WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

 

На правах рукописи

Спиридонова Вера Алексеевна

Структура аптамерных ДНК/РНК как основа для создания

лекарственных препаратов и регуляторных элементов

03.01.02 – биофизика

03.01.03 – молекулярная биология

Автореферат

диссертации на соискание

ученой степени доктора биологических наук

Москва 2011

Работа выполнена в НИИ физико-химической биологии имени А.Н. Белозерского Московского государственного университета имени М.В. Ломоносова

ОФИЦИАЛЬНЫЕ ОППОНЕНТЫ:

Доктор биологических наук,

профессор Розенфельд Марк Александрович

Доктор биологических наук Карпова Ольга Вячеславовна

Доктор химических наук,

профессор Ямсков Игорь Александрович

ВЕДУЩАЯ ОРГАНИЗАЦИЯ:

Учреждение Российской академии наук Институт молекулярной биологии имени В.А. Энгельгардта РАН

Защита состоится  18 мая 2011 года в 12 часов на заседании  диссертационного совета Д 002.039.01 при Учреждении Российской академии наук Институте биохимической физики им. Н.М. Эмануэля по адресу: Москва, ул. Косыгина, 4

С диссертацией можно ознакомиться в библиотеке Учреждения Российской академии наук Института химической физики им. Н.Н. Семенова РАН

Автореферат разослан

Ученый секретарь

диссертационного совета  Д 002.039.01

канд. хим. наук  Мазалецкая Л.И.

 

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Прошедшее десятилетие ознаменовалось существенным прорывом в использовании фундаментальных знаний о ДНК/РНК в прикладных работах. Бурный прогресс был связан с тем, что эти молекулы участвуют в хранении и передаче наследственной информации последующим поколениям. До недавнего времени нуклеиновые кислоты (НК) рассматривали как ленточные структуры, способные только к приему и передаче генетической информации. Открытие энзиматических функций, а теперь и регуляторных  (ингибирующих), показало, что третичные структуры НК имеют сложную конфигурацию, что придает им новые свойства (функции) в комплексах с белками. В клетке ДНК/РНК-белковые взаимодействия служат основой её жизнедеятельности: экспрессия генома, синтез РНК в клетке, синтез белка, поэтому изучение структуры и функции нуклеопротеидных комплексов, с одной стороны, является актуальной фундаментальной задачей. С другой стороны, использование специфичности взаимодействия белков с нуклеиновыми кислотами в прикладных задачах стало приоритетным направлением в разработке различных тест-систем (биосенсоры), лекарственных препаратов.

В том, что две сложно организованные  в пространстве макромолекулы (однотяжевая ДНК/РНК и белок) могут «узнавать» друг друга, нет ничего удивительного. Именно трехмерная структура биополимера определяет «узнавание» и является предметом исследования с помощью физических и физико-химических методов. Однако в ряде случаев различные по структуре  природные РНК способны «узнавать» один и тот же белок, участвуя тем самым в регуляции ряда процессов.

Изучение комплексообразования и стабильности бинарных модельных комплексов позволяет упростить задачи в биофизических исследованиях нуклеиново-белкового узнавания в сложных клеточных органеллах и разработать системы прикладного характера, например, технологии микро-матриц, биосенсоров и т.д.

Способность НК образовывать разнообразные сложные третичные структуры с новыми функциями позволила разработать метод SELEX (Systematic Evolution of Ligands by Exponential enrichment). Метод позволяет создавать искусственные бинарные нуклеопротеидные комплексы, в которых целевые фрагменты нуклеиновых кислот (аптамеры) могут проявлять новые функции, например, играть роль ингибиторов ферментов, регулировать экспрессию ряда генов (Gold, 1990; Szostak 1990). 

Аптамеры (от лат. Aptus – подходящий) представляют собой  однотяжевые  молекулы ДНК и РНК длиной 40-100 нуклеотидов с достаточно сложной трехмерной структурой. Именно она обеспечивает способность аптамеров специфически связывать различные молекулы, в том числе и белки. Специфичность данного комплексообразования  сравнивают со сложнейшим процессом биосинтеза белковых "узнающих элементов" – антител, которые созданы природой в течение длительной эволюции. 

В настоящее время в мировой практике комплекс антиген-антитело рассматривается как «золотой стандарт» специфического взаимодействия биомолекул. Это определило использование антител в медицинской диагностике и терапии. По способности образовывать специфический комплекс аптамеры, по сути, представляют собой функциональные аналоги антител, поэтому создание аптамеров, обладающих ингибирующим или активирующим воздействием на белки, совершенно актуально. Специфичность взаимодействия искусственного комплекса аптамер-белок, как правило, сравнивают с природным специфическим комплексом антиген-антитело. Константа диссоциации таких комплексов лежит в пределах 10-50 нМ.

В отличие от антител аптамеры мало иммуногенны, и их создание не требует использования живых систем.

Метод SELEX предоставляет принципиально иной путь биофизического поиска партнера c новой функцией. В настоящее время небольшие ДНК/РНК-аптамеры выделены для огромного числа белков. Поэтому генерация лекарственных форм на основе аптамеров представляется актуальнейшей проблемой. К достоинству аптамеров можно отнести и получение антидота к ним. Комплементарная последовательность к данному ДНК/РНК-аптамеру может служить антидотом, который будет приостанавливать действие аптамера в случае его передозировки.

Рассматривая аптамеры как перспективный класс новых медицинских препаратов, проводятся многочисленные биофизические, биохимические и медицинские исследования с целью дальнейшего их терапевтического применения. Аптамеры к VEGF (эндотелиальный фактор роста сосудов) уже используются при лечении ретинопатии глаз человека. Аптамеры к фактору Вилле-Бранда (участнику процесса свёртывания крови) проходят клинические испытания III фазы.

Цель и задачи исследования. Целью данной работы было cоздание ДНК/РНК аптамеров, изучение их структуры с помощью компьютерного моделирования, спектральных методов. Исследование процессов комплексообразования аптамеров с белками с использованием различных видов хроматографии, электрофорезов, поверхностного плазмонного резонанса, методов меченых атомов,

Было поставлено две задачи:  во-первых, исследовать структуру природных комплексов рибосомных белков S7, которые специфически связываются с РНК, и с помощью метода SELEX сконструировать РНК-аптамеры к термофильному белку, тем самым, отработав методические подходы. Во-вторых, используя метод SELEX, создать бинарные комплексы ДНК с ферментом тромбином, который не взаимодействует с нуклеиновой кислотой, изучить структуру полученных ДНК-аптамеров, ингибирующих активность фермента. Тромбин служит центральным звеном в реакциях свертывания крови. Его избыточная активность создает угрозу развития тромбозов.

Рибосомный белок S7, ключевой белок сборки и функционирования малой субчастицы прокариотических рибосом, образует природные комплексы с двумя различными по структуре молекулами РНК. Он связывается с 16S рРНК и инициирует сборку малой субчастицы  рибосомы 30S, а также связывается с межцистронным  фрагментом (МЦФ) матричной РНК (мРНК) стрептомицинового оперона, регулируя свой собственный синтез.

В работе были использованы два рибосомных белка из Escherichia coli (EcoS7) и Thermus thermophilus (TthS7). Термофильный белок TthS7 был выбран в качестве объекта, так как представляет собой природный мутант к белку EcoS7, а также в связи с отсутствием данных о регуляции синтеза данного белка в термофильных бактериях.

Вторую задачу решали, используя тромбин, сериновую протеиназу, которая играет ключевую роль в процессе свертывания крови. Тромбин не имеет природных комплексов с нуклеиновой кислотой. Ранее с помощью метода SELEX был получен 15-звенный фрагмент ДНК (Bock, 1992), который ингибировал фибриноген-гидролизующую активность тромбина. С помощью компьютерного моделирования была предложена 31-звенная нуклеотидная последовательность, которая также влияла на активность тромбина (Ikebukuro, 2005). Надо подчеркнуть, что тромбин обладает как прокоагулянтными, так и антикоагулянтными свойствами. Эти активности тромбина не были изучены в присутствии аптамерных ДНК. Наша задача состояла в исследовании структуры новых аптамеров, а также в изучении ингибирующих функций ДНК-аптамеров. Тромбин взаимодействует не только с фибриногеном, но и с клеточными  PAR рецепторами (“Protease Activated Receptors”) тромбоцитов, которые участвуют в процессе свертывания крови, поэтому планировали исследовать влияние аптамерных ДНК на агрегацию тромбоцитов, в которой участвуют PAR рецепторы.

Планировали решить следующие задачи.

  1. Для изучения структуры и термодинамики природной системы, дифференциального узнавания различных РНК рибосомным белком S7 провести компьютерную аннотацию зоны контакта рибосомного белка Thermus thermophilus (TthS7) с Tth16S рРНК в составе термофильной рибосомы, используя данные рентгеноструктурного анализа (РСА). Провести компьютерное моделирование третичной структуры рибосомного белка Escherichia coli  (EcoS7).
  2. Изучить комплексообразование  рибосомных белков S7 из Escherichia coli  (EcoS7) и TthS7 с фрагментами  16S рРНК E. Сoli и делеционными фрагментами str мРНК E. сoli. Получить аптамеры к термофильному белку TthS7, специфически связывающиеся с ним, с помощью метода SELEX, отработав методы селекции.
  3. Создать аптамерные ДНК к тромбину, провести компьютерное моделирование их структуры, Оценить эффективность ингибирующего действия аптамеров и их производных на активность тромбина в реакциях фибринолиза и агрегации тромбоцитов в условиях in vitro  и  in vivo .
  4. Создать модифицированные производные аптамеров для защиты от действия нуклеаз. Оценить эффективность ингибирующего действия модифицированных аптамеров на активность тромбина и возможность подавления  тромбообразования в модели in vivo.
  5. Создать структуру аптамерной ДНК (антидота) и изучить  конкурентное взаимодействие нуклеопротеидного комплекса аптамер-тромбин с комплементарной ДНК к аптамеру.

Научная новизна и практическая значимость работы. В данной работе  были использованы термодинамические подходы при изучении бинарных нуклеопротеидных комплексов. Впервые они охарактеризованы с помощью таких понятий, как аффинность, специфичность, конкурентное связывание. Для детального изучения ДНК/РНК-белковых комплексов очень большое значение имеет получение корректных характеристик, например, кажущихся констант диссоциации, которые позволяют сравнить комплексы по сродству между собой. С учетом того, что бинарный комплекс образуется при взаимодействии двух  конформационно лабильных макромолекул – РНК/ДНК и белка – необходимо было особое внимание уделять унификации их конформации. Любой препарат РНК практически всегда представляет собой набор различных конформеров, описываемых, например, в терминах “конформационного ландшафта” РНК (Russell, 2002). Видимо, поэтому изотермы связывания для РНК-белковых комплексов никогда не достигают платовых значений в 100% - экспериментальный факт, который неоднократно, но без объяснений, констатировался в литературе. Конформационная гетерогенность может быть обусловлена не только процедурой выделения препарата РНК, белка. В связи с этим предложен подход, основанный на денатурации  фрагментов рРНК, мРНК, РНК/ДНК-аптамеров при 90 0С с последующим резким охлаждением во льду. Для белков был предложен метод ступенчатого диализа с целью постепенной сборки нативной структуры. Были рассчитаны кажущиеся константы диссоциации, как для природных нуклеопротеидных комплексов, так и для искусственных. Стандартные изотермы комплексов рибосомного белка с различными РНК были подвергнуты дальнейшему анализу с помощью преобразований Скэтчарда.

Новизна работы состоит в использовании комбинаторных библиотек нуклеиновых кислот (НК).

К началу работы не было данных о  комплексе термофильного рибосомного белка S7 с регуляторным межцистронным фрагментом (МЦФ) мРНК стрептомицинового оперона E.coli. Оперон назван так потому, что мутации в этом опероне вызывают появление устойчивости  штаммов бактерий к действию антибиотика стрептомицина за счет мутаций в гене белка S12. Не было данных о регуляторном районе синтеза данного белка в клетке. На основе рентгеноструктурных данных была предложена модель термофильной 30S субчастицы рибосомы (Ramakrishnan, 1999), в состав которой входит белок S7, но все биохимические данные о связывании S7 с рРНК и с мРНК были получены для мезофильного белка S7 E.coli (Nomura, 1994; Cпирин, 1995).

Поэтому одной из задач было найти элементы связывания, ранее неизвестные, в структуре различных РНК с термофильным белком S7, используя комбинаторную библиотеку на основе мРНК. Надо отметить, что в методе SELEX используют небольшие фрагменты НК (30-100 нуклеотидных остатков), поэтому необходимо было отработать получение аптамеров, удовлетворяющих этим условиям. Методы и подходы, отработанные  в экспериментах с комбинаторными библиотеками на белке, обладающем РНК-связывающей активностью, были применены к искусственным системам.

Развивая новое направление, создание лекарственных препаратов на основе нуклеиновых кислот, были получены и исследованы искусственные комплексы ДНК-аптамеров к тромбину. Используя опыт, полученный при селекции природной системы, был проведен отбор аптамеров к тромбину, и получены родственные нуклеотидные последовательности. Впервые найдено несколько аптамеров, обладающих высокой ингибирующей активностью к тромбину SG50, SG51, SG52, SG53, SG54, RSG55, RE31, ST43,. Их структура охарактеризована с помощью КД-спектроскопии, молекулярной динамики (МД). Впервые искусственный  комплекс аптамерная ДНК-тромбин  был охарактеризован как бинарный нуклеопротеидный комплекс.

Совместно с сотрудниками Российского кардиологического научно-производственного комплекса Росмедтехнологий (лаборатория проф. А.В. Мазурова) впервые было изучено влияние аптамеров на агрегацию тромбоцитов человека, что расширило представления о механизмах свертывания крови. Впервые исследованы изменения параметров коагуляции плазмы крови в присутствии аптамеров по четырем показателям: тромбиновое время, протромбиновое время, АЧТВ (частичное тромбопластиновое время), амидолитическая активность. Предложено использовать данные аптамеры как лекарственные препараты при внутрисосудистом тромбообразовании. Получены патенты РФ: № 2401306, дата приоритета 17 декабря 2008 г. и  №  2410432, дата приоритета 23 ноября 2009 г.

Проведены эксперименты по ингибированию тромбозов у животных в присутствии новых аптамеров на моделях артериального тромбообразования.

Апробация работы. Результаты работы были представлены на Международном конгрессе по антителам « BIT Life Sciences, Antibody-2010», (Пекин, Китай, 2010); на съездах Российского общества биохимиков и молекулярных биологов (Санкт-Петербург, 2002; Новосибирск, 2008); на съезде физиологов СНГ (Кишинев, Молдавия, 2008); на Международной конференции «Достижения фундаментальных наук в решении актуальных проблем медицины» (Астрахань, Россия, 2008); на Международном форуме по нанотехнологиям (Москва, 2008); на Всероссийских  конференциях по клинической гемостазиологии и гемореологии в сердечно-сосудистой хирургии (Москва, 2007, 2009, 2011); на симпозиумах по химии протеолитических ферментов (Москва, 2002, 2008); International Symposium «Strategies on the Development of New Biological Products» (Сеул, Южная Корея, 1999); на Международном симпозиуме  XVIth International Symposium on bioelectrochemistry and bioenergetics (Bratislava, Slovakia, 2001); на Российском конгрессе  «Человек и лекарство» (Москва, 2001, 2007, 2008); на 7-ой конференции IUBMB “Receptor-Ligand Interactions. Molecular, Physiological and Pharmacological Aspects” (Bergen, Norway. 2002).

Личный вклад автора

В цикле исследований, составляющих диссертационную работу, автору принадлежит решающая роль в выборе направления исследований, разработке экспериментальных подходов, в обобщении полученных результатов. В работах, выполненных в соавторстве, личный вклад автора заключается в непосредственном участии во всех этапах исследования - от постановки задачи, проведения экспериментов до обсуждения и литературного оформления полученных результатов.

Основные положения, выносимые на защиту.

- Изучение структуры и термодинамики природной бинарной системы, дифференциального узнавания различных РНК рибосомным белком S7 прокариот.

- Создание плазмидных конструкций для получения фрагментов рибосомной и матричной РНК, проведение делеционного анализа межцистронного фрагмента мРНК E.coli, отработка метода SELEX при создании аптамерных РНК к термофильному рибосомному белку;

- Изучение структуры и термодинамики искусственной бинарной системы  тромбин – аптамерная ДНК. Получение различных 31-звенных ДНК-аптамеров и их модифицированных аналогов;

- Изучение динамики и оптимальных условий сборки и стабильности  базовых и модифицированных G-квартетов ДНК-аптамеров, которые ингибируют фибриноген-гидролитическую активность тромбина;

- Исследование ингибирующего воздействия аптамеров на две прокоагулянтные реакции тромбина – свертывание фибриногена и активацию PAR-1 рецепторов;

- Изучение аптамерных ДНК в качестве ингибиторов внутрисосудистого тромбообразования  на модельных клеточных системах (тромбоцитах), а также на животных моделях.

Структура работы и объем работы. Диссертационная работа изложена на 246 страницах машинописного текста и содержит следующие разделы: введение, обзор литературы, результаты и их обсуждение, материалы и методы, выводы и приложение. Материал иллюстрирован 75 рисунками и 8 таблицами. Библиографический указатель включает 248 ссылок.

СОДЕРЖАНИЕ РАБОТЫ

В данной работе использован сравнительный анализ структур  природных и искусственных бинарных нуклеопротеидных систем, который позволит сформулировать критерии специфичности взаимодействия. Параллельное изучение ДНК-/РНК-белковых взаимодействий для двух систем: природной и искусственной, дает возможность получать дополняющие друг друга независимые результаты.

Прежде чем приступить к созданию фрагментов РНК с определенными свойствами, было изучено образование специфичных комплексов белков EcoS7 и TthS7 с фрагментами рРНК и мРНК E. coli с целью получения небольших (80-100 нуклеотидов) фрагментов РНК, что требуется при использовании метода SELEX.

Фантастические успехи, достигнутые при расшифровке супрамолекулярных структур рибосом, позволили воспользоваться данными рентгеноструктурного анализа при изучении бинарных нуклеопротеидных комплексов. Была проведена аннотация зоны контактов рибосомного белка с 16S рРНК термофильных рибосом  и  компьютерное моделирование белка EcoS7.

    1. Компьютерная аннотация зоны контакта белка TthS7 с Tth 16S рРНК в составе Tth30S, компьютерное моделирование третичной структуры белка EcoS7

Благодаря расшифровке структур бактериальных рибосом методом РСА (Ramakrishnan, 1999, Wimberly 2000) стало возможным детальное изучение структур, как белков, так  и их комплексов. На сегодняшний день остро стоит вопрос о корреляции данных РСА, полученных для рибосом Т. thermophilus, с биохимическими данными, накопленными для рибосом E. coli.  Рибосомы – это сложнейший нуклеопротеидный комплекс, образованный тремя рибосомными РНК и 51 рибосомным белком, который самособирается за счет специфичности взаимодействия между отдельными белками и рРНК. 

Описание контактной зоны рибосомного белка с рибосомной рРНК в составе термофильной рибосомы помогает понять, какие группы вовлечены во взаимодействие. К началу данной работы структурные данные РСА были только для термофильных рибосом, а все биохимические и генетические данные известны только для рибосом E.coli. Для решения этой проблемы была предложена замена термофильного белка на мезофильный в структурных данных РСА, и обратно, в комплексах с РНК E.coli. Используя данные делеционного анализа, выявивших минимальный фрагмент Eco16S рРНК, сохраняющий способность взаимодействовать с белком (Brakier-Gingras, 1994), было сделано компьютерное наложение  структуры этого фрагмента на структуру Tth16S рРНК, согласно данным РСА.

Далее было проведено компьютерное аннотационное описание зоны контакта Tth16S рРНК и белка TthS7. С помощью программы Swiss PDB Viewer выявлены аминокислоты белка TthS7, удаленные от Tth16S рРНК на расстояние от 2,5 до 3,5 с шагом 0,5 . Собранные данные позволили приступить к моделированию третичной структуры белка EcoS7. На основании анализа трех структур S7, решенных методом РСА на тот момент, BstS7, TthS7 и его же в составе рибосомы Tth30S было проведено моделирование третичной структуры белка EcoS7. Для этого выбран пакет программ SWISS-MODEL (http://www.expasy.org/swissmod/SWISS-MODEL.html). Сравнение полученной модели структуры TthS7 с известными белками-аналогами приведено на рисунке 1.

При наложении третичных структур BstS7 и TthS7 с помощью программы Swiss pdb Viewer, оказалось, что белки обладают схожей структурой, они состоят из 6 -cпиралей и -шпильки. При сравнении структуры белка TthS7 в свободном состоянии и в составе рибосомы и белка BstS7 выявились их различия: разница наблюдается в конформации -шпильки и удлиненном неструктурированном N-конце белка. В составе рибосомы N-конец белка TthS7 зафиксирован.

.

Рис. 1. Третичные структуры рибосомных белков S7, согласно данным РСА.

Модель EcoS7 оказалась наиболее близка структуре TthS7 в составе Tth30S. Метод компьютерного молекулярного моделирования для белка EcoS7 с помощью пакета программ SWISS-MODEL дает возможность анализа биохимической информации, а также прогноза для последующих  экспериментов по изучению структурных аспектов РНК-белкового узнавания.

Согласно выбранной стратегии, следующим этапом исследования было изучение бинарных комплексов белков S7 in vitro биохимическими методами с обратным (по сравнению с in silico) переходом от гомологичного комплекса EcoS7 – Eco16S рРНК к гетерологичному - TthS7 – Eco16S рРНК.

    1. Комплексообразование рибосомных белков EcoS7 и TthS7 с фрагментами 16S рРНК E. Сoli и делеционными фрагментами str мРНК E. сoli. Получение аптамеров к термофильному рибосомному белку S7, специфически связывающихся с ним с помощью метода SELEX

Изучение природных специфических бинарных комплексов рибосомных белков S7 с фрагментами РНК поставило вопрос о влиянии рибосомных белков на конформационные изменения в структуре  РНК. Чтобы перейти к созданию аптамерных РНК, далее проводили поиск делеционных фрагментов  strмРНК E. Сoli меньшей длины, но имеющих сродство к белкам, что требуется при использовании метода SELEX. Была продемонстрирована возможность сконструировать РНК-аптамеры с новыми функциями на основе  РНК молекул, не связывающихся с белком.

1.2.1. Взаимодействие фрагментов Eco16S рРНК и EcoStr мРНК c белками EcoS7 и TthS7

Биогенез бактериальных рибосом связан с синтезом и поэтапным взаимодействием рибосомных белков с рРНК. Ранее было показано, что можно вычленить минимальные субдомены 16S рРНК, которые образуют бинарные комплексы с ключевым белком сборки рибосомы S7 (Brakier-Gingras, 1994). Чтобы изучать бинарные комплексы in vitro, нужно иметь достаточное количество белка. Для этого были разработаны экспрессионные системы генов двух рибосомных белков EcoS7 и TthS7 на плазмидах

Выделенные и очищенные рибосомные белки EcoS7 и TthS7 образовывали комплексы с фрагментами Eco16S рРНК и EcoStr мРНК. Степень комплексообразования определяли по количеству радиоактивного комплекса методом сорбции на нитроцеллюлозных мембранах, отработанным в ранних работах автора, и строили изотермы связывания (рис. 2 а, б).

Рис. 2.  Изотермы связывания для комплексов EcoS7 – Eco16S рРНК (а); TthS7 – Eco16S рРНК (б). Исходная концентрация Eco16S рРНК – 20 нМ.

Кажущиеся константы диссоциации (кКd) РНК-белкового комплекса  рассчитывали в координатах Скэтчарда (табл. 1).

Табл. 1.  Кажущиеся константы диссоциации комплексов белков EcoS7 и TthS7 с фрагментом Eco16S рРНК.

EcoS7

TthS7

Eco16S рРНК

Кd= 6,5 ± 1,9 нМ

Кd= 35,8 ± 9,3 нМ

EcoStr мРНК

Кd= 55 ± 7 нМ

Кd= 114 ± 11 нМ

Бактериальный рибосомный белок S7 выступает ключевым не только для сборки малой субчастицы рибосомы, он также участвует в регуляции экспрессии своего собственного цистрона, т.е. регулирует свой собственный синтез. Второй мишенью для S7 является МЦФ матричной РНК (str мРНК E. Coli) стрептомицинового оперона (рис. 3). Интерес к изучению str-оперона определяется и практическим аспектом. Хромосомные мутации белка S12 приводят к фенотипу устойчивости к стрептомицину, что и определило название оперона. Связываясь с межцистронным участком str мРНК, белок S7 участвует в регуляции трансляции собственного гена.

Рис. 3. Схема стрептомицинового оперона (А), включающая последовательность генов рибосомных белков S12, S7, белковых факторов EF-G, EF-Tu. Представлены модели вторичных структур межцистронного фрагмента (МЦФ) S7-S12 str мРНК (Б) и основного 3’-концевого домена 16S рРНК (В). Спиральные участки пронумерованы от I до V, УФ-индуцируемые сшивки РНК с белком S7 указаны стрелками. На структуре МЦФ темным цветом выделены (UAA) стоп кодон гена белка S12, последовательность Шайна-Дальгарно и AUG кодон гена белка S7. Контурами выделены идентичные участки в данных фрагментах РНК.

Межцистронный район различной длины от 800 нуклеотидов (Nomura, 1994) до 400 нуклеотидов (Brakier-Gingras, 1994) был определен как регуляторный в трансляции стрептомицинового оперона. В совместных работах с Головиным (Golovin, 2006) фрагмент, связывающий рекомбинантный EcoS7, был сокращен до 143 нуклеотидов. Было показано, что МЦФ str мРНК способен образовывать как гомологичный, так и гетерологичный комплексы с рекомбинантными белками EcoS7 и TthS7 (рис. 4, табл. 1).

Сравнивая константы диссоциации комплексов, можно сделать вывод, что оба белка способны высокоаффинно связываться с Eco16S рРНК и EcoStr мРНК.

Рассматривая TthS7 как близкий структурный гомолог EcoS7, нужно отметить, что стабильность гомологичного комплекса EcoS7-Eco16S рРНК оказалась в 6 раз выше, чем гетерологичного TthS7 – Eco16S рРНК. Следовательно, можно использовать фрагменты РНК E. coli в качестве базовых для поиска участков, высокоаффинно связывающихся с TthS7. В данном случае размер такого фрагмента составлял более 100 нуклеотидов, и вторичная структура мотива взаимодействующего участка рРНК оказалась разветвленной, что осложняло выбор селектируемого района, поэтому более перспективным оказался фрагмент EcoStr мРНК.

       А        Б

Рис.4. А) Изотермы связывания в координатах Скэтчарда комплексов EcoS7 – EcoStr мРНК; Б) Изотермы связывания в координатах Скэтчарда комплексов  TthS7 - EcoStr мРНК. Концентрация EcoStr мРНК = 20 нМ.

Очевидно, что оба белка S7 (мезофильный и термофильный) способны эффективно образовывать бинарные комплексы c EcoStr мРНК. Нужно отметить, что в стрептомициновом опероне у термофилов этот межцистронный участок составляет всего 4 нуклеотида. Регуляторный район для стрептомицинового оперона у термофилов не описан, хотя порядок и чередование генов в нем совпадают с опероном E. Coli. Это позволяет использовать для поиска регуляторного района гена белка TthS7 межцистронный участок str мРНК, используя комбинаторные библиотеки.

Чтобы применить метод SELEX для получения РНК-аптамера, обладающего сродством к термофильному белку, необходимо было уменьшить размер участка и доказать, что, действительно, TthS7, связываясь с вновь получаемым фрагментом, влияет на структуру данного района. 

1.2.2. Изучение влияния белков EcoS7 и TthS7 на структуру фрагмента EcoStr мРНК

Чтобы оценить влияние термофильного белка на данный участок РНК была проведена химическая модификация фрагмента EcoStr мРНК в присутствии и в отсутствие белков. Для сравнения модификацию проводили как в комплексах с EcoS7, так и в комплексах с TthS7 разными реагентами: 1-циклогексил-3-(2-морфолинил-4-этил)-карбодиимид-N-толуолсульфонатом (СМСТ), кетоксалем (КЕ), диметилсульфатом (DMS) при 37 0С.

А                                                Б

Рис. 5. А. Радиоавтограф электрофореза в ПААГ при анализе фрагмента EcoStr мРНК и его комплексов с белками EcoS7 и TthS7 методом химической модификации. Дорожки 6, 9, 12 – модификация РНК; 7, 10, 13 - модификация РНК в присутствии 10-кратного избытка EcoS7; 8, 11, 14 - модификация РНК в присутствии 10-кратного избытка TthS7 реагентами КЕ, DMS и СМСТ, соответственно. Б. Предполагаемая вторичная структура S12 - S7 межцистронного участка EcoStr мРНК. Стрелками указаны модифицируемые нуклеотиды: R - модификация РНК, Е - модификация РНК в присутствии EcoS7, T - модификация  РНК в присутствии TthS7.

В положении модифицированного нуклеотида транскрипция останавливается, и образуется набор фрагментов кДНК, которые разделяли электрофорезом в ПААГ в денатурирующих условиях. Параллельно проводили реакции секвенирования контрольной РНК (рис. 5).

Обнаружено, что оба белка, действительно, защищают от модификаций верхнюю часть шпильки в районе бифуркации -30 -40, что происходит, видимо, из-за прямого экранирования белками района связывания с РНК. Этот компактный район прямого взаимодействия белков с мРНК оказался удобным объектом для исследования бинарных комплексов, а также помогал выбрать участок для последующей селекции аптамеров.

      1. Анализ связывания делеционных фрагментов str мРНК E.coli

Чтобы приступить к экспериментам по селекции, необходимо было уменьшить размер узнаваемого фрагмента, поэтому был проведен систематический делеционный анализ МЦФ str мРНК.

Рис. 6. Модели предполагаемой вторичной структуры межцистронного участка EcoStr мРНК. Делеционные фрагменты EcoStr мРНК. Позиция +1 соответствует А инициаторного кодона AUG цистрона S7; мРНК103 с координатами -100 +3 (непосредственно сам межцистронный участок); мРНК84 (-91 -8); мРНК73 (-86 -14); мРНК61 (-81 -21). Шпилька (AG) построена на базе мРНК61 с дополнительными тремя G-C парами. Шпилька (AU) имеет замену неканонической пары A – G (-80/-22) на пару A – U. Контурами показаны районы, идентичные районам 16S рРНК. Cтрелкой указана структура аптамера, полученного в результате селекции. Символами (+) и (-) обозначены те РНК, которые связываются с TthS7.

Амплификацией ПЦР с помощью серии праймеров, один из которых содержал промотор Т7 РНК-полимеразы, были  синтезированы фрагменты мРНК: EcoStr мРНК143 длиной 143 нуклеотида и с координатами -100 +43 (позиция +1 соответствует А инициаторного кодона AUG цистрона S7); мРНК103 с координатами -100 +3 (непосредственно сам межцистронный участок); а также укороченные производные межцистрона: мРНК84 (-91 -8); мРНК73 (-86 -14); мРНК61 (-81 -21) (рис. 6). Для полученной серии фрагментов мРНК определяли способность связывания двух рекомбинантных белков – гомологичного EcoS7 и гетерологичного TthS7. Был проведен анализ связывания делеционных фрагментов межцистрона str мРНК E. coli с белками EcoS7 и TthS7. Изотермы связывания для EcoS7 и TthS7 с фрагментами EcoStr мРНК получали с помощью фильтрации на нитроцеллюлозных мембранах. Линеаризация изотерм связывания в координатах Скэтчарда показана на рис. 7.

А                                                        Б

Рис. 7. А) Изотермы связывания белка EcoS7 с фрагментами EcoStr мРНК в координатах Скэтчарда. мРНК143 кКd = 55 ±12 нM;         мРНК103 кКd = 60 ± 25 нM; мРНК84 кКd = 50 ±24 нM .Б) Изотермы связывания белка TthS7 с фрагментами EcoStr мРНК. в координатах Скэтчарда. мРНК143 кКd = 171 ±41 нM; мРНК103 кКd = 230 ± 31 нM; мРНК84 кКd = 182 ± 48 нM. [EcoStr мРНК] = 20 нМ.

Делеция 40-ка нуклеотидов (мРНК103) и 19-ти нуклеотидов (мРНК84) кодирующей части цистрона S7 с 3'-конца мРНК143 не приводит к изменению связывания. Однако делеция следующих девяти нуклеотидов (мРНК73) и двенадцати нуклеотидов (мРНК61), включая  последовательность Шайна-Дальгарно цистрона S7, приводит к потере связывания с белком EcoS7.

Аналогичные результаты были получены для гетерологичных комплексов (рис. 7Б). Белок TthS7 был способен связывать фрагменты  мРНК143, мРНК103, мРНК84, также как белок EcoS7. Можно предположить, что благодаря высокой степени гомологии пространственных структур и сходному поведению в комплексообразовании с фрагментами мРНК E.coli, белки  S7 из разных бактерий могут однотипно взаимодействовать с РНК, а их РНК-связывающие центры консервативны.

Следует подчеркнуть, что регуляторный район в стрептомициновом опероне у термофильных бактерий неизвестен, поэтому комплексообразование TthS7 с фрагментами EcoStr мРНК, возможно, показывает, что регуляторный участок для термофильного белка имеет сходную структуру.

1.2.4. Селекция аптамеров РНК на основе фрагмента  EcoStr мРНК

Используя метод SELEX, стало возможным решить задачу по созданию фрагмента РНК на основе базовой структуры межцистрона E.coli, который узнавал бы термофильный белок TthS7. Надо еще раз отметить, что межцистронный участок S12-S7 в стрептомициновом опероне в термофильных бактериях мал, составляет всего четыре нуклеотида, и в настоящее время неизвестен район, который регулирует экспрессию данных белков.

В классическом варианте SELEX для создания таких РНК, как правило, используют полностью рандомизированную последовательность, но это приводит к появлению неприродного аналога структуры РНК, поскольку при селекции проходит отбор наиболее стабильных нуклеопротеидных комплексов. Мы использовали прием частичной рандомизации (рис. 8). 

       А        Б

Рис. 8. А - Структура рандомизированной шпильки (1024 варианта), которую использовали  в селекции с белком TthS7. Б — структура РНК-аптамера (из библиотеки «шпилька AU»), константа диссоциации которого с белком составляет 70±21 нМ. Красным контуром обозначен участок, идентичный району 16S рРНК.

В верхней части шпильки были рандомизированы пять нуклеотидов, которые, по-видимому, не взаимодействуют с белком непосредственно, т.е. исходная библиотека содержала 45 = 1024 варианта молекул РНК. На рисунке 7А представлены два варианта библиотек, которые были стабилизированы дополнительными тремя G-C парами в нижней части шпильки, а пятая пара A-G (аутентичная природной, -82/-20) была заменена на классическую пару A-U. Библиотекам присвоили названия «шпилька AG» и «шпилька AU»

Для молекул РНК один цикл отбора аптамеров включает реакцию транскрипции с матрицы ДНК, связывание РНК с иммобилизованным белком - мишенью, элюцию связавшейся обогащенной фракции РНК, синтез кДНК на обогащенной РНК и амплификацию ДНК с помощью ПЦР. Далее вновь получают обогащенную фракцию РНК и начинают новый цикл селекции.

Было проведено 10 циклов селекции с постепенным повышением строгости отбора. К десятому циклу кКd комплекса обогащенной фракции РНК TthS7 составила 87 нМ (рис. 10). Эта фракция была клонирована в плазмиду pUC19. 70% клонов имели одинаковую последовательность нуклеотидов (рис. 9). Были сделаны выравнивания первичных структур полученных молекул, и в каждой группе идентичных последовательностей проведено сравнение с исходными структурами: «шпилька AG»  и «шпилька AU».

А

2  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

4  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

5  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

6  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

7  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

10 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

13 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

14 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

15 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

16 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

19 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

21 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

22 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

шпилька AG 1  GGGTAAGGCCAAACGTTTTAACT--TAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

18 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGCCAATCCTGACCC 68

шпилька AG 1  GGGTAAGGCCAAACGTTTTAACT--TAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

 

24 1  GGGTAAGGCCAAACGTTTTAACT-AAATGTCTGTTGAAATTCGTAGAGTTTTGGACAATCCTGACCC 67

шпилька AG 1  GGGTAAGGCCAAACGTTTTAACTTAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

 

17 1  GGGTAAGGCCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 69

шпилька AG 1  GGGTAAGGCC-AAACGTTTTAACTT--AAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

 

12 1  GGGTAAGGCCAAACGTTTTAACTTATATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

шпилька AG 1  GGGTAAGGCCAAACGTTTTAACTTAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

 

3  1  GGGTAAGGCCCAAACGTTTTAACTTAAATGTCGTGTTAATCTCGTAGAGTTTTGGACAATCCTGACCC 68

шпилька AG 1  GGGTAAGGCC-AAACGTTTTAACTTAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

Б

12AG 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

11AG 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

2AG  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

8AG  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

9AG  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

5AG  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

шпилька AG 1  GGGTAAGGCCAAACGTTTTAACT--TAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

 

7AG  1  GGGTAAGGCCAAACGTTTTAACTTAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

шпилька AG 1  GGGTAAGGCCAAACGTTTTAACTTAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

 

13AG 1  GGGTAAGGCCAAACGTTTTAACTTAAATGTCGGGTTAAACTCCTAGAGTTTTGGACAATCCTGACCC 67

шпилька AG 1  GGGTAAGGCCAAACGTTTTAACTTAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTGACCC 67

8AU  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTTACCC 68

9AU  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTTACCC 68

4AU  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTTACCC 68

3AU  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTTACCC 68

13AU 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTTACCC 68

шпилька AU 1  GGGTAAGGCCAAACGTTTTAACT--TAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTTACCC 67

 

12AU 1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGGTTTAAC-CGTAGAGTTTTGGACAATCCTTACCC 68

6AU  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGGTTTAAC-CGTAGAGTTTTGGACAATCCTTACCC 68

шпилька AU 1  GGGTAAGGCCAAACGTTTTAACT--TAAATGTCAAACTAAACTCGTAGAGTTTTGGACAATCCTTACCC67 

2AU  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAACCCCGTAGAGTTTTGGACAATCCTTACCC 70

шпилька AU 1  GGGTAAGGCCAAACGTTTTAACT--TAAATGTCAAACTAAACTC-GTAGAGTTTTGGACAATCCTTACCC67

TthРНК1  1  GGGTAAGGCCAAACGTTTTAACTTTTAAATGTCGGTTTAAAC-CGTAGAGTTTTGGACAATCCTGACCC 68

Рис 9. Выравнивание первичных структур индивидуальных аптамеров  к белку TthS7. А) аптамеры из библиотеки «шпилька AG» (эксперимент 1); Б) аптамеры из библиотеки «шпилька AG» и «шпилька AU» (эксперимент 2).. Жирным выделен рандомизированный участок, подчеркнуты нуклеотидные вставки в полученных аптамерах. В конце каждой группы жирным шрифтом  даны исходные последовательности.

Рис. 10. Изотермы связывания белка TthS7 с фрагментами EcoStr мРНК в координатах Скетчарда. обогащенная фракция «шпилька AG» (эксперимент 1) после 10 циклов селекции кКd = 87 ± 23 нМ; обогащенная фракция «шпилька AU» (эксперимент 2) после 4 циклов селекции кКd = 115 ± 45 нМ; обогащенная фракция «шпилька AG» (эксперимент 2) после 4 циклов селекции кКd = 113 ± 16 нМ; исходная библиотека «шпилька AG» кКd не определяется; исходная библиотека «шпилька AU» (пунктир) кКd не определяется.

На основе библиотеки с рандомизированной нуклеотидной последовательностью длиной в 5 нуклеотидов получены аптамеры  к белку TthS7. Согласно выравниванию структур, они были разбиты на семейства, и каждая обогащенная фракция была охарактеризована по сродству к белку. Было проведено комплексообразование на нитроцеллюлозных мембранах, построены изотермы связывания, которые позволили оценить сродство каждого семейства аптамеров к белку (рис. 10).

После клонирования были  изучены РНК-связывающие свойства индивидуальных аптамеров: т.н. «основной» аптамер, имеющий структуру, представленную в наибольшем числе клонов, связывался с белком с кКd = 87 ± 23 нМ. Для сравнения на рис. 10 приведены данные по связыванию белка TthS7 с природным фрагментом EcoStr мРНК 84. Отчетливо видно, что полученные аптамеры имеют лучшее сродство к белку по сравнению с природным вариантом EcoStr мРНК 84.

Рис. 11. Изотермы связывания белка TthS7 c отдельным «основным» аптамером из библиотеки в координатах Скэтчарда: «шпилька AG» кКd = 87 ± 23 нМ; «шпилька AU» кКd = 70 ± 21 нМ. (эксперимент 2) и с фрагментом EcoStr мРНК 84 кКd = 182 ± 48 нМ.

Однако в большинстве полученных вариантов, кроме рандомизированного, подверглись изменениям и другие участки молекулы РНК: произошла вставка двух U -61, -62 и делеция U -44. Чтобы проверить, являются ли мутации в константных частях следствием контаминации системы или случайным сбоем, который возник при амплификации на стадии полимеразных реакций, закрепился и оказался выгодным для связывания с белком, вытеснив другие варианты, был проведен ещё один отбор аптамерных РНК к белку  TthS7 в более жестких условиях. Параллельно проводили селекции для библиотек «шпилька AG» и «шпилька AU» (эксперимент 2). В результате 4-х циклов селекции было достигнуто обогащение библиотеки, аналогичное предыдущему опыту селекции (рис. 11). После клонирования и секвенирования индивидуальных аптамеров оказалось, что как вставка, так и делеция в константных частях, присутствуют в подавляющем большинстве аптамеров. Это позволяет сделать вывод, что произошедшие изменения в константной части аптамеров необходимы для формирования таких структур РНК, которые способны наилучшим образом связываться с белком S7. То есть случайные ошибки, возникающие при полимеразных реакциях, закрепляются в процессе селекции. Наличие природных первичных структур среди отобранных молекул свидетельствуют о том, что исходная библиотека не содержала ошибок.

Опираясь на природные комплексы рибосомных белков, селекцией комбинаторной библиотеки РНК был создан участок связывания термофильного белка S7 на основе межцистронного фрагмента мРНК, ранее не связывающего термофильный белок. Тем самым показана принципиальная возможность создания специфических участков связывания для  рибосомных белков на основе рандомизированных библиотек. 

Это позволило в дальнейшем направить исследования на создание аптамеров, молекулярных узнающих элементов, к белкам, не имеющим природных комплексов с нуклеиновыми кислотами (НК). 

1.3. Создание аптамерных ДНК к тромбину, обладающих стабильной пространственной структурой и способностью связывать тромбин с высокой эффективностью и специфичностью in vitro. Оценка эффективности ингибирующего действия аптамеров на активность тромбина в реакциях фибринолиза и агрегации тромбоцитов в условиях in vitro

Решение второй задачи было связано с созданием аптамерных ДНК к тромбину, не имеющему природных комплексов с НК. Отработав метод селекции на природной нуклеопротеидной системе, мы применили его к искусственной системе тромбин-аптамер с целью создания аптамерных ДНК, ингибирующих избыточную активность тромбина и тем самым влияющих на процессы тромбообразования в системе гемостаза.

Тромбин играет ключевую роль в системе свертывания крови, способствуя быстрому образованию тромбов. Избыточная активность тромбина грозит развитию внутрисосудистого тромбообразования, которое является причиной развития опасных заболеваний: инфаркт миокарда, нестабильная стенокардия, ишемический инсульт, тромбозы сосудов нижних конечностей и др. В настоящее время ведется активный поиск как прямых, так и непрямых ингибиторов тромбина.

Тромбин - это многофункциональная сериновая протеиназа. Несмотря на то, что тромбин по своей природе не является ферментом, способным связывать НК, он был первой протеиназой, для которой был получен аптамер методом  SELEX (Bock, 1992). Было показано, что он взаимодействует с фибриноген-связывающей областью белка и ингибирует активность фермента (Tsiang, 1995). Согласно данным ЯМР (Schultze, 1994) и рентгеноструктурного анализа (РСА) (Padmanabhan, 1993), ДНК-аптамер 15ТВА (thrombin-binding aptamer) имеет структуру G-квадруплекса (рис. 12). Восемь гуанинов создают два плоских G-квартета (структура «кресло»), связанных тремя петлями: две короткие Т-Т петли и одна T-G-T. Ион калия выступает стабилизирующим фактором G–квадруплекса, который выполняет роль структурообразующего элемента для ДНК–аптамера к тромбину. Позиция калия координируется атомами кислорода гуанинов внутри G-квадруплекса. Также  структура стабилизируется стэкинг-взаимодействиями нуклеотидов G8 и Т9 и верхним G – квартетом.

Рис. 12. А - Структура G-квартета в плоскости, в центре указан ион калия, который координирует карбонильные кислороды гуаниновых оснований, ниже дана проекция сбоку;  В — структура 31ТВА, который состоит из структуры 15ТВА с фланкирующими комплементарными олигонуклеотидными последовательностями. В центре представлена  структура  15ТВА

К моменту начала наших работ по селектированию был известен только один 15ТВА аптамер к тромбину. Поэтому мы выбрали его в качестве базового и предложили ряд ДНК-аптамеров, которые ингибировали прокоагулянтную активность фермента. Параллельно в ряде лабораторий мира проводили компьютерный дизайн структур аптамеров с  ингибирующей функцией (Ikebukuro, 2005). Один из них, 31ТВА, обладал улучшенной ингибирующей активностью по сравнению с 15ТВА, но структурные данные для 31ТВА отсутствовали. Нашей целью было создание ДНК-аптамера, структурным элементом которого был G–квадруплекс, так как эта необычная структура похожа на G-квартеты, найденные в природных объектах, например, у теломерных ДНК (Lipps, 2009), в промоторных областях ряда вирусов (Wang, 1994).

1.3.1. Создание ДНК-аптамеров к тромбину

На основе 15ТВА была создана библиотека случайных последовательностей с вырожденным участком в 3 нуклеотида в петле. Используя иммобилизованный тромбин в качестве мишени, было проведено 6 циклов селекции, в результате которых произошло накопление олигонуклеотидов с исходной последовательностью, как наиболее эффективно связывающейся с тромбином. Далее структура 15ТВА была усложнена дополнительным двутяжевым участком длиной 8 нуклеотидов, в котором 6 пар были комплементарными. Сразу надо подчеркнуть, что это усилило ингибирующие свойства аптамеров. Полученные аптамеры можно рассматривать как двухдоменные, состоящие из структуры G–квадруплекса (структура «кресло»), дуплексного района и соединяющего участка (шарнира). Были получены и исследованы следующие аптамеры: 15ТВА, 31ТВА, SG50, SG51, SG52, SG53, SG54, SG55, RE31 и ST43. Ниже приведены нуклеотидные последовательности аптамеров, структура 15ТВА подчеркнута:

31ТВА dCACTGGTA GGTTGGTGTGGTTGG GGCCAGTG

SG50 dCACTGGTT GGTTGGTGTGGTTGG GGCCAGTG

SG51 dCACTGGTT GGTTGGTGTGGTTGG TGCCAGTG

SG52 dCACTGGCA GGTTGGTGTGGTTGG GGCCAGTG

SG53 dCACTGGAA GGTTGGTGTGGTTGG GGCCAGTG

SG54  dCACTGGTA GGTTGGTGTGGTTGG GGTCAGTG

SG55 dCACTGGTAT GGTTGGTGTGGTTGG GGTCAGTG

RE31 dGTGACGTA GGTTGGTGTGGTTGG GGCGTCAC

ST43 dGTGACGTAT GGTTGGTGTGGTTGG GGCGTCAC

Все они удлиняли тромбиновое время в сравнении с базовым 15ТВА (табл.3).

Табл.3  Тромбиновое время в присутствии аптамерных ДНК к тромбину. Точность определения ± 3 сек.

Аптамер

1мкМ

15ТВА

31ТВА

SG50

SG51

SG52

SG53

SG54

RSG55

RE31

ST43

Тромбиновое время, сек

27

103

98

92

90

106

133

113

250

122

Молекулы SG50, SG51, SG52, SG53, SG54 и RSG55 отличаются точечными заменами в области стыковки дуплекса со структурой «кресла». Замена Т7 на С7 или А7 и С26 на Т26 в последовательностях удлиняло тромбиновое время, что свидетельствовало об улучшении ингибирующей активности аптамеров. Но самое большое удлинение было зафиксировано при замене пятизвенного фланкирующего  участка на комплементарный, при этом сохранялся дуплексный район. Таким образом, мы варьировали сочленение двух модулей, отбирая варианты, наиболее выигрышные с медицинской точки зрения. Было изучено влияние дополнительных комплементарных и некомплементарных олигонуклеотидов на структуру «кресла».

1.3.2.  Компьютерное моделирование структур ДНК-аптамеров        

Пространственная структура полученных аптамеров была неизвестна. Используя данные РСА 15ТВА (PDB ID 1HАP), было проведено компьютерное моделирование представленных аптамеров.  Центральный район каждого аптамера содержал последовательность  15ТВА; при этом аптамеры отличались фланкирующими комплементарными последовательностями и некомплементарными петлями, соединяющие эти два домена.

С помощью программ PyMol v.0.99, пакеты 3DNA и GROMACS v.3.3, были построены структуры 31ТВА, RE31, ST43. Диаметр двухтяжевого участка и структуры «кресла» не совпадали по размерам, поэтому координаты двухтяжевого участка стыковали с координатами 15ТВА с помощью программы PyMol, после чего симуляцией молекулярной динамики (МД) проводили оптимизацию структур с помещенным в центр G–квадруплекса ионом калия для стабилизации структур. Симуляцией МД было показано, что получены устойчивые структуры. Рассматривая данные аптамеры  как двухдоменные, можно констатировать, что они представлены двумя различными конформерами, обозначенными как “bulge” и “helix” (рис. 13).

       5`-                3`-                                 5`-  3`-

               А                                                        Б

Рис. 13. Схематическое изображение структур: А) 31ТВА“bulge”. Основания Т7, А8 и G24 образуют стэкинг трех оснований; Б) 31ТВА“helix”. Основания Т7 и G25 образуют  неканоническую пару.

Отличие структур “bulge” и “helix” состоит в районе соединения структуры «кресла» (нуклеотиды G9, G10, G22, G23) со структурой дуплекса. В “helix” структуре происходит образование неканонической пары Т7-G25, А8 частично перекрывается с G24 и стабилизируется за счет стэкинг – взаимодействия, и в целом образуется упорядоченная жесткая структура. Для “bulge” структуры, наоборот, происходит нарушение пары G6-С26, и основания Т7, А8 и G24 образуют стэкинг трех оснований. До сих пор такие элементы структуры наблюдали только для тРНК. Большую подвижность атомов в “bulge” структуре подтвердили методами молекулярной динамики.

В случае RЕ31 и его близкого гомолога ST43, тромбиновое время которых в тестовых реакциях максимально,  было интересно сравнить модели этих структур с уже полученными для 31ТВА (рис. 14).

Структура RE31 резко отличается от структур 31ТВА, рассмотренных ранее. Нужно отметить другой характер взаимодействия центральной TGT-петли G-квадруплекса с верхним G-квартетом и шарнирным участком неспаренных оснований.

Итоговые структуры существенно различаются, несмотря на минимальные различия в последовательности. В структуре RE31 нуклеотиды G16-Т17 центральной петли (TGT) интеркалируют между верхним G-квартетом и первой парой участка неспаренных оснований G24-A8. Это стабилизирует структуру G-квартета, в результате чего происходит организация и ТТ-петель. Следующая пара некомплементарных оснований Т7 и G25 выстраивается в стэкинг друг с другом и с нижней парой некомплементарных оснований. Это вызывает разрушение пары C26-G6.

3`-                5`-                          3`-                5`-

Рис. 14. Слева: модель структуры аптамера RE31 (G-квадруплекс составлен G9,G10,G22, G23), справа — модель структуры аптамера ST43 (G-квадруплекс составлен ,G10,G11, G23, G24).

В структуре ST43, наоборот, с введением дополнительного Т9 нуклеотида в район шарнира появился наклон дуплексного участка. Структура становится асимметричной относительно вертикальной оси молекулы. Это приводит к образованию неканонической пары G25-T7, а не имеющее пары основание A8 интеркалирует между G26 и G25.

1.3.3. Изучение ДНК-аптамеров методом кругового дихроизма

Стабильность структур данных аптамеров было решено подтвердить  плавлением, регистрируя изменения в спектрах КД. Известно, что для классической двухтяжевой формы ДНК характерен спектр КД с положительным максимумом около 270 нм и отрицательным максимумом, а структуре G-квадруплекса соответствует появление положительного максимума КД при 294-295 нм и отрицательного максимума при 268 нм. При увеличении температуры происходит постепенное снижение максимумов кругового дихроизма, что отражает разрушение структуры G-квадруплекса, т.е. переход упорядоченная структура клубок.

Полученные спектры КД 15ТВА при различных температурах приведены на рис. 15. При повышении температуры происходит постепенное уменьшение максимумов при 246, 268 нм и 294 нм.  Изменение  молярно-дихроичного поглощения при 294 нм отражает изменение структуры только G-квадруплекса, и на основании данных значений  была построена кривая плавления 15ТВА, Тпл 15ТВА составила 38,8оС (рис. 18, табл. 4).

Табл. 4. Температуры плавления аптамеров в присутствии 5 mM KCl

аптамеры

15ТВА

31TBA

RE31

Температура, С°

38,8±0,7

39,6±0,6

41,2±0,6

Рис. 15. Спектры КД 15TBA в 20 mМ Трис-HCl буфере, pH 7.5, 5 mM КСl при различных температурах.

Спектры КД для 31ТВА показывают, что в тех же условиях происходит эффективное формирование G-квадруплекса: присутствуют аналогичные экстремумы КД при 246, 268 и 294 нм (рис. 16).

Рис. 16. Спектры КД 31TBA в 20 мМ

трис-HCl буфере, pH 7.5, 5 мM КСl

при различных температурах.

Следует отметить, что значение максимума КД при 294 нм уменьшается по сравнению с 15ТВА на 20%, а абсолютное значение максимума КД при 268 нм увеличивается (на 30-35%), что связано, по-видимому, с вкладом комплементарного участка 31ТВА. Тпл 31ТВА, рассчитанная аналогично, составляет 39,6±0,6оС, что сравнимо с  Тпл  для 15ТВА в пределах ошибки опыта (табл. 4).

В спектрах КД RE31 значение положительного максимума при 294 нм увеличивается в 1,5 раза по сравнению со спектрами для 31ТВА, при этом возрастает Тпл, что свидетельствует об изменении конформации молекулы, она стала более асимметричной (рис. 17, 18). Это связано с измененными фланкирующими нуклеотидными последовательностями, что совпадает и с описанием моделей, построенных с помощью данных по МД.

                                                               

Рис. 17. Спектры КД RE31 в 20 мМ трис-HCl буфере, pH 7.5, 5 мM КСl при различных температурах

Таким образом, введение дополнительного модуля с различной нуклеотидной последовательностью может как  увеличивать, так и уменьшать стабильность структуры G-квадруплекса.

Рис. 18. Кривые плавления 15ТВА, 31ТВА и RE31 в 20 мМ Tрис-HCl  буфере, pH 7.5, 5 мM КСl.

Cтруктуры всех полученных аптамеров образовывали структуры G-квадруплексов, что подтверждено спектрами КД (рис.19).

Рис. 19. Спектры КД 31TBA, SG50, SG51, SG53, SG55 в 20 мМ Tрис-HCl  буфере, pH 7.5, 5 мМ калия  при 20 оС.

Известно, что ион К+ стабилизирует структуру G-квадруплекса. Чтобы оценить влияние иона калия, были получены спектры КД 15ТВА в отсутствие ионов К+ (рис. 20). В них присутствуют характерные экстремумы, но небольшие по величине, что свидетельствует о формировании G-квадруплекса, но при повышении температуры происходит быстрое падение максимума при 294 нм. 

Рис. 20. Спектры КД 15TBA в 20 мМ Tрис-HCl  буфере, pH 7.5, в отсутствие калия  при различных температурах.

Тпл  G-квадруплекса 15ТВА без калия равна 25,2 о С.

Для того чтобы оценить вклад G-квадруплекса в структуру аптамера, был получен 31-звенный олигонуклеотид 31ТВА(G14А) dCACTGGTAGGTTGATGTGGTTGGGGCCAGTG с заменой G14 на А14 (G14A), которая  препятствует  образованию G-квадруплекса.

Рис. 21. Спектр КД 31ТВА(G14А) в 20 мМ трис-HCl  буфере, pH 7.5 в присутствии  5 мМ КСl при различных температурах.

Можно заметить, что максимум 31ТВА (G14A) при 295 нм исчезает (рис. 21). Спектры данного олигонуклеотида  при различных температурах представляют собой извилистую линию с отсутствием экстремумов, характерных  для G-квадруплексов. Введение замены G14A, по-видимому, разрушило G-квадруплекс.

Чтобы оценить вклад коротких двухтяжевых участков, составляющих второй домен в данной структуре, были исследованы спектры КД 6-звенных фрагментов (D1: dCACTGG; D2: dCCAGTG), фланкирующих  структуру «кресло» при низких температурах.

Рис. 22 Спектры КД  комплементарных двухтяжевых 6-звенных фрагментов в 31ТВА  в 20 мМ трис-HCl  буфере, pH 7.5 в присутствии 40 мM КСl при 5оС. Для сравнения приведен спектр КД 15ТВА.

Спектры КД  олигонуклеотидов D1 и D2 представляют собой слабо извилистую линию, что указывает на отсутствие какой-либо структуры, которая могла быть зафиксирована спектрами КД. В то же время спектр  их эквимолярной смеси при низких температурах (5оС) имеет характерный максимум при 270 нм, что свидетельствует о формировании данными олигонуклеотидами дуплекса (рис. 22).

Чтобы ответить на вопрос, влияет ли наличие дополнительных фрагментов на формирование G-квадруплекса, был получен аптамер 31ТВА(D3,D4) 5`-dACACCCTAGGTTGGTGTGGTTGGGGCCAGTG, в котором структура G-квадруплекса была фланкирована некомплементарными последовательностями D3: dACACCCTA  и D4: GGCCAGTG (рис. 23 А, Б). Как следует из полученных спектров, G-квадруплекс у 31ТВА(D3,D4) в стандартных условиях  не формируется. Сдвиг положительного максимума к 280 нм и образование плеча указывает на образование другой сложной структуры, возможно, неструктурированного клубка. G-квадруплекс не образуется даже при увеличении концентрации ионов калия до 100 мM КСl (рис. 23 Б ). По-видимому, отсутствие дуплекса не только не поддерживает структуру «кресла» в G-квадруплексе, а даже препятствует её образованию в присутствии высоких концентраций ионов калия.

       А        Б

Рис. 23.  A - Спектр КД 31ТВА(D3,D4) в 20 мМ Трис-HCl буфере, pH 7.5 в присутствии 5 мМ КСl при 18оС. Б - Спектр КД 31ТВА(D3,D4) в 20 мМ Tрис-HCl буфере, pH 7.5 в присутствии 100 мМ КСl при 20оС.

1.3.4.  Комплексы ДНК-аптамеров с тромбином

Нами было изучено сродство данных аптамеров к тромбину в различных буферах и с различными препаратами фермента. Стабильность комплексов была оценена электрофорезом в полиакриламидном геле, фильтрованием на нитроцеллюлозных мембранах.

В присутствии  увеличивающегося количества тромбина пропорционально возрастала доля удерживаемого аптамера (рис. 24 А, Б). Отсутствие  ионов калия в буфере ухудшало комплексообразование в несколько раз (рис. 24 Б). Было отмечено, что сродство ДНК-аптамера к тромбину, с высокой  удельной активностью (4500 ед. NIH/мг) было в 20 раз эффективнее (5.6 нМ), чем для препаратов тромбина с активностью 1200 ед. NIH/мг (84 нМ), как в первом, так и во втором буфере, которые отличаются наличием ионов калия. Буфер с ионом калия был выбран, как близкий по солевому составу к плазме крови.

Рис. 24. А. Изотермы связывания тромбина с аптамерной ДНК в буфере 20мМ трис-Ас (рН 7.4), 1 мМ CaCl2, 140 мМ NaCl, 5 мМ KCl, 1 мМ MgCl2.: 1) – препарат тромбина с активностью 1200 NIH ед./мг, Кd=160±6.9 нМ; 2) – препарат тромбина с активностью 4500 NIH ед./мг, Кd= 10.2±1.9 нМ. Б. Изотермы связывания тромбина с аптамерной ДНК в буфере 20мМ трис-Ас (рН 7.4), 100 мМ NaCl, 1мМ MgCl2: 1) – препарат 

Для оценки связывания ДНК с тромбином  на нитроцеллюлозных фильтрах препарат аптамера метили -32Р-АТФ. Для фиксирования комплекса с помощью электрофореза в ПААГ реакцию проводили при постоянной концентрации ДНК (80 и 100 нM в различных случаях), и варьировали концентрацию тромбина в пределах 20-400 нM. Инкубировав реакционную смесь при 5оС не менее часа, комплексы белка с олигонуклеотидами отделяли от свободных олигонуклеотидов в 8 %-ом неденатурирующем ПААГ. В случае 31ТВА, RE31 SТ43 и других олигонукдеотидов использовали окрашивание геля флуоресцентным красителем SybrGreen. Комплексы, как с радиоактивной, так и с флуоресцентными метками детектировали на приборе FLUORESCENT IMAGE ANALYZER (FLA-3000 series), Fujifilm (рис. 25).

Рис. 25. Электрофореграммы комплексообразования тромбина с аптамерами в 8 %-ом неденатурирующем ПААГ. Суммарный объем реакционной смеси составлял в каждом опыте 25мкл, реакцию проводили при постоянной концентрации ДНК и варьировали концентрацию тромбина в пределах 20-400 нМ: А - комплексообразование 15ТВА (150 нМ) с тромбином (20-400 нМ); Б – комплексообразование 31ТВА (80 нM) с тромбином (20 – 150 нМ),  В — комплексообразование RE31 (80нМ) с тромбином  (20-150 нМ); Г- комплексообразование ST43 аптамера (100нМ) с тромбином (80 - 400 нМ).

Табл. 5. Константы диссоциации Kd, nM, определенные методом Скэтчарда

аптамер

15-ТВА

31ТВА

RE31

ST43

Kd,  nM

50,4±17,1

10,2±2,2

7,2±2,1

12,1±2,4

В табл. 5 приведены кажущиеся константы диссоциации комплексов, полученных при электрофорезе в ПААГ. Важно заметить, что значения констант диссоциации рассчитаны для комплексов в электрическом поле, т.е. в жестких условиях электрофореза, а не в растворе.

       А        В

                               Г

       Б        Г

  Рис. 26. Изотермы связывания аптамеров с тромбином в координатах Скэтчарда: А) 15ТВА, Б) 31ТВА, В) RE31, Г) ST43, согласно данным электрофореза в ПААГ.

Построение изотерм связывания для каждой серии опытов позволило оценить сродство нуклеиновых препаратов к белку (рис. 26).

Очевидно, что наилучшей константой диссоциации обладает комплекс тромбина с RE31. 15ТВА обладал меньшим сродством к тромбину. Повышенное сродство RE31 аптамера к тромбину, видимо, связано с наличием двухтяжевого участка, который, возможно, дает дополнительные контакты с белком. 

Одним из современных физических методов, который позволяет получить не только равновесные характеристики связывания, но и кинетические, является метод поверхностного плазмонного резонанса (ППР), используемый в приборах Биакор. С помощью ППР также было доказано образование комплексов аптамерных ДНК с тромбином (рис.27). В приборе Биакор один из взаимодействующих партнеров, лиганд, иммобилизован на поверхности биосенсора (чипа), а другой, аналит, растворен в буфере, который протекает над поверхностью чипа. Образование и диссоциация комплекса между двумя взаимодействующими молекулами сопровождается ППР, который отражает изменение массы на поверхности чипа. Сигнал записывается в виде сенсограммы. Используя иммобилизованный тромбин на чипе СМ5, был получен сигнал с увеличением концентрации аптамера в аналите, но амплитуда сигнала  была невелика. Было решено провести обратный эксперимент. Иммобилизовать аптамер на чипе, а в аналите пропускать тромбин различной концентрации.

               А                                                        Б

Рис. 27. Сенсограммы: А - связывание аптамера RE31 c тромбином, иммобилизованном на чипе СМ5: Б связывание тромбина с RE31-биотин, иммобилизованном на стрептавидиновом чипе. Приборный рисунок. Увеличение резонансного отклика при повышении концентрации тромбина  в растворе: 5,4; 17; 34; 68; 135 и 270 нМ (кривые снизу-вверх).

Увеличение концентраций тромбина приводит к усилению сигнала. Это позволяет предположить, что данный метод может быть использован не только для качественного, но и количественного определения концентрации тромбина в растворимой фазе как аналог биосенсора.

  Рис. 28. Кривые ингибирования тромбина аптамером. при различных  концентрациях фибриногена: 1. - 19мкМ; 2 — 26 мкМ; 3 -38 мкМ.

Было изучено  влияние  31ТВА  аптамера на ферментативную активность тромбина in vitro (рис. 28). Было установлено, что аптамер ингибирует гидролиз фибриногена при увеличении концентрации ДНК-аптамера вплоть до 700 нМ, что значительно превышало концентрацию фермента в реакции. 

1.3.5. Тромбин – ключевой белок свертывания крови

Тромбин – это сериновая протеиназа, которая расщепляет пептидную связь, образованную аргинином или лизином в низкомолекулярных субстратах (амидолитическая активность). Тромбин играет центральную роль в процессах свертывания крови. Он гидролизует высокомолекулярный субстрат, фибриноген, до фибрина, а также расщепляет мембранный рецептор на тромбоцитах, способствуя их агрегации. Тромбин регулирует прямо противоположные реакции: свертывание крови, противосвертывание, фибринолиз и агрегацию тромбоцитов. Направленность (специфичность) его действия определяется тем, что в реакциях гидролиза высокомолекулярных субстратов участвуют  как минимум, два участка молекулы тромбина – активный центр фермента и области специфичного «узнавания» ряда субстратов и кофакторов (экзосайт I и экзосайт II). При повреждении стенки кровеносных сосудов начинается каскад протеолитических реакций, где каждый предыдущий белковый фактор (протеаза) активирует каждый последующий (Струкова, 1997, 2001). Протромбин, синтезируемый печенью как неактивный предшественник, активируется X фактором в комплексе с V, а появившийся  тромбин не только гидролизует фибриноген до фибрин-мономера – структурной основы тромбов, но и стимулирует свое образование, активируя белковые факторы V, VIII, XI, участвующие в гемостазе. Тромбин является наиболее мощным из известных индукторов активации тромбоцитов. Он специфически взаимодействует с PAR рецепторами, (рецепторы, активируемые протеазами) на мембране тромбоцитов и отщепляет пептид от внеклеточного N-конца их аминокислотной последовательности. Образующийся новый N-концевой фрагмент взаимодействует со специальным участком рецептора, что и приводит к активации и последующей агрегации тромбоцитов. Рост тромба сопровождается самополимеризацией фибрина с образованием протофибрилл с образованием больших узлов фибриновых молекул, ветвлением волокон с захватом агрегатов тромбоцитов и других клеток крови. Стабильность тромба повышается под действием XIII белкового фактора (трансглутаминазы), который образует изопептидные связи между боковыми цепями лизина и глутаминовой кислоты (Панченко, Добровольский, 1999).

Наиболее известные антитромбиновые препараты – это гепарин и его низкомолекулярные производные. Они подавляют функции тромбина, стимулируя активность антитромбина III, его главного эндогенного ингибитора. К числу недостатков гепарина относится непрямой характер его действия, связывание с другими белками плазмы крови и клеток сосудистого русла, и такие нежелательные эффекты, как тромбоцитопения и непрямая  активация тромбоцитов. Этими недостатками не обладают прямые ингибиторы тромбина – белок гирудин, выделенный из медицинских пиявок, и его производные (бивалирудин), а также некоторые низкомолекулярные органические соединения (аргатробан, мелагатран). Все они действуют на активный центр тромбина (или совместно на активный центр и центр связывания субстратов, называемых экзосайт I и экзосайт II) и, таким образом, ингибируют как его прокоагулянтные, так и антикоагулянтные эффекты. Прямые ингибиторы тромбина, полученные на основе ДНК-аптамеров, взаимодействуют лишь с участками связывания субстратов (на основе данных рентгеноструктурного анализа) (Padmanabhan, 1993). Они не вызывают иммуногенных реакций и могут быть основой  для создания лекарственных препаратов, для лечения и профилактики тромбозов.

1.3.6. Ингибирование процессов свертывания крови ДНК-аптамерами

Было исследовано влияние аптамеров на две ключевые реакции тромбина – образование фибрина из фибриногена и стимуляцию агрегации тромбоцитов. Образование фибрина происходит в результате протеолитического отщепления от фибриногена фибринопептидов А и B. На поверхности тромбоцитов тромбин взаимодействует со специфическими PAR рецепторами.

Из полученных нами аптамеров были выбраны четыре: 15ТВА, 31ТВА, RE31 и ST43. Мы сравнивали наши результаты с литературными данными для 15ТВА. Для 31ТВА было известно только тромбиновое время, поэтому мы  исследовали ингибирующие активности аптамеров RE31 и ST43, сравнивая их между собой и с литературными данными. Все аптамеры 15ТВА, 31ТВА RE31 и ST43 влияют на ингибирование процессов свертывания крови, не затрагивая процесс расщепления тромбином низкомолекулярного субстрата (амидолитическая активность). Все аптамеры при добавлении к плазме крови человека подавляли коагуляционную активность тромбина, удлиняя тромбиновое время, протромбиновое время и АЧТВ (рис. 29 А, Б, В).

Тромбиновое время отражает скорость образования фибринового сгустка после добавления к плазме экзогенного тромбина, а протромбиновое время и АЧТВ – скорость образования сгустка при действии эндогенного тромбина. При измерении протромбинового времени свертывание активируется по внешнему пути (последовательная активация факторов VII, X, V и протромбина), а при измерении АЧТВ по внутреннему пути (последовательная активация факторов XII/прекалликреина, XI, IX, VIII, X и протромбина) (Панченко, Добровольский, 1999).

Рис. 29. Влияние аптамеров RE31, ST43, 31ТВА и 15ТВА на свертывание плазмы крови человека. Аптамеры добавляли в указанных концентрациях к плазме крови человека и регистрировали тромбиновое время (используя тромбин человека) (А), протромбиновое время (Б) и АЧТВ (В). Во всех тестах регистрировали время образования фибринового сгустка.

Было показано, что RE31 обладает наиболее выраженным ингибирующим действием, чем остальные аптамеры. Тромбиновое время у RE31 (0,5мкМ) увеличивается более, чем в 10 раз, а для 15ТВА (0,5 мкМ) только в 3 раза. Протромбиновое время (активация свертывания крови по внешнему пути) при введении 1мкМ раствора RE31 увеличивается с 12 до 105 секунд, т.е. в 9 раз, а для 15 ТВА (1мкМ) лишь в 1,5 раза. При изучении влияния аптамера на активацию внутреннего пути свертывания крови АЧТВ у RE31 (1мкМ) изменяется от 35 до 160 секунд, а для 15ТВА (1мкМ) от 30 до 50 секунд. При сравнении воздействия аптамера и гепарина 1мкмоль 15ТВА вызывает тот же эффект ингибирования, что и 0,15 единиц/мл гепарина, но за меньшее время АЧТВ. Ингибирующая способность у аптамера RE31 была выше, чем у 31ТВА, во всех трех тестах сходные эффекты (удлинение времени свертывания плазмы крови)  наблюдались при более низких концентрациях RE31.

31ТВА, RE31, ST43 и 15 ТВА не влияют на амидолитическую активность, т.е.  ингибируют только присоединение высокополимерного субстрата (фибриногена) к тромбину (табл. 6). Активность тромбина по отношению к трипептиду, хромогенному субстрату “Chromozym TH”, который взаимодействует только с активным центром, не менялась. Скорость расщепления  хромогенного субстрата Tos-Gly-Pro-Arg-pNA была одинаковой в отсутствие и в присутствии 1 мкМ аптамеров. Степень его расщепления, регистрируемая по увеличению оптической плотности при 405 нм, не снижалась в присутствии всех исследуемых аптамеров, что еще раз подтверждает, что аптамеры взаимодействуют с экзосайтами, не затрагивая активный центр.

Табл. 6. Амидолитическая активность тромбина в присутствии аптамеров.

Аптамер (1мкМ)

Контроль

15ТВА

31ТВА

RE31

ST43

А405 / мин

± 0,002

0,257

0,259

0,273

0,259

0,262

Таким образом,  аптамеры ингибировали образование фибрина, стимулированное как экзогенным тромбином, так и эндогенным тромбином, образующимся в результате активации коагуляционного каскада плазмы крови.

1.3.7. Влияние мутантного аптамера на процесс свертывания крови

Изучая мутантный 31ТВА(G14A), у которого один из гуаниновых остатков заменен на аденин, так что в результате не собирается структура «кресло» (подтверждено КД спектрами, рис. 20), было показано, что при концентрации 1 мкМ он не оказывал влияния на свертывание фибриногена.  Тромбиновое время было 12,5 сек и 12,0 сек, как в присутствии 31ТВА(G14A), так и без него, соответственно. АЧТВ составляло 32,2 сек и 30,0 сек как в присутствии, так и в отсутствие 1ТВА(G14A),  соответственно.

1.3.8. Влияние  аптамеров  на агрегацию тромбоцитов

Известно, что тромбин взаимодействует с двумя высокомолекулярными субстратами: фибриногеном и PAR-1 рецептором тромбоцитов (безъядерных клеток крови). Аптамеры эффективно ингибировали как гидролиз фибриногена, так и агрегацию отмытых от плазмы тромбоцитов, индуцированную тромбином (рис. 30).

Исследование агрегации тромбоцитов в присутствии 15ТВА, 31ТВА, RE31, ST43 и 31TBA(G14A) аптамеров показало, что агрегация отмытых тромбоцитов, индуцированная тромбином в концентрации 0,1 ед/мл, полностью ингибируется RE31 при концентрации 0,05 мкМ , 31ТВА - при 0,1 мкМ, а 15ТВА – при 0,2 мкМ.  Созданный  аптамер RE31 обладает  наибольшей ингибирующей активностью (рис. 31). Как было показано ранее, он обладает более высоким сродством по отношению к тромбину, и, как следствие, он более эффективно ингибирует активность тромбина по сравнению с базовым 15ТВА аптамером.

Рис. 30. Ингибирование тромбин-индуцированной агрегации тромбоцитов аптамерами 15ТВА и 31ТВА. (а) К отмытым тромбоцитам не добавляли аптамеров (кривая 0) или добавляли 0,1 мкМ 31ТВА (кривая 1), 0,1 мкМ 15ТВА (кривая 2) или 1 мкМ 31ТВА(G14A) (кривая 3). Агрегацию тромбоцитов стимулировали добавлением 0,1 ед/мл тромбина (тромбин добавляли через 30 сек после начала регистрации светопропускания (% Т), и затем измеряли агрегацию в течение 4,5 мин. Представлены результаты одного из 3 воспроизводимых экспериментов. (б) Агрегацию тромбоцитов стимулировали 0,1 ед/мл тромбина в отсутствие аптамеров и в присутствии различных концентраций 31ТВА (кривая 1) и 15ТВА (кривая 2). Определяли максимальный уровень агрегации в % от контроля (без аптамеров, 100%).

Рис. 31. Сравнение эффектов ингибирования тромбин-индуцированной агрегации тромбоцитов человека аптамерами RE31 и 31ТВА. (а) К отмытым от плазмы тромбоцитам не добавляли аптамеров (кривая 0) или добавляли 0,025 мкМ RE31 (кривая 1) и 0,025 мкМ 31ТВА (кривая 2). Агрегацию тромбоцитов стимулировали добавлением 0,25 ед/мл тромбина человека (тромбин добавляли через 30 сек после начала регистрации светопропускания). Представлены результаты одного из 4 воспроизводимых экспериментов. (б) Агрегацию тромбоцитов стимулировали 0,25 ед/мл тромбина в отсутствие аптамеров и в присутствии различных концентраций RE31 (кривая 1) и 31ТВА (кривая 2). Определяли максимальный уровень агрегации в % от контроля (без аптамеров, 100%).

1.4. Создание  модифицированных производных аптамеров. Оценка эффективности ингибирующего действия модифицированных аптамеров на активность тромбина и возможность подавления тромбообразования в модели in vivo

1.4.1. Свойства модифицированных  аптамеров 

       При введении аптамеров  в кровоток возникает проблема их стабильности и длительности действия в системе in vivo. На сегодняшний день используемые  прямые низкомолекулярные прямые ингибиторы тромбина выводятся за 40 – 90 минут. Полученный  активный аптамер RE31 выводился из кровотока за 10 минут, поэтому было предложено ввести химические модификации по 5`-  и 3`-концам молекулы. С одной стороны,  вводимые группы должны были защищать от действия нуклеаз, с другой стороны, препятствовать выведению аптамера через почки. Известно, что для снижения скорости вывода лекарств через почки используют полиэтиленгликоль (ПЕГ) различной молекулярной массы. Поэтому одно из производных RE31 содержало ПЕГ группировки по обоим концам. Также было предложено вводить аминогруппу с помощью аминогексанола, как наиболее легко вводимую защиту. Были получены три варианта модифицированных производных аптамера RE31: PREP, PREА и АREP, где А – производное аминогексанола, Р – производное ПЕГ. Все три модифицированных соединения  были проверены  по двум тестам: тромбиновое время и протромбиновое время (рис. 32).

  А Б

Рис. 32. Влияние аптамеров RE31, PRE31P, PRE31А и  АRE31P на свертывание плазмы крови человека. Аптамеры добавляли в указанных концентрациях к плазме крови человека и регистрировали тромбиновое время (используя тромбин человека) (А) и протромбиновое время (Б). Во всех тестах регистрировали время образования фибринового сгустка. На всех рисунках представлены результаты одного из 3-4 воспроизводимых экспериментов.

Из представленных графиков видно, что ингибирующая активность модифицированных аптамеров сохраняется, хотя и немного снижается в сравнении с исходным RE31. Наилучший результат был получен с АREP, поэтому было изучено его комплексообразование с тромбином в полиакриламидном геле (рис. 33). Отчетливо видно, что модифицированный  аптамер АREP образовывал комплекс с тромбином. Кажущаяся константа диссоциации составляла ~ 100нМ. Это позволило приступить к модельным опытам на животных.

Комплекс

Аптамер

Рис. 33. Электрофореграммы комплексообразования тромбина с аптамерами в 8 %-ом неденатурирующем ПААГ. Суммарный объем реакционной смеси составлял в каждом опыте 25мкл, реакцию проводили при постоянной концентрации АREP 200нМ. 1 – контроль,  концентрацию тромбина варьировали  в пределах 100-1500 нM.

1.4.2. Изучение влияния ДНК-аптамеров на коагуляционную способность плазмы крови на животных моделях

Перед началом проведения экспериментов на животных было необходимо выяснить возможность существования видоспецифичности аптамеров по отношению к тромбинам разных экспериментальных животных. Наиболее удобными на этом этапе представлялось проведение экспериментов на крысах или кроликах. Использование более крупных животных (например, собак) потребовало бы большего расхода исследуемых аптамеров, а более мелких (например, мышей) – затруднило бы проведение неоднократного забора крови для исследования динамики подавления тромбиновой активности.

Исследование видоспецифичности проводили на RE31. Удлинение тромбинового времени в присутствии RE31 было существенно более выражено при стимуляции свертывания тромбином человека по сравнению с тромбином крысы (при некоторых концентрациях аптамера регистрировались 3-4-кратные различия), а при использовании тромбина кролика аптамер в применяемых концентрациях вообще не оказывал ингибирующего действия (рис. 34). При этом в контрольных образцах (без аптамера) время образования сгустка было приблизительно одинаковым  всех трех тромбинов – в среднем около 10 сек.

Рис. 34. Действие аптамера RE31 на свертывание плазмы крови человека, стимулированное тромбином человека, крысы и кролика. Аптамер RE31 добавляли к плазме в указанных концентрациях и регистрировали тромбиновое время образования сгустка после внесения в пробу тромбина человека (кривая 1), тромбина крысы (кривая 2) и тромбина кролика (кривая 3). Представлены результаты одного из 3 воспроизводимых экспериментов.

В связи с тем, что в отличие от тромбина кролика, активность тромбина крысы достаточно эффективно подавлялась в присутствии аптамеров (хотя и в более высоких концентрация, чем при использовании тромбина человека), для экспериментов in vivo в качестве экспериментального животного была выбрана крыса.

Данные по видоспецифичности аптамеров еще раз указывают на сходство в характеристиках аптамеров и антител, в данном случае с точки зрения их высокой специфичности по отношению к мишени.

1.4.3.1. Оценка эффективности ингибирующего действия модифицированных аптамеров на активность тромбина и возможность подавления тромбообразования в модели in vivo

Антитромботическую активность модифицированного аптамера проверяли на модели артериального тромбоза у крыс, индуцируемого обработкой сосуда раствором хлористого железа. Для изучения были использованы крысы самцы. Первоначально крыс наркотизировали, а затем послойно обнажали сосуд, и на открытую сонную артерию длиной в 2 см присоединяли датчик расхода кровотока, а также устанавливали  катетер для  введения соответствующих препаратов. После периода стабилизации кровотока (в течение 5-10 минут) осуществляли внутривенное болюсное введение аптамеров через катетер. В качестве контроля использовали введение 0,2 мл физиологического раствора.  Через 10 минут к участку сонной артерии прикладывали тампон, смоченный 50% раствором хлористого железа, что способствовало образованию тромба. В течение часа от установки аппликации хлористого железа вели регистрацию расхода кровотока. В ходе эксперимента следили за уменьшением или остановкой кровотока и фиксировали время частоту остановки окклюзии кровотока. В контрольной пробе время окклюзии составляло 20 минут, масса тромба составляла около 8 мг. При введении аптамера время увеличивалось до 120 минут, при этом масса тромба была меньше 1 мг (рис. 35). Таким образом, были  получены положительные результаты в модельных экспериментах (как на клеточных, так и на животных моделях). Высокая антитроботическая активность модифицированного аптамера  позволяет утверждать, что на его основе может быть создана лекарственная форма, использующая  фрагмент нуклеиновой кислоты.

Рис. 35. Действие аптамера AREP на тромбообразование in vivo

(FeCl2 модель, крыса)

1.5. Создание антидота к аптамерной ДНК. Изучение  конкурентного взаимодействия аптамера к тромбину с антидотом в нуклеопротеидном комплексе аптамер-тромбин

1.5.1. Создание  антидота к аптамерной ДНК

Уникальное свойство нуклеиновых кислот образовывать комплексы с комплементарной олигонуклеотидной последовательностью позволило разработать антидот к  ДНК аптамеру, который раскрывает структуру аптамера, изменяет структуру G-квадруплекса, тем самым разрушает комплекс аптамера с тромбином. Сравнивая прямые ингибиторы тромбина, низкомолекулярные (аргатробан, дабигатран), пептидной природы (гирудин, бивалирудин), для которых не получены антидоты, с ДНК-аптамерами, к которым имеются антидоты, нужно подчеркнуть, что это является большим преимуществом в использовании препарата в медицинской практике. Возможность синтезировать комплементарную последовательность (антидот) позволяет разработать пару, лекарство – антидот, что, безусловно, даст возможность регулировать  введение препарата, и быстрой отмены его действия.

Первоначально разработка антидота была смоделирована на 31ТВА аптамере и комплементарной последовательности к нему. Поскольку в структуру 31ТВА включены комплементарные последовательности, то представляется интересным оценить влияние данных участков на G-квадруплексную половину добавлением комплементарной олигонуклеотидной последовательности. С помощью спектров КД было показано разрушение структуры «кресло» в аптамере (рис. 36).

Чтобы определить характер спектра в присутствии обеих форм, добавляли меньшее, чем нужно по стехиометрии, количество комплементарной цепи (рис. 36). При добавлении комплементарного олигонуклеотида появляется плечо при 275-280 нм, что свидетельствует об образовании двухтяжевой ДНК. При избыточном количестве комплементарной цепи  31ТВА-rev аптамер  полностью переходил в двухтяжевую структуру, т.е. образование двуцепочечной ДНК эффективно конкурирует с G-квадруплексной структурой, разрушая последнюю.

Рис. 36. Спектры КД  31ТВА в буфере (20мМ трис-ацетат, 5 мМ KCl) в присутствии комплементарного олигонуклеотида rev31 (соотношение концентраций 31ТВА/ rev31 – 1:0.5, 1:1, 1:2 соответственно) при 18оС.

Рассматривая 31ТВА как многообещающий противосвертывающий агент, комплементарный олигонуклеотид  представляет собой антидот к 31ТВА.

1.5.2. Изучение конкурентного взаимодействия аптамера к тромбину с антидотом в нуклеопротеидном комплексе аптамер-тромбин

Разрушение комплекса аптамера RE31 с тромбином было продемонстрировано с помощью электрофореза в полиакриламидном геле (рис. 37).

Отчетливо видно, что при добавлении комплементарной олигонуклеотидной последовательности комплекс разрушается, а интенсивность полосы, соответствующей аптамеру, увеличивается. Следовательно, рассматриваемые комплементарные олигонуклеотиды могут выступать антидотами  для быстрой отмены действия препарата, например, в случае его передозировки.

Рис. 37. Электрофореграмма комплексообразования тромбина с RE31 в 8 %-ом неденатурирующем ПААГ. Суммарный объем реакционной смеси составлял 25 мкл, реакцию проводили при постоянной концентрации ДНК (80 нM) и тромбина (240 нМ). Справа налево: 1 – молекулярные маркеры, 2 - RE31, 3 - комплекс RE31 с тромбином, 4 – добавление комплементарного олигонуклеотида (200 нМ), 5 – добавление комплементарного олигонуклеотида (500 нM).

Заключение

По своим свойствам: высоко аффинному и специфическому связыванию с молекулой мишенью и способности ингибировать ее активность, аптамеры напоминают моноклональные антитела. Однако в отличие от антител, они могут быть синтезированы химически, что упрощает возможности их технологичной наработки в больших количествах. А кроме того, в отличие от белковых молекул антител при введении в организм они не вызывают иммунных и аллергических реакций.

Выводы

  1. Методами компьютерного анализа и моделирования in silico показано, что два белка-аналога EcoS7 и TthS7 по первичной структуре идентичны на 52%, а в зоне РНК-белковых контактов в 30S субчастице – на 83%. Получены гомологичные и гетерологичные комплексы EcoS7,  TthS7 с фрагментом  16S рРНК с использованием  белков EcoS7,  TthS7, выделенных из суперпродуцентов E.coli. Определены константы диссоциации комплексов, что позволило cделать вывод о консервативности РНК-связывающего центра белков.
  2. Делеционный анализ межцистронного фрагмента S12-S7 str мРНК показал, что для взаимодействия как с белком EcoS7, так и с TthS7 необходим фрагмент РНК около 84 нуклеотидов длиной, заключенный между терминирующим кодоном цистрона S12 и инициирующим кодоном цистрона S7.
  3. Используя комбинаторную библиотеку на основе межцистронного регуляторного участка Ecostr мРНК с рандомизированной пентануклеотидной последовательностью, создан фрагмент РНК, связывающий белок TthS7, который в начале эксперимента не обладал сродством к данному белку. Тем самым показана принципиальная возможность создания регуляторных участков трансляции рибосом в клетке. 
  4. Созданы ДНК-аптамеры к тромбину, которые обладали G-квадруплексной пространственной структурой и ингибировали прокоагулянтную активность фермента. Изучена их структура методами молекулярной динамики и кругового дихроизма. Подтверждено наличие структуры «кресла» как для 15ТВА, так и для  31ТВА, SG50, SG51, SG52, SG53, SG54, RSG55, RE31 и ST43. Показано, что в присутствии комплементарной последовательности  структура «кресла» раскрывается и переходит в двухтяжевую структуру.
  5. С помощью электрофореза в неденатурирующих условиях показано образование комплексов аптамерных ДНК с тромбином in vitro, рассчитаны кажущиеся константы диссоциации, величины которых свидетельствуют о высоком сродстве данных аптамеров к тромбину.
  6. Исследовано влияние 15ТВА и 31ТВА, RE31, ST43, SG50, SG51, SG52, SG53, SG54, RSG55 и их модифицированных производных на активность тромбина. Показано, что при добавлении к плазме крови человека аптамеры вызывали зависимое от дозы удлинение тромбинового времени, протромбинового времени и активированного частичного тромбопластинового времени. Это свидетельствует о влиянии аптамеров на процессы свертывания крови и тромбообразования.
  7. Показано, что аптамеры ингибируют не только гидролиз фибриногена, но и активацию PAR-1 рецептора тромбоцитов. Это приводит к ингибированию процесса агрегации тромбоцитов человека и дополнительно замедляет процессы свертывания крови. В то же время аптамеры не влияют на амидолитическую активность тромбина.
  8. Таким образом, исследуемые антитромбиновые ДНК-аптамеры, не влияя на активный центр тромбина, способны эффективно подавлять его две ключевые реакции – образование фибрина и стимуляцию агрегации тромбоцитов. Испытания на животных подтвердили антитромбиновую активность ДНК-аптамеров в процессах свертывания крови.

Список работ:

Обзоры:

  1. Спиридонова В.А. Аффинная хроматография, основанная на нуклеиново-белковых взаимодействиях // Итоги науки и техники, серия Молекулярная биология, Москва, 1975. Т. 4, С. 176-217; ISSN 0202-7070
  2. Копылов А.М., Спиридонова В.А., Парк К-Х. Применение аптамеров в медицинской диагностике и терапии // Российский Химический Журнал. 1998. Т. 42, С. 89-96; ВАК
  3. Копылов АМ, Спиридонова ВА. Комбинаторная химия нуклеиновых кислот: SELEX //Молекулярная биология. 2000. Т. 34, С. 1097-1113; ВАК
  4. Спиридонова В.А. Молекулярные узнающие элементы - ДНК/РНК аптамеры к бекам // Биомедицинская химия. 2010. Т. 56 (6), 639-656; ВАК

Статьи:

  1. Spiridonova V.A., Gyenge L., Bogdanov A.A. RNA-protein interactions in the ribosomes III. Complexing of ribosomal RNA with sepharose-bound ribosomal proteins // FEBS Lett. 1972. V. 20, Р.209-212; (IF- 3,54)
  2. Спиридонова В.А., Дьенге Л., Богданов А.А. Связывание рибосомных РНК с белками рибосом, ковалентно закрепленными на полимерных носителях // Биохимия. 1975. T. 40, С.83-88; ВАК
  3. Спиридонова В.А., Каграманова В.К., Баратова Л.А., Голова Ю.Б., Чекулаева Л.Н., Манькин А.С. Клонирование гена рибосомного белка HS4 архебактерии Halobacterium halobium // Биоорганическая химия. 1988. T. 14, С.16-118; ВАК
  4. Spiridonova V.A., Akhmanova A.S., Kagramanova V.K., Kopke A.K.E., Mankin A.S.Ribosomal prоtein gene cluster Halobacterium halobum: nuclеotide sequence of the genes coding for S3 and L29 equivalent ribosomal proteins // Canadian J. of Biochemistry and Cell Biology. 1989. V. 35, Р.153-159.
  5. Karginov A.V., Karginova O.A., Spiridonova V.A., Kopylov A.M. In vivo assembly of plasmid-expressed ribosomal protein S7 of Thermus thermophilus into Echerichia coli ribosomes and conditions of its overexpression // FEBS Lett. 1995. V. 369, Р.158-160; (IF- 3,54)
  6. Исаева Л.В., Спиридонова В.А., Люмович Д., Ковалева И.Е., Черноголов A.A., Усанов A.С., Лузиков В.Н., Синтез в Escherichia coli и свойства некоторых гибридных белков, составленных из модифицированного предшественника  адренодоксинредуктазы и укороченного предшественника адренодоксина // Биохимия 1996. T. 61, С.1026-1033; ВАК
  7. Spiridonova V.A., Golovin A.V., Drygin D.Yu., Kopylov A.M. An extremly high conservation of RNA-protein interactions during prokariotic str operon regulation // Biochem.Mol.Biol.Internat. 1998. V. 44, Р.1141-1146; (IF- 3,58)
  8. Птицин Л.Р., Котельников М.А., Спиридонова В.А., Копылов А.М., Егоров А. М. Селекция олигодезоксирибонуклеотидов, связывающих тироксин // Докл. РАН 1999. T/ 364, С.260-63; ВАК
  9. Рождественский Т.С., Рассохин Т.И., Анохина М.М., Головин А.В., Спиридонова В.А., Копылов А.М., Делеционный анализ межцистронного района S12-S7  str mRNA E.coli для связывания термофильного рибосомного белка S7 // Вестн. Моск. Ун-та. 1999. T. 40, С.375-380; ВАК
  10. Белякова М.М., Петрова Е.В., Спиридонова В.А., Добров Е.Н., Копылов А.М., Егоров Ц.А., Витман-Лейбольд Б., Сангер В., Фотоаффинная модификация тетрациклинового репрессора TetRD  тетрациклином // Вестн. Моск. Ун-та. 1999. T. 40, С.380-384; ВАК
  11. Spiridonova V.A., Rozhdestvensky T.S., Kopylov A.M. A study of the thermophilic ribosomal protein S7 binding to the truncated S12-S7 intercistronic region provides more insight for a mechanism of regulation of str operon of E.coli // FEBS Lett. 1999. V. 460, С.353-356; (IF- 3,54)
  12. Beliakova M.M., Anokhina M.M., Spiridonova V.A., Dobrov E.N., Egorov T.A., Wittmann-Liebold B., Orth P., Saenger W., Kopylov A.M. A direct photo-activated affinity modification of tetracycline transcription repressor protein TetR(D) with tetracycline // FEBS Lett. 2000. V. 477.  Р.263-267; (IF- 3,54)
  13. Рассохин Т.И., Головин А.В., Петрова Е.В., Спиридонова В.А., Каргинова О.А., Т.С. Рождественский, Брозиус Ю., Копылов А.М. Изучение связывания белка S7 с фрагментом 926-986/1219-1393 16S рРНК – ключевого этапа сборки малой субчастицы прокариотических рибосом // Mолекулярная биология. 2001. T. 35, С.617-627; ВАК
  14. Spiridonova V., Rassokhin T., Golovin A., Petrova E., Rohzdestvensky T., Pakhomova Ju., Kopylov A.,  A comparative thermodynamic study for both natural and artificial RNA/DNA-protein binary complexes // Bioelectrochim. 2002. V. 55, Р.95-97. (IF- 2,65)
  15. Спиридонова В.А., Копылов А.М., Аптамерные ДНК-принципиально новые узнающие элементы для биосенсоров // Биохимия, 2002. T. 67, С.850-854; ВАК
  16. Спиридонова В.А., Копылов А.М., Аптамеры как узнающие элементы для создания  биосенсоров // Наукоемкие технологии. 2003. T. 3, С.34-40; ВАК
  17. Спиридонова В.А., Рог Е.В., Дугина Т.Н., Струкова С.М., Копылов А.М., Аптамерные ДНК - ингибиторы тромбина нового типа // Биоорган. химия. 2003. T. 29, С.495-498; ВАК
  18. Anokhina MM, Barta A, Nierhaus KH, Spiridonova VA, Kopylov AM, Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli // Nucleic Acids Res. 2004. V. 32, Р.2594-2597; (IF- 6,88)
  19. Golovin AV, Spiridonova VA, Kraal B, Kopylov AM, Mapping of contact of S12 – S7 intercistronic region of E. coli streptomycin mRNA with recombinant ribosomal protein S7 // FEBS Lett. 2006. V. 580, Р.5858-5862; (IF- 3,54)
  20. Спиридонова В.А.,  Лыгина А.С., Анохина М.М., Тупицын Н.Н., Получение функционально активного рекомбинантного интерлейкина-6 человека // Биохимия. 2007. T. 72, С.525-532; ВАК
  21. Спиридонова В.А., Бессонов С.И., Тупицын Н.Н., Широков Д.А., Копылов А.М. Перспективы антицитокинотерапии. Получение РНК-аптамеров к интерлейкину-6 человека методом SELEX, 2007, Иммунология гемопоэза, 2, С.54-71; ISSN 1818-4820
  22. Сурдина А.В., Рассохин Т.И., Головин А.В., Спиридонова В.А., Крааль Б., Копылов А.М.,  Селекция случайных фрагментов РНК (SERF) как метод поиска участка регуляции трансляции стрептомициновой мРНК E. coli рибосомным белком S7 // Биохимия. 2008. T. 73, С652-659; ВАК
  23. Добровольский А.Б.,  Титаева Е.В., Хаспекова С.Г., Спиридонова В.А., Копылов А.М., МазуровА.В.  Ингибирование активности тромбина аптамерами ДНК // Бюллетень экспериментальной биологической медицины. 2009. T. 148 (7), С.41-45; ВАК
  24. Reshetnikov R., Golovin A., Spiridonova V., Kopylov A., Sponer J., Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations // J Chem.Theory Comput. 2010. V. 6, Р.3003-3014; (IF- 4,8)
  25. Сурдина А.В., Рассохин Т.И., Головин А.В., Спиридонова В.А, Копылов А.М., Картирование регуляторного участка связывания рибосомного белка S7 со стрептомициновой мРНК E.coli // Биохимия. 2010. T. 75 (7), С.841-850; ВАК
  26. Мазуров А.В., ТитаеваЕ.В., Хаспекова С.Г., Сторожилова А.Н., Спиридонова В.А., Копылов А.М., Добровольский А.Б., Свойства нового ДНК аптамера — прямого ингибитора тромбина // Бюллетень экспериментальной биологической медицины. 2010. T. 150 (10), С.394-397 ВАК
  27. Спиридонова В.А., Головин А.В., Копылов А.М., Добровольский А.Б., Мазуров А.В., ДНК аптамеры – ингибиторы тромбина, патент № 2401306, дата приоритета 17 декабря 2008 г
  28. Спиридонова В.А., Головин А.В., Копылов А.М., Добровольский А.Б., Мазуров А.В., Модифицированные ДНК аптамеры, ингибирующие активность тромбина, патент РФ № 2410432, дата приоритета 23 ноября 2009 г.



© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.