представленные в литературе. Определены унифицированные термодинамические характеристики, позволяющие проводить прогностический расчет термодинамических параметров образования совершенных и несовершенных тандемных комплексов, содержащих любые типы мисматчей на стыке дуплексных структур, а также совершенных комплексов ДНК с МО. Созданы алгоритмы прогностического расчета Тпл таких дуплексов для стандартных буферных условий (1 M NaCl, нейтральный pH) и новый способ расчета соответствующих величин для условий с другой ионной силой растворов. Показано, что с использованием разработанных алгоритмов удается с хорошей точностью прогнозировать стабильность составных олигонуклеотидных дцДНК-конструкций, средняя ошибка расчета Тпл комплексов составных олигонуклеотидов в стандартных условиях не превышает 2 °С.

3. Осуществлено систематическое исследование закономерностей превращения составных олигонуклеотидных комплексов в реакциях, катализируемых ДНК-лигазой фага Т4 и ДНК-полимеразой Thermus аquaticus. Определены основные характеристики строения тандемных комплексов и комплексов МО/ДНК, обеспечивающие сохранность субстратных свойств соответствующих дцДНК-структур в реакциях, катализируемых данными ДНК-зависимыми ферментами. Показано, что в диагностических подходах, основанных на ферментативном лигировании и/или минисеквенировании ДНК, эффективность дискриминации мисматчей в несовершенных комплексах с участием составных тандемных и мостиковых олигонуклеотидов выше, чем при использовании немодифицированных протяженных олигонуклеотидов.

4. Доказано, что составные олигонуклеотидные конструкции могут выступать в качестве сайт-специфичных агентов для направленного воздействия на нуклеиновые кислоты в рамках как комплементарно-адресованной модификации, так и РНКаза Н-опосредованного воздействия при физиологических температурах. Продемонстрирована перспективность использования составных конструкций на основе модифицированных конкатемерных структур для эффективной доставки биологически активных олигонуклеотидов внутрь клеток млекопитающих.

5. Предложены новые варианты использования составных олигонуклеотидных конструкций для анализа ДНК. Показано, что тандемы тетрануклеотидов и их производных образуют составные праймеры для секвенирования ДНК по методу Сэнгера. С использованием тандемов коротких олигонуклеотидов и МО разработаны новые подходы к определению точечных мутаций в ДНК, создан ряд прототипов тест-систем для анализа полиморфных сайтов в ДНК, обуславливающих генотип вирусных инфекций, генетические заболевания, а также вариации генетических маркеров в популяции человека. Проведена оптимизация протоколов использования составных олигонуклеотидных зондов при проведении параллельного гибридизационного анализа ДНК в гомо- и гетерофазном вариантах. Разработаны новые способы мягкой фрагментации ДНК (кислотазависимый и урацил-ДНК-гликозилаза-зависимый варианты) для повышения эффективности выявления специфических последовательностей в её составе с использованием составных олигонуклеотидных зондов, обладающих пониженными гибридизационными свойствами.

CПИСОК ОСНОВНЫХ ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ Обзоры 1. Vlassov V.V., Pyshnyi D.V., Vorobjev P.E. Nucleic acids: Structures, functions, and applications in Handbook of Nucleic Acid Purification. - Ed. D. Liu. - CRC Press. - NY. - 2009. - P. 1-20.

2. Пышный Д.В., Веньяминова, А.Г. Синяков, А.Н., Зенкова М.А., Власов В.В. Нуклеиновый наноконструктор // Наука из первых рук. - 2008. - №. 5(23). - С. 42-57.

3. Виноградова О.А., Пышный Д.В. Селективность ферментативного превращения олигонуклеотидных зондов при анализе нуклеотидных полиморфизмов ДНК // Acta naturae. - 2010. - Т. 2. - № 1(4). - С. 40-58.

Патенты 4. Koulikova V.F. (Zarytova), Ivanova E.M., Pyshnyi D.V., Lokhov S.G., Krivenko A.A., Dymshits G.M. Procede de detection d’une sequence d’acide nucleique a analyser // Patent FR #9704290.

5. Куликова В.Ф. (Зарытова), Пышный Д.В., Иванова Е.М., Лохов С.Г., Кривенко А.А., Дымшиц Г.М. Способ выявления анализируемой последовательности нуклеиновых кислот, в том числе содержащей точечные мутации // Патент на изобретение PCT/RU № 2146707 от 20.03.2000.

6. Пышный Д.В., Иванова Е.М., Пышная И.А., Зарытова В.Ф. Способ выявления анализируемой последовательности ДНК // Патент на изобретение РФ № 2259402 от 27.08.2005.

7. Скобельцына Л.М., Пышный Д.В., Иванова Е.М., Пышная И.А., Дымшиц Г.М., Зарытова В.Ф. Способ определения однонуклеотидных замен в известных последовательностях нуклеиновых кислот// Патент на изобретение РФ № 2247781 от 10.03.2005.

8. Пышная И.А., Дмитриенко Е.В., Пышный Д.В. Способ получения ДНК-чипа // Патент на изобретение РФ № 2340677 от 10.12.2008 г.

9. Шопаева Г.А., Бейсембаева Ш.А., Пышная И.А., Дмитриенко Е.В., Зарытова В.Ф., Пышный Д.В. Способ диагностики вирусного гепатита С и определение генетического типа вируса // Инновационный патент Республики Казахстан на изобретение № 22681 от 15.07.2010.

Статьи 10. Pyshnyi D., Pyshnaya I., Lokhov S., Ivanova E., Zarytova V. How to force the reactive derivatives of hydrophobic tetranucleotides to attack site specifically nucleic acid targets at physiological conditions? // Nucleic Acids Symp. Ser. - 1994. - №. 31. - P. 115-116.

11. Pyshnyi D., Pyshnaya I., Sergeev D., Vorobjev P., Lokhov S., Zarytova V. A new approach to potentiate site-specific hybridization: a set of hydrophobic heterofunctional short oligodeoxyribonucleotides // Nucleosides Nucleotides. - 1995. - V. 14. - P. 1065-1068.

12. Кнорре Д.Г., Пышный Д.В., Иванова Е.М., Бондарь А.А., Морозов И.В., Мертвецов Н.П., Зарытова В.Ф. Тетрануклеотиды и их феназиниевые производные в качестве составных праймеров для секвенирования ДНК методом Сэнгера // Докл. Акад. Наук. - 1996. - Т.

350. - С. 119-121.

13. Денисов А.Ю., Пышный Д.В., Пышная И.А., Иванова Е.М., Зарытова В.Ф. Пространственная структура 5'- и 3'-эстроновых эфиров тетрануклеотида CAGC по данным 2МЯМР и ограниченного молекулярного моделирования // Биоорган. химия. - 1996. - Т.22. - С. 117-125.

14. Denisov A.Yu., Sandstrom A., Maltseva T.V., Pyshnyi D.V., Ivanova E.M., Zarytova V.F., Chattopadhyaya J. The NMR structure of estrone (Es)-tethered tandem DNA duplex:

(d(5'pCAGC3')-Es)+(Es-d(5'pTCCA3')) :d(5'pTGGAGCTG3') // J. Biomol. Struct. Dyn. - 1997.

- V.15. - P. 499-516.

15. Lokhov S.G., Pyshnyi D.V. Thermodynamic and spectral properties of DNA miniduplexes with the terminal G-A mispair and 3' or 5' dangling bases// FEBS Lett. - 1997. - V.420. - P. 134-138.

16. Balbi A., Sottofattori E., Grandi T., Mazzei M., Pyshnyi D., Lokhov S., Lebedev A. Synthesis and hybridization properties of the conjugates of oligonucleotides and stabilization agents – II // Bioorg. Med. Chem. - 1997. - V. 5. - P. 1903-1910.

17. Пышный Д.В., Кривенко А.А., Лохов С.Г., Иванова Е.М., Дымшиц Г.М., Зарытова В.Ф. Взаимодействие производных коротких олигонуклеотидов с нуклеиновыми кислотами. V. Лигирование коротких олигонуклеотидoв в тандеме на комплементарной матрице ДНК // Биоорган. химия. - 1998. - Т. 24. - С. 25-31.

18. Пышный Д.В., Кривенко А.А., Лохов С.Г., Иванова Е.М., Дымшиц Г.М., Зарытова В.Ф. Взаимодействие производных коротких олигонуклеотидов с нуклеиновыми кислотами VI. Дискриминация комплексов с мисматчем при лигировании тандема коротких олигонуклеотидов // Биоорган. химия. - 1998. - Т. 24. - С.32-37.

19. Zarytova V.F., Pyshnyi D.V., Krivenko A.A., Dymshitz G.M., Ivanova E.M. The accurate detection of one point mutations by ligation of short oligonucleotides // Nucleosides Nucleotides.

- 1998. - V. 17. - P. 2149-2152.

20. Pyshnaya I.A., Pyshnyi D.V., Ivanova E.M., Zarytova V.F., Bonora G.M., Scalfi Happ C., Seliger H. Oligonucleotide conjugates with non-nucleotidic spacers designed for discriminative hybridization at physiological temperature // Nucleosides Nucleotides. - 1998. - V. 17. - P. 12891297.

21. Пышный Д.В., Лохов С.Г., Сильников В.Н., Шишкин Г.В., Иванова Е.М., Зарытова В.Ф. Влияние структуры азинов, присоединенных к 5'-концевому фосфату олигонуклеотида, на термодинамику образования комплементарных комплексов // Биоорган. химия. - 1999. - Т. 25. - C. 40-56.

22. Денисов А.Ю., Пышный Д.В., Иванова Е.М. Природа стабилизации тандемного дуплекса pTGGAGCTG•(pCAGC+Phn-NH-(CH2)3-NH-pTCCA) по данным УФ-, КД- и двумерной ЯМР-спектроскопии // Биоорган. химия. - 2000. - Т.26. - С.373-386.

23. Bonora G.M., De Franco A.M., Rossin R., Veronese F.M., Ferruti P., Plyasunova O., Vorobjev P.E., Pyshnyi D.V., Komarova N.I., Zarytova V.F. PAcM-AN: poly (Nacryloylmorpholine)-conjugated antisense oligonucleotides // Nucleosides Nucleotides Nucleic Acids. - 2000. - V. 19. - P. 1281-1288.

24. Скобельцына Л.М., Пышный Д.В., Шишкина И.Г., Табатадзе Д.Р., Дымшиц Г.М., Зарытова В.Ф., Иванова Е.М. Разработка колориметрической тест-системы для выявления точечных мутаций путем лигирования тандема коротких олигонуклеотидов на твердофазном носителе // Молекулярн. биология. - 2000. - Т.34. - С. 378-385.

25. Пышный Д.В., Скобельцына Л.М., Гущина Е.Н., Пышная И.А., Шишкина И.Г., Дымшиц Г.М., Зарытова В.Ф., Иванова Е.М. Выявление однобуквенных замен в амплифицированных фрагментах ДНК путем лигирования тандемов коротких олигонуклеотидов в растворе и на твердофазном носителе // Молекулярн. биология. - 2000. - Т.34. - С. 984-997.

26. Pyshnyi D.V., Lokhov S.G., Podyminogin M.A., Ivanova E.M., Zarytova V.F. A new strategy of discrimination of a point mutation by tandem of short oligonucleotides // Nucleosides Nucleotides Nucleic Acids. - 2000. - V. 19. - P. 1931-1941.

27. Vorobjev P.E., Pyshnaya I.A., Pyshnyi D.V., Venyaminova A.G., Ivanova E.M., Zarytova V.F., Bonora G.M., Scalfi-Happ C., Seliger H. Nuclease resistance and RNase H sensitivity of oligonucleotides bridged by oligomethylenediol and oligoethylene glycol linkers // Antisense Nucleic Acid Drug Dev. - 2001. - V. 11. - P. 77-85.

28. Денисов А.Ю., Рябинин В.А., Пышный Д.В., Абрамова Т.В., Синяков А.Н. Пространственная структура ДНК-дуплекса d(CGTTTATT)p-Net : d(AATAAACG) с необычной локализацией ковалентно присоединенного аналога нетропсина (Net) по данным двумерной ЯМР спектроскопии // Журнал структурной химии. - 2001. - Т. 42. - С. 111-119.

29. Ryabinin V.A. Boutorine A.S., Hlne C., Denisov A.Yu., Pyshnyi D.V., Sinyakov A.N.

Oligonucleotide—minor groove binder 1:2 conjugates: side by side parallel minor groove binder motif in stabilization of DNA duplex // Nucleosides Nucleotides Nucleic Acids. - 2004. - V. 23. - P. 953 - 968.

30. Pyshnyi D.V., Pyshnaya I.A., Levina A.S., Goldberg E.L., Zarytova V.F., Knorre D.G., Ivanova E.M. Thermodynamic analysis of stacking hybridization of oligonucleotides with DNA template // J. Biomol. Struct. Dyn. - 2001. - V.19. - P. 555-570.

31. Кабилов М.Р., Пышный Д.В., Дымшиц Г.М., Гашникова Н.М., Покровский А.Г., Зарытова В.Ф., Иванова Е.М. Новый подход к выявлению анализируемой последовательности ДНК путем УФ-иммобилизации ее гибридизационного комплекса с высокоспецифичным зондом, образующимся при лигировании тандема коротких олигонуклеотидов в растворе // Молекулярн. биология. - 2002. - Т. 36. - С. 424-431.

32. Пышный Д.В., Иванова Е.М. Термодинамические параметры коаксиального стэкинга при гибридизации олигодезоксирибонуклеотидов встык // Изв. Акад. Наук. Сер. Хим. – 2002. - С. 1057-1066.

33. Пышный Д.В., Скобельцына Л.М., Иванова Е.М., Зарытова В.Ф.. Тест-системы для выявления точечных мутаций в структуре ДНК // Наука – производству. - 2003. - Т. 3. - C.

35-41.

34. Pyshnyi D.V., Goldberg E.L., Ivanova E.M. Efficiency of coaxial stacking depends on the DNA duplex structure // J. Biomol. Struct. Dyn. - 2003. - V. 21. - P. 459-468.

35. Pyshnaya I.A., Pyshnyi D.V., Lomzov A.A., Zarytova V.F., Ivanova E.M. The influence of the non-nucleotide insert on the hybridization properties of oligonucleotides // Nucleosides Nucleotides Nucleic Acids. - 2004. - V. 23. - P. 1065 - 1071.

36. Кабилов М.Р., Пышный Д.В., Дымшиц Г.М., Зарытова В.Ф., Иванова Е.М. Выявление тринуклеотидной делеции F508 в гене СFTR человека УФ-иммобилизацией на капроне комплекса ПЦР-фрагмента с высокоспецифичным зондом // Молекулярн. биология.

- 2003. - V. 37. - P. 793-800.

37. Kabilov M., Pyshnyi D., Dymshits G., Zarytova V., Ivanova E. A new approach to revealing point mutations in DNA analyzed by colorimetric detection // Nucleosides Nucleotides Nucleic Acids. - 2004. - V. 23. - P. 1023 - 1030.

38. Pyshnyi D.V., Ivanova E.M. The influence of nearest neighbours on the efficiency of coaxial stacking at contiguous stacking hybridization of oligodeoxyribonucleotides // Nucleosides Nucleotides Nucleic Acids. - 2004. - V. 23. - P. 1057 - 1064.

39. Ломзов А.А., Пышная И.А., Иванова Е.М., Пышный Д.В. Термодинамические параметры для расчета стабильности комплексов мостиковых олигонуклеотидов // Докл. Акад.

Наук. – 2006. - Т. 409. - № 2. - С. 266-270.

40. Pyshnyi D.V., Lomzov A.A., Pyshnaya I.A., Ivanova E.M. Hybridization of the bridged oligonucleotides with DNA: thermodynamic and kinetic studies // J. Biomol. Struct. Dyn. - 2006.

- V. 23. - P. 567-580.

41. Виноградова О.А., Пышная И.А., Зарытова В.Ф., Иванова Е.М., Пышный Д.В. Повышение эффективности гибридизационного анализа путем ограниченной фрагментации ДНК пробы // Молекулярн. биология. - 2007. - Т. 41. - С. 163-172.

42. Gusachenko(Simonova) O.N., Pishnyi D.V., Vlassov V.V., Zenkova M.A. Modified concatemeric oligonucleotide complexes: new system for efficient oligonucleotide transfer into mammalian cells // Hum. Gene Ther. - 2008. - V. 19. - P. 532-546.

43. Mal’shakova V.S., Pyshnyi D.V., Bondar A.A., Vlassov V.V., Laktionov P.P. Isolation and sequencing of short cell-surface-bound DNA // Ann. N.Y. Acad. Sci. - 2008. - V. 1137. - P. 47 - 50.

44. Дмитриенко Е.В., Пышная И.А., Зарытова В.Ф., Пышный Д.В. Разработка новых подходов к параллельному анализу ДНК // Ученые записки Санкт-Петербургского государственного медицинского университета им. акад. Павлова. - 2008. - Т. XV. - С. 73-74.

45. Ломзов А.А., Пышный Д.В. Расчет температуры плавления нативных и модифицированных комплексов ДНК при различных концентрациях катионов металлов с помощью расширенной модели конденсации противоионов // Вестник НГУ. Сер. физика. - 2008. - T.

3. - C. 61-75.

46. Виноградова О.А., Еремеева Е.В., Ломзов А.А., Пышная И.А., Пышный Д.В. Конструирование изогнутых дцДНК с заданными геометрическими характеристиками на основе комплексов мостиковых олигонуклеотидов // Биоорган. химия. - 2009. - Т. 35. - С. 384-396.

47. Филиппов Н.С., Ломзов А.А., Пышный Д.В. Термодинамическое описание самоассоциации олигонуклеотидов в конкатемерные структуры // Биофизика. - 2009. - Т. 54. - C. 402-417.

48. Пышная И.А., Виноградова О.А., Кабилов М.Р., Иванова Е.М., Пышный Д.В. Мостиковые олигонуклеотиды – молекулярные зонды для исследования ферментсубстратного взаимодействия и аллель-специфичного анализа ДНК // Биохимия. - 2009. - Т. 74. - С. 123 - 1251.

49. Дмитриенко Е.В., Пышная И.А., Пышный Д.В. Гибридизационный анализ нуклеиновых кислот с помощью олигонуклеотидных производных. I. Ковалентная иммобилизация олигонуклеотидных зондов на капроне // Биоорган. химия. - 2010. - Т. 36. - С. 700 - 713.

50. Дмитриенко Е.В, Хомякова Е.А, Пышная И.А., Брагин А.Г., Ведерников В.Е., Пышный Д.В. Гибридизационный анализ нуклеиновых кислот с помощью олигонуклеотидных производных. II. Изотермическая амплификация сигнала при анализе ДНК методом минисеквенирования // Биоорган. химия. - 2010. - Т. 36. - С. 700-713.

51. Skobeltsyna L.M., Pyshnyi D.V., Ivanova E.M., Stepanov V.A., Puzyrev V.P., Dymshits G.M., Kharkov V.N., Zarytova V.F. Short oligonucleotide tandem ligation assay for genotyping of single-nucleotide polymorphisms in Y chromosome // Mol. Biotechnol. - 2010. - V. 45. - P. 1 - 8.

52. Закабунин А.И., Камынина Т.П., Ходырева С.Н., Пышная И.А., Пышный Д.В., Храпов Е.А., Филипенко М.Л. Клонирование генов, выделение и исследование свойств рекомбинантных ДНК-лигаз термофильных археев Pyrococcus abyssi и Methanobacterium thermoautotrophicum // Молекулярн. биология. - 2011. - Т. 45. - С. 258 - 266.

53. Виноградова О. А., Щеглов Д. В., Латышев А. В., Пышный Д. В. Изучение структурной организации конкатемерных комплексов на основе нативных и модифицированных дцДНКблоков // Вестник НГУ. Сер. Биология, клиническая медицина. - 2011. - Т. 9. - C. 109 - 117.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.