WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Бажан Сергей Иванович

ТЕОРЕТИЧЕСКОЕ ИССЛЕДОВАНИЕ МЕХАНИЗМОВ ПРОТИВОВИРУСНОГО ИММУНИТЕТА

03.00.03 - молекулярная биология

Автореферат диссертации на соискание ученой степени доктора биологических наук

Кольцово - 2008

Работа выполнена в ФГУН Государственный научный центр вирусологии и биотехнологии «Вектор» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека Минздравсоцразвития России.

Официальные оппоненты:

доктор биологических наук, профессор, член-корр. РАЕН В.Б. Локтев доктор медицинских наук, профессор, член-корр. РАМН М.И. Воевода доктор биологических наук, профессор Е.Я. Фрисман Ведущая организация Институт цитологии и генетики СОРАН, г. Новосибирск

Защита состоится «3» октября 2008 года в __ часов на заседании диссертационного совета Д.208.020.01 при Государственном научном центре вирусологии и биотехнологии «Вектор» по адресу: ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора, Кольцово Новосибирской области, 630559, тел.(383)336-74-28.

С диссертацией можно ознакомиться в библиотеке ГНЦ ВБ «Вектор».

Автореферат разослан « ___ » 2008 года

Ученый секретарь диссертационного совета Л.И. Карпенко Посвящается памяти Л.С. Сандахчиева, внесшего неоценимый вклад в развитие и выполнение данной работы

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность исследования Взаимодействие вируса и хозяина является сложным процессом, в который, так или иначе, вовлекаются практически все системы организма, хотя их роль в инфекционном процессе неравноценна. Современный уровень знаний позволяет говорить о том, что ведущую роль в защите организма от вирусов играет иммунная система. Эффективность индукции и динамика иммунного ответа во многом определяют развитие и исход заболевания.

В этой связи крайне актуальной задачей является поиск и оптимизация применения иммунокоррегирующих и вакцинных препаратов с лечебной и профилактической целями.

Очевидно, что в процессе решения этой задачи важно иметь хорошую математическую модель или экспертную систему, которая позволяла бы быстро оценивать воздействие иммуномодуляторов, оптимизировать их дозу и схему применения в зависимости от характера развития инфекционного процесса. Считается, что в основе эффективно работающей экспертной системы могут лежать методы системной биологии, в том числе методы математического моделирования инфекционного процесса и системы иммунитета, а также методы проектирования противовирусных препаратов и вакцин.

Учитывая сложность системы взаимодействия «вирус + хозяин», предсказание развития инфекции в зависимости от влияния той или иной динамической характеристики вируса, реакции иммунной системы или состояния неспецифических механизмов защиты представляется возможным только при наличии адекватной (имитационной) динамической модели, удовлетворительно описывающей поведение вируса в организме. Поэтому для решения как фундаментальных, так и прикладных задач в различных областях биологии и медицины, чрезвычайно актуальной задачей является создание имитационных математических моделей целевых биологических систем «вирус + хозяин».

В данной работе технология математического моделирования использовалась для анализа механизмов противовирусного иммунитета при инфекциях, вызывающих социально значимые заболевания, среди которых особую роль занимают вирус гриппа (ВГ) и вирус иммунодефицита I типа (ВИЧ-1), обладающие высокой антигенной изменчивостью.

В силу очень высокой изменчивости вируса гриппа, защитные барьеры организма не всегда справляются с данной инфекцией, поэтому вирус периодически вызывает эпидемии и пандемии и может приводить к высокому уровню летальных исходов. В последнее время интерес к исследованию ВГ значительно возрос в связи с возникновением нового высоко патогенного штамма H5N1 вируса гриппа птиц и опасностью его перехода в популяцию людей [Claas et al., 1998]. Среди выявленных случаев заражения человека этим вирусом смертность составила более 50% (http://www.who.int/csr/disease/avian_influenza/en/). Постоянная угроза возникновения новых, высоко патогенных для человека штаммов ВГ требует разработки новых нетрадиционных методов лечения. Математическое моделирование жизненного цикла вируса гриппа в инфицированной клетке дает основу для исследования закономерностей его размножения и поиска таких методов лечения.

Одним из важных факторов неспецифического противовирусного иммунитета является интерферон (IFN). Развитие и результат инфекции предопределяются эффективностью индукции интерферона, а также его антивирусной и иммуномодулирующей активностями. Исследование молекулярных механизмов индукции и антивирусного действия интерферона представляется актуальным для лучшего понимания регуляции и функционирования системы интерферона. От этого зависит успешное использование интерферона и его индукторов в качестве лечебнопрофилактических препаратов при вирусных инфекциях и некоторых других патологических состояниях. Сложная сеть взаимоотношений в системе вирусинтерферон в определенных ситуациях делает трудным прямой экспериментальный анализ вклада индивидуальных механизмов в регуляцию системы. В связи с этим актуальным становится проведение теоретического анализа закономерностей индукции и действия интерферона и использование для этих целей технологии математического моделирования с прогнозирующими возможностями компьютерного эксперимента.

ВИЧ-1 является этиологическим возбудителем синдрома приобретенного иммунодефицита (СПИД). После открытия в 1983 году ВИЧ-1 это заболевание продолжает распространяться по всему миру, охватывая как развитые, так и в развивающиеся страны.

Важным фактором специфической защиты организма от вирусов является индуцируемый вакциной противовирусный иммунитет. Однако в случае ВИЧ-инфекции известные стратегии создания вакцины, основанные на использовании различных форм вирусного антигена, оказались неэффективными. Разработка безопасной и эффективной анти-ВИЧ/СПИД вакцины затруднена из-за наличия ряда факторов, среди которых высокая генетическая вариабельность ВИЧ-1, недостаток знаний иммунных механизмов защиты, отсутствие адекватных и предсказуемых моделей и сложность проведения эффективных испытаний, особенно в развивающихся странах. Кроме того, неудачи сначала вакцины VaxGen (октябрь 2003 г.), а затем вакцины MRKAd5 HIV-1 gag/pol/nef (октябрь 2007 г.) еще более осложнили ситуацию с разработкой вакцины против ВИЧ-1.

Необходимо преодолевать существующие проблемы и создавать вакцину, способную индуцировать как Т-, так и В-клеточный ответы против широкого спектра изолятов ВИЧ-1. При этом необходимо основной упор делать на разработку новых технологий, концепций и подходов к созданию безопасных и эффективных вакцин против ВИЧ/СПИД, учитывая особенности иммунитета и патогенеза ВИЧ-1.

В связи с этим особенно актуальными становятся работы по рациональному дизайну вакцин с применением методов биоинформатики, системной биологии и математического моделирования.

Цели и задачи исследования Целью данной работы явилось проведение комплексного теоретического исследования специфических и неспецифических механизмов противовирусного иммунитета с использованием методов системной биологии. Для достижения этой цели решались следующие задачи.

1. Изучение закономерностей функционирования сложных биологических систем с использованием технологии математического моделирования путем анализа альтернативных механизмов регуляции этих систем и интерпретации полученных результатов;

2. Построение математической модели, позволяющей анализировать ключевые звенья в регуляции основных стадий внутриклеточного размножения вируса гриппа, которые являются потенциальными мишенями для действия противовирусных препаратов.

3. Построение математической модели, позволяющей анализировать ключевые звенья регуляции и функционирования интерфероновой системы;

4. Построение математической модели регуляции иммунного ответа при вирусной инфекции для выявления потенциальных мишеней для действия противовирусных препаратов, а также для анализа эффективности применения вакцин при иммунизации против ВИЧ-1;

5. Разработка новых подходов к созданию эффективных и безопасных вакцин против ВИЧ-1, индуцирующих высокие уровни ответов цитотоксических Т-лимфоцитов (CD8+ CTL или ЦТЛ), на основе оптимизации экспрессии, процессинга и представления иммунной системе целевого иммуногена;

6. Дизайн и конструирование новых искусственных поли-CTL-эпитопных иммуногенов – кандидатов для использования в качестве эффективной и безопасной ДНК-вакцины против ВИЧ-1.

Научная новизна и практическая значимость работы В данной работе впервые проведено комплексное теоретическое исследование механизмов противовирусной резистентности с использованием системного подхода и комплекса имитационных математических моделей, описывающих процессы регуляции инфекционного процесса и системы противовирусного иммунитета на молекулярногенетическом, клеточном и организменном уровнях. Численное исследование моделей позволило получить ряд новых знаний об особенностях регуляции инфекционного процесса и системы противовирусного иммунитета при инфекциях, вызываемых вирусом гриппа и ВИЧ-1.

Обоснованы наиболее принципиальные механизмы регуляции селективной экспрессии генов ВГ в течение его внутриклеточного размножения.

Впервые проведено комплексное исследование закономерностей регуляции экспрессии и противовирусного действия интерферона с помощью набора математических моделей, описывающих процессы регуляции различных звеньев системы интерферона на молекулярно-генетическом и клеточном уровнях. Сделан ряд заключений о ключевых механизмах индукции и действия интерферона.

С помощью математической модели регуляции иммунного ответа при ВИЧинфекции показано, что проблемы создания вакцины против ВИЧ-1 могут быть обусловлены не столько высокой изменчивостью ВИЧ-1, сколько его иммунопатогенными свойствами. Фактически полученные в рамках модели результаты указывают на то, что рациональный дизайн вакцин должен учитывать как механизмы иммунитета, так и механизмы иммунопатогенеза ВИЧ-инфекции.

Разработан новый подход к созданию эффективных и безопасных вакцин против ВИЧ-1 для индукции высоких уровней ответов CD8+ CTL на основе оптимизации экспрессии, процессинга и представления иммунной системе целевого иммуногена.

Эффективность подхода подтверждена экспериментально. Полученные данные вносят вклад в рациональное проектирование вакцин, способных индуцировать стабильно высокие уровни ответов CD8+ CTL на все включенные детерминанты.

Сконструированный в данной работе полиэпитопный Т-клеточный иммуноген TCI является ДНК-вакцинным компонентом двух созданных во ФГУН ГНЦ ВБ «Вектор» кандидатных вакцин против ВИЧ/СПИД «Сал-ВИЧ Д» и «КомбиВИЧвак». В настоящее время проведены доклинические испытания кандидатных вакцин «КомбиВИЧвак» и «Сал-ВИЧ Д». Показано, что обе вакцины индуцируют формирование ВИЧспецифического гуморального и клеточного ответов и не оказывают негативного воздействия на функцию основных физиологических систем организма. Полученные при иммунизации животных сыворотки обладали вируснейтрализующей активностью in vitro.

Положения, выносимые на защиту Предметом защиты настоящей диссертации является комлекс математических моделей, описывающих процессы регуляции инфекционного процесса и системы противовирусного иммунитета на молекулярно-генетическом, клеточном и организменном уровнях, а также искусственные полиэпитопные иммуногены – кандидаты для использования в качестве ДНК-вакцины против ВИЧ-1.

Используя технологию математического моделирования, в работе получен ряд новых результатов, которые обосновывают следующие положения.

- Ранняя амплификация фрагментов генома вируса гриппа, кодирующих нуклеопротеин и неструктурный белок NS1, связана с действием белка NS1, а поздняя амплификация фрагментов, кодирующих гемагглютинин, нейраминидазу и матриксный белок, обусловлена действием белка NS2;

- В основе индукции экспрессии гена интерферона лежит антирепрессорная модель, согласно которой лимитирующей стадией индукции промотора интерферона является удаление конститутивных репрессоров;

- Интерферон и вирус вызывают синергическое повышение регуляции экспрессии белка Мх1, что является важным фактором противовирусной резистентности.

- Рациональный дизайн вакцин должен учитывать как механизмы иммунитета, так и механизмы иммунопатогенеза ВИЧ-инфекции, поскольку проблемы создания вакцины против ВИЧ-1 обусловлены как высокой изменчивостью ВИЧ-1, так и его иммунопатагенными свойствами.

- Обеспечение высоких уровней CD8+ CTL ответов можно достигнуть путем оптимизации основных стадий процессинга целевого поли-CTL-эпитопного иммуногена и представления полученных эпитопов иммунной системе.

Апробация работы и публикации Основные результаты работы были представлены на следующих научных конференциях: Международном симпозиуме "HIV Vaccines: Progress and Prospects" (Банфф, Канада, 2008); Международном рабочем совещании "Статус исследования вакцин против ВИЧ\СПИД: перспективы и потенциал развития ВИЧ вакцины" (СанктПетербург, 2007); Международной конференции "Basic Science for Biotechnology and Medicine" (Новосибирск, 2006); 3-й и 5-й Международной конференции "Bioinformatics of Genome Regulation and Structure" (Новосибирск, 2002, 2006); XVI Международной конференции по СПИД (Торонто, Канада, 2006); Международной конференции " Biotechnology and Medicine " (Москва, 2006); Первом Российско-Немецком рабочем совещании "Infection and Immunity. Tools and Strategies for Novel Vaccines" (Берлин, Германия, 2005); Международной конференции “New Approaches to Vaccine Development – From the bench to the field” (Берлин, Германия, 2005); Международной конференции "Развитие международного сотрудничества в области изучения инфекционных заболеваний" (Новосибирская область, 2004); Международной конференции "International Informatics and Biotechnology Convergence" (Лондон, Англия, 2004); 11-й и 13-й Межународном симпозиуме "HIV and Emerging Infection Diseases" (Тулон, Франция, 2001, 2004); Х Юбилейном Российском национальном конгрессе "Человек и лекарство" (Москва, 2003); 7-й, 8-й и 10-й Международной конференции "СПИД, РАК И РОДСТВЕННЫЕ ПРОБЛЕМЫ" (Санкт Петербург, 1998, 2000, 2002); Международной конференции "DNA vaccines" (Эдинбург, Шотландия, 2002); Английско-Российском семинаре по биотехнологии "Policy Issues, International Partnerships & Commertial Opportunitis” (Эдинбург, Шотландия, 2001); Международной конференции "The Increasing Threat of Infectious Diseases’01" (Стокгольм, Швеция, 2001); 5-й Международной конференции по молекулярной биологии (Москва, 2001); IV Семинаре Научного совета МНТЦ по фундаментальным наукам (Новосибирск, 2001);

Международной конференции "Оценка спонсируемых биологических исследований в России в новом тысячелетии" (Новосибирск, ГНЦ ВБ "Вектор", 1999.); Ежегодной конференции ISICR (International Society for Interferon & Cytokine Research) (Балтимор, США, 1995. Первой, Второй и Третьей Всесоюзных конференциях "Геном человека" (Москва, 1990, 1991 и 1993);

Благодарности Работа выполнена в 1991-2007 годах в ФГУН ГНЦ ВБ "Вектор" Роспотребнадзора в рамках научных тем организации и по грантам государственных научно-технических программ: "Исследования и разработки по приоритетным направлениям развития науки и техники, подраздел: Защита от патогенов", по Федеральной Государственной программе "Вакцины нового поколения и диагностические системы будущего", по проекту МНТЦ №2153р "Дизайн, конструирование и биологическое тестирование ДНКвакцины против ВИЧ-1, кодирующей множественные CTL-эпитопы ВИЧ-1". На разных этапах выполнения работы в ней приняли участие В.А. Лихошвай, В.В. Чуйков, О.Е. Белова, П.А. Белавин, у которых автор являлся научным руководителем диссертационных работ, а также А.М. Ерошкин, С.В. Серегин, Н.К. Данилюк, И.Н. Бабкина, Л.И. Карпенко, Р.В. Ужаченко, Т.Н. Ильичева, А.А. Ильичев, Г.М. Игнатьев, В.А. Иванисенко, Е.А. Ананько, Т.М. Хлебодарова, Н.А. Кашеварова – автор приносит им искреннюю благодарность.

Публикации По материалам диссертации опубликовано 34 статьи, получено 3 патента Российской Федерации.

Структура и объем работы Диссертация построена по монографическому типу и состоит из введения, четырех глав, выводов, списка цитируемой литературы (427 ссылок) и двух приложений. Каждая глава содержит обзор литературы, основные результаты и заключение, посвященные теме исследования данной главы. Работа изложена на 317 страницах, включая рисунка и 28 таблиц. Нумерация рисунков, таблиц и формул приводится отдельно для каждой главы.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

Глава 1. МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ ВНУТРИКЛЕТОЧНОГО РАЗМНОЖЕНИЯ ВИРУСА ГРИППА 1.1. Концептуальная модель регуляции внутриклеточного онтогенеза вируса гриппа Схема регуляции внутриклеточного онтогенеза вируса гриппа представлена на рис. 1. Вирус гриппа (ВГ) имеет негативный геном, состоящий из восьми фрагментов одноцепочечной вирионной РНК (вРНК). Первые три фрагмента кодируют белки полимеразного комплекса (pB2, pB1 и pA), четвертый – гемагглютинин (HA), пятый – нуклеопротеин (NP), шестой – нейраминидазу (NA), седьмой – матриксный белок (M1) и неструктурный белок (M2), восьмой кодирует два неструктурных белка (NS1) и (NS2) [Desselberger., Palese, 1978]. Второй фрагмент PB1 кодирует еще один белок PB1-F2, который образуется в результате альтернативного сплайсинга мРНК и вызывает апоптоз через нарушение структуры митохондрий [Henklein et al., 2005]. В составе вириона все фрагменты вРНК находятся в виде рибонуклеопротеида (вРНП), который состоит из вРНК ассоциированной с белком NP и вирионой РНК-полимеразой, состоящей из трех Р-белков: РВ1, РВ2 и РА [Noda et al., 2006]. Проникновение ВГ в клетку происходит путем эндоцитоза вирионов с последующим переносом всех восьми фрагментов вРНП сначала в цитоплазму [Deng et al., 2005], а затем в ядро инфицированной клетки [Lakadamyali et al., 2004; O’Neill et al., 1995]. В целом в одиночном цикле развития ВГ можно выделить следующие этапы, которые были учтены при построении математической модели.

Первичная транскрипция. После проникновения в ядро фрагментов вРНП вирионассоциированная РНК-полимеразы осуществляет транскрипцию всех фрагментов родительского генома. Образующиеся при этом мРНК синтезируются примерно в эквимолярных количествах. В этом процессе участвует белки вируса РВ1 и РВ2 и клеточная мРНК [Cros, Palese, 2003]. Белок РВ2 связывает кэп-структуру клеточной мРНК и отщепляет фрагмент кэпированной РНК длиной 10-13 нуклеотидов, который служит затравкой инициации синтеза вирусной мРНК [Mikulasova et al., 2000; Plotch et al., 1981; Shi et al., 1995]. Белок РВ1 ответственен за осуществление элонгации новой цепи.

Синтез кРНК. Согласно модели синтез кРНК и образование кРНП происходят в ядре с участием двух вирусных белков PB1 и NP [Nakagawa et al., 1996].

Синтез вРНК (репликация). Образовавшиеся в ядре фрагменты кРНП используются в качестве матриц для синтеза вРНК, который осуществляется полимеразой, содержащей белок РА [Nakagawa et al., 1996].

Сплайсинг. Сплайсингу подвергаются мРНК седьмого и восьмого фрагментов. В результате образуется мРНК кодирующие неструктурные белки M2 и NS2 [Valcarcel et al., 1991; Alonso-Caplen, Krug, 1991]. В модели сплайсинг описан только для мРНК восьмого фрагмента.

Белк NSТрансляция Транспорт мРНК через ядерную M2 NSмембрану Сплайсин мРНК (PB1+PB2+P Первичная транскрипция PB2 PB1 PA HA NP NA M1 NSИнфицирование клетки вРНП Синтез кРНК и (PB1+PB2+N Формирование кРНП кРНП (PB1+PB2+NS1) (PB1+PB2+NS2) NP NSHA NA MвРНК Формирование Ранняя Поздняя вРНП вторичная вторичная транскрипция транскрипция мРНК Транспорт (экспорт) Транспорт мРНК Транспорт мРНК вРНП цитоплазму через ядерную через ядерную NS2 (nuclear export мембрану мембрану protein, NEP) Трансляция Трансляция PB2 PB1 PA HA NP NA Белки Сборка и почкование вирионов Рис. 1. Схема регуляции внутриклеточного размножения вируса гриппа (Пояснения в тексте) Упаковка вРНК и вторичная транскрипция. Вновь синтезированные вРНК участвуют в двух процессах: 1) упаковываются белком NP, образуя фрагменты рибонуклеопротеина, и транспортируются в цитоплазму, где впоследствии включаются в дочерние вирионы (стадия сборки) и 2) служат матрицами для синтеза вирусной мРНК на стадии вторичной транскрипции. Экспорт фрагментов рибонуклеопротеина из ядра в цитоплазму зависит от функции белка NS2 (другое название – ядерный экспортный белок – nuclear export protein, NEP) [O'Neill et al., 1998]. Экспортная функция белка NS2/NEP учитывается в предложенной модели.

Трансляция. После первичной и вторичной транскрипции вирусная мРНК выходит из ядра в цитоплазму [Fechter, Brownlee, 2005], где при участии клеточных рибосом происходит ее трансляция в вирусные белки. Скорость инициации трансляции зависит от NS1 белка [de la Luna et al., 2995]. Вновь синтезированные вирусные белки РB1, РB2, PA, NS1 и NP транспортируются в ядро [Smith et al., 1987; Jones et al., 1986; Melen et al., 2003], белки НА, NA и М2 остаются в цитоплазме и мигрируют к клеточной поверхности, а белки NS2 и М1 распределяются по всей клетке, причем NSнакапливается в основном в ядре [de la Luna et al., 2995].

Сборка вирионов. В процессе упаковки вируса важную роль играет взаимодействие вРНП, М1 и NA, а также и цитоплазматические хвосты HA и NA [Zhang et al., 2000].

Показана роль цитоплазматического хвоста М2 в координированной упаковке геномных фрагментов и формировании инфекционных вирусных частиц [McCown, Pekosz, 2005;

McCown, Pekosz, 2006]. Однако эта функция белка М2 в данной версии модели не учитывалась.

Клетка. В процессе внутриклеточного размножения ВГ использует клеточные ресурсы, такие как рибосомы (для синтеза белка), пул клеточных мРНК (для кэпирования вирусных мРНК) и клеточную мембрану (для почкования вируса), которые лимитируют процессы транскрипции, трансляции и репликации вируса. Поэтому математическая модель одноклеточного цикла ВГ содержит два блока. Первый блок модели («клетка») описывает в упрощенном виде динамику клеточных компонентов, включая синтез ядерной фракции суммарной РНК клетки, трансляцию суммарного пула клеточных белков, рециклизацию поверхностной мембраны, которые лимитируют размножение ВГ на разных стадиях его развития. Второй блок модели («вирус») описывает основные этапы размножения вируса гриппа в клетке, которые были рассмотрены выше.

1.2. Математическая модель регуляции внутриклеточного онтогенеза вируса гриппа Для моделирования внутриклеточного размножения вируса гриппа применялся обобщенный химико-кинетический метод моделирования, разработанный В.А. Лихошваем [Likhoshvai et al., 2000]. В рамках данного метода модель «вирус+клетка» описана как совокупность элементарных подсистем. Каждая подсистема описана некоторым набором формальных процессов (блоков), представленных в таблице 1. Построение модели проводится на основе правила суммирования локальных скоростей [Likhoshvai et al., 2000]. Согласно данному правилу полная скорость изменения концентрации каждого вещества является суммой скоростей изменения концентраций данного вещества по всем элементарным процессам, входящих в модель.

1.3. Динамика изменения основных компонентов модели в течение внутриклеточного онтогенеза вируса гриппа Верификацию модели проводили с учетом имеющихся экспериментальных данных, позволяющих качественно реконструировать динамику основных переменных модели.

Результаты реконструирования для четырех переменных модели, включая (А) динамику проникновения вирионной РНК в клетку, (Б) наработку кРНК, (В) наработку клеточных мембран, ассоциированных с вирусными белками HA, NA и M (SURFASE) и (Г) динамику дочерних вирусных частиц, представлены на рис. 2.

Таблица Формальные процессы, использованные при моделировании размножения ВГ в клетке № Структурное Дифференциальная Примечание п/п обозначение система k dx 1 Реакция конститутивного y = k синтеза/поступления dt dx dy1 dyn 2 Мономолекулярная x k y1 +... + yn - = =... = = kx реакция dt dt dt k1,kdx1 dx2 dy 3 Бимолекулярная реакция = = - = k2 y - k1x1xx1 + x2 y dt dt dt ko,KM 4 Обобщенная симметричная a1 x1 +...+ an xn Z = k0 n ( ) ( ) схема Михаэлиса-Ментен, b1 y1 +...+ bm ym 1+ KM -( ) ( ) где ai иbi являются xi i= стехиометрическими dxi dyi = -aiZ, = biZ коэффициентами dt dt Полученные динамические кривые в целом удовлетворительно описывают имеющиеся экспериментальные данные, согласно которым (А) 85% вирусных частиц обнаруживается в клетке через 30 мин после заражения [Lakadamyali et al., 2004]; (Б) динамика репликации кРНК нелинейно нарастает во временном промежутке 90-120 мин и достигает максимума через 3 час после заражения [Варич и др., 1988], причем фрагменты кРНК нарабатываются приблизительно в эквимолярных концентрациях [Shapiro et al.,1987; Baccam et al., 2006]; (В) уровень наработки вирусных белков HA, NA и M1, ассоциированных с клеточной мембраной (SURFASE) и готовых для упаковки вирусных частиц, эквивалентен образованию ~600-1000 единиц мембраны, что также соответствует имеющимся экспериментальным данным [Horsfal, 1955]; (Г) основная часть вирусных частиц нарабатывается не ранее, чем через 4 часа после заражения, так как до этого времени отсутствует белок NS2 [Krug, 1971], который необходим для экспорта вРНП из ядра в цитоплазму [Alonso-Caplen, Krug,1991] и формирования инфекционных частиц [Baccam et al., 2006].

А Б 2110 0 1 2 3 4 5 6 7 8 0 1 2 3 4 5 6 7 время (ч) время (ч) В Г 6105846342210 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 время (ч) время (ч) Рис. 2. Результаты расчета модели, описывающие (А) динамику проникновения вирионной РНК в клетку, (Б) наработку кРНК, где 1 – кРНК Pol, NP, HA, NA, M и 2 – кРНК NS, (В) наработку клеточных мембран, ассоциированных с вирусными белками HA, NA и M (SURFASE) и (Г) динамику образования дочерних вирусных частиц.

(МИ=45 вирусных частиц на клетку).

Ключевые моменты регуляции внутриклеточного онтогенеза ВГ связаны с синтезом вирус специфических РНК. Динамические характеристики внутриклеточного размножения ВГ показывают, что синтез трех типов вирусных РНК имеет ряд четких различий. Показано, что транскрипция мРНК осуществляется в три стадии [Inglis, Mahy, 1979; Mahy et al., 1980]. На стадии первичной транскрипции вирион ассоциированная РНК-полимераза осуществляет синтез мРНК всех фрагментов примерно с одинаковой вРНК (мол./кл.) кРНК (мол./кл.) SURFACE вир.част./кл.

интенсивностью [Skehel, Hay,1978]. Фаза ранней вторичной транскрипции начинается через 2 часа после заражения [Lee, Seong, 1998] и характеризуется увеличением (амплификацией) транскрипции генов, кодирующих белки NP и NS1. Третий этап – фаза поздней вторичной транскрипции начинается через 3,5-4 часов с момента инфицирования и характеризуется амплификацией транскрипции генов, кодирующих структурные белки HA, NA и M1 [Shapiro et al., 1997; Mahy et al., 1980]. Примерно в это же время или даже позже начинается синтез белка NS2. При этом имеющиеся данные литературы по накоплению мРНК, кодирующих белки NS1 и NS2, свидетельствуют о низком уровне сплайсинга мРНК, кодирующей белок NS1, в результате чего мРНК, кодирующая белок NS2 составляет порядка 10% от несплайсированой мРНК NS[Alonso-Caplen F.V., Krug]. Кроме того, показано, что уровни мРНК для всех фрагментов генома имеют тенденцию к снижению на поздней стадии инфекции [Shapiro et al., 1987].

Перечисленные особенности накопления различных сегментов вирусной мРНК, соответствующие трем фазам транскрипции, полностью отражены в результатах расчета модели, представленных на рис. 3, что говорит об адекватности предложенной модели.

Так как механизмы регуляции отдельных стадий внутриклеточного онтогенеза до сих пор остаются плохо изученными, то при построении модели потребовалось внесение в нее ряда дополнительных гипотез. Другими словами процесс адаптации модели к экспериментальным данным потребовал как параметрической, так и структурной идентификации модели. В результате удалось описать не только основные динамические характеристики размножения вируса в клетке, но также обосновать некоторые принципиальные механизмы репликации вирусного генома.

В частности, для объяснения специфических механизмов амплификации синтеза мРНК отдельных фрагментов были привлечены данные, согласно которым на поздние стадии онтогенеза ВГ влияют мутации в 8-ом фрагменте геномной РНК, кодирующей неструктурные белки NS1 и NS2 [Hatada et al.,1990]. Мы предположили, что белки NS1 и NS2 непосредственно детерминируют переход от первичной транскрипции к ранней и поздней вторичной транскрипции. При этом имеющиеся экспериментальные данные позволили предположить, что специфическая регуляция селективной амплификации генов происходит на уровне синтеза кРНК вРНК [Falcon et al., 2004], тогда как амплификация синтеза соответствующих мРНК и белков происходит неспецифически, то есть как следствие амплификации вРНК.

Первичная Ранняя Поздняя вторичная транскрипция транскрипция вторичная транскрипция 0 12 3 4 5 67 время (ч) Рис. 3. Результаты расчета модели, описывающие динамику количества цитоплазматической фракции вирусной мРНК в клетке при заражении 45 вирусными частицами: 1-мРНК Pol, 2 - NS1, 3 - HA, NA и M, 4 - NS2, 5 - NP.

Разумно было предположить, что ранняя амплификация 5-го и 8-го фрагментов связана с действием белка NS1, а поздняя амплификация 4-го, 6-го и 7-го фрагментов обусловлена действием белка NS2, так как заметный уровень белка NS2 обнаруживается в клетке лишь на поздних этапах инфекции. Такой вариант организации системы, когда переключение ее функционирования с одного режима на другой зависит от появления определенных сигналов, в случае регуляции онтогенеза ВГ имеет реальную основу, так как в качестве одного из механизмов, обуславливающих переключение системы, может выступать сплайсинг мРНК восьмого фрагмента, позволяющий разделить во времени экспрессию белков NS1 и NS2. При этом показано, что сам белок NS1 контролирует сплайсинг собственной мРНК [Falcon et al., 2004], и этот механизм также учтен в модели. После включения в модель механизмов, основанных на перечисленных выше предположениях, удалось адекватно описать все основные динамические характеристики системы, представленные на рис. 3.

1.4. Анализ чувствительности модели к изменению параметров Одним из наиболее важных моментов при изучении онтогенеза различных вирусов является поиск мишеней, чувствительных к различным воздействиям, в том числе к мРНК (тыс.мол./кл.) действию лекарственных препаратов. В общем случае такой мишенью может быть любой компонент системы, чувствительный к изменению параметров.

Анализ чувствительности модели выявил четыре группы параметров. К первой группе относятся параметры, к изменениям которых модель практически нечувствительна. К ним относятся параметры, контролирующие скорость проникновения вируса в клетку, скорость формирования дочерних вирусных частиц и скорость амплификации поздней вторичной репликации. Вторая группа – параметры, снижение значения которых по отношению к исходной величине приводит к подавлению размножения вируса, а увеличение, напротив, интенсифицирует процессы размножения и повышает выход вируса. К этой группе относится параметр, контролирующий скорость связывания полимеразы с вРНК при инициации первичной транскрапции. В третью группу входят параметры, изменение которых как в сторону низких, так и в сторону высоких значений по отношению к исходной величине приводит к подавлению размножения вируса. К этой группе относится параметр, контролирующий скорость амплификации ранней вторичной репликации. И, наконец, в четвертую группу входят параметры, изменение которых в любую сторону относительно исходного значения увеличивает выход вируса. В эту группу попадает параметр, контролирующий скорость упаковки вРНК в вРНП.

Очевидно, что параметры, входящие во вторую и третью группы, контролируют этапы размножения вируса, которые могут быть мишенями фармакологического воздействия как, например, в случае инициации первичной транскрипции, также при инициации репликации на стадии ранней вторичной транскрипции. Поэтому негативная мутация в сайте связывания вирусной полимеразы с вРНК или его связывание с конкурирующим лигандом будут резко подавлять развитие инфекции и снижать выход вируса. Этот факт обсуждается рядом исследователей в контексте поиска новых фармакологических мишеней [Abe et al., 1998].

Глава 2. ТЕОРЕТИЧЕСКОЕ ИССЛЕДОВАНИЕ МОЛЕКУЛЯРНЫХ МЕХАНИЗМОВ ИНДУКЦИИ И ПРОТИВОВИРУСНОГО ДЕЙСТВИЯ ИНТЕРФЕРОНА Важным фактором неспецифической противовирусной резистентности является интерферон (IFN). Сложная сеть взаимоотношений в системе вирус-интерферон делает трудным, в определенных ситуациях, прямой экспериментальный анализ вклада индивидуальных механизмов в регуляцию системы. В связи с этим актуальным становится проведение теоретического анализа закономерностей индукции и действия интерферона и использование для этих целей технологии математического моделирования с прогнозирующими возможностями компьютерного эксперимента.

При моделировании индукции и противовирусного действия интерферона были рассмотрены только интерфероны I типа, а именно интерфероны и , поскольку, с одной стороны, они синтезируются инфицированными клетками в ответ на размножение вирусов, а с другой – действуя на неинфицированные клетки, индуцируют в них развитие противовирусного состояния. Причем индукторами как интерферона, так и IFN-индуцируемых белков являются промежуточные репликативные формы вирусной двухцепочечной РНК (дцРНК).

2.1. Концептуальная модель регуляции индукции и действия интерферонов и 2.1.1. Модель регуляции экспрессии генов интерферонов и Регуляторные районы генов IFN- и IFN- имеют ряд четких структурнофункциональных различий, свидетельствующих о дифференцированном контроле экспрессии этих генов. Вместе с тем активация промоторов генов IFN- и IFN- имеет ряд общих закономерностей, которые позволяют подойти к моделированию регуляции экспрессии этих генов с общих позиций. Промоторные последовательности генов IFN- и IFN- содержат сайты связывания для ряда позитивных и негативных факторов (рис. и 5). Промотор IFN- содержит сайт связывания для позитивного фактора AF-1, промотор IFN- - для позитивного фактора NF-B. Оба промотора имеют сайт связывания для факторов IRF-1 и IRF-2, соответственно активатора и репрессора этих промоторов, а также сайт связывания для позитивного фактора ATF-2. В отличие от промотора IFN-, промотор IFN- содержит негативный регуляторный элемент NRE, с которым связывается репрессор NRE-BP, и сайты связывания для белков HMG I(Y).

Максимальная экспрессия генов IFN- и IFN- требует синергического взаимодействия регуляторных факторов. Вместе с тем сложная структурно-функциональная организация промоторных районов подразумевает регуляцию во времени экспрессии этих генов.

В неиндуцированных клетках конститутивные репрессоры связываются с соответствующими сайтами в промоторах генов IFN- и IFN-, блокируя транскрипцию этих генов (рис. 5 и 6). В соответствии с предложенной моделью, первичным событием, вызывающим индукцию IFN- и IFN- в ответ на вирусы и дцРНК, является дерепрессия их промоторов, вызванная разрушением IRF-2 (в случае IFN- и IFN-) и NRE-BP (в случае IFN-). Параллельно с этим происходит индуцируемая дцРНК зависимой протеинкиназой активация позитивных факторов AF-1 и NF-B, которые после удаления репрессоров связываются соответственно с промоторами IFN- и IFN-, вызывая амплификацию первичного ответа. Дальнейшее повышение экспрессии IFN- и IFN- происходит после появления в клетке фактора IRF-1, который синтезируется на поздней стадии индукции. При этом максимальный эффект достигается при синергическом действии факторов IRF-1 и AF-1 в случае активации промотора IFN- или факторов IRF-1, NF-B и ATF-2 в случае активации промотора IFN-.

Индукция IFN-/ с помощью дцРНК является временной. Ингибитором, выключающим транскрипцию генов IFN-/, может быть либо сам фактор IRF-2, который индуцируется вслед за появлением IRF-1 в поздний период индукции, либо еще более активные продукты его процессинга (In4, PRDI-BF1, PRDII-BF1 и др.).

Посттранскрипционное ингибирование экспрессии генов интерферона связано с синтезом de novo белка-регулятора – короткоживущего репрессора (рис. 6), который необратимо инактивирует мРНК интерферона [Kohase, Vilcek, 1977]. Этот репрессор отсутствует в неиндуцированных клетках. Предполагается, что экспрессия белкарегулятора, так же как и экспрессия интерферона, активируется дцРНК.

A. Неиндуцированная клетка NRE PRDIV PRDIII PRDI PRDII TATA AF--107 HMG I(Y) IRF-2 NRE-BP - HMG I(Y) -110 -103 -94 -85 - GAGTGAAGTAAAGAAAGTGAAAAGAGAATTGGAAAG A4IE Б. Индуцированная клетка A GT A C G A6IE TATA ATF IRF-1/IRF--107 ATF-2 NF-B - HMG I(Y) HMG I(Y) TATA -107 ATF-2 IRF-1 NF-B - HMG I(Y) HMG I(Y) HMG I(Y) ATF-IRF-1 HMG I(Y) TATA IRF-NF-B HMG I(Y) Рис. 4. Организация элемента VRE в Рис. 5. Модель взаимодействия регуляторных промотарах генов IFNA4 и IFNA6 мыши факторов с промотором гена IFN- Вирусная инфекция клетки ====================================== Рибонуклеаза Протеинкиназа дцРНК неактивная неактивная NF-kB/AF-неактивный Рибонуклеаза Протеинкиназа активная активная NF-kB/AF-Деградация IRF-1 IRF-неактивный клеточной неактивный активный (III) (II) мРНК (I) ДНК Конститутивная Удаление репрессора и активация транскрипция первичной транскрипции мРНК Белки Репрессор Интерферон Белок-регулятор (IRF-2, NRE-BP внутриклеточный (специфическая нуклеаза) Неспецифическая деградация, Гликозилирование постиндукционный процессинг и секреция IRF-2 интерферона ====================================== Интерферон внеклеточный Рис. 6. Концептуальная модель регуляции синтеза интерферона I типа Секретируемый инфицированными клетками интерферон действует на соседние неинфицированные клетки через связывание с поверхностными рецепторами и последующую активацию специфических генов. Среди IFN-индуцируемых белков, обладающих противовирусной активностью, наиболее хорошо изучены протеинкиназа, 2',5' олигоаденилатсинтетаза и белки Мх. Индукция интерфероном этих белков коррелирует с развитием противовирусного состояния в ряде инфицированных клеток.

2.1.2. Индукция и действие 2',5'-олигоаденилатсинтетазы и протеинкиназы Протеинкиназа и 2',5'-олигоаденилатсинтетаза обладают ферментативными активностями, однако до момента инфицирования клеток вирусами остаются в неактивном состоянии. Показано, что они активируются после инфицирования клеток вирусом и образования двухцепочечной репликативной формы вирусной РНК (рис. 7).

Активированная 2',5'-олигоаденилатсинтетаза осуществляет синтез олигоаденилатов с необычной 2',5'-фосфодиэфирной связью. Такие 2',5'-олигоаденилаты (2',5'An) активируют латентную эндорибонуклеазу L, катализирующую деградацию как вирусной, так и клеточной РНК.

Виру сная инфекция кл етки IFN Рецепто р ы IFN Кл еточ ная мембрана Jak1, Tyk2, Stat1, StatИндукция синтеза антивирусных Вирусная белков репликация Вирусная мРНК Эндорибонуклеаза L 2',5'-олигоаденилатсинтетаза Протеинкиназа неактивная неактивная неактивная дцРНК 2',5'-олигоаденилатсинтетаза Протеинкиназа активная активная Синтез Фосфорилирование олигоаденилатов P1 и eIF-2 a ppp(2'p5'A) n АТ Ф P1 и eIF-2 a n неактивные АТ Ф +АМФ Эндорибонуклеаза L активная 2',5'-фосфодиэстераза Деградация Ингибирование синтеза виру сно й мРНК виру сны х белков Ингибирование сборки виру со в Рис. 7. Концептуальная модель регуляции противовирусной активности интерферона Активированная протеинкиназа фосфорилирует и тем самым инактивирует два белка: ассоциированный с рибосомой белок P1 и малую субъединицу фактора инициации белкового синтеза еIF-2 [Samuel, 1991, 1993] (рис. 7). Это приводит к ингибированию процесса инициации трансляции в клетке, вызывая тем самым блокирование синтеза вирусных белков и, как следствие, ингибирование вирусной репликации [Williams, 1995].

2.2. Математическое моделирование регуляции индукции и действия интерферона 2.2.1. Адаптация модели Как и в случае моделирования внутриклеточного онтогенеза ВГ для описания процессов регуляции и функционирования системы интерферона применен разработанный Лихошваем В.А. обобщенный химико-кинетический метод моделирования. В соответствии с данным методом рассмотренная выше концептуальная модель была записана в терминах реакций химической кинетики с помощью набора формальных блоков, представленных в таблице 1.

Адаптация модели проводилась на двух уровнях: на уровне структурной идентификации модели, который заключался в анализе альтернативных механизмов регуляции, и на уровне идентификации параметров модели в пределах физиологических границ изменения их значений (параметрическая идентификация).

Адаптированный вариант модели достаточно хорошо воспроизводит качественные и количественные характеристики поведения системы в различных режимах функционирования. В частности, результаты моделирования демонстрируют (рис. 8), что доза-зависимое ингибирование выхода вируса коррелирует с накоплением в клетках противовирусных белков, что согласуется с экспериментальными данными [Rubin, Gupta, 1980].

2.2.2. Исследование роли интерферона в регуляции собственной экспрессии Известно, что эффективность индукции интерферона двухцепочечными РНК зависит от предварительной обработки клеток или животных интерфероном.

Предварительное введение небольших доз интерферона приводит к повышению продукции эндогенного интерферона или праймингу. Противоположный эффект, блокинг, также является результатом предварительного воздействия интерферона, однако эффект блокинга достигается при использовании больших доз интерферона (рис.

9) [Stewart, 1979]. Эти данные указывают на способность интерферона регулировать собственную экспрессию. Однако удовлетворительных объяснений механизмов прайминга и блокинга в настоящее время не существует.

Имеющиеся в настоящее время данные позволяют предположить, что в основе индукции интерферона при прайминге и блокинге лежать механизмы, которые обеспечивают противовирусную активность интерферона, в частности, механизмы, обусловленные активацией протеинкиназы и 2',5'-олигоаденилатсинтетазы. Обоснование этого предположения проведено с использованием технологии математического моделирования. Как видно из данных представленных на рис. 9, адаптированный вариант модели полностью воспроизводит эффекты прайминга и блокинга, которые наблюдаются в ответ на индукцию интерферона дцРНК после предобработки клеток, соответственно, либо низкими, либо высокими дозами интерферона.

Проведенное с помощью модели исследование показало, что в основе индукции интерферона при прайминге лежат процессы, связанные с активацией 2',5'олигоаденилатсинтетазы и эндонуклеазы L. Действительно, активация этих ферментов при прайминге фактически приводит к усилению стандартной схемы индукции интерферона, поскольку эндонуклеаза L в данном случае увеличивает скорость деградации мРНК репрессора и белка-регулятора (рис. 6,7). Инактивация репрессора амплифицирует транскрипцию гена интерферона, а инактивация белка-регулятора приводит к увеличению времени полужизни мРНК интерферона. В результате этих процессов интерферон при прайминге начинает синтезироваться раньше и в заметно большем количестве, чем в клетках не предобработанных интерфероном (рис. 9).

Исследование модели показало, что в отличие от прайминга при блокинге основную роль играет протеинкиназа. Действительно, предобработка клеток высокими дозами интерферона вызывает значительное повышение в клетке концентрации как протеинкиназы и 2',5'-олигоаденилатсинтетазы. Появление 2',5'-олигоаденилатсинтетазы синтетазы в этих условиях приводит к тому, что на ранней стадии блокинга индукция интерферона начинается в то же время, что и при прайминге, т.е. примерно на два часа раньше, чем в клетках, необработанных интерфероном (рис. 8). Тем не менее, исследование модели, приводит к выводу, что эффект блокинга обусловлен в основном высокой активностью протеинкиназы, которая в этих условиях обеспечивает практически полное подавление синтеза белка в клетке, включая продукцию интерферона.

Lg IFN ед/мл/час Часы после индукции дцРНК Lg IFN ед/мл/час Часы после индукции Предобработка интерфероном дцРНК Рис. 8. Влияние концентрации IFN на Рис. 9. Влияние предобработки клеток наработку вирусных белков и выход инитерфероном на его продукцию.

вируса. А – результаты моделирования; Б – А – Результаты моделирования развития экспериментальные данные (Stewart, антивирусного состояния при инфекции, 1979); 1 – нормальный ответ; 2 – блокинг вызываемо вирусом гриппа. Б – (предобработка дозой 1000 ед/мл); 3 – Экспериментальные данные (Rubin, Gupta, прайминг (предобработка дозой 1 ед/мл);

1980); (1-3) – IFN-индуцируемые белки; 4 – 4 – прайминг (предобработка дозой 10выход вируса. ед/мл+ циклогексимид).

Таким образом, исследование модели показало, что основную роль в регуляции интерфероном собственной экспрессии при прайминге играет 2',5'олигоаденилатсинтетаза, при блокинге – протеинкиназа.

2.3. Исследование молекулярных механизмов экспрессии и противовирусного действия белков Мх 2.3.1. Математическая модель регуляции индукции и действия белка Мх Следующая задача данной работы состояла в исследовании с помощью модели альтернативных механизмов регуляции экспрессии белка Мх при инфекции, вызываемой вирусом гриппа. Математическая модель системы вирус гриппа-интерферон-белок Мх представлена в виде системы обыкновенных нелинейных дифференциальных уравнений с запаздывающим аргументом, которые описывают динамику следующих переменных:

V(t) – концентрация инфекционных вирусных частиц [TCID50/мл];

I(t) – концентрация интерферона [ед/мл], где ед - единицы активности;

MI(t) – уровень IFN-индуцированного белка Мх [условных единиц/мл];

MV(t) – уровень вирус-индуцированного белка Mx [уе/мл];

C(t) – концентрация чувствительных к вирусу клеток-мишеней [клетки/мл];

CI(t) – концентрация защищенных интерфероном клеток [клетки/мл].

Численное решение системы дифференциальных уравнений с запаздывающим аргументом (ДУЗА) проводилось с помощью адаптивного кода DIFSUBDEL, построенного в работе [Бочаров, Романюха, 1986] для решения (с заданной точностью) ДУЗА, характеризуемых постоянными значениями задержек и свойством жесткости.

2.3.2. Адаптация и исследование модели При адаптации математической модели регуляции и функционирования системы вирус-интерферон-белок Мх1 за основу были взяты экспериментальные данные Arnheiter и соавторами [Arnheiter et al., 1980] (рис. 10 – А,Б,В,Г), описывающие размножение вируса гриппа в культурах клеток A2G и A/J, соответственно, устойчивых и чувствительных к ортомиксовирусам. Первая культура имела генотип Мх(+), а вторая Мх(-).

Исследование модели показало, что она воспроизводит все основные закономерности поведения системы вирус-интерферон-белок Мх1, полученные в экспериментах Arnheiter и соавторами [Arnheiter et al., 1980], в которых варьировались множественность инфекции, начальный уровень интерферона и синтез белка Мх1 (рис.

10). Вместе с этим исследование модели позволило также объяснить некоторые важные на наш взгляд особенности поведения системы.

Известно, что кроме интерферона экспрессию гена Мх могут индуцировать дцРНК и вирусы. При этом дцРНК и вирусы могут активировать экспрессию гена Мх либо непосредственно, либо через индукцию IFN. Проведенный анализ позволил оценить индивидуальный вклад каждого из этих механизмов из этих механизмов в индукцию и поддержание противовирусного состояния.

Модель предсказывает, что противовирусная активность белка Мх1, индуцируемого вирусом, ниже, чем в случае индукции интерфероном. Без участия других противовирусных механизмов индивидуальная экспрессия белка Мх1 ни при каких условиях не может обеспечить устойчивость клеток к вирусу гриппа. Напротив, белок Мх1, индуцируемый интерфероном, имеет выраженный противовирусный эффект и обеспечивает устойчивость клеток к вирусу. Однако, защита клеток, инфицированных с высокой множественностью, возможна только в случае одновременного выполнения двух условий: 1) действие интерферона предшествует инфекции; 2) интеферон и вирус оказывают синергический эффект на активацию промотора Мх1. Это позволяет говорить о том, что кооперативное участие интерферона и вируса в регуляции экспрессии белка Мх1 может быть одним из ведущих механизмов устойчивости мышей к инфекции вирусом гриппа.

A ББ A8 8 8 2 6 6 6 4 4 4 2 2 2 24 48 72 24 48 72 24 48 72 24 48 72 Время после инфекции, час Время после инфекции, час Время после инфекции, час Время после инфекции, час ГВ Г В8 8 8 2 6 6 6 4 4 4 1 2 2 2 24 48 72 24 48 72 24 48 72 24 48 72 Время после инфекции, час Время после инфекции, час Время после инфекции, час Время после инфекции, час Рис. 9. Размножение вируса гриппа в культурах гепатоцитов A2G и A/J. A, Б, В, Г – экспериментальные данные Arnheiter et al., 1980; А1, Б1, В1, Г1 – результаты расчета; А, Б и А1, Б1 – начальная концентрация интерферона в культуральной среде равна нулю; В, Г и В1, Г1 – начальная концентрация интерферона в культуральной среде равна 80 ед/мл.

Множественность инфекции равна 100 (А, В и А1, В1) и 0,01 (Б, Г и Б1, Г1).

1 – культура клеток A2G; 2 – культура клеток A/J.

Модель предсказывает, что на популяционном уровне роль IFN-индуцируемого белка Мх1 заключается в том, что он увеличивает процент резистентных к вирусу клеток. Вирус-индуцируемый белок Мх1 ограничивает наработку вируса, оставляя инфицированные клетки чувствительными к инфекции.

Lg TCID /мл Lg TCID /мл Lg TCID /мл Lg TCID /мл Lg TCID /мл Lg TCID /мл Lg TCID /мл Lg TCID /мл ГЛАВА 3. МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ РЕГУЛЯЦИИ СИСТЕМЫ ПРОТИВОВИРУСНОГО ИММУНИТЕТА При построении математической модели, описанной в данной работе, по возможности, были учтены ключевые аспекты взаимодействия вируса с чувствительным организмом, от которых зависят патогенные свойства вируса и исход заболевания.

Первоначально была предложенная базисная модель, которая описывает наиболее общие закономерности регуляции иммунного ответа при инфекциях, вызываемых вирусами.

Переменные базовой модели, описывающие регуляцию иммунного ответа при вирусной инфекции представлены, в таблице 2. Эти переменные описывают динамику основных компонентов системы «вирус+хозяин», в том числе концентрацию вируса, концентрацию трех популяций клеток-мишеней – неинфицированных, инфицированных и защищенных интерфероном клеток, концентрацию интактных и активированных натуральных киллеров и макрофагов, концентрацию предшественников и эффекторов Тхелперов и цитотоксических Т-лимфоцитов, а также концентрацию четырех цитокинов:

IFN-/, IL-1, IL-2 и IL-4.

В терминах принятых обозначений (табл. 2) математическая модель регуляции системы противовирусного иммунитета может быть представлена системой обыкновенных нелинейных дифференциальных уравнений с запаздываниями.

Численное интегрирование системы осуществляется с помощью алгоритма DIFSUBDEL, построенного для решения систем динамических уравнений с запаздываниями [Бочаров, Романюха, 1986]. В основе этого алгоритма лежат известные методы Гира переменного шага и переменного порядка.

Проведена идентификация параметров базовой модели для имитации острого течения инфекции, вызываемой вирусом гепатита В. Инфекция, вызываемая вирусом гепатита В, была выбрана потому, что является одной из наиболее изученных. Имеется необходимая количественная информация, которую собрал, проанализировал и представил в удобной для моделирования форме А.А. Романюха [Романюха, 1987]. Эта информация была использована в работах по математической моделью противовирусного иммунитета [Марчук, 1985; Marchuk et al., 1991] сначала при оценке начального приближения коэффициентов этой модели для решения задачи идентификации [Pомaнюxа, Бочаров, 1987], а затем имитации острого течения гепатита В [Романюха, Бочаров, 1987;

Marchuk et al., 1991] и гриппа [Bocharov, Romanyukha, 1994]. Эти работы явились основой для выбора параметров и адаптации разработанной в данной работе, математической модели к острому течению гепатита В [Чуйков и др., 1992; Chuykov et al., 1991].

Таблица Переменные базовой модели регуляции системы противовирусного иммунитета Обозначения Названия переменных переменных V(t) концентрация инфекционных вирусных частиц С(t) концентрация клеток-мишеней Cv(t) концентрация инфицированных клеток CI(t) концентрация защищенных интерфероном клеток-мишеней IFN(t) концентрация интерферона NK(t) концентрация интактных натуральных киллеров NKa(t) концентрация активированных лимфокинами натуральных киллеров М(t) концентрации интактных макрофагов Mv(t) концентрации интактных вирус-презеитирующих макрофагов Ma(t) активированных лимфокинами макрофагов Mav(t) активированных, вирус-презентирующих макрофагов H1r(t), H2r(t) концентрация предшественников Т-хелперов клеточного (Th1) и гуморального (Th2) иммунитета в фазе G0 клеточного цикла H1a(t), H2a(t) концентрация активированных Th1 и Th2 клеток в ранней Gl-фазе клеточного цикла H1p(t), H2p(t) концентрация Th1 и Th2 клеток в поздней Gl-фаза клеточного цикла, экспрессирующих рецепторы к IL2 и способных пролиферировать H1f(t), H2f(t) концентрация дифференцированных Th1 и Th2 клеток, секретирующих IL-2 или IL-4, соответственно В(t) концентрация специфического клона В-лимфоцитов Ва(1) концентрация активированных В-лимфоцитов, экспрессирующих рецепторы к IL-2 и IL-4, способных пролиферировать и дифференцироваться P(t) концентрация плазматических клеток F(t) концентрации специфических антител Er(t) концентрация предшественников эффекторов клеточного иммунитета Еа(t) концентрация активированных предшественников эффекторов клеточного иммунитета, экспрессирующих рецепторы к IL-2 и способных пролиферировать и дифференцироваться в цитотоксические Т-лимфоциты Ek(t) концентрация CD8+ CTL IL1 (t), IL2(t), концентрации интерлейкинов 1, 2 и 4, соответственно.

IL4(t) Результаты имитации с помощью разработанной нами математической модели острого течения гепатита В, представленные на рис. 11, хорошо согласуются с данными, полученными ранее с помощью математической модели инфекционного заболевания, разработанной Г.И. Марчуком и соавторами [Marchuk et al., 1991]. Совпадение результатов, полученных на моделях, описывающих биологический процесс с различной степенью детализации, говорит об адекватности выбранной стратегии моделирования инфекционного процесса. В данном случае выполняется принцип воспроизводимости результатов при изменении экспертных процедур.

Рис. 11. Численная имитация острого течения гепатита В с помощью математической модели регуляции системы противовирусного иммунитета.

По оси абсцисс отложено время в сутках, по оси ординат – расчетные концентрации (десятичные логарифмы) некоторых наиболее информативных показателей инфекционного процесса:

V–вирус, CV–инфицированные клетки, M –антигенпрезентируV ющие макрофаги, H1–хелперы клеточного иммунного ответа, H2–Т-хелперы гуморального иммунного ответа, В–специифические В-лимфоциты, Р–плазматические клетки, Tk–Ткиллеры.

Полученные оценки параметров использовались в качестве начальных приближений коэффициентов при моделировании смешанной биинфекции, вызываемой вирусом гепатита В и ВИЧ-1. При моделировании смешанной инфекции базовая модель регуляции системы противовирусного иммунитета была расширена с учетом особенностей патогенеза ВИЧ-1. Расширенный вариант модели учитывает:

- индукцию и действие ВИЧ-специфического иммунного ответа;

- размножение ВИЧ-1 в инфицированных Т-лимфоцитах и макрофагах, которые являются клетками-мишенями для ВИЧ-1;

- гибель инфицированных Т-лимфоцитов-хелперов и макрофагов благодаря цитолитической активности вируса и цитотоксической активности ЦТЛ и НКклеток.

Рассмотрим некоторые результаты численного моделирования смешанной инфекции. Прежде всего, представляло интерес оценить развитие ВИЧ-инфекции на фоне предварительной вакцинации. Для этого мы сравнивали динамику как моноинфекции (для каждого вируса), так и биифекции при заражении как невакцинированного, так и вакцинированного (против ВИЧ-1) организма.

VH V2 VVV10 0 0 0 100 200 0 100 200 0 100 200 0 100 2HHH 0 0 100 20 100 200 0 100 200 0 100 2Б А Рис. 12. Результаты имитации смешанной инфекции, вызываемой ВИЧ-1 и условно “нормальным” вирусом (в данном случае вирусом гепатита В): А – в отсутствии предварительной вакцинации; Б – на фоне предварительной вакцинации. Ось абсцисс – время после начала инфекйии (сут). Ось ординат – десятичные логарифмы показателей инфекционного процесса для двух вирусов: V1 – “нормальный” вирус; H1 – вирусспецифические Т-хелперы; V2 – ВИЧ-1; H2– ВИЧ-специфические неинфецированные Тхелперы. Сплошные кривые – показатели для моно-инфекции, вызываемой “нормальным” вирусом. Пунктирные кривые – показатели для моно-инфекции, вызываемой ВИЧ-1. Кривые пунктир с точкой – показатели для смешанной инфекции.

Результаты имитации инфекционного процесса в отсутствии предварительной вакцинации, представленные на рис. 12-А, показывают, что в случае смешанной инфекции наблюдается взаимное усиление скорости репродукции обоих вирусов.

Модель предсказывает, что развивающийся иммунодефицит, в частности, снижение уровня Th-клеток (рис. 12-А), обусловленной цитолитическим действием ВИЧ-1, не позволяет формировать адекватный иммунный ответ как против "нормального" вируса (в нашем случае вируса гепатита В), так и ВИЧ-1.

Имитация инфекции у индивидуумов, предварительно иммунизированных против ВИЧ-1, представлены рис. 12-Б. Как видно, модель не предсказывает защитный эффект вакцинации ни в случае индивидуальной ВИЧ-инфекции, ни в случае смешанной инфекции. Более того, рост концентрации ВИЧ-1 после вакцинации начинается раньше и достигает более высоких титров, чем при отсутствии вакцинации (рис. 12-Б).

Конечно, это очень пессимистический прогноз. К тому же этот теоретический результат фактически повторяет результаты, полученные при неудачных испытания испытаниях вакцины компании Мерк MRKAd5, по причине которых испытания этой вакцины были прекращены.

Таким образом, наши результаты предполагают, что предшествующий иммунитет не только к Ad5 (как в случае вакцины компании Мерк), но к любому другому вектору или к сопутствующей ко-инфекции может приводить к обострению ВИЧ-инфекции. В любом случае, пока механизмы “пропатогенного” действия вакцины MRKAd5 не будут полностью раскрыты, возможное влияние антивекторного иммунитета, а также предшествующего иммунитета к ВИЧ-1 или сопутствующей инфекции нельзя игнорировать. Это лишний раз подчеркивает, что в основе рационального дизайна вакцин должно лежать понимание механизмов и иммунитета и инфекционного процесса (патогенеза) при ВИЧ-инфекции.

ГЛАВА 4. ТЕОРЕТИЧЕСКИЙ ДИЗАЙН ИСКУССТВЕННЫХ ПОЛИ-CTLЭПИТОПНЫХ ИММУНОГЕНОВ – КАНДИДАТОВ ДНК-ВАКЦИНЫ ПРОТИВ ВИЧ-4.1. Дизайн синтетического TCI-иммуногена, кодирующего множественные CTL эпитопы основных антигенов ВИЧ-Учитывая стремительное распространение эпидемии СПИДа во всем мире, задача создания вакцины против ВИЧ-инфекции имеет чрезвычайно актуальное значение и требует создания новых подходов к разработке эффективных анти-ВИЧ вакцин. Данная работа посвящена конструированию новых искусственных полиэпитопных вакцин, индуцирующих CTL-ответы против ВИЧ-1. Искусственный поли-CTL-эпитопный иммуноген TCI (T-cell immunogen) был первой спроектированной нами ДНК-вакцинной конструкцией.

Для конструирования TCI-иммуногена, кандидата в ДНК-вакцину, из Los Alamos HIV Molecular Immunology Database были выбраны CTL эпитопов, которые удовлетворяют следующим критериям:

1. Выбирались эпитопы, которые индуцируют как CD8+ CTL, так CD4+ Th и являются консервативными среди трех основных подтипов ВИЧ-1 – А, В и С, циркулирующих на территории России, США и Западной Европы, что позволяет обойти высокую вариабельность вируса.

2. Эпитопы выбирались из основных вирусных белков-антигенов Env, Gag, Pol и Nef.

3. Учитывались CD8+ CTL-эпитопы, которые в совокупности рестриктированы десятью различными оптимально подобранными аллелями HLA I класса. Как известно, этого достаточно, чтобы покрыть генетическое разнообразие антигенов МНС I класса в популяции практически любого географического района.

4. Чтобы исключить возможность индукции аутоиммунных антител, из числа кандидатов в состав полиэпитопной вакцины исключались эпитопы, которые имеют локальное сходство с белками человека [Максютов и др., 2002; Maksyutov et al., 2004].

Общий дизайн TCI-иммуногена – кандидата в ДНК-вакцину против ВИЧ-представлен на рис. 13. Белок TCI включает 392 а.о. и содержит более восьмидесяти перекрывающихся эпитопов CD8+ CTL и CD4+ Th, ограниченных аллелями HLA I и II классов.

Ген, кодирующей поли-CTL-эпитопный иммуноген TCI, был клонирован в векторной плазмиде pcDNA3.1. Для оценки иммуногенности полученной ДНК-вакцинной конструкции pcDNA-TCI оценивались ответы CTL (ELISPOT) и титры антител (ИФА). Результаты анализа иммуногенности, представленные на рис. 14 и 15, показывают, что плазмида pcDNA-TCI индуцирует как ВИЧ-специфические Т ответы CTL, так и ВИЧ-специфические антитела у иммунизированных животных. Однократная иммунизация животных плазмидой pcDNA-TCI индуцирует дозозависимые ВИЧспецифические ответы как CTL, так и антител. Повторная иммунизация животных приводит к выраженному увеличению Т- и В-клеточных ответов. Видно, что специфические антитела связываются как с белком TCI, так и с белками ВИЧ-1, а спленоциты иммунизированных животных индуцируют CTL ответ при стимуляции как полноразмерным белком TCI, так и его отдельными эпитопами. Последнее указывает на TCI иммуноген A2 Cw4 A32 A24 A19 HLA A A B35 A3.1 A2 A2 B A3.1 Abroad A29 A2+Th B A2 B B27(Bw62) B35 A2 B7 B A3.1 Th Th B8 Cw3 Th A24 A*0201 B35 B A24 Th A (B8) Th (B15) Th A3.1 B35,A B (B8) Th A2 B35 A2,A3,(A11,B27) (B8) B35 (A11) B (B52) B7 A3. (B27) B7,(B8) (A11) (Bw62) (A11) Th (A11) Th (B8) H-2k H-2a,b,f H-2d,p,u,q Позиции Th Bэпитопов A Mamu A*01 A24(A9) B B A1,(B8) A B B*27 (B18) (B37) Фрагменты (B57) белков ВИЧ-1, (B57) содержащих p17 p24 gp120 (37-61;120-128; gp41 (593-600; Pol (71-79;

выбранные Nef(70-149) (12-47;71-86) (140-159;255-309) 375-384;410-444) 813-856) 205-219;266-277;310;314) эпитопы Рис. 13. Общий дизайн TCI-иммуногена - кандидата в вакцину против ВИЧ-Прямоугольниками обозначены последовательности белков ВИЧ-1, содержащие выбранные эпитопы. Позиции индивидуальных эпитопов обозначены линиями. Ограничения эпитопов по антигенам главного комплекса гистосовместимости человека, мышей и обезьян отмечены соответствующими буквами (HLA-A, B, Cw - human, H-2a, b, d, f, k, p, u, q - mouse, Mamu-A*01 - Macaca mulatta). Th – Т-хелперные эпитопы.

1,1,А В 1,1,1,2 1,0,0,0,0,0,0,0,0,0 7 10 14 21 30 0 7 10 14 21 30 Дни после иммунизации Дни после иммунизации EHEC TCI N15+NEHEC TCI N15+N1,1,Г Б 1,1,1,2 1,1 0,0,0,0,0,0,0,0,0 7 10 14 21 30 0 7 10 14 21 30 Дни после иммунизации Дни после иммунизации EHEC TCI N15+N16 EHEC TCI N15+NРис. 14. Пролиферативный ответ в группах мышей линии BALB/c, иммунизированных плазмидной плазмидой pcDNA-TCI A – однократная иммунизация, доза 20 мкг; Б – двукратная иммунизация, доза 20 мкг + 50 мкг; В – однократная иммунизация, доза 100 мкг; Г – двукратная иммунизация, доза 100 мкг + 50 мкг. Пролиферативный ответ оценивали в реакции бласттрансфомации спленоцитов, выделенных от иммунизированных мышей BALB/c. Для специфической стимуляции спленоцитов иммунизированных мышей (BALB/c) использовали белок TCI и два входящих в него пептида: N15 (DRVIEVVQGAYRAIR – эпитоп из белка gp41) и N16 (KQIINMWQEVGKAMYA – эпитоп из белка gp120). Для оценки неспецифической продукции использовали пептид EHEC (отрицательный контроль).

то, что при ДНК-иммунизации происходят все стадии, необходимые для доставки целевого иммуногена иммунной системе, а именно экспрессия гена TCI, процессинг целевого белка и представление полученных пептидов CD8+ лимфоцитам (CTL) вместе с молекулами МНС I класса.

Индекс пролиферации Индекс пролиферации Индекс пролиферации Индекс пролиферации 30A 2520151057 1 01 4 2 13 04 Дн и п о с л е и м м у н и з а ц и и p c DNA- T CI (2 0 )* p c DNA-T CI ( 2 0 ) * * p c D N A -T C I (1 0 0 )* pcDNA -TCI ( 100) * * 1Б B 11117 1 01 4 2 13 04 Дни после и мму низ а ц и и pcDNA-TCI (20)* pcDNA-TCI (20)* * pcDNA-TCI (100)* pcDNA -TCI (100)** 30В 2520151057 1 01 42 13 04 Дни п о с л е имму н из ац ии pcDNA -TCI (20)* pcDNA -TCI (20)* * pcDNA -TCI (100)* pcDNA -TCI (100)* * Рис. 15. Титры специфических антител IgG в группах животных, иммунизированных плазмидой ДНК pcDNA-TCI A – ИФА с белком TCI; Б – ИФА со смесью рекомбинантных белков Gag и Env; В – ИФА с лизатом ВИЧ-1.

pcDNA-TCI (20)* - Однократная иммунизация, доза 20 мкг;

pcDNA-TCI (20)** - Двукратная (prime-boost) иммунизация, доза 20 мкг + 50 мкг;

pcDNA-TCI (100)* - Однократная иммунизация, доза 100 мкг;

pcDNA-TCI (100) **- Двукратная (prime-boost) иммунизация, доза 100 мкг + 50 мкг.

1/Y, Титры антител 1/Y, Титры антител 1/Y, Титры антител 4.2. Оптимизация структуры полиэпитопных иммуногенов для индукции высоких уровней ответов CD8+ CTL 4.2.1. Дизайн ДНК-вакцинных конструкций Отметим, что при конструировании TCI-иммуногена мы использовали оптимально подобранные эпитопы, однако структура целевого иммуногена в данном случае не оптимизировалась. Поэтому следующей задачей данной работы явилась разработка новых подходов к созданию эффективных и безопасных вакцин против ВИЧ-1 для индукции высоких уровней ответов цитотоксических Т-лимфоцитов, на основе оптимизации экспрессии, процессинга и представления иммунной системе целевого иммуногена.

Известно, что CD8+ CTL распознают вирусные белки-антигены, синтезируемые внутри клетки, не как полноразмерные белки, а как короткие пептиды (8-аминокислотных остатков), ассоциированные с молекулами МНС I класса (рис. 16).

Аппарат Гольджи Тяжелая цепь молекулы МНС I класса Тапасин Транслокон Рибосома Калнексин Калретикулин Рис. 16. Процессинг и представление иммунной системе энодогенно-экспрессируемых белков Эти короткие антигенные эпитопы появляются из эндогенно синтезируемых вирусных белков в результате протеасом-опосредуемого процессинга после чего переносятся в просвет ER с помощью транспортных белков TAP (transporter associated with antigen processing), где связываются с образующимися молекулами MHC I класса.

Поэтому при оптимизации структуры поли-CTL-эпитопного иммуногена необходимо обеспечить высокие уровни ответов CD8+ CTL на индивидуальные эпитопы, входящие в состав полиэпитопной конструкции. Для этого необходимо обеспечить выполнение трех основных условий:

1) высокий уровень экспрессии целевого гена;

2) эффективный процессинг в протеасоме продукта экспрессии целевого гена;

3) транспорт образованных детерминант в эндоплазматический ретикулум (ER);

4) высокий уровень экспрессии на поверхности антиген-презентирующих клеток (АПК) комплексов [пептидMHC I класса], образованных пептидом с молекулами MHC I класса.

Для достижения этой цели можно использовать различные стратегии:

1. Нацеливание белков или полиэпитопных конструкций в протеасому путем генетического присоединения к NH2-концу белков последовательности убиквитина (Ub) [Varshavsky et al., 2000].

2. Использование аминокислот, фланкирующих детерминанты, чтобы гарантировать протеасомное расщепление белков и освобождение эпитопов [Ishioka et al., 1999;

Kuttler et al., 2000; Livingston et al., 2001].

3. Использование мотивов узнавания для TAP для фланкирования эпитопов [Uebel et al., 1999].

4. Использование эпитопов, которые имеют высокие значения времени полужизни комплексов [пептид-MHC I класса].

5. Использование детерминант для индукции TCD4+ ответов, так как они часто усиливают ответы CD8+ CTL.

6. Использование для конструирования целевых генов кодонов высоко экспрессируемых генов человека [Andre et al., 1999; zur Megede et al., 2000].

Для оптимизации структуры целевого иммуногена было использовано специально отобранных CD8+ CTL-эпитопов, рестриктированных молекулами HLA-A2.

Эти эпитопы представленных в таблице 3.

Кроме набора отобранных CTL-детерминант, все продукты экспрессии целевых генов содержат универсальный пептид ‘PADRE’ (AKFVAAWTLKAAA) для усиления ответов CD8+ CTL, так как этот эпитоп способен вызвать ответы CD4+ CTL в ассоциации с множественными HLA-DR алломорфами, а также с молекулами I-Ab, которые экспрессируются у трансгенных мышей [Alexander et al., 1994]. Эпитоп SIINFEKL из овальбумина был включен в состав полиэпитопных как COOH-концевой эпитоп конструкций для мониторинга экспрессии и иммуногенности вакцинных конструкций с помощью антител 25-D1.16, специфичных к комплексам [Kb-SIINFEKL] [Porgador et al. 1997].

Таблица HLA A*0201- рестриктированные CTL эпитопы, отобранные для дизайна полиэпитопных конструкций из Los Alamos HIV Molecular Immunology Database Последователь- Локализация эпитопов Score(*) Изменчивость эпитопов ности эпитопов в белках среди подтипо ВИЧ-E1 SLYNTVATL p17(77-85) 157.227 консервативный (A,B,C) E2 ALVEICTEM RT(33-41) 20.369 консервативный (B) E3 VIYQYMDDL RT(179-187) 18.008 консервативный (A,B,C) E4 ILKEPVHGV RT(309-317) 39.025 консервативный (A,B,C) E5 QMHEDIISL gp160(103-111) 145.490 консервативный (A,B,C) E6 KLTPLCVTL gp160(121-129) 74.768 консервативный (A,B,C) E7 RLRDLLLIV gp160(770-778) 20.437 консервативный (A,B) E8 VLEWRFDSRL Nef(180-189) 8.832 консервативный (B) E9 RILQQLLFI Vpr(62-70) 67.142 консервативный (A,B,C) E10 VLAEAMSQV Gag/p2p7p1p6(1-7) 1114.988 консервативный (A,B,) E11 RGPGRAFVTI gp160(311-320) 0.129 слабо консервативный (*), Предсказанная оценка времени полужизни диссоциации комплексов [пептид/MHC I класса], содержащих пептиды, перечисленные в таблице.

Конструкция C1 – простое объединение детерминант.

H E1 E2 E3 E4 E5 E6 E7 E8 E9 EКонструкция C2, в составе которой эпитопы фланкированы аминокислотными остатками (DR), обеспечивающими процессинг полиэпитопа и освобождение детерминант H DR E1 DR E2 DR E3 DR E4 DR E5 DR E6 DR E7 DR E8 DR E9 DR EКонструкция C3, в составе которой эпитопы содержат фланкирующие аминокислотные остатки, обеспечивающие процессинг полиэпитопа, а также мотивы для узнавания TAP.

H DR+TAP E1 DR+TAP E2 DR+TAP E3 DR+TAP E4 DR+TAP E5 DR+TAP E6 DR+TAP E7 DR+TAP E8 DR+TAP E9 DR+TAP EРис. 17. Дизайн поли-CTL-эпитопных иммуногенов и кодирующих их генов С использованием перечисленных эпитопов проведено конструирование трех вариантов ДНК-вакцинных конструкций, представленных на рис. 17, которые реализуют разные стратегии экспрессии, процессинга и представления целевого полиэпитопного иммуногена для стимуляции Т-клеточных ответов против ВИЧ-1.

Гены, кодирующие конструкции C1, C2 и C3, были экспрессированы в трех векторных плазмидах pV1, pV2 и pV3 как индивидуальные последовательности, а также в виде конструкций, содержащих либо N-, либо C-концевой убиквитин, для нацеливания полиэпитопных иммуногенов в протеасому для их деградации и освобождения эпитопов (рис. 18). В результате было получено 9 рекомбинантных плазмид – кандидатов для использования в качестве ДНК вакцины (табл. 4).

Конструкция CКонструкция CКонструкция C HindIII Acc65 I BstE II XhoI Vector plasmid pV1========AAGCTT=Kozak=HA=GGTACC====GGTGACC=Gag=stop=CTCGAG==== Vector plasmid pV HindIII Acc65 I BstE II XhoI Vector plasmid pV2==AAGCTT=Kozak=Ub-V76=HA=GGTACC====GGTGACC=Gag=stop=CTCGAG==== Vector plasmid pV HindIII Acc65 I BstE II XhoI Vector plasmid pV3========AAGCTT=Kozak=HA=GGTACC====GGTGACC=Gag=Ub=stop=CTCGAG= Vector plasmid pVРис. 18. Структура векторных плазмид для клонирования генов, кодирующих целевые иммуногены Kozak – мотив Козака (GCCGCCACC); Ub – убиквитин; HA-эпитоп – YPYDVPDYA;

Gag-эпитоп – EPFRDYVDRFYKTL (Mab 29F2/30AG(p24,Gag); Acc65 I and BstE II – сайты встраивания целевых генов в векторные плазмиды pV1, pV2 и pV3.

Таблица Перечень рекомбинантных плазмид – кандидатов ДНК-вакцин, кодирующих целевые иммуногены № Плазмиды Генные конструкции Генные продукты 1 pV1C1 C2 pV1C2 C2 Полиэпитопные конструкции C1, C2 и C3 pV1C3 C4 pV2C1 Ub-C1 Полиэпитопные конструкции C1, C2 и C3, 5 pV2C2 Ub-C2 с генетически присоединенным Ub их NH2-концу 6 pV2C3 Ub-C7 pV3C1 C1-Ub Полиэпитопные конструкции C1, C2 и C3, 8 pV3C2 C2-Ub с генетически присоединенным Ub к их COOH-концу 9 pV3C3 C3-Ub 4.2.2. Экспрессия комплексов [пептид-MHC I класса] на поверхности клеток, трансфицированных рекомбинантными плазмидами, кодирующими целевые иммуногены Измерение комплексов SIINFEKL/H-2 Kb проводилось после трансфекции эукариотических клеток 293-Kb рекомбинантными плазмидами. Результаты двух независимых экспериментов (рис. 19) различаются не более чем на 10% и позволяют выявить наиболее перспективные конструкции, для которых уровень экспрессии комплексов [SIINFEKL/H-2 Kb] сопоставим с положительным контролем (плазмида, кодирующая белок GFP и пептид SIINFEKL). Действительно, сравнительный анализ полученных результатов показал, что наиболее перспективной конструкцией является плазмида pV2C3, так как уровень экспрессии комплексов в данном случае был максимальный. Среднюю экспрессию комплексов показали клетки, трансфицированные плазмидами pV1C2, pV1C3, pV2C2, pV3C3. Слабую экспрессию обнаружили плазмиды pV2C1, pV3C1, pV3C2. Плазмида pV1C1 показала экспрессию на уровне отрицательного контроля.

4.2.3. Сравнительный анализ иммуногенности рекомбинантных плазмид, кодирующих целевые CTL-иммуногены. Отбор перспективных кандидатов Для исследования иммуногенности кандидатных ДНК-вакцин использовались HLA-трансгенные мыши. Использование мышей, экспрессирующих молекулы HLA I класса, дает возможность тестирования вакцинных кандидатов, разрабатываемых для человека, так как предшествующие исследования показали сходство репертуара CD8+ CTL у HLA-трансгенных мышей и человека [Wentworth et al., 1996; Alexander et al., 1997].

Для того чтобы сравнить ответы CD8+ CTL, индуцируемые различными вакцинными конструкциями, и выбрать наиболее перспективного кандидата для использования в качестве ДНК-вакцины, в эксперимент были взяты 11 групп мышей (мыши на группу), которые были иммунизированы как показано в таблице 5.

Очевидно, что идеальная ДНК-вакцина должна индуцировать высокие CD8+ CTLответы на все включенные эпитопы. Это означает, что при оптимизации вакцинной конструкции мы должны стремиться получить ответы на максимальное количество эпитопов. Согласно данному критерию наиболее оптимальными конструкциями являются плазмиды pV2C2 и pV2C3. Причем конструкция pV2C3 является более Частота комплексов SIINFEKL/Kb Частота комплексов SIINFEKL/Kb комплексов комплексов Рекомбинантная плазмида Рекомбинантная плазмида СИФ комплексов SIINFEKL/Kb СИФ комплексов SIINFEKL/Kb Эксперимент №Эксперимент №Рекомбинантная плазмида Рекомбинантная плазмида Рис. 19. Частота и средняя интенсивность флуоресценции SIINFEKL/Kb комплексов в клетках 293-Кв, трансфецированных исследуемыми плазмидами. Слева – первый эксперимент. Справа – второй эксперимент.

предпочтительной, так как она индуцирует ответы на большее количество пептидов. Этот результат наглядно демонстрирует рис. 20. Для каждой мыши из этой группы ответы выявлялись на 7, 8 и 9 пептидов, соответственно. Более того, это была единственная группа, для которой, по крайней мере, одна мышь отвечала на любой из 10 пептидов.

Таблица Протоколы иммунизации HLA-трансгенных мышей Группы мышей для 1-я иммунизация*) 2-я иммунизация*) 3-я иммунизация**) иммунизации 1 pV1C11) pV1C2 pV1C21) pV1C3 pV1C31) pV1C4 pV1C41) pV1C5 pV2C12) pV2C6 pV2C22) pV2C2 rVV-UbC7 pV2C32) pV2C8 pV3C13) pV3C9 pV3C23) pV3C10 pV3C33) pV3C11 (контроль) pV1 (vector) pV1 (vector) *) – 1-ая иммунизация (прайминг) и 2-я immunization (1-й буст) были выполнены с использованием 4 мкг плазмидной ДНК методом GeneGun с 14-ти дневным **) интервалом; – 3-я иммунизация (2-й буст) была выполнена с использованием 107 БОЕ rVV-UbC1/мышь, в/в через 14 дней. Анализ проводился на 6-й день после последней тммунизации.

Таким образом, сравнительный анализ иммуногенности, проведенный на HLA-A2-трангенный мышах, показал, что наиболее перспективной является вакцинная конструкция UbC3. Полученный результат является вполне закономерным, так как конструкция UbC3 оптимизировалась по трем параметрам:

1) конструкция UbC3 содержит N-концевой Ub для нацеливания полиэпитопной конструкции на протеасому;

2) внутри этой конструкции эпитопы фланкированы остатками, которые, как ожидалось, должны обеспечивать процессинг полиэпитопного иммуногена и освобождение детерминант;

3) все эпитопы содержат мотивы для TAP, которые обеспечивают транспорт эпитопов в эндоплазматический ретикулум, где они связываются с молекулами MHC I класса.

Полученные данные вносят вклад в рациональное проектирование вакцин, способных индуцировать стабильно высокие уровни CD8+ CTL ответов на все включенные детерминанты.

pV1C1 pV1C2 pV1C3 pV1C4 pV2C1 pV2C2 pV2C3 pV3C1 pV3C2 pV3CВакцинная конструкция Рис. 20. Количество специфических пептидов, которые индуцируют CD8+ CTL ответы у животных, иммунизированных различными вакцинными конструкциями.

Учитывались пептиды, стимуляция которыми превышала контроль в 3 и более раз.

В каждой группе результаты представлены для трех мышей.

Таким образом, в данной работе впервые проведено комплексное теоретическое исследование специфических и неспецифических механизмов противовирусного иммунитета с использованием системного подхода и комплекса имитационных математических моделей, описывающих процессы регуляции инфекционного процесса и системы противовирусного иммунитета на молекулярно-генетическом, клеточном и организменном уровнях.

Проанализирован ряд предположений об альтернативных механизмах регуляции инфекционного процесса и системы противовирусного иммунитета и сделаны выводы о ключевых звеньях регуляции и функционирования системы вирусхозяин.

Количество пептидов ВЫВОДЫ 1. Впервые разработана математическая модель, отражающая основные закономерности размножения вируса гриппа в инфицированной клетке, с помощью которой обоснованы наиболее принципиальные механизмы регуляции селективной экспрессии генов на стадии вторичной транскрипции.

- Показано, что ранняя амплификация 5-го и 8-го фрагментов генома вируса гриппа связана с действием белка NS1, а поздняя амплификация 4-го, 6-го и 7-го фрагментов обусловлена функцией белка NS2.

- Модель предсказывает, что потенциальными мишенями для действия эффективных противовирусных препаратов при инфекции, вызываемой вирусом гриппа, являются стадия инициации первичной транскрипции и стадия инициации репликации на этапе ранней вторичной транскрипции.

2. Впервые с использованием методов математического моделирования проведено комплексное исследование молекулярно-генетической системы регуляции индукции и действия интерферона I типа. В частности, обоснована антирепрессорная модель регуляции экспрессии интерферона, согласно которой лимитирующей стадией индукции гена интерферона является дерепрессия его промотора, вызванная разрушением конститутивных репрессоров. Показано, что основную роль в регуляции интерфероном собственной экспрессии при прайминге играет 2',5'-олигоаденилатсинтетаза, при блокинге – протеинкиназа.

3. Построена математическая модель регуляции и функционирования системы вирус гриппа-интерферон-белок Мх1, с помощью которой проанализированы альтернативные механизмы индукции белка Мх1, вызванные прямой активацией промотора Мх1 либо интерфероном, либо вирусом. Оценен вклад каждого из этих механизмов в индукцию и поддержание противовирусного состояния. Показано, что совместное присутствие в системе интерферона и вируса вызывает синергическое повышение экспрессии гена Мх1.

4. Построена базовая математическая модель регуляции иммунного ответа при вирусной инфекции, с помощью которой проведена имитация острого течения вирусного гепатита В. Полученные значения параметров использовались в качестве начальных приближений коэффициентов модели при имитации биинфекции, вызываемой вирусом гепатита В и вирусом иммунодефицита человека. Показано, что развивающийся при смешанной инфекции иммунодефицит, в частности, снижение уровня T-лимфоцитов-хелперов, вызывает взаимное усиление скорости репродукции обоих вирусов.

5. При имитации ВИЧ-инфекции модель предсказывает, что проблемы создания вакцины против ВИЧ-1 могут быть обусловлены не столько высокой изменчивостью ВИЧ-1, сколько его иммунопатогенными свойствами, в частности, способностью вируса размножаться в активированных Тлимфоцитах-хелперах и макрофагах, вызывая их гибель и тем самым снижая резистентность организма к инфекции. Следовательно, рациональный дизайн вакцин должен учитывать как механизмы иммунитета, так и механизмы иммунопатогенеза ВИЧ-инфекции.

6. Проведен дизайн нового полиэпитопного Т-клеточного иммуногена (TCI) – кандидата эффективной и безопасной ДНК-вакцины против ВИЧ-1. Целевой иммуноген спроектирован в виде чередующихся последовательностей консервативных фрагментов белков Gag, Env, Pol и Nef ВИЧ-1 подтипов А, В и С. Белок состоит из 392 а.о. и содержит более восьмидесяти перекрывающихся Т-клеточных эпитопов (как CD8+ CTL, так и CD4+ Th), ограниченных аллелями HLA I и II классов, а также ряд В-клеточных эпитопов, которые перекрываются с CD8+ CTL эпитопами.

7. На основе гена, кодирующего белок TCI, получена кандидатная ДНК-вакцина pcDNA-TCI. Показано, что при ДНК-иммунизации плазмида pcDNA-TCI обеспечивает дозозависимую индукцию ВИЧ-специфических цитотоксических Т-лимфоцитов и ВИЧ-специфических антител у иммунизированных животных.

8. Разработан и обоснован новый подход для рационального конструирования искусственных поли-CTL-эпитопных иммуногенов, обеспечивающий высокие уровни ответов CD8+ CTL, на основе оптимизации основных стадий процессинга и представления иммуногена иммунной системе, включая экспрессию гена, кодирующего целевой иммуноген, его процессинг протеасомой и транспорт образующихся эпитопов в эндоплазматический ретикулум.

9. На основе предложенного подхода проведена оптимизация структуры принципиально нового поли-CTL-эпитопного иммуногена – кандидата ДНКвакцины против ВИЧ-1. Экспериментально показано, что наиболее перспективной конструкцией является иммуноген, который содержит N-концевой убиквитин, а все эпитопы в составе полиэпитопной конструкции фланкированы аминокислотными остатками, которые обеспечивают процессинг полиэпитопной конструкции и мотивы для белков TAP, необходимые для транспорта образующихся антигенных детерминант в эндоплазмпатичикий ретикулум.

СПИСОК ОПУБЛИКОВАННЫХ РАБОТ ПО ТЕМЕ ДИССЕРТАЦИИ Статьи 1. Бажан С.И., Кашеварова Н.А., Хлебодарова Т.М., Лихошвай В.А., Колчанов Н.А. Математическая модель внутриклеточного размножения вируса гриппа.

Биофизика, 2008, т.53, №1.

2. Лихошвай В.А., Ратушный А.В., Бажан С.И. Методы моделирования динамики молекулярно-генетических систем. В монографии: «Системная компьютерная биология» (Отв. Ред. Н.А.Колчанов, С.С.Гончаров, В.А. Лихошвай и В.В.

Иванисенко), Н: Изд. СО РАН, 2008, с. 333-393.

3. Bazhan S.I., Karpenko L.I., Lebedev L.R., Uzhachenko R.V., Belavin P.A., Eroshkin A.M., Ilyichev A.A. A synergistic effect of a combined bivalent DNA-protein antiHIV-1 vaccine containing multiple T- and B-cell epitopes of HIV-1 proteins. Mol.

Immunol., 2008, V.45, No.3, P.661-669.

4. Karpenko L.I., Ilyichev A.A., Eroshkin A.M., Lebedev L.R., Uzhachenko R.V., Nekrasova N.A., Plyasunova O.A., Belavin P.A., Seregin S.V., Danilyuk N.K., Zaitsev B.N., Danilenko E.D., Masycheva V.I., Bazhan S.I. Combined virus-like particle-based polyepitope DNA/protein HIV-1 vaccine design, immunogenicity and toxicity studies. Vaccine, 2007, V.25, No.21, P.4312-4323.

5. Карпенко Л.И., Бажан С.И., Ерошкин А.М., Лебедев Л.Р., Ужаченко Р.В., Некрасова Н.А., Плясунова О.А., Белавин П.А., Серегин С.В., Данилюк Н.К., Даниленко Е.Д., Зайцев Б.Н., Масычева В.И., Ильичев А.А., Сандахчиев Л.С.

Вакцина «КомбиВИЧвак», содержащая полиэпитопные В- и Т-клеточные иммуногены ВИЧ-1 Доклады Академии наук РАН (раздел «Биохимия, биофизика, молекулярная биология»), 2007, Т.413, №4, С.553–556.

6. Карпенко Л.И., Бажан С.И., Ужаченко Р.В., Некрасова Н.А., Лебедев Л.Р., Агафонов А.П., Веремейко Т.А., Левагина Г.М., Даниленко Е.Д., Масычева В.И., Богрянцева М.П., Плясунова О.А., Ильичев А.А. Различные формы кандидатных вакцин против ВИЧ-1, несущих полиэпитопные иммуногены.

Биопрепараты. – 2006. №4. – С.8-11.

7. Бажан С.И., Карпенко Л.И., Ужаченко Р.В., Ильичев А.А. Новые направления конструирования вакцин против ВИЧ-1. Биопрепараты, 2007, №1, С.29-31.

8. Бажан С.И. Математические модели и информационные системы в вирусологии и иммунологии. Вестник ВОГиС. 2006, Том 9, №2, стр. 209-220.

9. Чеканова Т.А., Карпенко Л.И., Плясунова О.А., Воробьева М.С., Некрасова Н.А., Расщепкина М.Н., Бектимиров Т.А., Бажан С.И., Ильичев А.А. Изучение показателей индукции иммунного ответа у мышей при введении первых отечественных экспериментальных вакцин против ВИЧ/СПИД. Физиология и патология иммунной системы. – 2006. - №4. – С.15-19.

10. Ильичев А.А., Карпенко Л.И., Некрасова Н.А., Лебедев Л.Р., Игнатьев Г.М., Агафонов А.П., Белавин П.А., Серегин С.С., Данилюк Н.К., Бажан С.И.

Использование различных систем доставки ВИЧ-1 ДНК-вакцины, кодирующей поли-ЦТЛ -эпитопный иммуноген. Вестник РАМН, 2005, №1, 41-44.

11. Bazhan S.I., Belavin P.A., Seregin S.V., Danilyuk N.K., Babkina I.N., Karpenko L.I., Nekrasova N.A., Lebedev L.R., Ignatyev G.M., Agafonov A.P., Poryvaeva V.A., Aborneva I.V., Ilyichev A.A. Designing and engineering of DNA-vaccine construction encoding multiple CTL epitopes of major HIV-1 antigens. Vaccine, 2004, V. 22, P. 1672-1682.

12. Karpenko L.I., Nekrasova N.A., Ilyichev A.A., Lebedev L.R., Ignatyev G.M., Agafonov A.P., Zaitsev B.N., Belavin P.A., Seregin S.V., Danilyuk N.K., Babkina I.N., Bazhan S.I., Comparative analysis of the immunogenicity of artificial VLP and attenuated Salmonella strain carrying a DNA-vaccine encoding HIV-1 polyepitope CTL-immunogen. Vaccine, 2004, V. 22, P. 1692-1699.

13. Бажан С.И., Белавин П.А., Серегин С.В., Данилюк Н.К., Бабкина И.Н., Карпенко Л.И., Некрасова Н.А., Лебедев Л.Р., Агафонов А.П., Игнатьев Г.М., Ильичев А.А., академик РАН Сандахчиев Л.С. Конструирование искусственного иммуногена, кандидата ДНК-вакцины, кодирующей множественные CTL-эпитопы ВИЧ-1. Доклады Академии наук, 2004, Т. 395, №6, С. 108-110.

14. Maksyutov A.Z., Bachinskii A.G., Bazhan S.I., Ryzhikov E.A., Maksyutov Z.A.

Exclusion of HIV epitopes shared with human proteins is prerequisite for designing safer AIDS vaccines. J. Clin. Virol., 2004, V.31 Suppl 1, P. S26-38.

15. Maksyutov A.Z., Bachinsky, Bazhan S.I., Ryzhikov E.A. Design of safe AIDS vaccines based on the search for local similarities between HIV-1 and human proteins. AIDS Vaccines and Related Topics (Editor: Aldar S. Bourinbaiar), Research Singpost, 37/661 (2), Fort P.O., Trivandrum-695 023, Kerala, India, 2004, p. 47-62.

16. Карпенко Л.И., Бажан С.И., Игнатьев Г.М., Лебедев Л.Р., Ильичев А.А., Сандахчиев Л.С. Искусственные анти-ВИЧ иммуногены и способы их доставки.

Вестник РАМН, 2003, №1, С.24-30.

17. Максютов А.З., Бачинский А.Г., Бажан С.И. Поиск в белках ВИЧ-1 районов, локально сходных с белками человека. Применение к вакцинам. Молекулярная биология, 2002, Т. 36, № 3, C. 447-459.

18. Бажан С.И., Белова О.Е. Современные подходы к созданию вакцины против HIV. Русский журнал ВИЧ/СПИД и родственные проблемы, 2000, Т.1, №2, С.

25-28.

19. Likhoshvai V.A., Matushkin Yu.G., Vatolin Yu.N., Bazhan S.I. A Generalized chemical kinetic method for simulating complex biological systems. A computer model of phage ontogenesis. Computational Technologies, 2000, Vol.5, p.87-99.

20. Bazhan S.I., Belova O.E. Interferon-induced Antiviral Resistance. A Mathematical Model of Regulation of MX1 Protein Induction and Action. J. Theor. Biol., 1999, Vol.198, p.375-393.

21. Климов Н.А., Ерошкин А.М., Поздняков С.Г., Веревочкин С.В., Мурашев Б.В., Котов А.Ю., Пигарева Н.В., Симбирцев А.С., Романович А.Э., Бажан С.И., Щелкунов С.Н., Козлов А.П. Сравнительные испытания новых иммуногенов и способов их доставки на мелких лабораторных животных. Аллергия, астма и клиническая иммунология, 1999, №9, с.110-113.

22. Бажан С.И., Белова О.Е. Молекулярно-генетические аспекты индукции и противовирусного действия интерферона. Вестник РАМН, 1998, №3, с. 18-24.

23. Бажан С.И., Белова О.Е. Математическое моделирование регуляции синтеза и противовирусного действия интерферонстимулируемого белка Мх1.

Молекулярная биология, 1997, Том 31, №6, с.1071-1081.

24. Ананько Е.А., Бажан С.И., Белова О.Е., Кель А.Э. Механизмы регуляции транскрипции интерферон-индуцируемых генов: Описание в информационной системе IIG-TRRD. Молекулярная биология, 1997, Том 31, №4, с.701-713.

25. Bazhan S.I., Likhoshvay V.A., Belova O.E. Theoretical analysis of the regulation of interferon expression during priming and blocking. Journal of Theoretical Biology, 1995, V.175, P.149-160.

26. Belova O.E., Likhoshvai V.A., Bazhan S.I., Kulichkov V.A. Computer system for investigation and integrated description of molecular-genetic system regulation of interferon induction and action. 1995, Comput. Appl. Biosci. V.11, N.2, P.213-218.

27. Belova, O.E., Likhoshvai, V.A., Bazhan, S.I., Kulichkov, V.A. Integrated Knowledge Base for Description and Investigation of Biological Systems. In:

Proceedings of Japan-CIS Symposium on Knowledge Based Software Engineering'94. (Ueno, H. & Stefanuk, V.L., eds), Japan: ISSHINSHA, Ltd, 1994, P.221-224.

28. Belova, O.E., Likhoshvai, V.A., Bazhan, S.I. The Knowledge-Base System for Investigation of Regulation and Functioning of Molecular-Genetic Systems In:

Proceedings of EWHCI'94 (The East-West International Conference on HumanComputer Interaction, St. Petersburg, 2-6 August, 1994), V.2, P.115-118.

29. Бажан С.И., Лихошвай В.А., Белова О.Е. Теоретический анализ возможных механизмов индукции интерферона при прайминге и блокинге. Бюллетень экспериментальной биологии и медицины, 1993, Т.116(CXVI), №9, С.279-283.

30. Likhoshvai V.A., Bazhan S.I., Belova O.E. Mathematical modelling of molecular genetic system regulation of the interferon induction and antiviral action. In "Modelling and computer methods in molecular biology and genetics" (Reports of International Conference, Novosibirsk, August 28-September, 1990), Ed. by V.A.Ratner and N.A.Kolchanov, Nova Science Publishers, Inc., New York, 1992, p.

293-299.

31. Чуйков В.В., Бажан С.И., Куличков В.А. Математическая модель регуляции системы противовирусного иммунитета. Кибернетика и системный анализ, 1992, №2, С.154-164.

32. Chuykov V.V., Bazhan S.I., Kulichkov V.A. AIDS and AIDS vaccine. Analisys of vaccination perspective for struggle against infection induced by human immunodeficiency virus (HIV): Mathematical model. "Modelling and computer methods in molecular biology and genetics" (Reports of International Conference, Novosibirsk, August 28-September, 1990), Ed. by V.A.Ratner and N.A.Kolchanov, Nova Science Publishers, Inc., New York, 1992, p. 301-308.

33. Chuykov V.V., Bazhan S.I., Kulichkov V.A. Mathematical modelling of antiviral immune response regulation. I. Conceptual description of the modelled processes.

Folia Biologica (Praga), 1991, V.37, P.1-9.

34. Chuykov V.V., Bazhan S.I., Kulichkov V.A. Mathematical modelling of antiviral immune response regulation. II. Mathematical formalization of the modelled processes. Imitation of acute course of hepatitis B. Folia Biologica (Praga), 1991, V.37, P.10-20.

Патенты 1. Бажан С.И., Белавин П.А., Серегин С.В., Бабкина И.Н., Данилюк Н.К., Сандахчиев Л.С. Искусственный белок-иммуноген TCI, содержащий множественные CTL-эпитопы основных антигенов ВИЧ-1, искусственный ген TCI, кодирующий полиэпитопный белок-иммуноген TCI. Патент РФ №2238946.

Заявка на изобретение №2002110800. Приоритет от 22.04.02 г.

2. Карпенко Л.И., Бажан С.И., Некрасова Н.А., Белавин П.А., Данилюк Н.К., Серегин С.В., Бабкина И.Н., Игнатьев Г.М., Агафонов А.П., Бойченко М.Н., Воробьев А.А., Ильичев А.А., Сандахчиев Л.С. Рекомбинантная плазмидная ДНК pcDNA-TCI, обеспечивающая экспрессию искусственного гена TCI в клетках эукариот, и рекомбинантный аттенуированный штамм бактерий Salmonella enteritidis E-23/pcDNA-TCI как кандидат для конструирования живой ДНК-вакцины против вируса иммунодефицита человека. Патент РФ № 2248396.

Заявка на изобретение №2003111095. Приоритет от 17.04.03 г.

3. Карпенко Л.И., Бажан С.И., Лебедев Л.Л., Некрасова Н.А., Белавин П.А., Серегин С.С., Данилюк Н.К., Ерошкин А.М., Ильичев А.А.. Рекомбинантная вакцина против вируса иммунодефицита человека 1 типа. Патент РФ №2317107.

Заявка на изобретение №2006100808. Приоритет от 10.01.06 г.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.