WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

  На правах рукописи

АНГАНОВА

Елена Витальевна

Условно-патогенные  ЭНТЕРОБАКТЕРИИ:

доминирующие популяции,  биологические свойства,  медико-экологическая  значимость

03.02.03-микробиология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора  биологических наук

Иркутск - 2012

Работа выполнена в ГБОУ ДПО «Иркутская государственная медицинская академия  последипломного образования»  Минздравсоцразвития России и ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН

Научный руководитель:

доктор медицинских наук,

профессор Савилов Евгений Дмитриевич

Официальные оппоненты:

доктор биологических наук  Фадеева  Татьяна Владимировна

доктор  биологических наук Данчинова Галина Анатольевна

 

доктор медицинских наук,

профессор  Киклевич Вадим Трофимович

Ведущая организация:

Институт клеточного и внутриклеточного симбиоза

Уральского отделения РАН (г. Оренбург)

Защита состоится «__» _______ в ___часов на заседании Диссертационного  Совета  ДМ 001.038.01 при  Научном центре проблем здоровья семьи и репродукции человека СО РАМН по адресу: г. Иркутск, ул. К. Маркса, 3. Почтовый адрес: 664025, г. Иркутск, а/я 539.

С диссертацией можно ознакомиться  в библиотеке Научного центра проблем здоровья семьи и репродукции человека СО РАМН.

Автореферат разослан «____» ________ 2011г.

Ученый секретарь

Диссертационного Совета,

кандидат медицинских наук Кулеш Д.В.

 

Общая характеристика  работы

 

Актуальность проблемы. В настоящее время во всех странах мира наблюдается активизация условно-патогенных микроорганизмов (УПМ) (Бондаренко В.М., 2011). Бактерии данной группы характеризуются выраженной неоднородностью, являясь, с одной стороны, представителями транзиторной нормальной микрофлоры человек,  а с другой,- возбудителями  инфекционных заболеваний (Марри П.Р. с соавт., 2006; Егорова, 2007; Бондаренко В.М., 2011).  В связи с этим, проблеме инфекций, обусловленных УПМ, особенно представителями  семейства Enterobacteriaceae,  уделяется пристальное внимание (Ахтариева А.А., 2010). К числу  наиболее распространенных инфекционных заболеваний относятся острые кишечные инфекции (ОКИ), занимающие одно из ведущих мест в инфекционной патологии  детского возраста  (Воротынцева Н.В.  соавт., 2001; Жеребцова Н.Ю. с соавт., 2007; Денисюк Н.Б., 2011; Хворостухина А.И., 2011; Калуцкий П.В., 2011). Доля  ОКИ, вызванных условно-патогенными энтеробактериями (УПЭ),  в общей структуре ОКИ установленной этиологии, по данным разных авторов, варьирует от 12,8-21,2% до 34,1% (Зуева Л.П., 2005; Жеребцова Н.Ю., 2006).

  Как отмечают А.Р. Мавзютов с соавт. (2001), С.В.Егорова (2008), В.М. Бондаренко (2011), для оценки этиологической значимости  УПЭ при инфекционных процессах необходимо заключение об их патогенном потенциале, который недостаточно учитывается при  верификации острых кишечных инфекций. Кроме того, масштабы изменения патогенности  условно-патогенных энтеробактерий, являющиеся одной из причин  увеличения их медицинской значимости, свидетельствуют о целесообразности изучения этого явления у данной группы бактерий,  как на фенотипическом, так и на молекулярно-генетическом уровне (Мавзютов А.Р. с соавт., 2002; Фиалкина С.В., 2004;  Жеребцова Н.Ю., 2006; Вершинин А.Е., 2008; Бондаренко В.М., 2011; Burgos Y. et al., 2010). В то же время, патогенность и региональные особенности  возбудителей острых кишечных инфекций, обусловленных  УПЭ, до сих пор изучены недостаточно.

Одним из важнейших аспектов фенотипической  характеристики условно-патогенных энтеробактерий является их резистентность к антимикробным препаратам  (АМП) (Страчунский  Л.С., 2002;  Cкала Л.З. с соавт., 2004; Tenover F.C., 2005). При этом, как отмечает  А.Е. Билев (2011),  массовое распространение антибиотикорезистентных штаммов в популяциях условно-патогенных микроорганизмов стало  важной проблемой  клинической медицины, в связи с их более высокими адаптационными возможностями  по сравнению с возбудителями классических инфекций.

На  фоне  информации о роли условно-патогенных микроорганизмов в инфекционной патологии человека недостаточно изученной остается проблема их циркуляции в природных,  в частности, водных экосистемах. Между тем, адаптивные возможности бактерий данной группы и, соответственно,  их потенциальные местообитания, экологические ниши, механизмы и формы  существования в природе необычайно широки и многообразны (Бухарин О.В., 1997). Особое значение имеет  изучение циркуляции  бактерий данной группы в водных объектах, оказывающих существенное влияние на жизнедеятельность человеческой популяции (Мамонтова с соавт., 2000). Условно-патогенные микроорганизмы способны не только  длительно обитать в субстратах внешней среды, в частности,  в  воде, но и накапливаться в ней. Выживанию и накоплению микроорганизмов в объектах внешней среды, в т.ч.  в воде, способствуют факторы персистенции (Макаров В.Ю., 2007).  Также  у  водных штаммов УПЭ выявлены  адгезивная и гемолитическая активность, описаны  ферменты  ДНКаза, гиалуронидаза, некоторые протеиназы (Кравченко О.С., 2009; Езепчук Ю.В., 1997; Kielleberg S.,1985), резистентность к антимикробным препаратам (Загайнова А.В., 2010). Усиливающееся антропогенное воздействие  на водные экосистемы  определяет необходимость  изучения биологических свойств  УПЭ  с позиций оценки их потенциальной эпидемической  опасности  и влияния  на  состояние микробиоценозов природных водоемов.  В рамках изучения биологической активности  УПЭ  важное значение имеет  выявление их адаптационных возможностей,  способствующих выживанию в различных условиях  среды обитания.

  Исходя из вышеизложенного  целью   работы является: выявить доминирующие популяции, фенотипические и генотипические  характеристики,  адаптационный потенциал условно-патогенных энтеробактерий на моделях острых кишечных инфекций и водных экосистем  для оценки их медико-экологической  значимости.

  Для выполнения указанной цели поставлены следующие задачи:

1.  Изучить  спектр условно-патогенных энтеробактерий, выделенных при острых кишечных инфекциях установленной этиологии, у детей  Иркутской области.

2. Изучить  циркуляцию  бактерий данной группы в микробных сообществах водных экосистем на модели  крупнейших водоемов Восточной Сибири, их таксономическую характеристику, выявить доминирующие и субдоминирующие популяции, видовое разнообразие.

3. Определить  фенотипические характеристики условно-патогенных энтеробактерий,  выделенных от больных  ОКИ, а также из водных объектов.

4. Выявить и оценить частоту встречаемости у микроорганизмов генетических детерминант патогенности.

5. Оценить резистентность к антимикробным препаратам условно-патогенных энтеробактерий, выделенных от больных ОКИ и из водных объектов.

6. Провести анализ клинических аспектов острых кишечных инфекций, обусловленных бактериями семейства Enterobacteriaceae,  их сопряженность с наличием генетических детерминант патогенности  микроорганизмов.

7.  Изучить адаптационный потенциал клинических и водных  штаммов энтеробактерий в  различных  условиях существования (количественная оценка ферментативной активности, способность к образованию биопленок). 

Научная новизна  и теоретическая значимость работы

Определен таксономический спектр  условно-патогенных энтеробактерий,  выделяемых при  ОКИ, у детей  Иркутской области, его смена в многолетнем аспекте, выявлены субдоминирующие популяции, изучены патогенные свойства, дана оценка влияния факторов патогенности на  клинико-эпидемиологические  особенности острых кишечных инфекций.

Полученные данные о  фенотипических  маркерах  условно-патогенных энтеробактерий вносят вклад  в изучение патогенности бактерий данной группы, их участия на различных этапах  инфекционного процесса.

Определены генетические  маркеры УПЭ, информативные  при оценке  их этиологической значимости при  ОКИ (hlyA, hlyB, sfaA,  sfaG, fimA, irp-2).  Показаны различия в частоте  встречаемости генов патогенности у различных видов  представителей семейства Enterobacteriаceae.

Показана  значимость условно-патогенных энтеробактерий,  их биологической активности, персистентного потенциала, распространенности генетических маркеров патогенности  среди водных изолятов для  оценки потенциальной опасности  водной среды.

  Получены данные  об адаптационных возможностях УПЭ (вариабельность ферментативного аппарата  УПЭ, способность к формированию биопленочных сообществ), что  позволяет внести вклад в  решение проблемы  по  изучению  их адаптации к различным условиям обитания.

 

Практическая значимость

  Определены  основные виды  условно-патогенных представителей семейства Enterobacteriаceae в структуре  ОКИ и маркеры их патогенности, существенно важные с клинической точки зрения. 

  Данные, полученные  при  определении фенотипических  и генотипических факторов патогенности бактерий указанной группы,  вносят вклад в оценку их этиологической и эпидемиологической значимости.

Мониторинг антибиотикоустойчивости УПЭ позволяет создать паспорт резистентности возбудителей ОКИ и  бактерий, выделенных из водных экосистем.

  Разработанный способ определения гетерогенности микробных популяций по показателю антибиотикорезистентности УПЭ позволяет проводить оценку их потенциальной опасности  и расширить возможности биотестирования  водных экосистем.

  Данные по  изучению  микробиоценозов  крупнейших водоемов Восточной Сибири могут быть использованы в качестве базовой информации  для мониторирования водных экосистем.

  Внедрения.  Материалы исследований  используются в практике работы ТУ Федеральной службы в сфере защиты прав потребителей и благополучия человека по  Республике Саха (Якутия) для целей  микробиологического  мониторинга поверхностных водоемов; в практике  работы Управления Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по Иркутской области  для целей эпидемиологического надзора за острыми кишечными инфекциями; внедрены в учебный процесс  на кафедре эпидемиологии и  микробиологии  ГБОУ ДПО «Иркутская государственная  медицинская академия последипломного образования» (акт внедрения  №16 от 22.10.2011).  Результаты исследований использованы при издании учебных пособий для врачей: «Микробиологический мониторинг водных экосистем» (2008); «Техногенное загрязнение окружающей среды и инфекционная патология  (клинико-эпидемиологические обобщения)» (2008); «Проявление инфекционной патологии  в условиях техногенного загрязнения окружающей среды»  (учебное пособие для  системы послевузовского профессионального образования врачей, утввержденный  УМО по медицинскому  и фармацевтическому образованию вузов России  (УМО -17-28/78 от 26.02.2010), методических рекомендаций для врачей «Выявление факторов риска в эпидемиологическом анализе» (2011). 

  По результатам исследований получены Свидетельства Федеральной службы по  интеллектуальной собственности, патентам и товарным знакам  (РОСПАТЕНТ) о гос. регистр. БД № 2010620379 от  14.07.2010г. «Биопрофиль условно-патогенных энтеробактерий - возбудителей острых кишечных инфекций у детей»; № 2010620552 от  24.09.2010г. «Таксономическая характеристика  и биологические свойства условно-патогенных микроорганизмов  водных экосистем»; № 2011620192 от 11.03.2011г. «Клинико-эпидемиологические особенности  острых кишечных инфекций, обусловленных условно-патогенными микроорганизмами»; № 2011620513 от 13.07.2011г.  «Антибиотикоустойчивость аутохтонных  и аллохтонных  представителей микробного сообщества  водных экосистем». 

Положения, выносимые на защиту:

  1. Основными представителями условно-патогенных энтеробактерий в  структуре  бактериальных ОКИ установленной этиологии  являются  бактерии родов Enterobacter, Proteus, Klebsiella и Citrobacter (класс  субдоминант). Данные виды энтеробактерий  (а также E.coli) преобладают  (с изменением степени доминирования) и в таксономическом  спектре грамотрицательной составляющей  микробиоценозов водных  экосистем.

2. Условно-патогенные бактерии семейства Enterobacteriaceae характеризуются  выраженной фенотипической и генотипической  гетерогенностью, что необходимо учитывать  при оценке их этиологической  и эпидемиологической значимости.

3. Условно-патогенные энтеробактерии, выделенные от больных ОКИ, несут генетические маркеры патогенности, детерминирующие  важные этапы взаимодействия возбудителя с клетками организма хозяина: адгезию, продукцию гемолизинов,  размножение в тканях (hlyА, hlyВ, sfaA, sfaG, fimA, irp-2). Наличие у  клинических штаммов энтеробактерий  генетических детерминант патогенности  сопряжено с утяжелением клинической картины заболевания.

4. Распространенность условно-патогенных энтеробактерий, их таксономическая  характеристика, степень доминирования, биологическая активность, персистентный потенциал, наличие генетических маркеров патогенности, антибиотикоустойчивость  являются  индикаторами степени потенциальной опасности  водных микробиоценозов.

5. Условно-патогенные бактерии семейства Enterobacteriaceae (клинические и водные изоляты) характеризуются  адаптационным потенциалом, отражающимся качественными и количественными проявлениями ферментативной активности, а также  способностью к формированию биопленочных сообществ.

Апробация работы

Материалы диссертационной работы были представлены на: Российской научно-практ. конференции, посвящ. 100-летию профессора  Е.В. Талалаева «Оценка  современного состояния микробиологических исследований в Восточно-Сибирском регионе» (Иркутск, 2002); Межрегиональной научно-практ. конференции «Биология микроорганизмов и  их научно-практическое использование» (Иркутск, 2004); научно-практической конференции «Здоровье населения Иркутской области:  проблемы и пути решения» (Иркутск, 2003);  I межрегиональном семинаре  «Организация  санитарно-эпидемиологического  мониторинга  за острыми кишечными инфекциями» (Иркутск, 2006);  научно-практ. конференции «Оценка эколого-экономической ситуации загрязнения водных экосистем в бассейне оз. Байкал и управление  экологическим риском» (Иркутск, 2006); научно-практ. конференции «Среда обитания человека и  санитарно-эпидемиологическое благополучие населения» (Улан-Удэ,  2006, Управление Федеральной службы по надзору в сфере защиты прав потребителей  и благополучия человека по республике  Бурятия); III  Российской научной конференции с международным участием  «Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера» (Новосибирск, 2006); Всероссийской  научно-практ. конференции «Здоровая семья- здоровый ребенок», посв. 20-летию  образования  Института педиатрии и репродукции человека СО РАМН  (Иркутск, 2009); Всероссийском пленуме  Научного совета по экологии человека и гигиене окружающей среды РАМН и  Минздравсоцразвития РФ (Москва, 2009, ГУ НИИ ЭЧ И ГОС им. А.Н.Сысина РАМН); научной конференции с международным участием  «Этиологические, эпидемиологические и клинические аспекты  инфекционных болезней» (к 90-летию кафедры микробиологии,  вирусологии и иммунологии Иркутского государственного медицинского университета) (Иркутск, 2010);  региональной научно-практ. конференции с международным участием  «Актуальные вопросы инфекционной патологии»  (Иркутск, 2010);  III межрегиональном семинаре  «Организация  санитарно-эпидемиологического  мониторинга  за острыми кишечными инфекциями» (Иркутск, 2010); международной конференции  «Проблемы экологии». Чтения памяти профессора  М.М. Кожова (Иркутск, 2010); II Международной научно-практ. конференции «Экология, здоровье, спорт» (Чита, 2010);  международной конференции  «Экология и геохимическая деятельность  микроорганизмов экстремальных местообитаний» (Улан-Удэ, 2011);  всероссийской научно-практ. конференции с  междунар. участием «Окружающая среда и здоровье населения» (г. Иркутск, 2011); всероссийской научно-практ. конференции с  междунар. участием «Актуальные проблемы эпидемиологии на современном этапе» (Москва, 2011); Пленуме Научного совета  по экологии человека и гигиене окружающей среды «Актуализированные проблемы здоровья человека и среды его обитания и пути их решения» (Москва, 2011).

Публикации

Основные положения диссертационной работы  нашли отражение  в 58 научных публикациях, в т. ч. в журналах, рекомендованных ВАК для публикации материалов докторских диссертаций - 21, монографиях - 2, пособиях для врачей - 3, из них утвержденных УМО по медицинскому  и фармацевтическому образованию вузов России - 1, методических рекомендациях для врачей-1,  базах данных, получивших Свидетельства РОСПАТЕНТа – 4.

Структура и объем диссертации

Диссертация состоит из введения,  обзора литературы,  описания материалов и методов,  результатов собственных исследований, отраженных в 7 главах,  главы обсуждения полученных материалов, выводов, списка использованных источников литературы.  Работа изложена на  302 страницах, иллюстрирована 112 рисунками и 25 таблицами.  Список литературы содержит  398 работ, из них 295 отечественных и  103 зарубежных авторов.

СОДЕРЖАНИЕ РАБОТЫ

  Материалы и методы

  В работе представлены результаты изучения  УПЭ,  выделенных от детей, больных ОКИ, поступивших на лечение  в Иркутскую областную инфекционную больницу; от  здоровых детей, посещающих детские дошкольные  учреждения (2006-2010 гг.); из вод крупнейших водоемов Восточной Сибири и Севера: река Ангара (Иркутская область),  река Лена на всей ее протяженности, от верховья (Иркутская область)  до впадения в море Лаптевых (Республика Саха (Якутия) (1999-2008 гг). Анализ заболеваемости  острыми кишечными инфекциями, в т.ч. обусловленной  УПЭ, проводили по  материалам Управления Федеральной службы по надзору в сфере защиты прав потребителей  и благополучия человека по Иркутской области (2000-2010 гг.); клинического течения  ОКИ - с использованием медицинской карты стационарного больного (2006-2010 гг.). Объем выполненных исследований приведен в таблице 1. 

  Таблица 1

Объекты и объем выполненных исследований

Направление исследований

Количество 

копрофильтраты  детей

водные объекты

всего

больные ОКИ

здоровые

Антибиотикоустойчивость

1695

128

8518

10341

Антилизоцимная активность

924

128

504

1556

Продукция ДНК-азы

924

128

504

1556

Гемолитическая активность

924

128

504

1556

Адгезивная активность

924

128

504

1556

Протеолитическая активность

924

128

504

1556

Продукция фосфатазы

924

128

504

1556

Молекулярно-генетические

исследования (кол-во штаммов/кол-во исследований)

175/1050

65/390

89/623

329/2063

Определение  вирулентности (внутрибрюшинная проба) (кол-во штаммов/кол-во  животных)

15/45

5/15

9/27

29/87

Экспериментальные исследования по количественному определению ферментативной активности УПЭ

168

«-»

168

336

Экспериментальные исследования по  определению  способности  образовывать биопленки

240

120

120

480

Анализ заболеваемости  острыми кишечными инфекциями (2000-2010 гг.)

инф.бюллетени-14

Анализ  многолетней  динамики частоты встречаемости УПМ (2000-2010 гг.)

штаммы УПМ - 5924

Анализ клинического течения  ОКИ (2006-2010 гг.)

ст.уч.ф. №0003/у-931

Прим.: «-»-исследования не проводились

Отбор проб воды, фильтрацию через мембранные фильтры, выделение  культур микроорганизмов, их  идентификацию проводили по общепринятым методикам (Приказ МЗ СССР № 535 от 22.04.85; «Энтеробактерии»…, 1985;  Краткий определитель Берджи, 1997; Поздеев О.К., 2002; Марри П.Р., 2006). Биохимические свойства микроорганизмов определяли  с помощью  коммерческих тест-систем «Enterotest» фирмы  Lachema (Чехия). Для выборочной идентификации использовали баканализатор Sceptor (Becton Dickinson, USA). Определение щелочной фосфатазы, продукции ДНК-азы, протеолитической и гемолитической активности  осуществляли согласно стандартным методам («Частная медицинская микробиология…» под ред. А.С. Лабинской, 2005), адгезивной активности - по методу С.С. Гизатулиной с соавт. (Способ оценки…, 1991), персистентных свойств - по методике О.В.Бухарина (Бухарин  О.В., 1999;  Метод. рекомендации…, 2001). Определение антибиотикорезистентности микроорганизмов и оценку результатов проводили согласно МУК 4.2.1890-04.

Оценку вирулентности  in vivo  проводили  по способности вызывать гибель  белых мышей путем  введения в/б 0,5 мл суспензии белым мышам  в количестве  трех  для каждой  бактериальной культуры, отмечая изменения через 6, 24, 48 и 72 часа и 10 суток (Методические указания…, 1999). Эксперименты выполняли на беспородных  белых мышах (весом 14-15 г) в соответствии с «Правилами проведения работ с использованием экспериментальных животных", утвержденными МЗ СССР (1977г.),  «Международными рекомендациями по проведению медико-биологических исследований с использованием животных» (1986г.).

Для определения количественных показателей ферментативной активности исследуемые микроорганизмы культивировали при  нескольких температурных режимах:  4оС, 24оС, 30оС и 37оС.  Использовали две  питательные среды: 1) необогащенная  среда - физраствор, забуференный 0.1 М фосфатным буфером, или так называемая "голодная" питательная среда;  2) обогащенная среда Красильникова или полная синтетическая среда. Количественное определение ферментативной активности микроорганизмов проводили в соответствии с общепринятыми методиками: Mn-пероксидазную – по НАДН (Asada Y. et al., 1987); липазную - по олеиновой кислоте, уреазу -  по мочевине (Хазиев Ф.Х., 1990). Активность каталазы определяли спектрофотометрически по убыли 0.06 М Н2О2 в растворе, содержащем Н2О2, культуральный фильтрат и 0.05 М фосфатный буфер рН 7.0.

  Определение  формирования биопленок  штаммами условно-патогенных энтеробактерий проводили по методике  И.А. Шагинян  с соавт. (2007).

  Молекулярно-генетические методы. Экстракцию тотальной бактериальной ДНК из бактериальных суспензий  исследуемых микроорганизмов (107 КОЕ/мл) проводили  согласно Методическим рекомендациям по детекции… (1998). Для  ПЦР амплификации  использовали стандартный набор «АмплиСенс-1» (пр-во ФГУН ЦНИИЭ Роспотребнадзора),  амплификатор  «Mastercycler» (фирма «Eppendorf»). Подбор температуры  отжига праймеров осуществляли экспериментальным путем, а также используя данные литературы (Бондаренко  В.М. с соавт., 2004;  Фиалкина С.В., 2004; Жеребцова Н.Ю., 2006; Вершинин А.Е.,2008) и рекомендации НПФ «Литех».  На один образец  использовали 15 мкл реакционной смеси : 5-x РСR- буфер 3,0; MgSO4 – 1,0; dNTP -1,0; олигонуклеотидные праймеры – по 1,0; Tag-полимераза – 0,2;  исследуемая проба- 5,0; деионизированная вода – 2,8.

Бактерии тестировали методом ПЦР на наличие генов вирулентности.  Использовали праймеры к ряду генов, обнаруженных  в составе «островков» патогенности E.coli, контролирующих  адгезию S типа (sfaA-(F1) 5'-cggtgtgcgtagttcaat-3', (R1) 5'-cacccgcatggataaaaa-3'; sfaG-(F2) 5'-tgccgggaacacagaccatag-3', (R2) 5'-caatcttgataccgccagcattc-3' и 1 типа (fim A-(F3) 5'-сgacgcatcttcctcattcttct-3', (R3) -5'-attggttccgttattcagggttgtt-3'); продукцию гемолизинов (hlyA-(F4) 5'- cacgcgtgccgacaagtt-3', (R4)-5'- gccacatcccggaaatcaat-3'; hlyВ – (F5)-5'- cgacgtcgccttgatgata –3', (R5)-5'-tccccctgcttaatactgagat-3'); синтез железорегулируемого  белка (irp-2 - (F6)-5'-gttgctgtccatcaagcacg -3', (R6)- 5'- gccggaaagcctggccttta -3'). Праймеры синтезированы в НПФ «Литех» (г. Москва). Анализ продуктов ПЦР проводили гель-электрофорезом в агарозе (камера электрофоретическая «SE-2»).  Использовали  агарозу  производства «Sigma» (США) на трис-боратном буфере, добавляли  1% р-р бромистого этидия. Амплифицированный фрагмент  идентифицировали по размеру, используя для сравнения  маркер молекулярного веса ДНК  Gene Ruler 100 bр DNA Ladder Plus. Результаты  документировали  с использованием видеосистемы гель-документирования и программы «Gel Imager».

  Статистические методы. Статистическую обработку эпидемиологических данных и  результатов микробиологических исследований  проводили  с  применением  общепринятых параметрических и непараметрических критериев статистики (Ашмарин Н.П. с соавт., 1962;  Лакин Г.Ф., 1980;  Гланц С., 1999;  Савилов Е.Д. с соавт., 2004; 2011).  Для анализа  эпидемиологической  обстановки по ОКИ применяли  интегральный  статистический критерий –  суммарный индекс эпидемиологической ситуации  (ИЭС) (Методический подход…, 2011). Для количественной оценки степени доминирования микроорганизмов, принадлежащих к различным таксономическим группам, использовали  шкалу Е.Л. Любарского (Баканов А.И., 1987); для оценки микробиоценозов водных экосистем - коэффициент  Серенсона (S) (Одум Ю., 1975), для определения  разнообразия – индекс видового разнообразия Margalef (d) (Margalef R., 1958). Показатель «Л», характеризующий состояние системы «лизоцим-антилизоцим», определяли как соотношение  числа лизоцимактивных и  антилизоцимактивных  микроорганизмов (Плотников  А.О., с соавт., 2000).  Оценку гетерогенности микробных популяций и состояния  микробиоценозов водных экосистем проводили в соответствии с разработанным способом по показателю антибиотикорезистентности (ИАР) с позиции кластерной структурированности.

Результаты исследований и их обсуждение

Заболеваемость  и спектр  возбудителей  острых кишечных инфекций  у  детей Иркутской области

  Анализ заболеваемости  ОКИ установленной этиологии  в Иркутской области  за период  2000-2010гг. выявил ее значимый рост (p<0,01), в т.ч.  и у детей до 14 лет, что отражает эпидемиологическую ситуацию в РФ за последние годы. В возрастной структуре заболевших ОКИУЭ имело место увеличение доли детей до 14 лет  (p<0,01). Одновременно отмечалось значимое повышение уровня заболеваемости  ОКИ бактериальной этиологии (коэффициент регрессии +11,80/000; p<0,05). Эпидемиологическая ситуация по  ОКИ бактериальной этиологии  в Иркутской области  достигла «порогового» уровня  (0,92) в начале  анализируемого периода (2000г.) и  оставалась относительно стабильной  до 2004 г. Ухудшение ситуации  отмечено в период с 2005 по 2008 гг., когда показатели индекса эпидемиологической ситуации превышали «пороговые» значения (1,08-1,12).

  Изучение спектра  микроорганизмов, выделяемых при острых кишечных инфекциях, показало  преобладание УПМ, которые значимо (p<0,01) превышали долю  патогенов  (1,5±0,1%) и  вирусных агентов (43,2±1,4%) и обусловливали  более половины всех ОКИУЭ  (55,3±0,4%). Среди условно-патогенных возбудителей  ОКИ  абсолютно доминировали представители семейства  Enterobacteriaceae (около 90%).  Спектр условно-патогенных  энтеробактерий  был представлен бактериями родов Proteus, Enterobacter, Citrobacter, Klebsiella, Morganella, Hafnia, Kluyvera, Serratia,  Providencia и Pantoea. На  смену состава условно-патогенных энтеробактерий, в первую очередь, оказывало влияние  содержание бактерий родов Proteus, Enterobacter, Citrobacter, Klebsiella, Morganella, составивших  около 95% всех  представителей  данного семейства.

  За период  наблюдения (2000-2010 гг.) спектр  условно-патогенных энтеробактерий, выделенных при острых кишечных инфекциях, претерпел  существенные изменения, характеризующиеся  значимым увеличением  доли  Klebsiella spp. (r=0,79; р<0,01), тенденцией к росту  доли  Enterobacter spp.,  варьированием (с тенденцией к снижению) частоты встречаемости  Proteus spp., Citrobacter spp. и Morganellа spp. (рис.1).

  Рис.1. Таксономический и количественный спектр  условно-патогенных энтеробактерий, выделенных  от  детей, больных острыми кишечными инфекциями, за 2000-2010 гг. (%)

  Выявлены изменения в распределении  УПЭ по классам  доминирования.  В 2000 г.  в класс субдоминант  (границы класса по доле от 36% до 14%)  входили только энтеробактерии родов Proteus  и Citrobacter,  прочие представители  семейства Enterobacteriaceaе (Klebsiella,  Enterobacter  и Morganella) относились к  второстепенному классу (границы класса по доле от 14% до 6%).  В конце  исследуемого периода произошли существенные изменения в таксономическом составе  условно-патогенных энтеробактерий, а именно: представители родов Klebsiella и  Enterobacter,  согласно доли  бактерий каждого рода  в общей численности, перешли в  класс субдоминант, а Morganella – в редкий класс (границы класса по доле от  6 до 0%). Таким образом, в 2010 г. при отсутствии  абсолютных доминант и доминант, спектр УПЭ, выделенных от больных острыми кишечными инфекциями, был представлен субдоминирующими  бактериями родов Enterobacter, Proteus, Klebsiella и  Citrobacter (табл.2).

Таблица 2

Оценка степени доминирования бактерий семейства  Enterobacteriaceaе, выделенных от больных острыми кишечными инфекциями (по шкале доминирования)

Балл

Класс (по степени доминирования)

Границы классов по доле рода

Родовая принадлежность микроорганизма

2000г.

2010г.

5

Абсолютный доминант

64 < N <100

«-»

«-»

4

Доминант

36 < N < 64

«-»

«-»

3

Субдоминант

14 < N < 36

  Proteus Citrobacter

Proteus

Citrobacter

Klebsiella

Enterobacter

2

Второстепенный

6<  N <14

Klebsiella

Enterobacter

Morganella

1

Редкий

0< N< 6

другие

Morganella, другие

Прим. : «-»- отсутствие

Фенотипические и генотипические маркеры патогенности условно-патогенных энтеробактерий

  Определение  фенотипических признаков у условно-патогенных энтеробактерий  позволяет, во-первых,  проводить мониторинг патогенности бактерий данной группы, во-вторых, является (наряду с другими)  критерием их  этиологической значимости.  Современный уровень изучения  биологических свойств микроорганизмов показывает, что,  как отмечает В.М. Бондаренко (2011), количественный критерий не всегда определяет  способность изолята вызывать заболевание, которое в большей степени связано с реализацией патогенного потенциала возбудителя. Для каждого вида  возбудителей характерен комплекс маркеров (фенотипических и генотипических) патогенности, благодаря которым  осуществляется развитие инфекционного процесса.

  Проведенная комплексная оценка фенотипических признаков клинических штаммов  энтеробактерий, коррелирующих с их патогенностью,  позволила  установить, что  исследуемыми фенотипическими свойствами обладала значимо большая часть  (p<0,01) протестированных штаммов. При этом у 50,9±1,6% исследованных микроорганизмов отмечены персистентные свойства - антилизоцимная активность, направленная на инактивацию факторов естественной резистентности организма человека; около 40% штаммов  продуцировали щелочную фосфатазу, способствующую увеличению проницаемости клеточных мембран,  и обладали адгезивной активностью, направленной на прикрепление и колонизацию  эпителиоцитов слизистых оболочек.  Данные свойства  встречались значимо  чаще (р<0,05) по сравнению с другими признаками. У  третьей части микроорганизмов отмечены протеолитическая и гемолитическая активность,  оказывающая повреждающее действие на  клеточные мембраны; у 26,5±1,4%-способность экспрессировать фермент патогенности ДНКазу, вызывающий повреждение структуры  нуклеиновых кислот (рис. 2).

Рис. 2.  Частота встречаемости  свойств, коррелирующих с патогенностью, среди УПЭ, выделенных из фекалий больных ОКИ (%)

Выявлена видовая и межродовая неоднородность  клинических штаммов энтеробактерий по наличию фенотипических маркеров патогенности  (рис.3).

 

Рис.3. Биопрофиль клинических штаммов УПЭ по  фенотипическим маркерам патогенности

  Так, среди  различных представителей энтеробактерий  более высокая  (p<0,05) частота встречаемости фосфатазной  и протеолитической активности отмечена у штаммов Proteus spp. (при этом  большим  уровнем ферментативной активности  обладали штаммы P.mirabilis), адгезивной активности - у штаммов  Enterobacter spp. (преимущественно за счет E.aerogenes) и  гемолитической - у Klebsiella spp. (данный признак среди штаммов K.pneumoniae  встречался в два раза чаще, чем  среди  K.oxytoca). Антилизоцимная активность чаще (p<0,05) отмечалась  у Klebsiella spp., Citrobacter spp. и M.morganii, продукция ДНКазы- у  Klebsiella spp. и  Proteus spp. 

  Проявленная условно-патогенными энтеробактериями гетерогенность по  фенотипическим маркерам позволила  условно разделить их на четыре группы: 1 - штаммы, характеризующиеся наличием более  двух маркеров; 2 - штаммы,  с двумя маркерами; 3 - одним маркером;  4 группа - не  обладающие исследованными свойствами. Установлено, что значимо чаще  встречались клинические штаммы энтеробактерий, у которых отмечалось более двух  фенотипических признаков (39,4±1,6%). В то же время были выделены микроорганизмы, характеризующиеся  отсутствием  фенотипических маркеров - 9,5±1,% (рис.4).

Рис. 4. Ранжирование клинических штаммов  условно-патогенных энтеробактерий по наличию фенотипических признаков 

Среди бактерий родов Proteus и Klebsiella значимо преобладали штаммы с наличием более двух фенотипических  признаков (67,1±2,6% и 54,4±3,0% соответственно),  а у Enterobacter и Citrobacter - с двумя  признаками (57,9±5,6% и 54,3±4,2%). Наличие самого  большого комплекса (пяти  из шести исследуемых) фенотипических маркеров патогенности значимо чаще выявлялось  у  штаммов Klebsiella spp. (8,8±1,7%). 

  В то же время среди энтеробактерий, полученных от  здоровых детей,  значимо чаще отмечались штаммы  четвертой группы (около 70%), пятая часть штаммов (22,7±3,7%)  характеризовалась  одним фенотипическим признаком;  7,8±2,4% - двумя признаками и  не было выявлено штаммов с сочетанием более двух признаков. Также установлено, что спектр фенотипических признаков  среди  клинических штаммов энтеробактерий оказался значительно шире (пять маркеров) по сравнению со штаммами контрольной группы (два  маркера). 

  Таким образом,  проведенные исследования показали, что условно-патогенные энтеробактерии, выделенные от больных ОКИ, крайне гетерогенны по наличию фенотипических признаков; среди них  преобладают штаммы, которым свойственно наличие комплекса факторов патогенности, при этом каждый десятый штамм не обладает  фенотипическими маркерами, необходимыми для  проявления патогенности.

  Патогенность клинических штаммов in vivo – наиболее признанный маркер их этиологической значимости.  Проведенная  оценка вирулентности  клинических штаммов энтеробактерий  in vivo  показала, что при тестировании 13 культур (K.pneumoniae -5, P.mirabilis -2, P.vulgaris -1, M.morganii-2, E.cloacae-2, С.freundii -1), обладающих комплексом фенотипических признаков,  гибель  88,2% мышей наблюдалась через 24 часа, 11,8% - через 48 часов. Штаммы  энтеробактерий, изолированные от больных ОКИ,  характеризующиеся  отсутствием маркеров патогенности,  в течение 10-дневного наблюдения не вызывали гибели лабораторных животных. Штаммы  энтеробактерий, выделенные от здоровых детей,  характеризующиеся  отсутствием маркеров патогенности, также не вызывали гибели лабораторных животных.

  Исследования последних лет показывают эффективность индикации у условно-патогенных энтеробактерий генетических маркеров патогенности с помощью молекулярно-генетических методов, в частности, ПЦР. В связи с этим проведено изучение  наличия и распространенности генетических маркеров патогенности  у клинических штаммов условно-патогенных энтеробактерий.  Для определения  нуклеотидных последовательностей генов, контролирующих продукцию факторов патогенности,  использовали праймеры, амплифицирующие фрагменты sfaA и sfaG генов,  детерминирующих продукцию фимбрий  S типа,  гена fimA, обеспечивающего синтез фимбрий l типа;  hlyA  и hlyB генов, контролирующих  продукцию токсических веществ - гемолизинов; irp-2 гена,  детерминирующего синтез  сидерофора, участвующего в транспорте железа  внутрь клетки. Тестирование коллекции из 175 штаммов УПМ показало, что у 41 изолята (23,4±3,2%) выявлены  нуклеотидные последовательности генов, кодирующих  фимбриальные факторы адгезии, продукцию гемолизинов и  синтез железорегулируемого белка. При этом генетические детерминанты патогенности обнаружены  у бактерий восьми родов (рис.5).

  Рис. 5. Спектр клинических  штаммов энтеробактерий с наличием генетических детерминант патогенности (в %) 

  Установлено, что чаще встречались гемолитические детерминанты (hlyA и (или) hlyB -13,4±2,6%), вызывающие  цитопатические изменения и являющиеся одним из важнейших факторов вирулентности  энтеробактерий, и  генетические детерминанты адгезивной активности энтеробактерий S типа и (или) 1 типа - 11,7±2,4%. Частота выявления нуклеотидных последовательностей генов, ассоциированных с  продукцией гемолизинов и адгезией, оказалась значимо  более высокой  (p<0,01) по сравнению  со  встречаемостью других исследуемых генов. Так, в пуле исследуемых культур  искомые ампликоны  при использовании праймеров к hlyA  и hlyB определены  у 17  штаммов (9,7±2,2%), sfaА- 13 (7,4±1,9%);  sfaG- 8 (4,6±1,5%), fim A- 4 (2,3±1,1%), irp-2 (1,2±0,3%) (рис.6).

Рис.6. Частота обнаружения генетических маркеров «островов» патогенности  среди условно-патогенных энтеробактерий, выделенных  от больных ОКИ (n=175)

Проведенные исследования показали генетическую неоднородность  популяции  клинических штаммов энтеробактерий  по признаку  патогенности. Установлено, что среди УПЭ, обладающих генетическими детерминантами патогенности, наибольшую  долю составили  Klebsiella  spp. и Citrobacter spp. (39,0 % и 24,4% соответственно среди штаммов с наличием генетических маркеров патогенности; 9,1±2,1% и  5,7±1,7% соответственно среди всех протестированных УПЭ). Кроме того, клинические штаммы Klebsiella  spp., значимость которых в  этиологии ОКИ  в последние годы возрастает,  несут самый большой набор генетических детерминант патогенности  по сравнению с  другими энтеробактериями (рис.7). 

Прим.: 1- доля среди  клебсиелл; 2- доля среди всех протестированных  энтеробактерий

Рис.7. Частота обнаружения генетических детерминант патогенности у  клинических штаммов  Klebsiella  spp.

У Klebsiella  spp. выявлены  практически все  изучаемые  генетические маркеры «островов» патогенности.  При этом наибольшая частота обнаружения  была характерна для нуклеотидных последовательностей  генов  hlyA  и sfaG 

Бактерии рода Cirtobacter также характеризовались  довольно  большим набором генетических детерминант  «островов» патогенности. У данных штаммов  выявлены  нуклеотидные последовательности генов, ассоциированных с продукцией гемолизинов (hlyB и hlyA), а также  адгезией S типа (sfa A) и адгезией 1 типа (fimA). Среди бактерий рода Kluyvera (вид  K.ascarbata)  выявлены  hlyB, hlyA и sfaA. У клинических штаммов Enterobacter spp. установлены ампликоны,  гомологичные  hlyA и sfaA генам, ответственным за продукцию гемолизинов и  адгезивную активность S типа, при этом hlyA  обнаружен у E.aerogenes, sfaA – у E.сloacae и E. intermedius. Штаммы M. morganii  и P. agglomerans  характеризовались только наличием генетических детерминант «островов» патогенности, ответственных за  продукцию  гемолизинов.

  Установлена неравномерность распространенности генетических детерминант патогенности у культур, полученных от детей разных возрастных групп.  В большинстве случаев (85,3%) маркеры «островов» патогенности были  обнаружены у культур, выделенных от детей до 3-х лет (группа риска). Кроме того, у клинических штаммов, выделенных от детей до 3-х лет,  отмечен самый широкий  набор  генетических детерминант патогенности.  Так, у культур данной возрастной  группы  выявлены  100% детерминант sfaG,  fimA и irp-2;  а также 88,2%- hlyB, 82,3% - hlyA, 76,9% - sfaA.  Результаты по  выявлению генетических маркеров  патогенности у культур, выделенных от  больных  разных возрастных групп,  сопоставимы с  исследованиями  Н.Ю. Жеребцовой. Данным автором при выявлении нуклеотидных последовательностей hlyA, hlyB, sfaG, cnfl, estB генов также показано, что  на культуры, полученные от детей до 3-х лет,  приходилась  самая большая  доля данных детерминант.

Следует отметить, что среди энтеробактерий, изолированных от детей контрольной группы,  встречаемость генов оказалась значимо более низкой и  характеризовалась единичными находками  (гены hlyA -3,1% и sfa -1,5%).

Клинические аспекты ОКИ и их сопряженность с наличием генетическим детерминант патогенности условно-патогенных энтеробактерий

  Для  изучения сопряженности клинических проявлений ОКИ с наличием генетических детерминант патогенности  условно-патогенных энтеробактерий проведен анализ клинического течения  ОКИ у детей, госпитализированных в Иркутскую областную клиническую инфекционную больницу. Установлено, что этиологическая структура выделенных  энтеробактерий была представлена бактериями 10 родов и  22 видов, преимущественно родов  Enterobacter, Proteus,  Klebsiella, Morganella и Citrobacter. Частота их  встречаемости превышала долю  энтеробактерий других родов  (p<0,01). 

Основную часть заболевших  составляли дети в возрастной группе до 3-х лет (около 80%). Доминировало среднетяжелое течение заболевания (88,8±0,3%). При этом у больных до 3-х лет тяжелая форма  ОКИ встречалась чаще, чем в других возрастных группах (около 8%). Средняя продолжительность заболеваемости острыми кишечными инфекциями составила 5,9 койко-дней с более длительным течением у детей  двух возрастных групп: до 3-х лет и  3-7 лет. Значимо чаще  (p<0,01) ОКИ протекали по типу острого  гастроэнтерита  и энтероколита (более  70% всех  острых кишечных инфекций). Осложнения  (синдром кетоацидоза и  токсико-эксикоза) наблюдались преимущественно у детей до 3-х лет и  3-7 лет. 

При анализе отдельных клинических показателей ОКИ (длительность лихорадки, средняя продолжительность болезни, наличие рвоты, диареи и т.д.)  установлено, что продолжительность госпитализации составила 5,6±0,5 дней; средняя продолжительность лихорадки - 4,1±0,2 дней, средняя максимаьная температура- 37,9±0,06°С. Среди детей в возрасте  до 3-х лет продолжительность  лихорадки была значимо  длиннее (4,2±0,2 дней), чем у детей 3-6лет и 7-14 лет и старше -  3,6±0,2 и 3,5±0,2 дней соответственно (p<0,01). Почти у половины больных (42,5±1,8%)  лихорадка наблюдалась в течение  4-6 дней, у десятой части  детей (11,1±1,8%) сохранялась  7 и более дней. 

Рвота регистрировалась более чем  у  половины  больных (51,3±1,8%). У третьей части детей 27,9±1,6% детей рвота была однократной;  повторная рвота встречалась значимо  реже -17,0±1,3% (p<0,05). Продолжительности диареи составила 4,4±0,1 дней,  в т.ч. у детей до 3-х лет - 4,7±0,2 дней  и была выше (р<0,05), чем у больных других возрастных  групп:  3-7лет -3,3±0,1 дней; 7-14 лет и старше-3,2±0,2 дней. Кратность стула  менее пяти раз в сутки отмечалась у  подавляющего большинства детей  (85,1±0,05%).

  Факторный дисперсионный анализ обнаружения генетических маркеров «островков» патогенности  у штаммов  энтеробактерий, выделенных от больных ОКИ, и клинических проявлений заболеваний показал наличие  значимых связей между наличием  генетических маркеров и  клиническими проявлениями  острых  кишечных инфекций  (табл.3). Анализ связей между  характеристикой выделенных от больных детей клинических штаммов  и  клиническими проявлениями  вызываемых ими инфекций  показывает, что  наличие у возбудителя генетических детерминант патогенности значимо сопряжено с  увеличением продолжительности  и  уровнем лихорадки, а также длительностью диареи у  детей, больных ОКИ. При наличии  у клинических штаммов генетических детерминант  патогенности  в испражнениях больных  чаще  обнаруживаются патологические примеси (p<0,01),  а при наличие полиантибиотикорезистентности наблюдалась более продолжительная лихорадка  (p<0,01).

Таблица 3

Оценка связей между  наличием генетических маркеров патогенности клинических штаммов энтеробактерий  с проявлениями  ОКИ

Наличие hlyB, hlyA, sfaA, sfaG, fimA, irp-2

Клинические проявления ОКИ

Критерий Фишера  (F)

р

Продолжительность лихорадки

3,80

р<0,01

Степень подъема температуры (мах)

4,4

р<0,01

Продолжительность рвоты

1,50

p>0,05

Продолжительность диареи

1,65

р<0,01

Следует отметить, что во всех  исследованных случаях генетические маркеры выявлены у штаммов,  выделенных при среднетяжелых и  тяжелых формах  ОКИ. При  этом  культуры, несущие  генетические детерминанты «островков» патогенности,  статистически чаще  (p<0,05) выявлялись при тяжелых формах  ОКИ (12,2%) по сравнению со штаммами, у которых  данные детерминанты не выявлены (0,7%). При тяжелом течении  ОКИ были выделены штаммы, несущие  следующие генетические детерминанты: ген  высокой патогенности - irp-2 (K.pneumoniae, S.  оdorifera), гены, ответственные за продукцию гемолизинов - hlyA и hlyВ (K.pneumoniae, C.koseri),  а также  за адгезию S типа - sfa A (E. intermedius). Штаммы бактерий,  несущие генетические  маркеры «островов» патогенности, в 73,2±6,9% случаев обладали полирезистентностью к антимикробным препаратам. Таким образом, полученные результаты показали, что наличие  у клинических  штаммов энтеробактерий генетических детерминант патогенности и их  сопряженность с клиническим течением острых кишечных инфекций свидетельствует  об этиопатогенетической значимости  выделяемых при ОКИ условно-патогенных энтеробактерий.

Условно-патогенные энтеробактерии в микробных сообществах водных  экосистем и их биологические свойства

Условно-патогенные микроорганизмы, являясь сочленами естественных экосистем, широко распространены в окружающей среде,  характеризуются вариабельностью их биологических свойств, возможностью патогенизации под воздействием различных факторов и  формирования  эпидемических вариантов возбудителей. Особое значение имеет  изучение циркуляции  бактерий данной группы в водных объектах, оказывающих существенное влияние на жизнедеятельность человеческой популяции.

  Статус биоценоза в поверхностных водах cоставляют две экологически различныe группы микроорганизмов –  аутохтонные и аллохтонные бактерии. Изменение соотношения  бактерий двух различных экологических групп может привести не только к  нарушению нормального экологического состояния  водоема, но и ухудшению его  санитарно-эпидемиологических показателей (Видовое разнообразие…, 2000). Среди аллохтонных  бактерий наиболее распространены  энтеробактеры,  клебсиеллы,  провиденции, алкалигенесы, аэромонады и т.д. Большую часть указанных микроорганизмов  принято считать условно-патогенными, т.к. при определенных обстоятельствах  они могут иметь этиологическое значение  в возникновении и развитии факторных и ассоциативных инфекционных болезней (Макаров В.Ю. с соавт., 2007).

  Проведенные исследования показали, что  грамотрицательная составляющая  микробиоценозов исследованных водных объектов (реки Ангара и Лена)  были представлены микроорганизмами различных семейств  (Enterobacteriaceaе,  Pseudomonadaceae, Moraxellacceae, Aeromonadoceae, Alcaligenaceae), среди которых абсолютными доминантами являлись бактерии семейства  Enterobacteriaceaе (река Лена-75,6%; река Ангара-88,6%).  Учитывая, что энтеробактерии составляли  существенно большую часть (р<0,05) микробиоценозов  водоемов, а также отличались наиболее широким спектром, для систематизации  значимости  различных представителей  данного семейства проведена количественная оценка  степени доминирования  микроорганизмов. При  этом не было выявлено микроорганизмов, относящихся к классу  абсолютных доминат (границы класса по доле от  100 до 64%). Все микроорганизмы  относились к четырем классам (доминант, субдоминант, второстепенный и редкий классы). При этом в класс доминант (границы класса по доле от  64 до 36 %) вошли  только штаммы одного рода - Escherichia,  представленные двумя фенотипами: ферментирующие и  неферментирующие  лактозу.. Субдоминантами  оказались бактерии рода Enterobacter, составившие  в биоценозе р. Ангары около трети всех штаммов бактерий; р. Лены –19,4%. Микроорганизмы данного рода были представлены бактериями трех  видов: E.cloacae, E. aerogenes  и  E. gergoviae, среди которых типовой вид (E. cloacae) доминировал. При этом частота встречаемости штаммов E. cloacae  в р. Ангаре  оказалась значимо (р <0,05) выше по сравнению с р. Леной. Другая особенность спектра  микробного сообщества реки Лены – значительная частота встречаемости штаммов  Klebsiella spp., которые наряду с Enterobacter spp. вошли в класс субдоминант. Доля данных бактерий в микробном сообществе р. Ангары был несколько ниже (второстепенный класс доминирования). Также следует отметить штаммы родов Pantoea (река Лена) и Citrobacter  (река Ангара), частота встречаемости которых  в микробном сообществе  водоемов позволила отнести  их к второстепенному классу доминирования (границы класса по доле от 14% до 6%). Микроорганизмы других  родов  семейства Enterobacteriaceaе по степени доминирования  относились к редкому классу:  бактерии рода Proteus  (оба водоема), родов Morganella и  Citrobacter (река Лена), а также  штаммы родов  Pantoea, Serratia, Hafnia и  Edwardsiella (река Ангара) (табл.4).

Таблица 4

Оценка  степени доминирования бактерий семейства Enterobacteriaceaе микробных сообществ  рек Ангара и Лена (по шкале доминирования)

Степень

(класс) доминирования

Баллы

5

4

3

2

1

Абсолютный доминант

Доминант

Субдоми

нант

Второстепенный

Редкий

Границы классов

по  доле (%)

64< N<100

36 < N< 64

14 < N< 36

6 <  N <14

0< N< 6

Водный объект

Таксономическая принадлежность  микроорганизма

река Лена

«-»

Escherichia

Enterobacter

Klebsiella

Pantoea

Proteus

Citrobacter

Morganella

река Ангара

«-»

Escherichia

Enterobacter

Klebsiella

  Citrobacter

Proteus

Pantoea

Serratia

Hafnia

Edwardsiella

Следует отметить, что  за период наблюдения не отмечалось  смены  таксономического спектра условно-патогенных энтеробактерий микробиоценозов изучаемых водоемов и колебания частоты встречаемости отдельных представителей семейства Enterobacteriaceaе находились в пределах  класса. В то же время  выявлены  изменения  их популяций на уровне  разнообразия. 

  Изучение варьирования содержания  УПЭ в составе микробиоценозов  водных объектов, приуроченных к районам биологического загрязнения, показало, что  в районе городов  Ангарск и Иркутск, испытывающих  выраженный антропогенный прессинг, индексы видового разнообразия (d) УПМ  (по R. Margalef) микробного сообщества реки Ангары  оказались, во-первых,  практически равными (6,95 и 6,59 соответственно), во-вторых, были выше по сравнению  с истоком реки (4,43).  По р. Лене  в районе г. Якутска  данный индекс составил 5,86; а с учетом всей протяженности  реки – 4,47.  При этом наиболее демонстративно различия микробных сообществ водоемов, а также  различных их участков, показывают индексы видового разнообразия УПЭ по сравнению с  бактериями других семейств. Например, в районе г. Якутска индекс видового разнообразия энтеробактерий был равен 4,18; а с учетом всей протяженности  реки – 2,84.

  Сравнение микробных сообществ между отдельными участками реки Ангары с использованием коэффициента  сходства Серенсона (S) показало, что наибольшая близость выявлена между количественным составом микробных сообществ р. Ангары в районе гг. Иркутск и Ангарск (0,72), и наименьшая – между  указанными городами и истоком реки (0,58).

  Информативной характеристикой микробиоценозов водных экосистем является и их ранговое распределение по параметрам «доминирования – разнообразия» условно-патогенных  представителей семейства Enterobacteriaceaе.  Показано, что для микробиоценоза реки Ангары (по сравнению с р. Леной) характерна более «уплощенная» кривая (большее разнообразие энтеробактерий  при данном  числе видов) (рис. 8 а, б).

а)

б)

Рис. 8. Ранговое распределение «доминирования – разнообразия»  условно-патогенных энтеробактерий микробиоценозов  рек Ангара (а) и Лена (б)

  Изучение  фенотипических характеристик водных изолятов условно-патогенных энтеробактерий показало, что около трети всех микроорганизмов обладали антилизоцимной активностью, способствующей их выживанию во внешней среде, и продуцировали  фосфатазу (38,1±2,4% и 34,9±2,4% соответственно).  Частота встречаемости  антилизоцимной активности щелочной фосфатазы  значимо (р<0,05) превышала  проявление других  фенотипических признаков: адгезия  и продукция  ДНКазы выявлена у 17,5±1,9% и 14,3±1,8% штаммов УПМ соответственно; гемолитическая  и протеолитическая активность – у  7,9±1,3%  и 11,1±1,3% соответственно (рис.9).

Рис.9. Характеристика фенотипических свойств  водных изолятов условно-патогенных энтеробактерий (%)

  Среди  водных изолятов энтеробактерий преобладали штаммы, характеризующиеся одним фенотипическим признаком (41,3±2,1%), и значимо реже (по сравнению с клиническими штаммами) встречались штаммы, обладающие комплексом (более двух) признаков (7,9±1,2%) (рис.10).

Рис. 10. Ранжирование водных штаммов  условно-патогенных энтеробактерий по наличию фенотипических признаков 

  Результаты проведенных исследований позволили установить наличие  значимой корреляционной связи между распространенностью  УПЭ в структуре  микробиоценозов  и наличием  у них  таких свойств, как персистенция (r=0,786; p<0,05), адгезивная активность (r=0,875; p<0,01) и продукция ДНКазы (r=0,871; p<0,01). Также установлена  зависимость между значимостью  УПМ (по шкале доминирования) и наличием у них сочетанности фенотипических проявлений. Так, микроорганизмы, обладающие  несколькими фенотипическими признаками входили по шкале доминирования  в  классы доминант, субдоминант и второстепенный класс.  В то же время штаммы Klebsiella spp., уступающие согласно ранжированию по доле в составе энтеробактерий микробного сообщества  штаммам E.coli и Enterobacter spp.,  имели самый высокий показатель выявления сочетанных фенотипических признаков.  Данные  микроорганизмы (E.coli,  Klebsiella spp. и  Enterobacter spp.)  имели самый широкий спектр (четыре из шести) фенотипических свойств. Самая высокая частота встречаемости  сочетанного  проявления  фенотипических признаков  была характерна для Klebsiella spp. (пятая часть  штаммов данного рода), а  биопрофиль  E.coli  характеризовался наибольшим разнообразием фенотипических проявлений  (пять вариантов).

  Изучение  на модели реки Лены  вариабельности фенотипических свойств условно-патогенных представителей семейства Enterobacteriaceae  в зависимости от  точки отбора проб воды показало, что  у энтеробактерий микробиоценозов р. Лены в районе г. Якутска («опытный» район) по сравнению  с рекой Леной на всей ее  протяженности  (контрольный район)  чаще  (p<0,01) выявляли  наличие одного (50,0±3,4% и 33,3±3,7% соответственно)  и  двух (30,6±3,1% и 18,5±3,0% соответственно)  фенотипических свойств. Микроорганизмы, обладающие сочетанием  трех и четырех  признаков, были характерны  только для микробного сообщества  «опытного» участка реки (2,7±1,% и 11,1±2,1% соответственно). Проведенные исследования показали, что  у энтеробактерий,  выделенных  в районе г. Якутска, по сравнению со штаммами контрольного участка значимо чаще отмечалась продукция ДНК-азы: 25,0±2,9% и 3,7±1,4% соответственно (p<0,01), щелочной фосфатазы: 41,7±3,3% и 29,5±3,5% соответственно (p<0,05)  и  адгезивная активность: 22,2±2,8% и 11,1±2,4%  соответственно (p<0,01). Практически все  штаммы, обладающие гемолитической активностью, были  выявлены на «опытном» участке (p<0,05). Для микробного сообщества данного участка  был характерен и значимо более высокий уровень распространенности персистентных свойств энтеробактерий: 52,8±3,1% и 18,5±3,0% соответственно (p<0,01). По критерию  Вилкоксона направленность изменений  фенотипических  признаков бактерий  на  «опытном» и контрольном участках носила статистически значимый характер (Т=1 при n=6; p<0,05).

Как было указано выше, из исследованных фенотипических признаков у водных штаммов энтеробактерий наиболее часто  отмечалось свойство персистенции (антилизоцимная активность), способствующее выживанию  на популяционном уровне и накоплению микроорганизмов в объектах внешней среды. Проведенные исследования  показали, что соотношение  штаммов, продуцирующих лизоцим и  обладающих антилизоцимной активностью,  в целом по р. Лене  (без учета г. Якутска) составило 6,87; что, согласно данным литературы (Плотников А.О. с соавт.,  2000), свидетельствует о нормальном  экологическом состоянии биоценоза. В районе г. Якутска данное соотношение уменьшилось  до  1,73, что отражает перестройку  микробиоценоза  в связи с повышением доли антилизоцимактивных штаммов. В целом по реке Лене  количество  лизоцимактивных представителей  аутохтонной микрофлоры составило 85,9±2,2%; антилизоцимактивных условно-патогенных микроорганизмов - 18,5±3,1%; в районе г. Якутска  количество штаммов с ЛА  уменьшилось до  73,5±2,6% (p<0,01), а доля  микроорганизмов  с АЛА  возросла до  52,8±3,3% (p<0,01).

  Выявление у условно-патогенных энтеробактерий, выделенных из вод поверхностных водоемов, особенно в районах антропогенного загрязнения, изменения биологических свойств, в частности, персистентного потенциала,  способности продуцировать ДНКазу,  фосфатазу, проявлять гемолитическую, адгезивную и протеолитическую активность свидетельствует о потенциальной опасности  бактерий данной группы водных экосистем.

  В связи с этим одним из аспектов оценки  эпидемиологической значимости  водных изолятов условно-патогенных энтеробактерий  является  изучение наличия и распространенности  среди них генетических детерминант патогенности. Однако, в настоящее время  в России  данные исследования  единичны. В частности, А.В. Загайновой (2010)  выявлены генетические детерминанты  «островов» патогенности (cnf-1, fimA, ehx) у  клебсиелл, выделенных из вод различного вида водопользования. Проведенные нами исследования показали, что условно-патогенные энтеробактерии, выделенные из воды, характеризовались  наличием  генетических детерминанант патогенности, что свидетельствует об их потенциальной  эпидемиологической значимости.  В то же время,  частота их обнаружения (7,8%) была  ниже (p<0,05) по сравнению с клиническими штаммами (23,4%), отмечена встречаемость только двух генов: hlyА (3,4%) и sfaG (4,5%), а набор генетических детерминант не превышал одного  маркера.

Оценка вирулентности  водных штаммов энтеробактерий  in vivo  показала, что при тестировании четырех культур, характеризующихся наличием генетических детерминант  патогенности,  на 12 лабораторных животных, гибель  мышей наступала  через  24 часа (75,0%) и через  48 часов (25,0%). Штаммы  энтеробактерий (количество культур-5, количество биопроб-15), характеризующиеся  отсутствием  генетических маркеров патогенности,  не вызывали гибели лабораторных животных.

Антибиотикорезистентность  условно-патогенных микроорганизмов

Клинические  штаммы условно-патогенных энтеробактерий

Одной из важнейших фенотипических  характеристик условно-патогенных энтеробактерий является их резистентность к антимикробным препаратам. Изучение антибиотикорезистентности  УПЭ, выделенных из  фекалий больных ОКИ, показало, что популяция энтеробактерий была  представлена штаммами, неоднородными по отношению к  АМП. Нами был разработан способ  оценки гетерогенности микробных популяций с использованием индекса антибиотикорезистентности (ИАР)  с позиции кластерной структурированности. Учитывая  величины и диапазоны величин  ИАР, все  индексы  были  сгруппированы в пять кластеров (шаг индекса составил 0,05).  Соответственно исследованные микроорганизмы  подразделяют на  чувствительные (I), монорезистентные (II), умеренно-резистентные (III),  полирезистентные (IV) и резистентные к максимальному количеству исследованных антибиотиков  (V).  Проведенные исследования показали, что  по величинам ИАР все клинические штаммы  энтеробактерий  входили в три кластера: монорезистентными  оказались  6,3±0,6%  протестированных штаммов, более трети микроорганизмов проявили устойчивость  к  двум-пяти антибиотикам; значимо (p<0,01) большую часть составили  полирезистентные изоляты  (табл.5 ).

Таблица 5

Оценка антибиотикорезистентности клинических штаммов условно-патогенных энтеробактерий (по  ИАР)

Кластер

Величина и (или) диапазон ИАР

%

I

0,0

0,0

II

0,05

6,3±0,6

III

0,10 ИАР   0,25

54,9±1,2

IV

0,30 ИАР 0,95

38,8±1,1

V

1,0

0,0

  Для сравнения укажем, что среди штаммов, выделенных от здоровых детей, доминировали штаммы УПЭ, входящих в I кластер (58,5%), около трети отнесены к монорезистентным (30,2%),  десятая часть штаммов  (11,3%) вошли в III кластер, а полирезистентных штаммов не выявлено.

  При проведении сравнительного  анализа устойчивости представителей разных родов  клинических штаммов  энтеробактерий, в первую очередь, учитывали штаммы, составившие большую часть от всех  тестируемых микроорганизмов (Enterobacter spp., Klebsiella spp., Citrobacter spp., Proteus spp., M.morganii).

В результате проведенных исследований были выявлены монорезистентные  штаммы  среди бактерий родов Proteus, Enterobacter (каждый десятый штамм) и  Citrobacter (около 5%). К двум  антимикробным препаратам проявили резистентность 12,6±0,8% штаммов; к  трем, четырем и пяти – примерно каждый десятый штамм. Свойство полиантибиотикорезистентности  значимо чаще  (p<0,05) отмечалось  среди Klebsiella  spp. (70,0±2,8%) по сравнению  с  бактериями родов  Citrobacter, Enterobacter и Morganella, среди которых  множественная антибиотикорезистентность установлена примерно у половины  штаммов. Среди представителей рода Proteus  данное свойство выявлено  в 65,7±2,4% случаев  (рис.11).

 

  Прим.: p1,2<0,05; p1,3<0,05; p1,4>0,05;p1,5<0,05

Рис. 11. Полиантибиотикорезистентность бактерий  семейства Enterobacteriaceae,  выделенных  от  больных  ОКИ (%)

  У клебсиелл значимо чаще (р<0,05) множественной резистентностью к АПМ  обладали штаммы Kl.pneumoniae  по сравнению с K.оxytoca (73,2±2,8% и 56,3±7,1% соответственно). Среди протеев данное свойство статистически чаще отмечалось у P.mirabilis (p<0,01),  среди энтеробактеров – у E.cloacae (p<0,01). Различия в частоте встречаемости полирезистентных цитробактеров (C.freundii и  С.koseri) не носили значимого характера.

В системе эпидемиологического мониторинга антибиотикорезистентности особое внимание уделяется  устойчивости микроорганизмов к -лактамным антибиотикам. Результаты проведенных исследований показали, что к цефалоспоринам  I поколения были  резистентны  74,6±1,1% штаммов;  II и III поколений – третья часть протестированных штаммов;  к АМП  IV поколения отмечен  статистически самый низкий (p<0,01)  уровень среди всех препаратов данной группы -  6,5±0,6%.

Немаловажное значение имеет изучение резистентности УПЭ к нелактамным АПМ. Установлено, что к нитрофуранам оказались  резистентными около половины протестированных штаммов - 50,9±1,2%; к  тетрациклинам - 43,1±1,2% (прежде всего, за счет  P.mirabilis, M. morganii и K.pneumoniae), хлорамфениколу – 27,6±1,1%.  Из всех  аминогликозидов значимо меньший (p<0,01) уровень резистентности отмечен к препарату III поколения - амикацину (7,1±0,6%); к  аминогликозидам II поколения (гентамицину и  тобрамицину) резистентность микроорганизмов составила 20,0±0,9% и 15,2±0,8% соответственно, I поколения - 27,3%±1,1%. Кроме того,  небольшое количество (около 7%)  штаммов энтеробактерий  были резистентны к  фторхинолонам (ципрофлоксацину и  офлоксацину).

Водные штаммы условно-патогенных энтеробактерий

  Принципиально важным информативным свойством водных штаммов условно-патогенных энтеробактерий является их отношение к антимикробным препаратам.  Приобретение  резистентности УПЭ к АМП демонстрирует их эволюционную изменчивость  под воздействием факторов окружающей среды. Уровень антибиотикорезистентности  микроорганизмов  водных  экосистем является одним из показателей  испытываемой ими  антропогенной нагрузки (Мамонтова Л.М. с соавт., 2000, Макаров Ю.А., 2007 и др.). F.Tenover (2005) связывает повышение уровня антибиотикоустойчивости  бактерий водных экосистем с  усиливающимся процессом обмена генами резистентности между естественными обитателями водных экосистем, и микроорганизмами, попадающими в водоемы  со сточными водами. В то же время недостаточная изученность  изменчивости данного свойства определяет  необходимость совершенствования  системы мониторинга за их природными популяциями с анализом популяционного  биопрофиля  водных изолятов условно-патогенных энтеробактерий.

Проведенные исследования позволили установить, что  микробные популяции исследованных водных экосистем были  представлены УПЭ, входящими по  индексу антибиотикорезистентности в три (река Ангара) и четыре (река Лена) кластера. Отличительной особенностью  УПМ микробиоценоза реки Лены (в отличии от реки Ангары) является присутствие штаммов, входящих в I кластер (чувствительных ко всем использованным в работе антибиотикам, ИАР=0,0),  составивших 4,3±0,5%. Что касается монорезистентных  условно-патогенных  грамотрицательных микроорганизмов, то  самой высокой (р<0,05) частота  их встречаемости была в истоке реки Ангары (27,8±4,3%). Распределение  монорезистентных  бактерий  в микробных сообществах  реки  вблизи  городов, испытывающих  выраженную антропогенную нагрузку, выглядело следующим образом: в районе  г. Ангарска данный показатель составил 4,5±1,4;  г. Иркутска- 0,8±0,2% (p>0,05). Количество монорезистентных штаммов  микробной популяции реки Лены в районе г. Якутска оказалось примерно  таким же, что и  в микробном сообществе реки  на всей ее протяженности: 6,1±1,5% и 7,6±0,5% соответственно. Доминирующая часть УПЭ  микробных сообществ  изучаемых водоемов относилась к III кластеру - умеренно–резистентные  (0,10ИАР0,25). Самая высокая частота встречаемости умеренно-резистентных штаммов  была характерна для микробного сообщества реки Лены  на  всей ее протяженности (68,3±0,8%), а также реки Ангары в  ее  истоке и районе г. Иркутска  (58,4±4,7% и 64,6±2,4% соответственно).

Особый интерес представляет  оценка частоты  встречаемости полирезистентных микроорганизмов (IV кластер), объединяющих большую группу  бактерий, характеризующихся значительным  количеством ИАР в диапазоне  от 0,30  до 0,95. Установлено, что, частота встречаемости  полиантибиотикоустойчивых штаммов энтеробактерий в целом по реке Лена составила  19,8±0,7%, в то же время в  районе г. Якутска  удельный вес  бактерий с данным свойством оказался  значимо выше (р<0,01). Аналогичная картина  отмечалась и в отношении р. Ангары, в  истоке которой количество полиантибиотикоустойчивых  штаммов  составило 13,8±3,3% и оказалось  значимо  (p<0,05) меньшим, чем в районе городов, где  доля  микроорганизмов, входящих в IV кластер,  увеличилась почти в три раза (табл. 6).

Таблица  6

Оценка антибиотиокрезистентности водных штаммов условно-патогенных энтеробактерий

(по  ИАР)


Водный объект

I

II

III

IV

V

%

р

%

р

%

р

%

р

%

река Лена

на всей протяженности

4,3±0,3

р<0,05

7,6±0,5

p>0,05

68,3±0,8

р<0,05

19,8±0,7

р<0,05

0,0

в районе

г. Якутска

0,0

6,1±1,5

53,5±3,2

40,4±3,1

0,0

река Ангара

в районе

г.  Ангарска

0,0

p>0,05

4,5±1,4

р<0,05

49,2±3,5

р<0,05

46,3±3,5

р<0,05

0,0

в районе

г. Иркутска

0,0

0,8±0,4

64,6±2,4

34,6±2,5

0,0

исток реки Ангары

0,0

27,8±4,3

58,4±4,7

13,8±3,3

0,0

  На исследованных участках  водоемов  количество полирезистентных штаммов  оказалось статистически значимо меньшим по сравнению с частотой встречаемости умеренно-резистентных микроорганизмов (p<0,05), за исключением  участка  в районе г. Ангарска, где  количество  бактерий, входящих в IV и  III кластеры,  оказалось практически равным. Таким образом, использование индекса антибиотикорезистентности позволяет  дать оценку гетерогенности  микробных популяций  водных экосистем  и  провести сравнительную оценку по данному признаку микробиоценозов разных водоемов, а также микробных сообществ различных участков одного водоема.

Многолетние исследования показали, что  экологическое состояние водной экосистемы  оценивается как благополучное, если в микробной популяции, представленной условно-патогенными грамотрицательными энтеробактериями, присутствуют микроорганизмы первого кластера (чувствительные ко всем  АМП) и (или)  монорезистентные (II кластер); доля умеренно-резистентных штаммов  (III кластер) составляет более  половины всех штаммов, а полирезистентных (IV  кластер) -  менее 25% от исследованных  микроорганизмов.

  Несомненный интерес представляет также изучение антибиотикорезистентности  представителей  аутохтонной составляющей исследованных водных объектов Анализ антибиотикорезистентности данной группы микроорганизмов показал  наличие различий  в уровне изучаемого показателя  не только между данными  микроорганизмами на разных участках реки, но также и  между представителями  указанной группы и условно-патогенными грамотрицательными микроорганизмами. Сравнивая  антибиотикорезистентность бактерий двух  групп, следует отметить, что частота встречаемости  условно-патогенных грамотрицательных бактерий, входящих в I и II кластеры, была меньшей по сравнению с представителями  аутохтонного сообщества. В то же время  энтеробактерии  чаще характеризовались  полиантибиотикорезистентностью. Данная тенденция прослеживалась как  в отношении  исследованных  водоемов,  так и на отдельных участках  рек, и в основном носила статистически значимый характер (рис.12).

 

Рис.12. Полиантибиотикоустойчивость  условно-патогенных бактерий  микробиоценозов  рек  Ангары и Лены  (%)

  Значительные различия  выявлены в частоте встречаемости полиантибиотикорезистентных УПЭ в зависимости от удаленности от берега и  расположения населенных пунктов. Известно, что береговая часть водоема испытывает  в большей степени влияние различных видов сточных вод. Исследование в 30 створов (от  верховья реки Лены в районе г. Усть-Кут до ее устья в районе моря Лаптевых) позволило установить, что  процент резистентных штаммов, входящих в микробное сообщество фарватера реки, по критерию знаков  оказался  более низким (р=0,01),  по сравнению с таковым у бактерий береговой зоны реки, где более выражено влияние населенных пунктов и рекреационных  зон. Суммарный показатель полиантибиотикорезистентных штаммов на середине р. Лена  составил  немногим более 10% и был значимо  ниже (р<0,05) по сравнению с микробиоценозом береговой зоны, где количество резистентных  микроорганизмов увеличилось в 1,6 раза.

Проведение статистического анализа  (критерий Вилкоксона) уровней  антибиотикоустойчивости  микроорганизмов, выделенных из реки  Лены в пяти створах показывает, что  количество  устойчивых штаммов бактерий ниже  населенных пунктов (по течению реки) было  существенно более высоким (Т=0, p<0,01).

  О важности изучения показателя антибиотикоустойчивости условно-патогенных энтеробактерий водных экосистем  свидетельствует проведение  корреляционного и регрессионного анализов, результаты которых показали наличие связи между  содержанием бактерий данной группы  и  количеством штаммов бактерий, обладающих  множественной антибиотикоустойчивостью (Rx/y=1,6%; Rу/x; r=0,73; p<0,01). 

Адаптационный  потенциал условно-патогенных  энтеробактерий, выделенных из различных  источников (клинический материал  и водные объекты)

  Изучение  адаптационного потенциала условно-патогенных энтеробактерий, выделенных из разных источников (организм человека, внешняя среда), к различным условиям обитания, позволили  выявить значительные различия по  их ферментативной активности. В  стрессовых условиях культивирования (различный температурный режим, разные питательные  среды)  энтеробактерии инициируют перестройку  метаболических процессов,  обеспечивающих  их адаптацию.  Так, у водных изолятов  УПЭ активизация  ферментов, способствующих выживанию  во внешней среде  (Mn-пероксидаза, каталаза, целлюлаза и др.) наблюдается  при низких температурах. Например, наиболее высокая активность оксиредуктаз (каталазы, целлюлазы и  Mn-пероксидазы) отмечалась при  низкой температуре, а при воздействии высоких температур активность ферментов снижалась (рис.13).

Рис. 13.  Изменение активности каталазы водных штаммов энтеробактерий при различных температурах культивирования

  Можно полагать,  что высокие уровни  активности каталазы требуются  для  детоксикации перекисей, выработке которых способствует  возрастание растворимости кислорода и его доступности  при низких температурах.

  У клинических  штаммов, напротив, наибольший уровень  каталазной активности отмечался при более высокой температуре. Так, если  активность каталазы водного штамма P.mirabilis  при  4°С составила 1,06 ед/мг, то при  повышении температуры до  37°С  наблюдалось снижение  активности до  0,67 ед/мг. У клинического штамма P.mirabilis активность данного фермента, составлявшая при  критически низкой температуре 0,46 ед/мг, при  30°С увеличилась до 1,07 ед/мг. Водный штамм K.pneumoniae обладал каталазной активностью  только при температуре (0,44 ед/мг), а  клинический штамм -  только при  30°С (0,54 ед/мг)

Синтез клиническими штаммами каталазы при более высоких  температурах  обеспечивает их адаптацию к  условиям существования  в организме хозяина. Бактерии, находясь во внутренней среде человека, вызывают его защитную реакцию: лейкоциты и макрофаги начинают продуцировать перекись водорода,  направленную на уничтожение микроба. Фермент каталаза, являясь защитной системой бактерий, превращает лейкоцитарную перекись в воду (Деева И.Б., 2004).  При этом, чем выше каталазная активность  бактерий,  тем эффективнее они защищаются от организма хозяина.

Одним из ферментов жизнеобеспечения микроорганизмов является целлюлаза.  Установлено, что у клинических штаммов целлюлаза  обнаруживалась только  при оптимальной температуре культивирования (37°С), а  штаммы бактерий, выделенные из воды, проявили ферментативную активность при  различных температурных режимах: от  стрессового низкого  до  оптимального и субоптимального. Например, водный штамм E.cloacae  продуцировал целлюлазу при  оптимальной температуре  (0,079 ед/мг),  а P.mirabilis – при  критически низкой  температуре (0,06 ед/мг).  У штамма E.aerogenes,  также выделенного из воды,  целлюлаза  присутствовала при 24°С (0,048 ед/мг),  30°С ( 0,035 ед/мг) и  37 °С (0,039 ед/мг).  Активность целлюлазы C.freundii проявилась при  двух температурах культивирования: 30°С (0,958 ед/мг) и 37 °С (0,05 ед/мг).

  Также показано, что активность  таких ферментов, как уреаза и липаза, у  клинических  штаммов энтеробактерий была выше  аналогичных количественных показателей штаммов, выделенных из воды (табл.7). В организме хозяина уреаза приводит к сдвигу рН среды в очаге воспаления  и способствует разрушению эпителиальных клеток, а  липаза облегчает адгезию и проникновение в ткани.  При существовании  микроорганизма  в воде необходимость в синтезе факторов вирулентности отсутствует. 

  Таблица 7

Соотношение  активности  (ед/мг) липазы и уреазы водных  и клинических штаммов  условно-патогенных энтеробактерий

Штамм

Температура °С

4°С

24°С

30°С

37°С

липаза

E.cloacae

1:1,3

1:2,8

1:2,2

1:1,5

E.aerogenes 

1:1,8

1:1,6

1:1,8

1:1,1

уреаза

E.cloacae

1:7,3

1:33,1

1:24,1

1:19,2

E.aerogenes 

1:20,0

1:29,4

1:27,9

1:20,2

Культивирование микроорганизмов на различных питательных средах («голодная» среда и  полная синтетическая среда Красильникова) показало, что клинические и водные изоляты УПЭ проявили разный уровень ферментативной активности на данных средах. У клинических штаммов ферментативная  активность на  полной синтетической среде была выше, чем на «голодной». Так, активность  липазы клинического штамма C.freundii  на полной среде  при всех температурах культивирования превышала  уровень активности данного фермента на «голодной»  среде от 0,6 раз до  5 раз. Практически только на полной среде проявлял липазную активность клинический штамм P.mirabilis (4°С-0,74 ед/мг; 24°С-0,8 ед/мг;  30°С-0,86 ед/мг; 37°С-1,01 ед/мг).  Аналогичные данные получены и в отношении оксиредуктаз. В частности, у C.freundii  и  P.mirabilis уровни Mn-пероксидазы на полной среде превышала аналогичные показатели на  «голодной» среде в 3,5-9,8 раз. 

  Водные изоляты, в отличии от клинических, обладали вариабельной активностью ферментов, часть из них  были активны при выращивании на полной питательной среде (оксиредуктазы K.pneumoniae и C.freundii), другие -  на «голодной» среде (липаза K.pneumoniae и P.mirabilis).

  Таким образом, проведенные исследования показали вариабельность ферментативной активности микроорганизмов  в  условиях  различного температурного режима и состава питательных сред. В организме человека  микроорганизмы вырабатывают ферменты, являющиеся защитной системой бактерий. При снижении температуры до  значений, соответствующих температуре окружающей среды и изменении доступности питательных элементов наблюдается перестройка метаболических процессов в сторону оптимизации; метаболизм микроорганизмов переключается с характерного  для паразитирования в организме человека на сапротрофный, способствующий выживанию во внешней среде.

Одним из механизмов формирования  фенотипической устойчивости является способность бактерий к  развитию  биопленочных сообществ.  Роли биопленок в окружающей среде и  организме хозяина  в последние время уделяется особое внимание. Для условно-патогенных энтеробактерий, обитающих как в организме человека, так и в окружающей среде,  способность к образованию биопленок является одной из возможностей выживания в различных условиях  существования.

Проведенные исследования  показали, что способностью образовывать биопленки обладали как клинические (E.cloacae, C.freundii, P.mirabilis, E.aerogenes и K.pneumoniae), так  и водные (E.coli, E.cloacae  и  E.aerogenes) штаммы условно-патогенных энтеробактерий,  что отражает их  высокий адаптационный потенциал.  Следует отметить, что способность к образованию биопленок  у штаммов, выделенных из разных источников, была различной. У клинических штаммов наибольшая способность к формированию  биопленок (по уровню оптической плотности) была отмечена при температурах  37°С и 30°С; у водных штаммов - при  30°С и 24°С.  При экстремально низкой температуре способность энтеробактерий образовывать биопленки снижалась, особенно у клинических штаммов. Так, при 4°С  уровень адсорбции  кристалвиолета этанолом в единицах  оптической плотности  соответствовал фону  у штаммов E.cloacae, C.freundii и  E.aerogenes.

Обращает на себя внимание тот факт, что среди клинических штаммов условно-патогенных энтеробактерий способность к формированию биопленочных сообществ при всех  температурах (в т.ч.  при экстремально низкой) была выявлена только  у K.pneumoniae, что может свидетельствовать о высоких адаптационных возможностях  клебсиелл (рис.14 а). У  других клинических штаммов энтеробактерий способность к образованию биопленок  была выявлена  только  при  24°С , 30°С  и 37° С (рис. 14 б)

а)  б)

Рис. 14. Образование  биопленок клиническими штаммами энтеробактерий: а) K.pneumoniae; б) другие виды энтеробактерий

Среди водных штаммов неспособность формировать биопленки при  низких температурах была отмечена только у E.coli. Другие  представители энтеробактерий, изолированные из  воды (E.cloacae  и  P.mirabilis), обладали способностью к формированию биопленок при всех температурах (рис.15).

Рис. 15. Образование  биопленок водными штаммами энтеробактерий

Также следует отметить, что  клинические изоляты характеризовались более  высокой плотностью биопленок по сравнению с водными штаммами.

  Выявленная  у водных и клинических штаммов УПЭ способность к образованию  биопленочных сообществ является  одной из стратегий выживания бактерий в различных условиях  существования (организм человека и  окружающая среда).

Таким образом, проведенные исследования позволили  выявить доминирующие и субдоминирующие популяции  условно-патогенных энтеробактерий и обосновать их  этиологическую (на модели ОКИ) и эколого-эпидемиологическую (водные экосистемы) значимость с учетом фено- и генотипических характеристик и адаптационных возможностей.

 

Выводы

1. Основными представителями условно-патогенных энтеробактерий в  структуре  бактериальных ОКИ установленной этиологии  являются  бактерии родов Enterobacter, Proteus, Klebsiella и Citrobacter (класс  субдоминант), характеризующиеся  сменой вариантного и количественного  состава в многолетнем аспекте. Данные виды энтеробактерий  (а также E.coli) преобладают  (с изменением степени доминирования) и в таксономическом  спектре грамотрицательной составляющей  микробиоценозов водных  экосистем.

2. Патогенность условно-патогенных энтеробактерий, характеризующихся  выраженной фенотипической неоднородностью, определяется свойствами  конкретного штамма, а не видовой или родовой принадлежностью. Среди клинических  штаммов УПЭ преобладают (p<0,01) изоляты, которым свойственно наличие  двух (32,9±1,5%) и более (39,4±1,6%) маркеров, коррелирующих с  патогенностью.

3. Клинические штаммы условно-патогенных энтеробактерий обладают фенотипическими маркерами (антилизоцимной, адгезивной, фосфатазной (40-50%), гемолитической и протеолитической (около 30%) активностью, а также продукцией ДНКазы (26,5±1,4%), способствующими реализации их  патогенного потенциала и обеспечивающими их участие на различных этапах инфекционного процесса.

4. Условно-патогенные энтеробактерии, выделенные от больных ОКИ, несут генетические маркеры патогенности (23,4±3,2%), детерминирующие  важные этапы взаимодействия возбудителя с клетками организма хозяина: адгезию, продукцию гемолизинов,  размножение в тканях (hlyА, hlyВ, sfaA, sfaG, fimA, irp-2), свидетельствующие об их  этиопатогенетической значимости. Наиболее широкий набор  генетических маркеров патогенности выявлен у  бактерий рода  Klebsiella,  доля которых  в структуре ОКИ у детей в последние годы  значимо возрастает.

5. В  большинстве случаев генетические детерминанты патогенности обнаружены у культур, выделенных от детей до 3-х лет, у которых  отмечен  и самый широкий  набор  генетических маркеров. Дети  данного возраста являются возрастной группой риска  по тяжести  течения ОКИ, которую во многом  определяет наличие у  клинического штамма  генетических детерминант патогенности.

6. Популяция клинических штаммов условно-патогенных энтеробактерий гетерогенна по отношению к  антимикробным препаратам и характеризуется  значительным распространением  антибиотикорезистентых штаммов (свойством полирезистентности обладают 54,9±1,2%, более трети микроорганизмов резистентны  к  двум-пяти препаратам,  монорезистентны лишь 6,3±0,6% штаммов). Клинические штаммы энтеробактерий обладают более  высоким (p<0,05) уровнем резистентности к  -лактамным антибиотикам и низким – к фторхинолонам и аминогликозидам III поколения.

7. Условно-патогенные энтеробактерии, выделенные из водных объектов, характеризуются  значимо  более редкой (по сравнению с клиническими штаммами)  частотой встречаемости исследованных фенотипических признаков, среди которых преобладают штаммы с одним  маркером (41,3%). Биопрофиль  водных штаммов УПЭ характеризуется преобладанием персистентных свойств, способствующих их выживанию в окружающей среде.  В то же время в  районах антропогенного загрязнения  наблюдается  изменение биологической активности  УПЭ, определяя  потенциальную опасность водной среды.

8. Водные штаммы условно-патогенных энтеробактерий характеризовались  наличием  генетических детерминанант патогенности, что свидетельствует об их потенциальной эпидемиологической опасности.  Вместе с тем, частота их обнаружения  была  ниже (p<0,05) по сравнению с клиническими штаммами, отмечена встречаемостью только двух генов (hlyА, sfaG) и  набор генетических детерминант не превышал одного  маркера.

9. Условно-патогенные энтеробактерии, выделенные из водных объектов, в отличие от клинических, среди которых не обнаружены штаммы, чувствительные ко всем  протестированным АМП, характеризовались принадлежностью  (по индексам антибиотикорезистентности) к четырем кластерам (чувствительные, моно-, умеренно- и полирезистентные). Гетерогенность микробных популяций условно-патогенных энтеробактерий по антибиотикорезистентности отражает  состояние  микробиоценозов водных экосистем и может быть использована в качестве  инструмента оценки при их биотестировании.

10. Содержание грамотрицательных условно-патогенных энтеробактерий  в микробиоценозах водных экосистем определяет потенциальную опасность водного объекта, оказывая влияние на уровень антибиотикорезистентности  штаммов. При повышении удельного веса УПЭ на 1%  имеет место увеличение содержания антибиотикоустойчивых штаммов  на 1,6% (rx,y= 0,7381; mr = ±0,131; p<0,01).

11. Для условно-патогенных энтеробактерий, изолированных от больных ОКИ и водных объектов, характерен  выраженный адаптационный потенциал, реализуемый путем перестройки их ферментативной активности  и образованием биопленочных сообществ, определяя способность выживания бактерий как в организме хозяев, так и в окружающей внешней среде.

Практические рекомендации

  В отношении  условно-патогенных энтеробактерий, выделяемых при острых кишечных инфекциях:

- Для выявления смены  таксономического  и количественного состава условно-патогенных  этиологических агентов  острых кишечных инфекций и оценки их патогенности следует  проводить  анализ доминирования  представителей данной группы с  определением важнейших факторов патогенности.

- Для подтверждения этиопатогенетической  значимости  условно-патогенных энтеробактерий, выделяемых при острых кишечных инфекциях,  рекомендуется определение генов «островов» патогенности (hlyB, hlyA, sfaA, sfaG, fimA, irp-2).

- Для выявления  устойчивых к АПМ различных фармакологических классов  и создания паспорта резистентности необходимо проводить мониторинг  антибиотикорезистентности УПЭ, выделяемых при острых кишечных инфекциях. 

  Для расширения возможностей, повышения информативности биотестирования  циркуляции условно-патогенных энтеробактерий в водных экосистемах, выявления  их потенциальной опасности целесообразен комплексный подход, отражающий следующие аспекты:

-  Оценка структуры микробиоценоза водных экосистем (доля условно-патогенных микроорганизмов);

- Таксономическая характеристика  условно-патогенной составляющей микробиоценоза,  структурированность степени доминирования различных представителей УПЭ, оценка  с использованием  различных дополнительных показателей (видового разнообразия, индекс антибиотикорезистентности);

-  Оценка уровня распространенности и выраженности  биологической активности и  персистентного потенциала условно-патогенных энтеробактерий с  анализом их популяционного биопрофиля;

- Выявление генетических детерминант патогенности, ответственных за адгезивную, инвазивную активность и другие свойства,  для определения потенциальной опасности УПЭ  водных микробиоценозов;

- Определение гетерогенности микробных популяций по показателю антибиотикорезистентности с позиции кластерной структурированности и оценка на ее основе  состояния  микробиоценозов водных экосистем.

Список работ, опубликованных по теме диссертации

  1. Принципы организации микробиологического мониторинга /Л.М.Мамонтова, А.М. Кондратьева,  А.В. Марков,  Е.В. Анганова и др. //Бюл.  ВСНЦ СО РАМН.- 2001.-  №4 (18).-С.50-55.
  2. Видовое  разнообразие  и антибиотикорезистентность  микробных сообществ водных экосистем/Л.М.Мамонтова, А.В. Марков, Е.В. Анганова и др.  // Бюл.  ВСНЦ СО РАМН.-2001.- №4 (18).-С. 64-69.
  3. Мамонтова Л.М. Биологические свойства энтеробактерий, выделенных от больных, проживающих в гг. Иркутск, Ангарск, Якутск /Л.М. Мамонтова, Е.В. Анганова, Е.Н. Рычкова //  Сибирь - Восток. – 2002. - №4(52).- С. 15-17.
  4. Мамонтова Л.М. Биологическая характеристика энтеробактерий, выделенных от больных, проживающих в гг. Иркутск, Ангарск, Якутск / Л.М.Мамонтова, Е.В. Анганова // Оценка современного состояния микробиологических исследований в Восточном регионе: Материалы Рос. научн.-практ. конф., посвящ. 100-летию со дня рожд. проф. Е.В. Талалаева, 11-13 марта 2002 г.- Иркутск : Изд-во Иркут. ун-та, 2002. – С. 178 –180.
  5. Иванова Н.Г. Сравнительная характеристика биологических свойств Shigella flexneri, выделенных от больных из городов Якутска и Красноярска / Н.Г. Иванова, Н.В. Зуенок, Е.В. Анганова, А.В. Марков и др.// Оценка современного состояния микробиологических исследований в Восточно-Сибирском регионе: Материалы Рос. науч.-практ. конф., посвящ. 100-летию со дня рожд. проф. Е.В. Талалаева, 11-13 марта 2002.- Иркутск: Изд-во Иркут. ун-та, 2002. – С.172-175.
  6. Анганова Е.В. Характеристика микробиоценозов окружающей среды и человека на различных территориях/ Анганова Е.В, Мамонтова Л.М., Зуенок Н.В, Иларова В.И., Марков А.В. Материалы науч.-практ. конф. «Здоровье населения Иркутской области: проблемы и пути решения» // Бюл. ВСНЦ СО РАМН.- 2003. -№3.- С.110-113.
  7. Анганова Е.В. Антибиотикорезистентность микроорганизмов, выделенных от госпитализированных больных на различных территориях / Е.В. Анганова,  Л.М. Мамонтова,  Н.Г. Иванова, В.И. Иларова и др.  // Материалы  науч.-практ. конф. «Здоровье населения Иркутской области: проблемы и пути решения» // Бюл. ВСНЦ СО РАМН.- 2003. - №3.- С.105-110.
  8. Мамонтова Л.М. Антибиотикорезистентность микроорганизмов,  выделенных от больных на различных территориях / Л.М. Мамонтова, Е.Д. Савилов,  В.А. Астафьев, Е.В. Анганова  и др./Актуальные вопросы клинической медицины : Материалы  XII  научно-практ. конф., посвящ. 25-летию  Иркутского ГИУВа.- 2004.- С. 202-204.
  9. Недачин А.Е. Обеспечение эпидемической безопасности  питьевого водоснабжения населения России / А.Е. Недачин, Т.З. Артемова, Р.А. Дмитриева, Т.В. Доскина,  Л.В. Иванова, Е.Д. Савилов, Л.М. Мамонтова, Е.В.Анганова // Современные проблемы  медицины окружающей среды : Материалы Пленума научн. совета  по экологии человека и гигиене окружающей среды РАМН и Минздрава и соцразвития РФ.- М. -2004.-С.  29-33.
  10. Анганова Е.В.Фенотипы лекарственной устойчивости  возбудителей ОКИУЭ  у детей в г. Иркутску / Е.В. Анганова, Л.М.Мамонтова, Н.И. Громадзинская // Биология микроорганизмов и  их науч.-практ. использование: Материалы  межрегиональной науч.-практ. конф.  Иркутск. ИГУ, 2004.- С.67-69.
  11. Анганова Е.В. Фенотипический профиль возбудителей  бактериальных кишечных инфекций  установленной этиологии у детей в гг. Иркутск,  Ангарск, Якутск / Е.В. Анганова, Л.М. Мамонтова //Бюлл. ВСНЦ СО РАМН.-2004.- №1, Т.3- С.  72-75.
  12. Анганова Е.В. Клинико-эпидемиологические особенности  острых кишечных инфекций установленной этиологии у детей в г. Усть- Илимск / Е.В. Анганова, Л.М. Мамонтова,  Т.В.Сухова,  Т.В. Гвоздик // Сибирь-Восток.- 2005.- №7.- С.  14-16.
  13. Анганова Е.В. Заболеваемость острыми кишечными инфекциями и биологические свойства их возбудителей  на различных территориях Восточно-Сибирского региона / Е.В. Анганова, Е.Д. Савилов, Л.М. Мамонтова //Бюл. ВСНЦ СО РАМН.- 2005.- №8 (46).- С.  168-172.
  14. Проблемы эпидемической безопасности питьевого водопользования населения России / А.Е. Недачин, Т.З. Артемова, Р.А. Дмитриева …Е.В. Анганова // Гигиена и санитария.- 2005.- №6.- С. 14-18.
  15. Недачин А.Е. Основы эпидемической безопасности  питьевого водопользования населения России / А.Е. Недачин,  Т.З. Артемова….Е.В. Савилов Е.В. Анганова //Экология  человека,  гигиена и медицина окружающей среды на рубеже веков :  состояние и перспективы развития: Материалы  Всерос. науч. конф., посв.  75-летию  образования НИИ  экологии человека и гигиены окружающей среды им. А.Н. Сысина.- М., 2006.- С. 107-127.
  16. Савченков  М.Ф. Эпидемиологический анализ  биологического загрязнения  водоемов Сибири и Севера  / М.Ф. Савченков, Е.Д. Савилов, Л.М. Мамонтова, В.А. Астафьев, А.В. Духанина, Е.В. Анганова // Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера : Материалы  III  Рос.  науч. конф. с междунар. участием 27-28 сент. 2006.- Новосибирск, 2006.- С. 28-29.
  17. Анганова Е.В.  Оценка антибиотикоустойчивости  возбудителей кишечных инфекций  на различных территориях Восточно-Сибирского региона / Е.В. Анганова, Е.Н. Рычкова, Н.А. Абель, Л.В. Парышева //. Сибирь- Восток- 2006.-  №10-С. 12-14.
  18. Анганова Е.В. Оценка качества реки Лена по санитарно-бактериологическим показателям /Е.В. Анганова, А.П. Протодьяконов //Бюл. ВСНЦ СО РАМН .-2006.- № 6 (52).-С. 129-131.
  19. Оценка  влияния  биологического загрязнения водоемов на  инфекционную заболеваемость /  В.А. Астафьев, Л.М. Мамонтова, Е.В. Анганова, А.В. Духанина,  Е.Д. Савилов,  Верхозина Е.В. //  Оценка эколого-экономической ситуации загрязнения водных экосистем в бассейне оз. Байкал и управление экологическим риском: Материалы науч.-практ. конф. 25-26 окт. 2006. – Иркутск: ИГТУ, 2006.- С.5-8.
  20. Эколого-эпидемиологическая оценка  качества вод реки Лены / Е.Д.  Савилов,  Ю. А. Долженко, А.П. Протодьяконов…Е.В. Анганова и др. –Новосибирск : Наука, 2006.-136с.
  21. Савилов Е.Д. Эпидемиологический анализ  биологического загрязнения  водоемов Сибири и Севера / Е.Д. Савилов, Е.В. Анганова, Л.М. Мамонтова  // Актуальные вопросы частной эпидемиологии : Тезисы  IX съезда ВНПОЭМП.- Москва,  26-27 апреля.- Т.1 - 2007г.-  С. 194.-195.
  22. Анганова Е.В. Антибиотикорезистентность  бактерий  микробиоценоза реки Лены /  Е.В. Анганова, Л.М. Мамонтова, А.П. Протодьяконов // Тезисы  IX съезда ВНПОЭМП.- Москва,  26-27 апреля 2007г.- Т.2.- 2007.- С. 204.
  23. Анганова Е.В.  Особенности  микробиологического мониторинга водных экосистем / Е.В. Анганова, В.А. Астафьев, Л.М. Мамонтова, Е.Д. Савилов // Микроорганизмы в экосистемах озер, рек, водохранилищ : Материалы 2-го Байкальского  Микробиологического симпозиума с  междунар. участием 10-15 сент. 2007г.- Иркутск: Из-во ин-та географии им. В.Б. Сочавы СО РАМН.- 2007.-С.7.
  24. Анганова Е.В.  Характеристика  микробного сообщества реки Лены / Е.В. Анганова, Е.В. Рычкова // Микроорганизмы в экосистемах озер, рек, водохранилищ : Материалы 2-го Байкальского  Микробиологического симпозиума с  междунар. участием 10-15 сент. 2007г.- Иркутск: Из-во ин-та географии им. В.Б. Сочавы СО РАМН.- 2007.-С.9.
  25. Анганова Е.В.  Особенности антибиотикоустойчивости  бактерий микробиоценоза реки Вилюй / Е.В. Анганова,  Е.Н. Рычкова, Е.Д. Савилов //  Бюл. ВСНЦ СО РАМН .- 2007.- № 2 (54). -С.72-74.
  26. Техногенное загрязнение окружающей среды и инфекционная патология  (клинико-эпидемиологические обобщения): пособие для врачей /Е.Д. Савилов,  С.В. Ильина, Е.В. Анганова и др.- Иркутск: РИО ИГУУВа, 2008.- 28с.
  27. Савилов Е.Д. Биологическое загрязнение поверхностных водоемов Восточной Сибири и Севера / Е.Д. Савилов, Е.В. Анганова,  М.Ф. Савченков, В.А. Астафьев, Л.М. Мамонтова // Гигиена и санитария.- 2008.-  №3.- С. 16-18.
  28. Анганова Е.В.  Антибиотикорезистентность бактерий  микробиоценозов водных объектов  как показатель антропотехногенной нагрузки  на водоем (на примере реки Лены) / Е.В. Анганова,  А.Д. Курносов, И.Ю. Самойлова, Е.Д. Савилов // Сибирский мед. журн.- 2008.- №1.- С. 75-77.
  29. Анганова Е.В.  Клинико-эпидемиологическая характеристика  острых кишечных инфекций, вызванных условно-патогенными микроорганизмами /  Е.В. Анганова, Е.Д.  Савилов //  Вестник  рос.  военно-мед. академ. : Материалы  Всерос. науч. конф. Санкт-Петербург, 17-18 апреля 2008г.- С. 528-529.
  30. Условно-патогенные микроорганизмы в водных экосистемах Восточной Сибири  и их роль в оценке качества вод / Е.Д. Савилов,  Л. М. Мамонтова, Е.В. Анганова, В.А. Астафьев // Бюлл. СО РАМН.-2008.- №1 (129).- С.47-51.
  31. Анганова Е.В. Острые кишечные инфекции у  детей на фоне  выделения  условно-патогенных микроорганизмов / Е.В. Анганова //  Казанский мед. журн.- 2009.-№1,т.90.-с.111-112. 
  32. Самойлова И.Ю.  Таксономическая характеристика  микробиоценоза реки Лены  в районе г. Якутска,  Хангаласского и Намского районов (республика Саха (Якутия) / И.Ю. Самойлова, Е.В. Анганова,  Е.Д. Савилов//  Сибирский мед. журн.- 2009.-№7 (ч.2).- С.192-194.
  33. Анганова Е.В. Антибиотикоустойчивость бактерий  микробиоценоза реки Лены в районе г. Якутска, Хангалассокго и Намского районов (республика Саха (Якутия) / Е.В. Анганова, И.Ю. Самойлова // Сибирский мед. журн.-  2009.-№7 (ч.2).- С. 211-212.
  34. Духанина А.В.  Особенности микробиологического пейзажа некоторых биотопов  у больных острыми кишечными инфекциями установленной этиологии /  А.В. Духанина, Е.В. Анганова // Сибирский мед. журн.-  2009.-№7 (ч.2).- С. 209-210.
  35. Анганова Е.В.  Условно-патогенные микроорганизмы в  микробном сообществе реки Лены / Е.В. Анганова, Е.Д. Савилов, А.В. Духанина, Н.В. Ермолаева // Экология:  Материалы I Междунар.  научн.-практ. конф. «Экология. Здоровье. Спорт». 16-17 декабря 2009г. - Чита. – С. 286-289.
  36. Анганова Е.В.  Микробиологический мониторинг  водных экосистем / Е.В. Анганова, Е.Д. Савилов //  Методологические проблемы изучения, оценки и регламентирования  биологических факторов в гигиене окружающей среды : Сб. материалов  Пленума  научного совета по экологии человека и гигиене окружающей среды РАМН и  Минздравсоцразвития РФ 16-17 дек.  2009г.- М., 2009.- С. 38-39.
  37. Микробиологический мониторинг водных экосистем: пособие для врачей / Савилов Е.Д., Анганова Е.В., Кичигина Е.В., Астафьев В.А., Духанина А.В.  Иркутск: РИО ИГИУВа, 2009.-28с.
  38. Проявление инфекционной патологии  в условиях техногенного загрязнения окружающей среды:  учебное пособие для  системы послевузовского профессионального образования врачей, утв.  УМО по медицинскому  и фармацевтическому образованию вузов России / Е.Д. Савилов, Е.В. Анганова, С.В. Ильина, В.А. Астафьев,  Л.А. Степаненко, С.Н. Жданова.- Иркутск: РИО ГИУВа,  2010.- 52с.
  39. Сборник стандартных операционных процедур при серологической диагностике кишечных инфекций: пособие для врачей / С.А.Верещагина, Т.С. Белохвостикова,  М.В.Пешкова,  И.Д. Митрохович,  Е.В. Анганова, Е.Л. Кичигина. Иркутск:  РИО  ИГИУВа, 2010.-24с.
  40. Характеристика  условно-патогенных возбудителей  острых кишечных инфекций /  Е.В. Анганова, Н.Н. Чемезова,  Н.В. Ермолаева,  Л.А. Распопина //  Журн. инфекционной патологии.-2010.- Т.17.-№1-2. – С. 12-13.
  41. Клинико-эпидемиологические особенности  острых кишечных инфекций у детей Иркутской области / Е.В. Анганова,  А.В. Духанина,  Н.В. Ермолаева,  Н.Н. Чемезова // Журн. инфекционной патологии : Материалы науч.конф. с междунар. участием «Этиологические, эпидемиологические и клинические аспекты инфекционных болезней».- .Иркутск. ИГМУ. 15-17 сент. 2010.- Т.17.- №3.- С.18-19.
  42. Анганова Е.В. Клинико-эпидемиологические особенности  острых кишечных инфекций, вызванных условно-патогенными микроорганизмами, у детей г. Иркутска / Е.В. Анганова // Якутский мед. журн.- 2010.- №1(29).- С. 66-68.
  43. Ферментативная активность  бактерий водных экосистем / Е.В. Анганова, А.В. Духанина, Н.Н. Чемезова, Н.В. Ермолаева / Проблемы экологии : Тезисы Междунар.  научн. конф., Иркутск,  20-25 сентября 2010г.  ИГУ. НИИ биологии.- 2010. -С. 373.
  44. Изменение активности  экзоферментов бактерий  рода Enterobacter в зависимости от источника  выделения  и условий культивирования/ Ю. А. Маркова, Л.А. Беловежец, Е.В. Анганова, А.В. Духанина, Е.Д. Савилов / Проблемы экологии : Тезисы Междунар.  науч. конф., Иркутск,  20-25 сент. 2010г.  ИГУ. НИИ биологии.- 2010. -С.353.
  45. Антибиотикоустойчивость микроорганизмов озера Байкал  как индикатор антропогенного влияния /  Е.В. Верхозина,  В.А. Верхозина,  Е.Д. Савилов, Е.В. Анганова // Проблемы экологии : Тезисы Междунар.  науч. конф..- Иркутск,  20-25 сент. 2010г.  ИГУ. НИИ биологии.- 2010. -С. 391.
  46. Антилизоцимная активность  бактерий водных экосистем /  Е.В. Анганова, А.В. Духанина,  Н.В. Ермолаева,  Н.Н. Чемезова //  Сибирский мед. журн. -2010.-№6.-С. 193-194.
  47. Анганова Е.В. Биологические свойства  условно-патогенных бактерий  водных экосистем / Е.В. Анганова //  Гигиена и санитария. -2010.- №5. С.  67-68.
  48. Савилов Е.Д. Микробиологический мониторинг водных экосистем /  Е.Д. Савилов, Е.В. Анганова // Гигиена и санитария. -2010.- №5. С.  56-58.
  49. Анганова Е.В. Эшерихиозы  в Иркутской области / Е.В.Анганова, Л.А. Распопина // Журн. инфекционной патологии.-2010.-Т.17, №4.-С. 27-28.
  50. Адаптационный потенциал  бактерий рода  Shigella к разным условиям культивирования / Л.А. Беловежец, Ю.А. Маркова, Е.В. Анганова, А.В. Духанина, Е.Д. Савилов // Журн. инфекционной патологии.-2010.Т.17, №4.-С. 29-30.
  51. Савилов Е.Д. Биологические свойства возбудителей острых  кишечных инфекций/ Савилов Е.Д., Ильина С.В., Анганова Е.В. // Инфекционная патология  в условиях техногенного загрязнения окружающей среды: клинико-эпид. исследования.-Новосибирск: Наука, 2010. С.121-127.
  52. Анганова Е.В. Характеристика  микробного сообщества реки Ангары (Иркутская область) / Е.В. Анганова, А.В. Духанина, Е.Д. Савилов// Проблемы здоровья и экологии.- 2011.-№2(28).-С.129-132.
  53. Анализ заболеваемости острыми кишечными инфекциями  населения Иркутской области / Анганова Е.В.,  Духанина А.В.,  Кичигина Е.Л.  //Сибирский мед. журн.-2011.-№6.-С. 230-232.
  54. Анганова Е.В. Оценка эпидемиологической ситуации по острым кишечным инфекциям в Иркутской области / Е.В. Анганова //  Бюлл. «Здоровье населения и среда обитания».- 2011.-№8.-С.19-22.
  55. Эпидемиологические особенности острых кишечных инфекций, обусловленных условно-патогенными микроорганизмами (база данных): рег.номер 2011620192 (11.03.2011) / Е.В. Анганова, А.В. Духанина, Н.В. Ермолаева // ОБПБТ.- 2011.- №2(75).- С.684.
  56. Выявление  антибиотикоустойчивых микроорганизмов  в экстремальных  местообитаниях  экосистемы оз. Байкал /Е.В. Верхозина,  В.А. Верхозина,  Е.Д. Савилов,  Е.В. Анганова: Материалы. Междунар. конф.  «Экология и геохимическая деятельность  микроорганизмов экстремальных местообитаний» 5-16 сент. 2011г.  г. Улан-Удэ (Россия) и Улан -Батор (Монголия).-2011.-С.46-47.
  57. Эколого-эпидемиологическая оценка  биологического загрязнения  водных экосистем Сибири / Савилов Е.Д., Астафьев В.А.,  Савченков М.Ф., Анганова Е.В. //Материалы Всерос. науч-практ. конф. с междунар. участием «Окружающая среда и здоровье населения» 5-7  окт.  2011.- Иркутск: НЦРВХ СО РАМН- 2011.-С.71-77.
  58. Анганова Е.В. Бактерии  рода Klebsiella  в этиологической структуре бактериальных ОКИ, оценка их патогенности на уровне фено- и генотипа /Е.В. Анганова,  А.В. Духанина, Е.Д. Савилов // Эпидемиология и вакцинопрофилактика.-2011.-№6(61).-С.62-65.

  Список сокращений

АМП-антимикробные препараты

АЛА – антилизоцимная активность

ИАР – индекс антибиотикорезистентности

ИЭС- индекс эпидемиологической ситуации

ГА- гемолитическая активность

КОЕ – колониеобразующие единицы

ОКИ - острые кишечные инфекции

ОКИУЭ - острые кишечные инфекции установленной этиологии

ПА – протеолитическая активность

УПМ – условно-патогенные микроорганизмы

УПЭ –условно-патогенные энтеробактерии

 



© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.