WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

Ильина Елена Николаевна

«Создание интегрированной геномно-протеомной системы для типирования и изучения патогенов бактериальной и вирусной природы»

03.00.04 - биохимия

Автореферат диссертации на соискание ученой степени доктора биологических наук

Москва 2009

Работа выполнена в Федеральном государственном учреждении Научноисследовательский институт физико-химической медицины Федерального медикобиологического агентства

Научный консультант:

доктор биологических наук, профессор Говорун Вадим Маркович

Официальные оппоненты:

член-корреспондент РАН, доктор химических наук, профессор Габибов Александр Габибович доктор биологических наук, профессор Северинов Константин Викторович доктор биологических наук, профессор Колесанова Екатерина Федоровна

Ведущая организация: Учреждение Российской академии медицинских наук Научно-исследовательский институт эпидемиологии и микробиологии имени почтного академика Н.Ф.Гамалеи РАМН.

Защита диссертации состоится « 22 » октября 2009 года в_____часов на заседании Диссертационного совета Д 001.010.01 при Учреждении Российской академии медицинских наук Научно-исследовательском институте биомедицинской химии имени В.Н.Ореховича РАМН (ИБМХ РАМН) по адресу: 119121, г. Москва, Погодинская ул., д.10.

С диссертацией можно ознакомиться в библиотеке ИБМХ РАМН.

Автореферат разослан «_____» _________________2009 года

Ученый секретарь диссертационного совета, кандидат химических наук Карпова Елена Анатольевна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

.

Актуальность проблемы.

Болезни бактериальной и вирусной природы занимают лидирующие позиции в структуре заболеваемости в России [Гос. доклад Роспотребнадзора, 2008], а инфекционные осложнения у пациентов хирургических и терапевтических стационаров представляют угрозу жизни и являются реальной причиной длительной потери трудоспособности. Серьезную проблему, обусловленную увеличение интенсивности курсов химиотерапии, представляет замещении дикой популяции возбудителей штаммами с множественной лекарственной устойчивостью, обладающими большей вирулентностью и патогенностью. На этом фоне задачи, связанные с созданием и реализацией новых эффективных средств идентификации, характеристики и типирования клинически-значимых патогенов, выглядят актуальными и своевременными.

Развитие методов обнаружения, описания структуры и функции природных биополимеров, к числу которых принадлежат молекулы нуклеиновых кислот и белков, во многом изменило наши представления о скорости мутационных процессов, предопределяющих природную вариабельность бактерий и вирусов и способствующих формированию устойчивости к используемым химиотерапевтическим средствам.

В этой связи возникла насущная необходимость модернизации применяемых в клинической микробиологии диагностических и исследовательских средств. Актуальным стало создание и внедрение интегральных высокопроизводительных измерительных систем, способных давать исчерпывающее представление о микробном сообществе в испытуемой пробе и определять клинически значимые свойства микроорганизмов в максимально сжатые сроки на основании молекулярного анализа.

Традиционные методы идентификации и характеристики возбудителя, основанные на бактериологическом посеве, имеют ряд недостатков, к числу которых относятся длительность исследования, лимитированная скоростью деления микробной клетки, относительная дороговизна метода, необходимость привлечения большого числа квалифицированных специалистов в силу сложности автоматизации аналитических процедур. Кроме того, значительная часть патогенных микроорганизмов, в частности представители анаэробной бактериальной флоры, фактически не анализируется в большинстве клинических лабораторий из-за трудности культивирования.

Изобретение и внедрение в медицинскую практику методов ПЦР-диагностики позволило сократить сроки анализа клинического образца для идентификации труднокультивируемой бактериальной флоры и вирусов [Глик, 2002]. Однако, этот подход оказался недостаточным для установления профиля чувствительности и штаммового типирования микроорганизмов, необходимых для выбора рациональной фармакотерапии и осуществления эпидемиологического надзора.

Приоритетность данного исследования состоит в создании уникальной геномно-протеомной измерительной системы, позволяющей выявлять механизмы формирования лекарственной устойчивости микроорганизмов на молекулярном уровне, а также прогнозировать микроэволюционные события, изучая мутационные процессы в бактериальных и вирусных популяциях. Компоненты такой системы могут быть использованы в мониторинге клинически-значимых микроорганизмов, а также применены в решении фундаментальных вопросов функционирования бактериальной клетки.

Комбинация технологий генетического и протеомного типирования с использованием матрично-активированной лазерной десорбции/ионизации времяпролетной масс-спектрометрии (МАЛДИ ВМС), как универсального анализатора, обеспечивает быструю идентификацию микрофлоры, позволяет осуществить молекулярное типирование штаммов, провести оценку лекарственной устойчивости.

Созданные системы предназначены для одновременного исследования геномных локусов, задействованных в формировании устойчивости бактерий к разным классам антимикробных препаратов (АМП), по одной универсальной технологии.

Кроме того, объединение технологии анализа на ДНК-чипе и созданных на основе МАЛДИ ВМС систем регистрации генетических детерминант устойчивости открывает перспективы установления профиля чувствительности патогена непосредственно в клиническом материале от пациента, минуя стадию культивирования in vitro.

Для иллюстрации возможностей созданной измерительной платформы объектами исследования были выбраны клинически значимые микроорганизмы – Mycobacterium tuberculosis, Streptococcus pneumoniae, Neisseria gonorrhoeae, вирусы гепатита В и С, изучение которых безусловно актуально для практического здравоохранении России. Так, в 2007 году в России уровень заболеваемости на 100 тыс. населения составил 82,9 для туберкулеза; 60,34 для гонореи; 5,8 и 3,58 для вирусных гепатитов В и С, соответственно [Гос. доклад Роспотребнадзора, 2008], что на порядок превышает аналогичные показатели для стран Евросоюза и США [ВОЗ, 2008].

В ряде стран изменчивость возбудителей этих заболеваний и их распространение контролируются в рамках международных и национальных программ, например International Union Against Tuberculosis and Lung Disease (IUATLD) (www.iuatld.org) или National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP) США (www.cdc.gov/nchhstp). В России соответствующие национальные программы находятся в стадии формирования и нуждаются в разработке и внедрении средств эффективного молекулярного мониторинга возбудителей бактериальных и вирусных инфекций.

Цель работы: создание и реализация вертикально интегрированной платформы геномно-протеомного типирования патогенов бактериальной (гонококк, пневмококк, микобактерии туберкулеза) и вирусной (вирусы гепатита В и С) природы для обеспечения широкомасштабного эпидемиологического мониторинга, определения факторов вирулентности и патогенности и изучения новых молекулярных механизмов формирования лекарственной устойчивости.

Задачи исследования были:

1. Разработка и внедрение в практику комплексной технологии на основе времяпролетной МAЛДИ масс-спектрометрии для высокопроизводительного выявления нуклеотидных полиморфизмов в геномах бактерий и вирусов. Демонстрация возможности комбинированного анализа биоматериала с применением технологии ДНК-чипов и масс-спектрометрического исследования.

2. Разработка и использование молекулярно-генетических тестов для типирования вирусов гепатита С и В, определение их аналитических характеристик.

3. Оптимизация и осуществление процедуры прямого масс-спектрометрического профилирования бактерий и оценка возможности его применения для типирования и видовой идентификации клинически значимых микроорганизмов.

4. Создание средств молекулярного типирования российской популяции M. tuberculosis и N. gonorrhoeae. Сопоставление информативности методов протеомного и геномного типирования бактерий.

5. Проведение широкомасштабных молекулярно-эпидемиологических исследований географически неоднородных групп (коллекций) штаммов гонококка, микобактерий туберкулеза, пневмококка. Оценка основных тенденций генетической изменчивости в микробных популяциях на территории Российской Федерации.

6. Разработка нового алгоритма обнаружения неизвестных молекулярных механизмов лекарственной устойчивости у бактерий и его демонстрация на примере анализа гонококка с привлечением протеомных исследований и моделирования генных (метаболических) сетей.

Научная новизна Впервые реализована возможность комбинированного применения новых молекулярных технологий – прямого МАЛДИ масс-спектрометрического профилирования бактериальных белков и исследования на ДНК-чипах – для видовой идентификации типичных представителей грамотрицательной и грамположительной флоры.

Впервые разработаны и реализованы в скрининге клинических изолятов пневмококка, туберкулеза и гонококка высокопроизводительные системы выявление генетических детерминант резистентности, в которых использован метод минисеквенирования с последующей МАЛДИ масс-спектрометрической детекцией.

Впервые способ обнаружения однонуклеотидных полиморфизмов на основании МАЛДИ масс-спектрометрического анализа продуктов реакции минисеквенирования использован для типирования возбудителей трансфузионных вирусных гепатитов В и С.

Для клинических изолятов S. pneumoniae и N. gonorrhoeae впервые определен спектр генетических мутаций, достоверно ассоциированных с устойчивостью к пенициллину, фторхинолонам, тетрациклину. Молекулярно-эпидемиологическое исследование коллекций клинических изолятов N. gonorrhoeae и M. tuberculosis, собранных в разных регионах РФ, позволило получить актуальную информацию о распространении генетических маркеров лекарственной устойчивости в микробных популяциях.

Впервые молекулярно-генетические особенности российской популяции M. tuberculosis и N. gonorrhoeae изучены с применением методов мультилокусного типирования (VNTR, NG-MAST, MLST), описаны новые сиквенс-типы, депонированные в мировые базы данных.

Впервые описан феномен резистентности к спектиномицину, обусловленный изолированной мутацией в рибосомальном белке S5; выявлены нарушения в системе транслокации белков внешней мембраны, способствующие снижению чувствительности гонококка к пенициллинам, тетрациклинам, макролидам; установлено вовлечение в развитие толерантности к цефтриаксону механизмов, ответственных за выживание бактериальной клетки в условиях осмотического стресса.

Практическая значимость В практическом аспекте разработанная геномно-протеомная система характеристики микроорганизмов решает задачи: 1) адекватной видовой идентификации патогенов, 2) оценки профиля лекарственной устойчивости, 3) характеристики локальной (географической, временной) структуры популяции/субпопуляции возбудителя, отслеживания клонального родства и путей распространения инфекции.

На основании сопоставления спектра мутаций, выявляемых в генах мишений действия антибиотиков с фенотипом изолята, для каждого включенного в исследование микроба (S. pneumoniae, N. gonorrhoeae, M. tuberculosis) установлены генетические маркеры, достоверно ассоциированные с формированием устойчивости к применяемым в терапии этих инфекций лекарственным препаратам. Аналитическая чувствительность предложенного способа установления генетически-детерминированной лекарственной устойчивости составила от 82 % до 96 % для разных групп препаратов, что демонстрирует перспективность применения этого подхода в практическом здравоохранении.

Для повышения эффективности мониторинга вирусных и бактериальных инфекций разработаны, утверждены и внедрены в практику отечественного здравоохранения наборы реагентов для выявления геномной ДНК N. gonorrhoeae, вируса гепатита В, РНК вируса гепатита С методом полимеразной цепной реакции - «Гонопол» «Полигеп В» и «Полигеп С» ТУ–9398-405-17253567-96, ТУ-9398-410-17253567-97.

Разработанные схемы молекулярно-генетического мониторинга N. gonorrhoeae и M. tuberculosis реализованы при выполнении в рамках Федеральной целевой программы «Предупреждение и борьба с заболеваниями социального характера (20022006 годы)» государственных контрактов № 03/ЦП «На проведение процедуры генотипирования, молекулярно-эпидемиологического мониторинга изолятов гонококка, выделенных из разных регионов Российской Федерации» от 1 ноября 2004 г.; № 24-«На проведение работ по генетическому типированию выделенных штаммов гонококка» от 23 сентября 2005 г.; № 06/365 на проведение работы по теме «Мониторинг лекарственной устойчивости микобактерий туберкулеза в Российской Федерации с использованием технологии масс-спектрометрии» от 15 марта 2006 г.

Разработанные технологии внедрены в клинико-лабораторную практику ГУ Центральный научно-исследовательский институт туберкулеза РАМН, ФГУ Государственный научный центр дерматовенерологии Минздравсоцразвития.

Апробация работы Основные результаты работы доложены и обсуждены на ежегодных итоговых конференциях НИИ ФХМ (2005 - 2008 г.г.), 15-ой и 16-ой Международных конференциях по патогенным нейссериям (15th IPNC, Cairns, Australia, 2006, 16th IPNG, Роттердам, 2008), 17-ом и 18-ом Европейских конгрессах по клинической микробиологии и инфекционным болезням (17th ECCMID, Мюнхен, 2007, 18th ECCMID, Барселона, 2008), 46-ой Междисциплинарной конференции по антибиотикам и антимикробной химиотерапии (47th ICAAC, Сан-Франциско, 2006), Международной научнопрактической конференции «Разработка противотуберкулезных терапевтических агентов нового поколения. Проблемы, подходы, перспективы» (Химки, 2006), VIII Российской конференции «Современные проблемы антимикробной терапии» (Москва, 2006), 55-ой Конференции Американского общества масс-спектрометрии (55th ASMS, Индианаполис, 2007), 39-ой Всемирной конференции по здоровью легких (39th Union World Conference on Lung Health, Париж, 2008), 3-ей и 4-ой Международных конференциях «Геномика, протеомика, биоинформатика и нанотехнологии для медицины» (3rd GPBNM, Новосибирск, 2006, 4th GPBNM, Москва, 2008).

Публикации. По материалам диссертации опубликованы 39 печатных работ, из которых 34 в рекомендованных ВАК РФ изданиях.

Структура и объем диссертации. Диссертация изложена на 265 страницах машинописного текста; состоит из введения, обзора литературы, экспериментальной части, включающей материалы и методы исследования, результаты, обсуждение и выводы. Работа иллюстрирована 51 таблицой и 41 рисунками; библиографический указатель включает 514 публикаций, из которых 23 в изданиях на русском языке.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

1. Материалы и методы.

Объектами исследования служили лабораторные штаммы E. coli DH5, N. gonorrhoeae ATCC 49226, S. pneumoniaе ATCC 49619, а также клинические изоляты S. pneumoniaе (n = 234), M.

tuberculosis (n = 693), N. gonorrhoeae (n = 585), N. meningitidis (n = 15), непатогенные нейссерии (n = 15). Клинический материал включал мазки слизистой влагалища (n = 24) от пациенток с бактериальным вагинозом, соскобы из уретры, с головки полового члена и крайней плоти (n = 60) от пациентов с баланопоститом, образцы сывороток крови (n = 329) больных вирусными гепатитами В и С. Все бактериальные изоляты прошли стандартную процедуру видовой идентификации и тестирования лекарственной чувствительности.

МАЛДИ масс-спектрометрическое профилирование. Свежие бактериальные клетки (1-2 колонии), находящиеся в стационарной фазе роста, переносили в 300 мкл деионизированной воды, перемешивали и добавляли 900 мкл этанола. Осадок после центрифугирования (15 мин х 14000 об/мин) растворяли в 20 мкл смеси 50 % ацетонитрила, 35 % муравьиной кислоты. Полученный последующим центрифугированием супернатант анализировали с помощью масс-спектрометра MicroflexTM (Bruker Daltonics, Германия), применяя -циано-4-гидроксикоричную кислоту в качестве матрицы.

Для записи, обработки и анализа масс-спектров использовали flexControl 2.4 и flexAnalysis 2.4 (Bruker Daltonics, Германия). Кластерный анализ, сопоставление получаемых масс-спектров с имеющимися базами данных производили с помощью программного пакета Biotyper 1.1 (Bruker Daltonics, Германия).

Протеомное картирование. Свежие клетки N. gonorrhоeae, находящиеся в стационарной фазе роста, отмывали в физиологическом растворе и обрабатывали смесью нуклеаз. Белки переосаждали метанол/хлороформом и растворяли в буфере, содержащем 8 М мочевины, 2 М тиомочевины, 2 % амфолинов (рН 3 – 10), 100 мМ ДТТ, 16,7 % раствора (30 % СHAPS + 10 % NP40). Концентрацию белка в образцах измеряли по методу Бредфорда с помощью Quick start Bradford dye reagent (Bio-Rad, США). При необходимости белки метили цианинами CyDye3-DIGE и CyDye5-DIGE (GE Healthcare, Великобритания) согласно рекомендациям фирмы-производителя. В первом направлении (изоэлектрофокусирование) использовали 4 % ПААГ, 8 М мочевину и 4 % амфолины (GE Healthcare, Великобритания) рН 3-10, либо ИПГ стрипы 3-10 (Bio-Rad, США). Изоэлектрофокусировку осуществляли в режиме 100 В – 200 В– 300 В – 400 В – 500 В – 600 В – по 45 минут, 700 В – 10 часов, 900 В – 1 час.

По завершению изоэлектрофокусирования гели или ИПГ-стрипы вымачивали в буфере 62,5 мМ Tris HCl, pH 6,8, 6 М мочевины, 30 % глицерола, 2 % додецилсульфата натрия, 20 мМ ДТТ, в течение мин, переносили на поверхность градиентного полиакриламидного геля (9 – 16 %) и проводили электрофорез во втором направлении. Электрофореграммы сканировали при длине волны 532 нм и 6нм на сканере TyphoonTrio (GE Healthcare, Великобритания) и анализировали программой PDQuest 8.0 (Bio-Rad, США). Дифференциальные белковые пятна вырезали из геля и подвергали трипсинолизу. Полученные образцы анализировали с помощью MALDI-TOF/TOF Ultraflex II (Bruker Daltonik, Германия), используя 2,5-дигидробензойную кислоту в качестве матрицы. Идентификацию белков производили методом пептидного фингерпринта с использованием программы Mascot Peptide Fingerprint (Matrix Science, США).

Экстракция нуклеиновых кислот. Геномную ДНК бактериальных возбудителей, вируса гепатита В, а также тотальную ДНК из клинического материала выделяли набором «ДНК экспресс» ООО НПФ Литех (ТУ- 9398-450-17253567-03). Выделение РНК ВГС и амплификацию фрагментов 5’нетранслируемой области вирусного генома проводили с помощью набора «Полигеп С» OOO НПФ Литех (ТУ –9398-409-17253567-97).

Минисеквенирование с последующей МАЛДИ ВМС. Амплификацию целевых локусов бактериальных и вирусных геномов проводили в буферной смеси, содержащей 66 мМ Tris-HCl, pH 9,0;

16,6 мM (NH4)2SO4; 2,5 мM MgCl2, по 250 мкМ каждого dNTP, 1 ед Taq-полимеразы (Promega, США) и по 5 пмоль специфичных праймеров в объеме 25 мкл. Реакцию осуществляли в амплификаторе DNA Engine Tetrad 2 (MJ Research, США), по универсальному профилю: 94 С – 5 мин.; 94 С – сек., 60 С – 15 сек., 72 С – 15 сек., 35 циклов. Дефосфорилирование 5’-концевых фосфатных групп dNTP в прошедшей амплификацию реакционной смеси проводили в ходе инкубации с 0,5 ед щелочной фосфатазы арктических креветок (Fermentas, Литва) в течение 20 минут при 37 С и последующей инактивации фермента прогреванием в течении 10 мин при 85 С. Предназначенные для секвенирования образцы дополнительно обрабатывали 5 ед экзонуклеазой I E. coli (Fermentas, Литва) в аналогичных условия инкубации.

Реакцию минисеквенирования проводили в 10 мкл реакционной смеси 66 мМ Tris-HCl, pH 9,0; 16,6 мМ (NH4)2SO4; 2,5 мМ MgCl2; по 0,2 мМ необходимых dNTP и/или ddNTP; по 10 пмолей соответствующих праймеров и 2 Ед TermiPol DNA Polymerase (Solis Biodyne, Эстония), используя в качестве матрицы амплифицированные фрагменты бактериальных или вирусных геномов. Реакцию осуществляли по профилю: 94 С – 20 сек, 60°С – 20 сек, 72 С – 15 сек, 70 циклов в амплификаторе DNA Engine Tetrad 2 (MJ Research, США). Для очистки продуктов реакции минисеквенирования в пробирку вносили 1 мг катион-обменной смолы SAC-50 (АНО «Синтез полимерных сорбентов») и инкубировали 15 мин при комнатной температуре. Сорбент осаждали центрифугированием. Супернатант (0,2-1 мкл) анализировали с помощью масс-спектрометра MicroflexTM (Bruker Daltonics, Германия), применяя 3-гидроксипиколиновую кислоту в качестве матрицы. Для записи, обработки и анализа масс-спектров использовали flexControl 2.4 и flexAnalysis 2.4 (Bruker Daltonics, Германия). По наличию в масс-спектрах продуктов реакции пиков, соответствующих ионам определенной ожидаемой молекулярной массы, судили о нуклеотидном контексте в данном положении.

Секвенирование фрагментов геномой ДНК проводили модифицированным методом Сенгера с использованием ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit и прибора ABI Prism 3100 Genetic Analyzer (Applied Biosystems, США) в соответствии с прилагаемыми инструкциями. Сборку и сравнение нуклеотидных последовательностей проводили с использованием модулей ContigExpress и AlignX программного пакета «Vector NTI 9.0» (Informax Inc., США).

Исследование на ДНК-чипах. Видоспецифичные олигонуклеотидные зонды в концентрации 0,1 мM в 50 мM Na2HPO4 разносили на стеклянные слайды CodeLink (GE Healthcare, Великобритания), используя автоматический репликатор (SDDC-2 Microarrayer, Virtek Vision, США). Нанесенные зонды фиксировали в парах NaCl в течение 12 часов. Затем стекла инкубировали 30 мин в растворе 0,1 М Tris-HCl, рH 9,0, 50 мМ этаноламин при 60°C, 2 раза промывали водой, инкубировали 30 мин в растворе 4х SSC, 0,1 % додецилсульфат натрия при 60°C, снова промывали водой и высушивали. Для контроля процесса разнесения и пространственной локализации реакционных полей использовали меченый олигонуклеотидный зонд Cy3 - 5’aaggccgttgccaatatcggcg 3’- NH2.

Амплификацию проводили в 20 мкл смеси 66 мМ Tris-HCl, pH 9,0; 16,6 мM (NH4)2SO4; 2,5 мM MgCl2; 0,1 мг/мл желатина, 800 мкМ dATP, dGTP и dTTP, 200 мкМ dCTP, 1 пмоль Cy3DyeTM-dCTP (GE Healthcare, Великобритания), 1 ед. Taq-полимеразы (Promega, США), 2 пмоль и 20 пмоль прямого и обратного универсальных праймеров по программе 93°C – 30 сек, 58°C – 30 сек, 72°С – 30 сек, 50 циклов. Ампликоны (15 мкл) смешивали с 15 мкл буфера 4x SSC; 0,1 % додецилсульфат натрия, инкубировали 5 мин при 94°С, вносили под гибридизационные камеры на стекла и помещали в термостат на 12 часов при 60°С. После гибридизации стекла освобождали от камер и 2 раза промывали 1 % раствором додецилсульфат натрия. Прошедшие процесс гибридизации и отмывки ДНК-чипы сканировали с помощью прибора Typhoon Trio (GE Healthcare, Великобритания). Результаты гибридизации оценивали с помощью программного пакета TotalLab v 2.01 (Nonlinear Dynamics), принимая за положительный сигнал превышение фона на 12 % в 3-х из 4-х точках, соответствующих одному зонду. Суждение о присутствии конкретного микроорганизма выносили на основании регистрации гибридизации с соответствующим зондом.

Транскрипционный анализ. РНК N. gonorrhoeae выделяли SV Total RNA Isolation System (Promega, США) и немедленно подвергали обратной транскрипции с 200 ед обратной транскриптазы (Fermentas, Литва) в прилагающемся буфере с использованием рандомизированных праймеров длиной 8 нт. ПЦР в реальном времени проводили в 30 мкл смеси, содержащей 66 мМ TrisHCl, рН 9,0, 16,6 мM (NH4)2SO4, 2 мМ MgCl2, 0,1 мМ SibrGreenTM, по 150 мкМ каждого dNTP, 1 ед Taqполимеразы (Promega, США) и по 5 пмоль соответствующих праймеров. Реакцию осуществляли в приборе AB Prizm 7000 (Applied Biosystems, США) по профилю: 94°С – 3 мин и 94°С – 30 сек, 60°С – 15 сек, 72°С – 30 сек, 35 циклов. Уровень экспрессии анализируемых генов оценивали относительно экспрессии генов «домашнего хозяйства» abcZ (putative ABC transporter) и adk (adenylate kinase).

Методы молекулярного типирования. Серотип гонококка устанавливали по принципу максимальной гомологии при сравнении нуклеотидной последовательности гена porВ анализируемого изолята с представленными в базе данных GenBank. Мультиантигенное типирование N. gonorrhoeae (NG-MAST) и мультилокусное секвенирование (MLST) осуществляли по методикам, описанным ранее [Martin, 2004; Bennett, 2007]. Анализ числа тандемных повторов в геномах изолятов M.

tuberculosis осуществляли по методикам Mazars, 2001 и Supply, 2006. Сполиготипирование осуществляли по протоколу Kamerbeek, 1997 с использованием набора «Spoligotyping Kit» (Isogen Lifescience, Нидерланды).

Статистические расчеты проводили с помощью программного пакета Statistica 6.0. Все тесты проводили для уровня значимости p<0,05. Наличие ассоциации исследуемых фенотипических и генетических признаков оценивали методом -квадрат Фишера. Для оценки вариабельности генетических локусов использовали индекс аллельного полиморфизма (h) [Selander, 1986]. Дискриминирующую способность методов типирования оценивали на основании индекса разнообразия Симпсона (D) [Simpson, 1949].

2. Результаты и их обсуждение 2.1. Создание геномно-протеомной платформы молекулярного типирования микроорганизмов.

На основании современных методов анализа природных биополимеров – белков и нуклеиновых кислот – были разработаны технологии, позволяющие решать круг задач, связанных с видовой идентификацией, оценкой профиля лекарственной чувствительности и молекулярного типирования клинически-значимых микроорганизмов. К ним относятся методики, базирующиеся на МАЛДИ ВМС – прямое белковое профилирование, идентификация однонуклеотидных полиморфизмов ДНК минисеквенированием, а также исследование на ДНК-микроматрицах.

Протокол прямого белкового профилирования, включающий обработку бактериальных клеток и параметры снятия МАЛДИ масс-спектров, был отработан на лабораторном штамме E. coli DH5. За основу метода была взята кислая экстракция белков и пептидов, позволяющая наиболее полно выделять основные рибосомальные белки, составляющие 20 % от общего пула белков E. coli [Arnold, 1998]. Подобранные условия прямого МАЛДИ масс-спектрометрического профилирования позволили получить спектр E. coli, качественный состав которого аналогичен спектру, заявленному ранее для штамма E. coli К-12 [Ryzhov, 2001].

Реакция минисеквенирования с последующей детекцией продуктов МАЛДИ ВМС была использована для обнаружения в бактериальных или вирусных геномах полиморфных локусов, ответственных за формирование лекарственной устойчивости или позволяющих установить генотип патогена. Впервые подобная система разработана в компании Sequenom для анализа однонуклеотидных полиморфизмов в геноме человека [Storm, 2002], приоритет применения этой технологии в области исследования прокариот принадлежит коллективу автора [Ilina, 2005].

Разработанные системы представляют собой последовательность процедур, разделенных условно на три блока: амплификация специфических фрагментов геномной ДНК, потенциально содержащих искомые полиморфизмы, осуществление реакций минисеквенирования в присутствии заданного набора dNTP/ddNTP, массспектрометрическое исследование продуктов удлинения праймеров с последующим выводом о нуклеотидном контексте в точке полиморфизма (рис. 1).

Рисунок 1. Схематичное представление реакции минисеквенирования с последующей МАЛДИ ВМС детекцией. Внутренние олигонуклеотидные праймеры прилегают к точке полиморфизма (вариабельные нуклеотиды выделены жирным). Терминирующие процесс элонгации праймера дидезоксинуклеотиды обозначены звездочкой. Исходные праймеры и продукты реакции минисеквенирования выделены рамкой. Масс-спектры продуктов минисеквенирования различны для дикого (а) и мутантного (в) генотипов.

Для включенных в исследование микробов был осуществлен подбор праймерных систем, предназначенных для селективной специфичной амплификации локусов и их последующего анализа согласно разработанному протоколу минисеквенирования. Используемая схема предполагает регистрацию детерминант устойчивости, обусловленных как приобретением мобильных генетических элементов (для S.

pneumoniae и N. gonorrhoeae), так и мутациями в специфических хромосомных локусах бактерий (для S. pneumoniae, N. gonorrhoeae, M. tuberculosis). По аналогичному принципу сформулированы системы, направленные на установление генотипа вирусов гепатита В и С. С целью уменьшения себестоимости и повышения производительности анализа, нами были отработаны универсальные условия амплификации, использован мультипраймерный формат минисеквенирования, минимизировано количество операций по переносу и разведению образцов, все процедуры адаптированы к формату 96-ти и 384-х луночной плашки.

Ограничением использования прямого масс-спектрометрического профилирования для идентификации микробных возбудителей в биологическом образце является необходимая стадия культивирования. Хотя возможность тестирования колоний непосредственно с чашки первичного посева существенно повышает эффективность метода, проблема идентификации медленно растущей и/или трудно культивируемой флоры остается не решенной. В этой связи мы использовали комплементарную технологию ДНК-микроматриц (ДНК-чипов), ранее показавшую свою состоятельность для изучения микробного разнообразия в клиническом материале [Bouchara, 2009;

You, 2008] и пищевых продуктах [Kim, 2008].

В ходе работы был создан оригинальный ДНК-чип, предназначенный для видовой идентификации 50-ти микробов и ориентированный на изучение микробиоценозов слизистых урогенитального и бронхо-легочного трактов. Мишенью для идентификации служили видоспецифичные фрагменты генов 16S рРНК. Использование рибосомальных генов в качестве мишеней для идентификации было обуловлено их максимальной представленностью в базах данных, а также относительным консерватизмом, что облегчает задачу подбора универсальных праймеров для амплификации всей совокупности микроорганизмов. Наряду с уникальными видоспецифичными зондами в дизайн ДНК-чипа включен универсальный зонд, комплементарный консервативному участку анализируемых фрагментов генов rrs, позволяющий контролировать процесс гибридизации.

В качестве носителя при создании ДНК-чипа нами выбраны стеклянные слайды CodeLink (GE Healthcare, Великобритания), предназначенные для присоединения олигонуклеотидов через аминогруппу путем образования ковалентной связи с эфиром Nгидроксисукцидина, покрывающего поверхность слайда. Несмотря на существование множества аналогов, за счет высокой реакционной способности эфира Nгидроксисукцидина данный способ позволяет добиться высокой плотности посадки олигонуклеотидов, а также упростить и ускорить протокол иммобилизации [Lindroos, 2001]. Аналитическая специфичность разработанной технологии составила в среднем 96,0 %, что наряду с чувствительностью 103-104 микробных клеток, позволяет говорить о пригодности это подхода для анализа условно-патогенной флоры.

2.2. Применение разработанных методик в молекулярном мониторинге бактериальных и вирусных патогенов.

2.2.1. Масс-спектрометрическое профилирование клинических изолятов S. pneumoniae и N. gonorrhoeae.

Методикой прямого МАЛДИ масс-спектрометрического профилирования исследованы грамположительные -гемолитические стрептококки (S. pneumoniae и близкородственные «зеленящие» стрептококки) и грамотрицательные бактерии рода Neisseria.

Масс-спектры кислого экстракта клеток грамположительных стрептококков, содержащие около 60 пиков, не отличались по представительности от масс-спектров грамотрицательных Е. coli и нейссерий (около 70 пиков), что иллюстрирует универсальность отработанного протокола (рис. 2). Большинство воспроизводимо регистрируемых масс соответствовало массам рибосомальных белков протестированных микробов – 11/19 для пневмококка, 14/20 для N. gonorrhoeae и 11/17 для N. meningitidis (табл. 1).

Таблица 1. Перечень воспроизводимых пиков (частота регистрации 0,7), регистрируемых при МАЛДИ масс-спектрометрическом профилировании лабораторных штаммов S. pneumoniae ATCC 49619, N. gonorrhoeae ATCC 49226 и клинического изолята N. meningitidis_547. Пики, предположительно соответствующие рибосомальным белкам, выделены жирным. Идентичные для N. gonorrhoeae и N. meningitidis пики обозначены серым.

Neisseria gonorrhoeae ATCC 49226 Neisseria meningitides_537 (serogroup B) S. pneumoniae ATCC 496M M Тип M Тип № M f Тип иона D № M f D № M f D (match) (match) иона (match) иона 1 4474 1 4473 M+H+ RL36 1 4489 0,9 4489 M+H+ RL36 1 4196 1 8387 M+2H+ RL2 4511 0,8 2 4419 1 4421 M+H+ RL3 4689 1 9377* M+2H+ RS20 2 4688 0,7 9377* M+2H+ RS20 3 4534 4 4784 1 9570 M+2H+ RL27 4 4718 5 5010 1 5010 5 5044 1 10089 M+2H+ RL6 5052 1 5051 M+H+ RL34 3 5051 1 5051 M+H+ RL34 6 5201 1 10403* M+2H+ RS 4 5115 0,7 10230* M+2H+ RS19 7 5309 0,7 5304* M+H+ RL7 5130 0,9 10259* M+2H+ RS19 5 5129 0,8 8 5833 0,8 5484 0,7 6 5541 0,9 9 5873 9 5908 1 5907 M+H+ RL33 7 5624 0,7 10 5951 10 5946 1 8 5937 1 5937 M+H+ RL33 11 6265 1 6267* M+H+ RL11 6053 0,9 9 6342 1 6342 M+H+ RL32 12 6614 12 6404 1 6402* M+H+ RL32 10 6431 0,9 13 6638 1 6640* M+H+ RL13 7080 1 7078 M+H+ RL29 11 7078 1 7078 M+H+ RL29 14 6751 1 6752* M+H+ RL14 7227 1 7226* M+H+ RL35 12 7226 0,7 7226* M+H+ RL35 15 6887 15 8068 1 13 9350 0,7 16 7983 1 7987 M+H+ RL16 8167 1 8165 M+H+ RL31 17 8390 1 8387* M+H+ RL17 8225 1 8224* M+H+ RS21 18 9513 18 9379 1 9377* M+H+ RS20 14 9377 0,9 9377* M+H+ RS20 19 10089 1 10089 M+H+ RL19 9570 1 9568* M+H+ RL27 15 9557 0,8 9554* M+H+ RL20 10260 1 10259* M+H+ RS19 16 10237 0,7 10237* M+H+ RS 17 11248 0,M – среднее значение экспериментальных m/z для каждого пика (использованы масс-спектры, полученные в ходе 10 независимых экспериментов);

f – частота регистрации пика;

M (match) – масса белка согласно SwissProt/TrEMBL базе данных (Da) * - с учетом потери N-концевого метионина.

Тип иона – только для пиков, соотнесенных с конкретными белками D – описание белка согласно SwissProt/TrEMBL базе данных (b) (а) Рисунок 2. МАЛДИ масс-спектры экстрактов клеток штаммов S. pneumoniae ATCC 49619 (a), N. gonorrhoeae ATCC 49226 (b), и N. meningitidis_547 (c), отснятые при использовании -циано-4-гидроксикоричной кислоты в качестве матрицы. По шкале абсцисс отложены значения m/z, по шкале ординат – относительная интенсивность пиков, регистрируемая при масс-спектрометрическом анализе.

(c) Несмотря на таксономическое (филогенетическое) родство N. gonorrhoeae и N.

meningitidis, только 6 пиков оказались общими в МАЛДИ масс-спектрах обоих видов.

МАЛДИ масс-спектрометрическое профилирование зеленящих стрептококков (n = 3) и клинических изолятов идентифицировались как S. pneumoniae согласно панели иммунологических и биохимических тестов (n = 25), продемонстрировало неоднородность исследуемой группы (рис. 3, А).

В настоящее время проблема надежной и однозначной дифференциации S.

pneumoniaе от других представителей -гемолитических стрептококков – S. mitis, S.

oralis и др. однозначно не решена. Такое положение дел вынуждает использовать MLST в качестве референс-метода, устанавливающего видовую принадлежность штамма [Ip, 2006], что было реализовано в текущем исследовании и позволило выявить различную видовую принадлежность 25-ти клинических изолятов – 19 идентифицированы как S. pneumonia и 6 – как не пневмококки.

Выделенная группа, так называемые псевдопневмококки, имела аллельный профиль, отличный от «истинных» пневмококков, однако обладала свойственным пневмококку фенотипом ( гемолиз, оптохин чувствительность и растворение в солях желчи). По данным масс-спектрометрического профилирования эта группа, хотя и образовывала отдельный кластер, все равно относилась к общему пулу пневмококков, тогда как зеленящие стрептококки имели однозначно отличные масс-спектры.

Полученные нами данные хорошо иллюстрирую ситуацию, сложившуюся в последние годы в области видовой таксономии гемолитических стрептококков, обусловленной их высокой степенью гомологии. Неоднозначность видовой идентификации на основании биохимических тестов и последовательностей гена 16S рРНК [Woo, 2008] приводит к существованию отличных мнений о таксономической принадлежности тех или иных групп штаммов, их роли в инфекционном процессе. И если клиническая необходимость дискриминации пневмококков от зеленящих стрептококков не вызывает сомнений, то выделение группы псевдопневмококков является весьма спорным вопросом [Carvalho, 2003; Arbique, 2004].

А В Рисунок 3. Сравнительный анализ масс-спектров, полученных для исследуемой группы стрептококков (А) и нейссерий (В). Выделены изоляты, не относящиеся к виду S. рneumoniae, согласно MLST.

Продемонстрированная ранее возможность эффективной дискриминации зеленящих стрептококков на основании прямой масс-спектрометрии [Friedrichs, 2007] была подтверждена в нашем исследовании с применением других протоколов тестирования. Сравнительный анализ масс-спектров кислых белковых экстрактов зеленящих стрептококков и пневмококков позволил предположить, что такой подход будет использован в практике. Кроме того, была продемонстрирована принципиальная возможность кластеризации псевдопневмококков в отдельную группу, что открывает перспективы для раздельного мониторинга этих бактерий и, возможно, дальнейшего исследования S. pseudopneumoniae с целью установления его роли в развитии легочных патологий.

МАЛДИ масс-спектрометрическое профилирование лабораторного штамма (n = 1) и клинических изолятов (n = 278) N. gonorrhoeae показало однородность получаемых профилей в исследуемой группе. Отдельно следует отметить, что в целом МАЛДИ масс-спектры, отснятые для гонококка по разработанному протоколу, существенно богаче аннотированных ранее при исследовании гемофильных бактерий, в том числе и N. gonorrhoeae [Haag, 1998].

Сравнительный анализ полученных масс-спектров (пик-листов) выявил три пика со значениями m/z 4473, 5051 и 8165, соответствующих рибосомальным белкам RL36, RL34 и RL31 штамма N. gonorrhoeae ATCC 49226 и меняющихся у ряда изолятов на 4487, 5081 и 8146. Подобные изменения зарегистрированы для пиков, соотнесенных с рибосомальными белками RS20 и RL27 N. meningitidis (табл. 2).

Секвенирование соответствующих генов N. gonorrhoeae (rpmJ, rpmH и rpmE), и N. meningitidis (rpsT и rpmA) подтвердило существование в каждом из них однонуклеотидного полиморфизма, приводящего к аминокислотной замене. Теоретически рассчитанное изменение массы белка при данной замене совпало с регистрируемым в масс-спектрометрическом анализе.

Таблица 2. Регистрируемые изменения в последовательностях рибосомальных белков соответствующие наблюдаемым отличиям в МАЛДИ масс-спектрах клинических изолятов N. gonorrhoeae и N. meningitidis.

m/z Описание Ген Нуклеотидные Аминокислотные Расчитанная масса, Дa (SwissProt/TrEMBL) замены замены N. gonorrhoeae 4473 RL36 rpmJ wt wt 44G19A Val7Ile 445051 RL34 rpmH wt wt 50G109A Ala37Thr 508166 RL31 rpmE wt wt 81G29A Arg10His 81N. meningitidis 9378 RS20 rpsT wt wt 93G169A Val57Ile 939557 RL27 rpmA wt wt 95G79A Gly27Ser 95Среди исследованной группы изолятов N. gonorrhoeae обнаружены четыре варианта сочетаний меняющихся значений m/z этих белков. Учитывая неизменность остальных значений m/z в спектре, выделено четыре типа МАЛДИ масс-профилей (протеотипов) гонококка. Исследуемая выборка гонококков (n = 278) распределилась следующим образом: подавляющее большинство – 236 (84,9 %) относились к протеотипу 1 (m/z 4473/5051/8165), соответствующему контрольному штамму N. gonorrhoeae ATCC 49226; 26 изолятов (9,4 %) были отнесены к протеотипу 2 (m/z 4487/5051/8165); 15 изолятов (5,4 %) к протеотипу 3 (m/z 4487/5051/8147) и 1 изолят (0,4 %) – к протеотипу 4. Индекс разнообразия Симпсона при таком типировании составил 0,27.

Наблюдаемые незначительные отличия качественного состава масс-спектров в группе клинических штаммов гонококка согласуются с нашим представлением о консервативности рибосомальных белков. Высокая гомогенность качественного состава масс-спектров делает невозможным применения этого подхода для типирования гонококка, однако, открывает перспективы для видовой идентификации возбудителя.

При относительной внутривидовой стабильности масс-спектров исследованных изолятов N. gonorrhoeae и N. meningitidis, МАЛДИ масс-профили, накопленные для разных видов бактерий рода Neisseria, демонстрируют существенные различия в числе и положении пиков. Этот тезис был подтвержден в ходе кластерного анализа накопленных масс-профилей близкородственных бактерий – менингококков (n = 15) и непатогенных нейсерий (n = 15) (рис. 3, В). Непатогенные нейссерии сформировали достаточно гетерогенную группу, полностью отличную от N. gonorrhoeae и N. meningitidis.

В целом, результаты, полученные в ходе тестирования гетерогенных коллекций клинических изолятов S. pneumonia и N. gonorrhoeae, а также близкородственных им видов бактерий, подтверждают возможность применения нового, основанного на МАЛДИ ВМС, способа видовой идентификации микробов, в том числе при мониторинге бактериальных инфекций.

2.2.2. Исследование микробного сообщества при бактериальном вагинозе женщин и неспецифическом баланопостите мужчин на ДНК-микроматрицах Для определения эффективности созданного нами ДНК-чипа мы исследовали клинический материал от пациентов с признаками неспецифических воспалительных процессов в урогенитальной сфере – бактериального вагиноза у женщин и неспецифического баланопостита у мужчин. Надо отметить, что тезис об инфекционной природе этих заболеваний до сих пор является предметом дискуссий, в силу наблюдаемых неудач на фоне антимикробной терапии, с одной стороны, и низкой высеваемости микробной флоры при проводимом бактериологическом исследовании, с другой.

В группе мужчин, страдающих баланопоститами, наиболее часто выявлялись анаэробные грамотрицательные бактерии. Их наличие в содержимом препуциального мешка и отделяемом уретры обнаружено у 45/60 (75 %) пациентов. В 27/60 (45 %) случаях анаэробные бактерии были единственными микробными агентами, выявленными при первичном баланопостите. Среди них обнаружены микроорганизмы рода Prevotella – 14/27 (52 %) случаев, Bacteroides – 8/27 (27 %) случаев, Mobiluncus – 5/(19 %). В 9/27 (15 %) случаев выявлены различные ассоциации перечисленных анаэробных микроорганизмов. В 18/60 (30 %) случаях установлено сочетание анаэробной флоры с другими микроорганизмами – G. vaginalis, Ureaplasma spp., M. hominis, E.coli, S. agalactiae.

На данной стадии исследования отмечена тенденция к более легкому клиническому течению баланитов и баланопоститов, вызванных только анаэробными бактериями, и утяжеление характера наблюдаемого воспаления при сочетании анаэробной флоры с U. urealyticum, M. hominis, G. vaginalis. Включение в схему терапии таких больных пероральных препаратов метронидазола позволило достичь выраженного клинического эффекта в виде эпителизации эрозивных дефектов и исчезновения болезненности в течение 3 – 4 дней.

Характерный для бактериального вагиноза микробный пейзаж наблюдался у всех пациенток, включенных в исследование (n = 12). Однако, спектр выявляемой микрофлоры и информативность получаемых данных отличались для бактериологического и молекулярно-генетического исследования (рис. 4).

Бактериология до лечения Бактериология после лечения ДНК-чип до лечения ДНК-чип после лечения Рисунок 4. Результаты лабораторного тестирования клинических образцов от пациенток с бактериальным вагинозом до и после антибактериальной терапии. Проведено сопоставление данных бактериологического исследования и анализа на ДНК-чипе. Маркерные для бактериального вагиноза микроорганизмы выделены рамкой.

Так, по данным культурального посева почти во всех образцах выявлены S. epidermidis (12/12, 100 %), Corynebacterium spp (10/12, 83 %), которые не являются маркерами бактериального вагиноза и относятся к сопутствующей флоре. Применение технологии анализа на ДНК-чипе на стадии лабораторного обследования позволило выявить у 10/12 (83 %) пациенток присутствие анаэробных бактерий семейства Bacteroidales (B. fragilis, B. caccae, B. stercoris, P. melanogenica), V. parvula, A. vaginae, F. nucleatum, M. сurtisii, обнаружение которых с помощью стандартного бактериологического посева, как правило, затруднено.

Наблюдаемое снижение частоты обнаружения G. vaginalis и урогенитальных микоплазм при тестировании на ДНК-чипе может быть объяснено очаговой природой Число пациентов локализации возбудителя в слизистой влагалища, что влечет за собой отличия в микробном составе двух образцов, взятых у одного пациента.

Зафиксированные изменения в спектре микрофлоры, выявляемой на фоне антимикробной терапии, касались преимущественно маркерной для бактериального вагиноза флоры (выделены рамкой на рис. 4), тогда как сопутствующие микроорганизмы были обнаружены во всех образцах, проанализированных бактериологическими методами. В этой ситуации тестирование образцов с помощью ДНК-микроматриц позволило получить дополнительную информацию о состоянии микробиоценоза влагалища. В частности, обнаружение у пациентки A. vaginae, свидетельствует о недостаточной эффективности проведенного курса терапии и необходимости продолжения лечения, а «отсутствие» какой-либо флоры в 3-х образцах является сигналом резкого снижения общего титра бактерий менее 104 КОЕ/мл, что требует назначения курса заместительной терапии.

Высокая частота обнаружения трудно культивируемой флоры в проведенных исследованиях позволила нам предположить, что данная технология может быть использована в качестве дополнительного метода тестирования при анализе биоценозов, потенциально включающих анаэробную и микроаэрофильную флору, особенно для оценки эффективности антибактериальной терапии.

2.2.3. Тестирование генетических маркеров резистентности микобактерий туберкулеза, пневмококка, гонококка и оценка их вклада в формирование устойчивого фенотипа.

Мониторинг изменений в профиле лекарственной чувствительности бактериальных патогенов занимает ведущее место в мероприятиях по борьбе с ними. Сегодня понятно, что необходимо не просто регистрировать факт появления устойчивых изолятов, но и выявлять молекулярные изменения, предопределяющие эти процессы. Последнее особенно важно для разграничения хромосомных и плазмидных механизмов реализации резистентности, имеющих разную скорость распространения в микробной популяции.

Анализ опубликованных данных позволил нам систематизировать информацию об известных генетических механизмах формирования лекарственной устойчивости микобактрий туберкулеза, пневмококка и гонококка к различным классам лекарственных препаратов, применяемым в терапии соответствующих инфекционных заболеваний. В данном случае всю совокупность анализируемых признаков можно разбить на две группы – наличие/отсутствие гена, что легко детектируется с привлечением амплификационных технологий, и однонуклеотидные замены в генах-мишенях, для детекции которых в рамках данного исследования разработаны оригинальные диагностические системы, реализующие принцип минисеквенирования с последующей масс-спектрометрической детекцией.

Адекватность разработанного подхода обнаружения генетическидетерминированной лекарственной устойчивости, его пригодность для осуществления молекулярно-эпидемиологического мониторинга были продемонстрированы в ходе тестирования клинических изолятов S. pneumoniaе (n = 234), M. tuberculosis (n = 693) и N. gonorrhoeae (n = 585), фенотип которых был установлен на основании бактериологического тестирования.

Изучение закономерностей распространения генетических маркеров резистентности среди клинических изолятов S. рneumoniaе Для S. pneumoniae был проведен анализ генетических маркеров лекарственной устойчивости к -лактамным антибиотикам и фторхинолонам, поскольку пенициллин, цефотаксим, наряду с моксифлоксацином являются препаратами выбора в терапии пневмококковых инфекций.

При выборе значимых маркеров формирования устойчивости пневмококка к -лактамным антибиотикам были отобраны три гена – pbpA, pbp2b и pbpX, продукты которых – пенициллин связывающие белки (ПСБ) 1, 2b и 2Х, рассматриваются как первичные мишени действия данного класса АМП [Zapun, 2008]. Поскольку единого мнения о первичном сайте возникновения мутаций, обуславливающих устойчивость S. pneumoniaе к -лактамным антибиотикам не существует, мутации в этих генах рассматривались независимо, с учетом возможного кумулятивного эффекта.

По данным генетического тестирования, 55/169 (32,5 %) изолятов относились к дикому генотипу (не содержали мутаций в исследованных локусах), что достоверно ассоциировалось с чувствительностью к пенициллину ( 2 = 143,3, p<0,001). Среди оставшейся части выборки были выявлены восемнадцать различных комбинаций генетических маркеров, потенциально вовлеченных в формирование резистентности пневмококка к пенициллину. В целом, из 120 изолятов S. pneumoniaе со сниженной чувствительностью к пенициллину мутации в рассмотренных ПСБ были обнаружены в 111 (92,5 %) случаях (табл. 3), что реально свидетельствует о высокой диагностической чувствительности метода.

Таблица 3. Распределение изолятов пневмококка по категориям чувствительности к пенициллину, установленным по критериям CLSI (www.clsi.org) для каждого генетического варианта, сформированного согласно рабочей гипотезе: S – чувствительные, I – с промежуточной чувствительностью, R – устойчивые.

N (%) Категория чувствительности, N (%) Генотип изолята, согласно тестированию генов ПСБ S I R wt 55 (32,5) 46 (88,5) 9 (11,5) pbp2bmut 12 (7,1) 3 (25,0) 9 (75,0) pbp2bmut, pbpAmut 5 (3,0) 4 (80,0) 1 (20,0) pbpX Ile371Thr, pbp2bmut 1 (0,6) 1 (100) pbpX Gln552Glu, pbp2bmut 11 (6,5) 11 (100) pbpX Ile371Thr, pbp2bmut, pbpAmut 25 (14,8) 25 (100) pbpX Gln552Glu, pbp2bmut, pbpAmut 2 (1,2) 2 (100) pbpX Asn605Thr, pbp2bmut, pbpAmut 3 (1,8) 2 (66,7) 1 (33,3) pbpX Ile371Thr, Asn605Thr, pbp2bmut 2 (1,2) 1 (50,0) 1 (50,0) pbpX Ile371Thr, Asn605Thr, pbp2bmut, pbpAmut 52 (30,7) 13 (25,0) 39 (75,0) pbpX Ile371Thr, Gln552Glu, Asn605Thr, pbp2bmut, pbpAmut 1 (0,6) 1 (100) Всего 169 (100) 49 (30,0) 66 (38,1) 54 (31,9) Поскольку достоверной информации о кумулятивном эффекте мутаций в транспептидазном домене ПСБ 1А нет, и оценить его в рамках настоящего исследования не представлялось возможным, мутации в pbpA гене мы не дискриминировали и рассматривали в совокупности как pbpAmut, приравненные по частоте к аминокислотным заменам в Thr574 кодоне. Исходя из аналогичных предпосылок, был сформирован pbp2bmut генотип, равный по частоте встречаемости заменам Thr445Ala. Стоит отметить, что в последних работах именно этот маркер фигурирует как значимый для процесса развития пневмококком устойчивости к -лактамным антибиотикам [Izdebski, 2008]. При рассмотрении мутаций, выявленных в транспептидазном домене ПСБ 2Х, обращает на себя внимание факт обнаружения чувствительных изолятов с генотипом Thr338mut, Arg384Gly. Несмотря на то, что мутации в этих кодонах являются первыми описанными маркерами устойчивости пневмококка к пенициллинам, сейчас появляется все больше данных противоречащих этой точки зрения [Maurer, 2008].

При рассмотрении собственных результатов была принята рабочая гипотеза об отсутствии влиянии изолированных мутаций в Thr338 и Arg384 кодонах на чувствительность пневмококка. В этом случае генотипы Thr338mut, Arg384Gly приравнивались к дикому типу (wt), а при наличии других замен в pbpX они просто не учитывались. Полученное распределение изолятов S. pneumonia с различными генотипами по трем категориям чувствительности к пенициллину представлено в табл. 3.

Выполненный анализ позволил нам выделить полиморфизмы, наиболее информативные для предсказания генетически-детерминированной устойчивости пневмококка к пенициллину. В этот список попали любые мутации в транспептидазном домене ПСБ 2В, в первую очередь Thr445Ala, сопровождающиеся изменениями в ПСБ 1А и/или ПСБ 2Х.

Традиционно транспептидазный домен ПСБ 2Х рассматривался как первичная мишень накопления мутаций при формировании устойчивости пневмококка к пенициллину [Carapito, 2006; Mouz, 1999]. Однако, в настоящем исследовании выявлены изолята, имеющие дикий генотип по ПСБ 2Х, но реализующие устойчивость за счет вовлечения ПСБ 1А на фоне мутаций в ПСБ 2В. Этот факт дает основание утверждать о существовании альтернативных механизмов резистентности S. pneumoniae к пенициллину. И хотя изолированные мутации в ПСБ 2В, по нашим данным, не обеспечивают клинически-значимое снижение чувствительности S. pneumoniae к пенициллину, именно их следует рассматривать как ранний маркер формирования устойчивости пневмококка к -лактамным антибиотикам.

Дополнительное подтверждение эта точка зрения получила при рассмотрении мутаций в ПСБ 2Х. Среди обнаруженных аминокислотных замен удалось выделить три, по-видимому, независимо возникающие мутации – Ile371Thr, Gln552Glu, Asn605Thr, которые достоверно приводят к снижению чувствительности пневмококка к пенициллину. Данный вывод частично согласуется с работой Maurer, 2008, в которой мутации Gln552Glu и Asn605Thr также выделены как маркерные. В тоже время канонические мутации – Thr338Ala, Pro, Gly в активном центре фермента наряду с Arg384Gly, по-видимому, играют лишь вспомогательную роль в формировании клинической устойчивости. Обсуждая вариабельность транспептидазного домена ПСБ 2Х, необходимо отметить отсутствие изолятов с мутациями Phe339Met и Met400Thr, что может объясняться региональными особенностями S. pneumoniaе и требует дальнейших исследований для уточнения этого предположения.

Диагностическая значимость установленных маркеров устойчивости пневмококка к пенициллину – pbp2bmut, pbpАmut и замены в кодонах Ile371, Gln552 и Asn605 гена pbpX, была продемонстрирована путем сравнения распределения «выведенных» на основании генотипа категорий чувствительности с данными бактериологического тестирования этой же выборки (рис. 5).

Рисунок 5. Сопоставление распределения изолятов по категориям чувствительности к пенициллину на основании данных генетического и бактериологического тестирования. Категория «устойчивые» включает все изоляты со сниженной чувствительностью к пенициллину.

Полученное распределение, не имеющее достоверных отличий между двумя методами тестирования (р>0,05), указывает на адекватность выбранных маркеров и перспективность применения генетического исследования как для индивидуальной оценки чувствительности пневмококка к -лактамным антибиотикам, так и для мониторинга распространения генетических детерминант устойчивости в популяции.

Сходное по идеологии исследование распределения мутаций в генах гираз (gyrA, gyrB) и топоизомераз (parC, parE) позволило установить ассоциацию одновременного обнаружения мутаций в генах gyrA и parC с клинической устойчивостью S.

pneumoniae к фторхинолонам. Наличие мутаций только в одном из рассмотренных генов не приводит к формированию значимой устойчивости к левофлоксацину и моксифлоксацину, что не противоречит данным литературы [Balsalobre, 2003; Heather, 2007], однако может рассматриваться как маркер начавшихся мутационных процессов в популяции.

В целом, высокая диагностическая чувствительность отобранных генетических маркеров дает основание утверждать о применимости разработанной системы геномного сканирования мутаций как в диагностических целях, так и в мониторинге лекарственной устойчивости пневмококка, что особенно важно для своевременного предотвращения распространения изолятов, несущих детерминанты устойчивости на фоне клинической чувствительности к -лактамным антибиотикам и фторхинолонам.

Молекулярный мониторинг генетически детерминированной лекарственной устойчивости клинических изолятов M. tuberculosis В ходе исследования впервые осуществлено молекулярное типирование обширной коллекции клинических изолятов M. tuberculosis (n = 693), собранных из разных регионов России, по 13-ти маркерным сайтам, расположенным в четырех локусах геномной ДНК – RRDR гена rpoB, ген katG и регуляторная область inhA и ген embB – мутации в которых обуславливают устойчивость к рифампицину (RIF), изониазиду (INH) и этамбутолу (EMB).

Всего мутации в RRDR обнаружены у 323 (88,0 %) из 369 устойчивых к RIF изолятов M. tuberculosis. В проанализированной выборке найдено шестнадцать вариантов однонуклеотидных замен в кодонах 533, 531, 526, 516 и 511 гена rpoB и один вариант вставки между кодонами 513 и 514. Ни один из изолятов не имел изменений в кодонах 513 и 522. Среди замен преобладали мутации в Ser531, обнаруженные у 42,5 % от общего числа изолятов. Наибольшее число вариантов мутаций – семь – выявлены в His526 среди 32 (4,6 %) изолятов. Четыре варианта замен найдено в Asp516 у 28 (4,0 %) образцов. Всего мутации в кодонах 531 и 526 гена rpoB, приводящие к высокому уровню устойчивости к RIF, выявлены у 327 (47,2 %) микобактерий, в кодонах 533, 516, 511, ассоциированные с умеренной устойчивостью, – у 44 (6,3 %).

Среди 324 изолятов, чувствительных к RIF по методу абсолютных концентраций, 266 (82,0 %) не несли мутаций в изучаемой области гена rpoB. У 58 изолятов выявлены мутации в RRDR, из них у 39-ти – в Ser531. Однако, определение ингибирующей концентрации RIF для этих микобактерий показало, что 15 из них устойчивы к концентрациям RIF меньшим или равным критической. Данное наблюдение подчеркивает актуальность генетического тестирования, поскольку устойчивость таких изолятов не выявляется в ходе регламентированного Приказом № 109 МЗ РФ бактериологического тестирования, однако может иметь клиническое значение при последующей химиотерапии.

Генетические маркеры устойчивости к INH (мутации в локусах katG и inhA) обнаружены в общей сложности у 426 (92,2 %) изолятов из 462 фенотипически устойчивых. Устойчивость оставшейся группы изолятов может быть вызвана мутациями в других генах, например, kasA (ген -кетоацил-АПБ-синтетазы), ndh (ген НАДНдегидрогеназы), ahpC (ген алкилгидропероксидредуктазы), потенциально вовлеченных в процесс формирования устойчивости к INH и не затронутых в данном исследовании. Изолированные мутации в кодоне Ser315 гена katG обнаружены у 402 (58,0 % от общего числа) изолятов, в области inhA – у 9 (1,3 %). Сочетание мутаций в обоих локусах наблюдалось в 59 (8,5 %) случаях. В целом у 461 (66,5 %) изолятов выявлены мутации, приводящие к высокому уровню устойчивости к INH.

Среди 231 изолятов, чувствительных к INH по методу абсолютных концентраций, 187 (81,0 %) не несли мутаций в изучаемых областях. Обнаружение в оставшихся образцах мутаций в локусе inhA и кодоне Ser315 гена katG может свидетельствовать о начавшемся процессе формирования клинической устойчивости к INH.

Обладая высокой аналитической чувствительностью – до 50 микробных клеток в образце – примененная методика обнаружения генетически-детерминированной устойчивости к RIF и INH продемонстрировала высокую диагностическую чувствительность – 88 % и 92 %, соответственно. Этот факт дает основание утверждать о применимости технологии минисеквенирования с последующей МАЛДИ ВМС для анализа клинического материала – мокрота, бронхо-альвеолярный лаваж, минуя стадию бактериологического посева.

Известно, что структура мутаций и частоты встречаемости мутантных кодонов у M. tuberculosis различаются в зависимости от географии выделения штамма [Bttger, 2008]. Среди исследованных в нашей выборке изолятов наиболее часто точечные мутации, обуславливающие устойчивость к RIF, были обнаружены в кодонах Ser351, His526 и Asp516 гена rpoB, составляя 76,6 %, 10,7 % и 9,2 % от общего числа мутаций, соответственно. Подобное распределение характерно для многих регионов Российской Федерации [Gryadunov, 2005; Nikolayevsky, 2004]. Однако, в ряде областей наблюдаются и некоторые отличия. В частности, в Северо-Западном регионе отмечается преобладание замен в Gln513 RpoB (10,0 %) над мутациями в Asp516 (3,3 %) [Gryadunov, 2005], тогда как в настоящей выборке подобная замена была обнаружена лишь у одного устойчивого к RIF изолята.

Общая частота встречаемости точечных мутаций в кодонах Met306 и Gly406 гена embB среди резистентных к EMB изолятов была невысокой – около 54,0 % (97 из 181). Наши данные согласуются с представленными ранее для Северо-западного региона России (от 48,6 до 54,0 %) [Gryadunov, 2005] и Латвии (52,0 %) [Toungoussova, 2002], что свидетельствует о низкой информативности выявления этих мутаций при мониторинге устойчивости к EMB.

С другой стороны, в группе чувствительных изолятов 63 из 71 (88,7 %) не имели перечисленных мутаций. Для шести из оставшихся восьми изолятов ингибирующая концентрация EMB составила 2 мг/л, что объективно не позволяет рассматривать их как чувствительные. Все это подчеркивает значимость генетического тестирования, поскольку устойчивость таких изолятов не обнаруживается при стандартном бактериологическом исследовании, но может повлиять на эффективность терапии.

В тоже время, обнаружена достоверная связь между частотой встречаемости мутаций в гене embB и числом препаратов, к которым устойчив изолят (табл. 4).

Мутации в кодонах Met306 и Gly406 встречались достоверно чаще среди мультирезистентных (MDR) изолятов (113/204; 55,4 %), чем среди моноустойчивых и чувствительных (4/81; 4,9%) (2 = 60,99; р<0,001). Стоит отметить, что пять из восьми изолятов, чувствительных к EMB, но имеющих мутации в гене embB, имели MDR фенотип. При сравнении относительных частот мутаций в кодонах Met306 и Gly406 гена embB в двух группах: MDR-изоляты, не имеющие генетических детерминант устойчивости к рифампицину и изониазиду, и MDR-изоляты, содержащие мутации в генах rpoB, katG и локусе inhA, значимых различий обнаружено не было (2 = 0,02; р=0,90).

Таким образом, генетические детерминанты MDR и мутации в гене embB не связаны между собой, несмотря на то, что наблюдается статистически значимая ассоциация этих замен с MDR фенотипом.

Таблица 4. Частоты встречаемости мутаций в кодонах 306 и 406 гена embB в зависимости от профиля лекарственной устойчивости изолята M. tuberculosis.

Фенотипическая Число Число изолятов с мута р устойчивость изолятов циями в гене embB; N(%) Чувствительные 43 0 группа сравнения Устойчивые к одному препа24 1 (4,1) 1,8 0,17рату; RIF или INH или EMB Устойчивые к двум препаратам; RIF,INH или RIF,EMB 29 8 (27,5) 13,34 0,00или INH, EMB Устойчивые к трем препара169 96 (57,1) 45,97 <0,00там; RIF, INH и EMB - устойчивость определена методом абсолютных концентраций. RIF – рифампицин, INH – изониазид, EMB – этамбутол.

Ранее подобное наблюдение было сделано для мутаций в кодоне Met306 гена embB [Мокроусов, 2002], однако мутации в кодоне Gly406, как маркер MDR фенотипа, до настоящего времени не рассматривались.

Учитывая, что распространение множественной лекарственной устойчивости представляет особую проблему во многих областях медицины, включая фтизиатрию, очевидна необходимость в развитии и внедрении новых подходов для быстрого выявления MDR-изолятов M. tuberculosis. Исходя из наблюдения ассоциации мутаций в локусах embB306/406 с MDR-фенотипом, мы предприняли попытку оценить возможности использования данного генетического локуса для быстрой диагностики MDR.

В исследованной выборке анализ локусов embB306/406 для определения MDRфенотипа обладал низкой диагностической чувствительностью – около 55,0 % (102/185), но высокой специфичностью – 95,0 % (77/81). При этом диагностическая чувствительность определения MDR на основании двух генетических маркеров – локусы rpoB и katG/inhA - составила 89,2 % (165/185), однако при использовании трех локусов – embB306/406, rpoB и katG/inhA – чувствительность возрастала до 94,6 % (175/185).

Таким образом, использование комбинированного анализа перечисленых генетических локусов может рассматриваться как достаточно интересный и перспективный подход, при помощи которого можно повысить эффективность своевременного обнаружения MDR-изолятов M. tuberculosis, и обеспечить разработку мероприятий по предотвращению их появления и распространения в человеческой популяции.

Изучение закономерностей распространения генетических маркеров резистентности среди клинических изолятов N. gonorrhoeae.

В исследование включены 15 генетических локусов, для которых в литературе имеются указания на причастность к формированию устойчивости гонококка к применяемым в практике АМП [Hu, 2005; Ropp, 2002; Lindbck; 2006]. В настоящей работе впервые все известные механизмы резистентности N. gonorrhoeae рассмотрены в совокупности, показана возможность прогнозировании лекарственной устойчивости на основании генетического тестирования и осуществлено молекулярное типирование клинических изолятов, собранных в различных регионах России.

О наличие плазмидных механизмов резитентности к пенициллину и тетрациклину судили на основании обнаружения гена blaTEM1 –лактамазы и TetM детерминанты, соответственно. Для оценки специфических хромосомных механизмов формирования устойчивости к пенициллину, тетрациклину и фторхинолонам, в первом случае рассмотрены мутации генов ponA и penA, кодирующих ПСБ 1 и 2, во втором – мутация в гене rpsJ, кодирующем рибосомальный белок S10, в третьем – мутации в QRDR генов гиразы (gyrA) и топоизомеразы IV (parC).

Кроме того, исследованы мутации в кодирующей и промоторной областях гена mtrR, продукт которого отвечает за активацию неспецифического эффлюкса АМП и мутации в локусе penB гена porВ, приводящие к снижению проницаемости мембранного белка порина для ксенобиотиков. Перечисленные механизмы являются неспецифическими в отношении исследуемых АМП. Поскольку мутации в локусе penC гена pilQ мембранного белка секретина носят вспомогательный характер [Zhao, 2005], они не были включены в общую панель генетических тестов.

Проведенный анализ встречаемости генетических детерминант лекарственной устойчивости показал, что их отсутствие достоверно ассоциируется с клинической чувствительностью N. gonorrhoeae к исследованным классам АМП. Также в категорию чувствительных попали большинство гонококков, имеющих изолированные мутации в локусах penB, mtrR, penA или rpsJ, потенциально вовлеченных в формирование устойчивости к пенициллинам и тетрациклинам (табл. 5).

При исследовании молекулярных механизмов устойчивости к пенициллину, для 54 (11,6 %) изолятов, относящихся к дикому генотипу (отсутствие мутаций в хромосомных локусах и гена blaTEM1), установлена достоверная ассоциация с чувствительным фенотипом ( = 134,3, p<0,001). Для остальных изолятов были выявлены одиннадцать различных комбинаций генетических маркеров, потенциально вовлеченных в формирование резистентности к пенициллину.

Четыре генотипа (ponAmut, penAmut), (ponAmut, penAmut, mtrRmut), (ponAmut, penAmut, penBmut), и (ponAmut, penAmut, penBmut, mtrRmut) преобладали в исследованной выборке и были обнаружены у 39 (8,4 %), 62 (13,4 %), 76 (16,4 %), и 133 (28,7 %) изолятов, соответственно. Для всех этих генотипов была показана достоверная ассоциация с невосприимчивостью гонококка к пенициллину ( =281,7, p<0,001).

Таблица 5. Чувствительность к пенициллину, тетрациклину, ципрофлоксацину изолятов N.

gonorrhoeae с различными генотипами. S – чувствительные, I – изоляты с промежуточным уровнем устойчивости, R – устойчивые изоляты. Категории установлены в соответствии с рекомендациями CLSI (www.clsi.org). Серым выделены генотипы, достоверно ассоциированные с резистентностью.

N (%) N (%) изолятов по чувствительности к АМП Генотип p изолятов S I R Пенициллин wt 54 (11,6) 49 (90,7) 5 (9,3) 0 (0,0) p<0,0penAmut 51 (9,4) 25 (49,0) 24 (47,1) 2 (3,9) p>0,mtrRmut 1 (0,2) 1 (100,0) 0 0 - penBmut 2 (0,4) 2 (100,0) 0 0 - penAmut, penBmut 7 (1,5) 2 (28,6) 5 (71,4) 0 p>0,penAmut, 5mtrRmut 15 (3,2) 5 (33,3) 9 (60,0) 1 (6,7) p>0,penAmut, penBmut, 5mtrRmut 6 (1,3) 3 (50,0) 3 (50,0) 0 p>0,penAmut, ponAmut 39 (8,4) 6 (15,4) 31 (79,5) 2 (5,1) p<0,0penAmut, ponAmut, 5mtrRmut 62 (13,4) 6 (9,7) 51 (82,3) 5 (8,0) p<0,0penAmut, penBmut, ponAmut 76 (16,4) 6 (7,9) 63 (82,8) 7 (9,2) p<0,0penAmut, penBmut, ponAmut, 5mtrRmut 133 (28,7) 15 (11,3) 95 (71,4) 23 (17,3) p<0,0blaTEM1pres 18 (3,9) 0 3 (16,7) 15 (83,3) p<0,0Всего 464 120 (25,9) 289 (62,2) 55 (11,9) Тетрациклин wt 91 (19,6) 76 (83,5) 15 (16,5) 0 p<0,0mtrRmut 3 (0,6) 3 (100,0) 0 0 - penBmut 3 (0,6) 2 (66,7) 1 (33,3) 0 p>0,rpsJmut 59 (12,7) 18 (30,5) 30 (50,8) 11 (18,7) p<0,rpsJmut, 5mtrRmut 78 (16,8) 21 (26,9) 21 (26,9) 36 (46,2) p<0,rpsJmut, penBmut 87 (18,8) 18 (20,7) 22 (25,3) 47 (54,0) p<0,rpsJmut, penBmut, 5mtrRmut 139 (30,0) 29 (20,9) 32 (23,0) 78 (56,1) p<0,tetMpres 4 (0,9) 0 0 4 (100,0) p<0,Всего 464 167 (40,0) 119 (25,6) 178 (38,4) Ципрофлоксацин wt 150 (32,2) 149 (99,3) 1 (0,7) 0 p<0,0mtrRmut 85 (18,3) 82 (96,5) 0 3 (3,5) p<0,0gyrAmut 17 (3,7) 2 (11,8) 1 (5,9) 14 (82,3) p<0,0parCmut 4 (0,1) 1 (25,0) 0 3 (72,0) p>0,gyrAmut, 5mtrRmut 6 (1,3) 2 (33,3) 0 4 (66,7) p>0,parCmut, 5mtrRmut 13 (2,8) 2 (15,4) 0 11 (84,6 ) p<0,0gyrAmut, parCmut 70 (15,1) 1 (1,4) 0 69 (98,6) p<0,0gyrAmut, parCmut, 5mtrRmut 119 (25,6) 12 (10,1) 0 107 (89,9) p<0,0Всего 464 251 (54,1) 2 (0,4) 211 (45,5) – совокупность генетических детерминант, отобранных для изучения закономерностей формирования устойчивости к пенициллину, тетрациклину и фторхинолонам, соответственно;

– достоверность различий между изолятами, относящимися к различным категориям чувствительности внутри одного генотипа (использован двухсторонний точный критерий Фишера);

– wild type (дикий тип) – отсутствие изменений нуклеотидной последовательности в локусах, вовлеченных в формирование устойчивости к пенициллину, тетрациклину и фторхинолонам, соответственно;

– совокупность нуклеотидных мутаций, обнаруженных как в кодирующей области гена mtrR, так и в его промоторе;

– комбинация присутствия гена blaTEM1 или tet(M) детерминанты с любыми вариациями нуклеотидных последовательностей других локусов;

Присутствие гена blaTEM-1 обнаружено у 18 изолятов со следующей географической принадлежностью: Санкт-Петербург (n = 5), Самара (n = 5), Москва (n = 4), Чебоксары (n = 1), Мурманск (n = 1), Нижний Новгород (n = 1), Екатеринбург (n = 1).

Все изоляты, содержащие tetM-детерминанту (n = 4), относились к Московскому региону, что свидетельствуют о большей распространенности плазмидных маркеров резистентности в субпопуляции гонококка крупных промышленных и торговых центров с числом жителей, превышающим один миллион. Однако, общая частота встречаемости плазмидных факторов устойчивости в популяции гонококка оказалась низкая – менее 4,0 % для исследуемой выборки.

Настоящее исследование позволило внести некоторые коррективы в сложившуюся картину формирования резистентности гонококка к пенициллину. Так, изолированная мутация Asp345а в ПСБ 2 (ген penA ) традиционно рассматривалась как первая ступень приобретения устойчивости к пенициллину, приводящая к увеличению МПК до 0,12 – 0,25 мг/л [Brannigan, 1990; Dowson, 1989]. В нашем исследовании эта закономерность не нашла подтверждения. Для изолятов с penAmut генотипом (n = 51), равно как и для 28 изолятов, несущих изолированные мутации в локусах penB или mtrR в сочетании с penA, не удалось выявить достоверной ассоциации с устойчивым фенотипом (p>0,05). Большинство устойчивых к пенициллину изолятов гонококка (n = 310) имели мутации в генах penA и ponA в комбинации с любым вариантом нуклеотидной последовательности в локусах penB и mtrR. И хотя ранее замена Leu421Pro в ПСБ 1 (ген ponA) рассматривалась только как дополнительная ступень в процесс формирования устойчивости к пенициллину [Ropp, 2002], настоящие данные свидетельствуют о важности этой мутации. Сходные результаты были получены в более узком исследовании (без анализа локусов penB и mtrR) на выборке из 120 гонококков [Vernel-Pauillac, 2006]. Закономерно, что высокая устойчивость к пенициллину характерна для изолятов гонококка, несущих мутации во всех исследованных областях.

Как и следовало ожидать, большинство устойчивых к тетрациклину изолятов гонококка либо несли плазмидную Tet(M) детерминанту (n = 4), либо имели мутации в локусах rspJ, mtrR и penB хромосомной ДНК. Изоляты N. gonorrhoeae, в которых перечисленные маркеры не обнаружены (n = 91), были чувствительны или умеренно устойчивы к тетрациклину (МПК 1,0 мг/л). Аналогичная тенденция наблюдалась для 6 изолятов с мутациями в локусах mtrR или penB.

Хотя для 59 гонококков, несущих изолированную мутацию Val45Met в рибосомальном белке S10 (ген rpsJ), не удалось установить связь с устойчивым фенотипом (p>0,05), остальные выявленные у 304 изолятов генотипы – (rpsJmut, mtrRmut), (rpsJmut, penBmut), and (rpsJmut, penBmut, mtrRmut), достоверно ассоциировались с лекарственной устойчивостью ( = 163,1, p<0,001). Настоящее заключение полностью согласуется с первоначальной точкой зрения на мутацию в гене rpsJ как дополнительный механизм развития устойчивости к тетрациклину [Hu, 2005].

Продемонстрирована достоверная ассоциация между выявлением различных комбинаций мутаций в QRDR гиразы (ген gyrA) и топоизомеразы (ген parC) и устойчивостью гонококка к фторхинолонам ( = 404,1, p<0,001). Стоит отметить, что два генотипа – (gyrAmut, mtrRmut) и (parCmut) встречались крайне редко, что не позволило объективно оценить их роль в формировании резистентности.

В целом, анализ распределения отдельных маркеров и их сочетаний в группах чувствительных и устойчивых изолятов гонококка позволил отобрать генотипы, пригодные для прогнозирования лекарственной устойчивости гонококка к пенициллину, тетрациклину и фторхинолонам с высокой достоверностью (p<0,01) (выделены серым в табл. 5). Достоверность предсказания фенотипической устойчивости на основании отобранных маркеров (генотипов) составила 90,3 % для фторхинолонов, 91,1 % для пенициллина и 81,9 % для тетрациклина. Однако, даже в случае тетрациклина, детерминанты резистентности к которому отобраны с наименьшей достоверностью (р<0,01), нет значимых различий при сопоставлении «выведенных» на основании генотипа категорий чувствительности с данными бактериологического исследования (рис. 6).

Рисунок 6. Сопоставление распределения изолятов гонококка (n = 129) по категориям чувствительности к тетрациклину на основании данных генетического и микробиологического тестирования. Категория «устойчивые» включает все изоляты со сниженной чувствительностью к тетрациклину.

В ходе работы продемонстрирована также возможность обнаружения генетических детерминант устойчивости в препаратах геномной ДНК N. gonorrhoeae, выделенной непосредственно из клинического материала. При такой постановке анализа первичная идентификация гонококка может быть осуществлена любыми методом генодиагностики, в том числе с применением ДНК-микроматриц. Сходная идеология прослеживается в исследовании Martin, 2007, продемонстрировавшем возможность молекулярного типирования ДНК гонококка, экстрагированной из ткани.

В совокупности, рассмотренные результаты тестирования клинических изолятов пневмококка, гонококка, туберкулеза иллюстрируют качественный скачок в процессе реформирования существующих систем мониторинга путем внедрения средств молекулярного анализа. Выбор перечисленных возбудителей, как модельных для создания на основе МAЛДИ ВМС технологии выявления нуклеотидных полиморфизмов в геномах бактерий применительно к тестированию лекарственной устойчивости, был обусловлен их несомненной клинической значимостью и позволил нам продемонстрировать универсальность разработанной методики для грамположительных (S.

рneumoniaе, M. tuberculosis) и грамотрицательных (N. gonorrhoeae) бактерий. Причем, если гонококк можно охарактеризовать как типичный микроб с хорошо развитыми адаптивными механизмами регулирования проницаемости клеточной стенки и эффлюкса, легко обменивающийся генетическим материалом с другими микроорганизмами, то микобактерии, ограниченные малопроницаемой восковой капсулой, представляют замкнутую систему, возникновение лекарственной устойчивости в которой происходит исключительно за счет геномных мутаций.

2.2.4. Молекулярно-генетическое исследования популяционного полиморфизма вирусов гепатита В и С.

Используя технологическую платформу, эффективно примененную для обнаружения генетически-детерминированной лекарственной устойчивости бактериальных патогенов, нами были разработаны методы молекулярного типирования ДНК ВГВ и РНК ВГС, позволяющие оценить вариабельность этих вирусов.

На основании сравнительного анализа последовательностей pre-S1/pre-S2 области ДНК ВГВ и 5’ нетранслируемой области (5’ UTR) РНК ВГС выделены кластеры типоспецифичных однонуклеотидных замен, регистрация которых дает возможность установить генотип вируса, и подобраны соответствующие олигонуклеотидные праймеры для проведения реакций амплификации и минисеквенирования с последующей МАЛДИ ВМС детекцией.

Методику типирования ВГВ применили для исследования образцов сыворотки, полученных от 260 пациентов с хроническим гепатитом В. В 103 (39,6 %) образцах обнаружена ДНК ВГВ. Среди них у 7 (6,8 %) больных установлен генотип A ВГВ, у (3,9 %) - генотип C, и у 86 (83,5 %) - генотип D. У шести пациентов (5,8 %) выявлено смешанное инфицирование генотипами D и С вируса.

Полученные нами данные отличаются от представлений, сложившихся по результатам исследования 2000 года, когда на европейской части России доминировал генотип D ВГВ (99 %), а остальные генотипы практически не встречались [Morozov, 2000]. Обнаружение генотипов А и С среди проанализированных образцов можно объяснить интенсивной миграцией населения из Якутии, Кавказского и Азиатского региона, где процентное соотношение генотипов А и С относительно генотипа D намного выше. В пользу этого утверждения свидетельствует меньшее разнообразие генотипов ВГВ, выявленных в Санкт-Петербурге [Писарева, 2007], где уровень миграции объективно ниже.

Система генотипирования ВГС была апробирована на ВГС-позитивных образцах из лабораторного банка сывороток, протестированных также аллель-специфичной амплификацией для установления генотипа вируса [Ильина, 2002]. Среди исследованных 69 образцов генотип вируса 1а выявлен в 4,5 % случаях, 1в – 48 %, 2а – 4,5 %, 3а – 29 %, 4 – 1,5 %. В 8 (12 %) образцах регистрируется микст-инфекция.

Долгое время о распространенности различных генотипов ВГС на территории РФ судили по данным НИИ вирусологии им. Ивановского [Львов, 1997], декларировавших тотальное преобладание 1b генотипа вируса. Эпидемиологическая картина распространенности различных генотипов ВГС в Москве не отличалась от таковой по стране в целом. Наши данные указывают на снижение доли генотипа 1b среди ВГСинфицированных жителей Москвы и возрастание числа пациентов, инфицированных 3а генотипом ВГС и имеющих микст-инфекцию. Кроме того, применение предложенной схемы типирования позволило выявить генотип 4 ВГС, что повысило эффективность методики до 100 %.

Сам факт использования разработанной технологии для анализа как бактериальной, так и вирусной ДНК (или РНК в случае ВГС) указывает на универсальность предложенного нами подхода. Будучи реализован в плашечном формате, этот метод дает возможность использовать роботизированные системы для разнесения образцов и реагентов, автоматизированные алгоритмы считывания результатов. Внедрение данного подхода, позволяющего осуществлять одновременное тестирования 96/384/1536 образцов, может значительно ускорить масштабные исследования, направленные на мониторинг распространения ВГВ и ВГС в нашей стране. В тоже время, метод минисеквенирования имеет явное преимущество перед прямым считыванием нуклеотидной последовательности, поскольку позволяет однозначно выявлять случаи смешанного инфицирования вирусами с различными генотипами.

2.2.5. Молекулярное типирование бактериальных патогенов Преобладание хромосомных механизмов формирования резистентности, распространяющихся клонально в микробных популяциях, диктует необходимость дополнения средств генетического тестирования резистентности средствами штаммового типирования, нацеленными на отслеживание путей распространения инфекции.

Поскольку для популяции пневмококка существуют общепризнанные стандартные методы типирования – MLST и серотипирование на основании капсидных антигенов, основное внимание в этой области было уделено типированию туберкулеза и гонококка. Причем ставились задачи оценить пригодность разнообразных методов для решения конкретных эпидемиологических задач, связанных с молекулярногенетической характеристикой и оценкой природного разнообразия бактериальных популяций, а так же поиска закономерностей распространения лекарственной устойчивости.

Среди существующего разнообразия методов типирования туберкулеза основное внимание уделено двум – сполиготипирование и мультилокусное VNTR типирование, первый из которых является специфичным для M. tuberculosis. Его применение ограничивается изучением популяции микобактерий, поскольку основывается на определении структуры уникального генетического элемента (т.н. DR-региона) методом гибридизации. Второй подход – VNTR типирование – является достаточно универсальным и применяется для изучения генетического разнообразия многих микроорганизмов [Van Belkum, 2007].

Оба метода использованы для типирования ограниченной группы клинических изолятов (n = 115), выделенных от больных легочным туберкулезом жителей Москвы и Московской области (проживание не менее 5-ти лет). Согласно данным сполиготипирования, исследованная выборка разделена на 20 сполиготипов, входящих в состав 15 генетических семейств. Наибольший кластер образован 76-ю (66,0 %) изолятами, относящимися к семейству Beijing. Гораздо меньше изолятов входило в состав двух следующих по величине семейств – LAM и T, 12 (10,4 %) и 10 (8,7 %) изолятов, соответственно. Шесть изолятов имели уникальный генотип, не представленый в международных базах данных. Разрешающая способность метода сполиготипирования оказалась весьма низкой (D = 0,59).

При этом для штаммов, принадлежащих к преобладающему в исследуемой выборке генетическому семейству Beijing, значение индекса разнообразия Симпсона составило всего 0,08. В то же время, для группы штаммов, не относящихся к этому семейству, разрешающая способность сполиготипирования оказалась весьма высокой (D = 0,94). Однако, учитывая, что большая часть изолятов (66,0 %) в исследованной выборке относилась к семейству Beijing, становится очевидным, что использование метода сполиготипирования без комбинации с другими схемами молекулярноэпидемиологического анализа, недостаточно эффективно для мониторинга M. tuberculosis в России.

Значительное преобладание в исследуемой выборке изолятов, относящихся, по данным сполиготипирования, к семейству Beijing, является характерной особенностью популяции M. tuberculosis, циркулирующей на территории Российской Федерации [Drobniewski, 2005], а также в странах – бывших республиках СССР и многих регионах мира (Азия, Южная Африка, Северная Америка) [Bifani, 2002]. В качестве одной из причин широкой мировой экспансии штаммов этого семейства предполагается ассоциация генотипа Beijing с устойчивостью (в т.ч. и MDR) к противотуберкулезным препаратам [Bifani, 2002].

В исследованной нами выборке MDR-изоляты также достоверно чаще встречались среди семейства Beijing (59/76; 77,6 %), чем среди других семейств (17/39;

43,6 %) (2 = 13,3; p<0,001), что подтверждает ведущую роль изолятов семейства Beijing в распространении мультирезистентного туберкулза в Московском регионе.

Анализ разнообразия исследованной микробной популяции при помощи 24-х локусного VNTR типирования позволил обнаружить 71 различных генетических вариантов, из которых 59 (83,0 %) были уникальными (выявлялись только у одного изолята в выборке). Остальные 56 изолятов M. tuberculosis образовывали 12 кластеров.

Три основных кластера имели VNTR-профили 223325173533424454433672, 223325153533424454433682 и 22332513533424454433662 и включали 13 (11,3 %), (10,4 %) и 9 (7,8 %) изолятов M. tuberculosis, соответственно. Необходимо отметить, что изоляты, образующие основные кластеры, входили в состав крупной эволюционно близкой группы. Разрешающая способность 24-х локусного VNTR-анализа значительно превосходила таковую для сполиготипирования – 0,97 и 0,59, соответственно.

Различная степень вариабельности тех или иных VNTR локусов позволила рассмотреть возможность оптимизации схемы VNTR типирования M. tuberculosis за счет исключения локусов, характеризующихся низким полиморфизмом. При этом шесть отобранных нами локусов (MIRU-26, MIRU-31, ETR-A, M tub21, QUB-11b и QUB-26), отличающихся наибольшим индексом вариабельности (более 0,5), обеспечивали высокую разрешающую способность (D = 0,94), приближающуюся к значениям разрешающей способности всей совокупности 24 локусов. Как показывают исследования других авторов [Wada, 2007], подобный подход, направленный на оптимизацию протокола VNTR анализа за счет формирования альтернативной комбинации локусов с учетом молекулярно-генетических особенностей региональной микробной популяции, представляется весьма интересным и перспективным для использования в системах национального мониторинга туберкулезной инфекции.

Сравнение разрешающей способности комбинаций различных методик генотипирования, использованных в данной работе (табл. 6) показало, что наилучшие результаты достигаются путем сочетания сполиготипирования с 24-х локусным VNTR анализом.

Таблица 6. Сравнительная характеристика использованных методов молекулярногенетического типирования клинических изолятов M. tuberculosis.

Общее Число Размеры клаМетод, исследуемая группа Число число уникальных стеризованных D изолятов кластеров генотипов генотипов групп Сполиготипирование Все изоляты 26 19 7 2 – 73 0,5Изоляты семейства Beijing 3 1 2 2 – 73 0,0Изоляты, не относящиеся 23 18 5 2 – 8 0,9к семейству Beijing VNTR-анализ, все изоляты 24-VNTR 71 52 12 2 – 13 0,912-MIRU-VNTR 48 36 12 2 – 27 0,96-VNTR 49 36 13 2 – 20 0,9Сполиго+24-VNTR Все изоляты 74 63 11 2 – 13 0,9Изоляты семейства Beijing 36 26 10 2 – 13 0,9Сполиго+12-MIRU-VNTR Все изоляты 53 42 11 2 – 25 0,9Изоляты семейства Beijing 17 11 8 2 – 25 0,8Сполиго+6-VNTR Все изоляты 56 44 12 2 – 20 0,9Изоляты семейства Beijing 22 14 8 2 – 20 0,8Уникальный генотип – генотип, представленный в исследуемой выборке одним штаммом.

24-VNTR – типирование с использованием 24 локусов: MIRU-2, 4, 10, 16, 20, 23, 24, 26, 27, 31, 39, 40; ETR-A, B, C; Mtub-04, 21, 29, 30, 34, 39; QUB-11b, 26, 4112-MIRU-VNTR – типирование с использованием 12 локусов: MIRU-2, 4, 10, 16, 20, 23, 24, 26, 27, 31, 39, 6-VNTR – типирование с использованием шести наиболее полиморфных локусов: MIRU-26, MIRU-31, ETR-A, M tub21, QUB-11b и QUB-D – дискриминирующая способность метода, индекс Симпсона Необходимо отметить, что это первый опыт применения VNTR типирования по 24 локусам для российских изолятов M. tuberculosis. Будучи изначально известным как микросателлитный анализ эукариотической ДНК, начиная с 2000 года, мультилокусное VNTR типирование активно используется для исследования микроэволюции прокариот [Grissa, 2008]. При этом M. tuberculosis был первым микроорганизмом, для которого сформулирован принцип VNTR анализа [Supply, 2000]. Сейчас общедоступная база данных (http://minisatellites.u-psud.fr) содержит информацию о вариабельности числа тандемных повторов в геномах более чем 150 видов бактерий, и этот метод типирования продолжает активно развивается в силу своей универсальности, возможности автоматизации в исполнении, простоте интерпретации, точности и воспроизводимости получаемых данных.

В качестве потенциальных схем типирования N. gonorrhoeae в данной работе рассмотрены прямое масс-спектрометрическое профилирование, por-типирование и мультилокусное типирование в двух вариантах реализации – мультиантигенное (NGMAST) и мультилокусное секвенирование (MLST).

Осуществленное прямое масс-спектрометрическое профилирование географически разнородной группы из 278 изолятов гонококка продемонстрировало постоянство получаемых масс-профилей, что полностью закрыло вопрос о возможности применения данной методики в штаммовом типировании гонококка.

Гетерогенность популяции на уровне изменчивости гена porB оценивали двумя способами, в основе которых лежал анализ практически полноразмерной (более 9п.н.) нуклеотидной последовательности гена porB.

Первый подход заключался в установлении серотипа возбудителя на основании сравнении анализируемых последовательностей гена porB с представленными в базах данных по принципу максимальной гомологии. Предложенный анализ позволил относительно легко получить общее представление о гетерогенности популяции, причем в терминах серотипирования – традиционного метода молекулярноэпидемиологической характеристики штаммов N. gonorrhoeae. Таким образом, данные генетического анализа, приведенные к формату «серотипирования» могут быть сопоставлены с уже накопленной в разных странах информацией о циркулирующих в популяции гонококка сероварах и серотипах.

Всего в исследованной выборке (n = 464) выявлено 11 P1B и 6 P1A серотипов, отмечено преобладание в выборке P1B серовара (88,6 %) с высоким процентом встречаемости серотипов Р1B2 (41,3 %), Р1B3 (29,6 %) и Р1B22 (9,9 %). В группе штаммов, относящихся к P1A серовару (11,4 %), доминирует серотип Р1A6 (71,2 %). Индекс разнообразия Симпсона, определяющий дискриминирующую способность метода, составил 0,78, что свидетельствует о низкой эффективности такого типирования.

Следует отметить, что убедительные данные о представленности основных серотипов гонококка для российской популяции получены впервые. Кроме того, сопоставление серотипа гонококка с профилем устойчивости позволило проверить гипотезу об ассоциации P1B серовара с феноменом мультирезистентности. Установлено, что наблюдаемая ассоциация обусловлена известными изменениями локуса penB, участвующими в формировании неспецифической устойчивости гонококка путем снижения проницаемости поринового канала для ксенобиотиков [Shafer, 2006].

Второй подход в типировании популяции гонококка на основании регистрации изменчивости гена porВ состоял в прямом детальном сравнении нуклеотидных последовательностей, оценке их вариабельности, выявлении уникальных аллельных профилей. Такой подход, несомненно, дает более полное представление об изменчивости гена белка порина, более информативен с точки зрения объема и точности эпидемиологической информации, хотя и более трудоемок.

На выборке, состоящей из 103 клинических изолятов N. gonorrhoea, полученных из 5-ти областных центров РФ – Иркутск (n = 22), Самара (n = 10), Архангельск (n = 28), Мурманск (n = 14), Санкт-Петербург (n = 29), осуществлен детальный сравнительный анализ нуклеотидных последовательностей генов porВ, а также апробированы две альтернативные системы мультилокусного молекулярного типирования.

Среди исследованных изолятов 92 имели аллель 1b гена porВ, соответствующую P1В серовару, и 11 - аллель 1a (P1A серовар). Всего были выявлены 55 варианта гена porB, при этом обнаружена более высокая гетерогенность аллеля porB1b по сравнению porB1a. Индекс разнообразия Симпсона данного метода типирования составил 0,96.

Кластерный анализ позволил разделить исследованную выборку на две крупные группы, соответствующие аллелям porB1a и porB1b, а также выделить несколько групп внутри аллеля porB1b. Полученное распределение свидетельствует о высокой вариабельности исследованной выборки, однако, не отражает ни географию выделения исследованных изолятов гонококка, ни их фенотип.

Поскольку в современной эпидемиологии гонококка нет устоявшихся систем штаммовой дискриминации, кроме серотипирования, базирующегося на антигенной структуре белка порина, нами рассмотрены две альтернативные системы мультилокусного молекулярного типирования, каждая из которых имеет шансы стать основной в эпидемиологии гонококка. Это мультиантигенное типирование (NG-MAST), оценивающее полиморфизм генов porB и tbpB [Martin, 2004] и мультилокусное секвенирование (MLST) [Maiden, 1998]. Причем в случае последнего был изучен расширенный набор генов с учетом их индивидуальной вариабельности.

По результатам NG-MAST вся анализируемая выборка изолятов (n = 103) оказалась разделена на 61 сиквенс-тип, что ощутимо больше, чем при por-типировании (55 вариантов), однако сохранилось четкое разграничение между двумя сероварами.

57 (55 %) изолятов сформировали 15 различных сиквенс-типов, представленных двумя и более изолятами. Самые крупные из них были 206 (n = 6), 285 (n = 7), 1043 (n = 8) и 972 (n = 5). Остальные 46 сиквенс-типа были представлены одиночными изолятами, включая четыре бета-лактамазных гонококка. Стоит отметить, что наиболее распространенный в странах Евросоюза сиквенс-тип 225 [Palmer, 2008] обнаружен у единственного гонококка, изолированного в Иркутске. Расчитанный индекс разнобразия Симпсона составил 0,98, что свидетельствует в пользу высокой дискриминирующей способности метода.

Анализ генетической вариабельности 13-ти генов «домашнего хозяйства», проведенный для той же группы клинических изолятов N. gonorrhoeae (n = 103), выявил существенные отличия в уровне их изменчивости. Причем полученные характеристики генов оказались сопоставимы с результатами аналогичного исследования, проводимого в это же время на группе из 204 гонококков, выделенных в клиниках Балтимора [Prez-Losada, 2005].

Ориентируясь на максимально выявленное количество аллельных вариантов, обоснованным для дальнейшего использования в мультилокусном типировании гонококка выглядит набор 7 локусов: fumC, gdh, glnA, gnd, pilA, pyrD, serC. Этот перечень несколько отличается от применяемого для типирования N. meningitidis (abcZ, adk, aroE, fumC, gdh, pdhC, pgm) и предложенного как универсальный типирующий инструмент для всех нейссерий (N. meningitidis, N. lactamica и N. gonorrhoeae) в рамках общедоступного MLST сайта (www.pubmlst.org), функционирующего на базе Оксфордского университета с 2006 года [Bennett, 2007].

Осуществленное по стандартному международному протоколу MLST гонококка разделило анализируемую выборку на 30 секвенс-типов, индекс разнообразия Симпсона в этом случае составил 0,91. В случае типирования по максимально гетерогенным локусам: fumC, gdh, glnA, gnd, pilA, pyrD, serC, стало возможным разделить исследуемую выборку на 63 сиквенс-типа. Индекс разнообразия Симпсона при таком варианте MLST стал 0,98. В обоих случаях MLST позволило отойти от обязательного в формате por-типирования и NG-MAST разделения на серовары с выделением отличных от упомянутых методов групп изолятов.

Стоит отметить, что оба метода типирования – NG-MAST и MLST – так или иначе группируют изоляты гонококка согласно региону их выделения. Является ли это следствием клонального распространения гонококка в изолированных группах населения, или отражает миграционные процессы – вопросы будущих исследований.

Однако, большая часть изолятов имела уникальные сиквенс-типы, не связанные между собой. Более того, исследуемая выборка содержала 39/61 (64 %) новых сиквенстипов согласно NG-MAST схеме типирования и 24/30 (80 %) – согласно MLST.

Таблица 7. Сопоставление результатов кластеризации клинических изолятов гонококка с профилем устойчивости к пенициллину, тетрациклину, ципрофлоксацину. Чувствительный (S), устойчивый (R) фенотипы и фенотип с промежуточной чувствительностью (I) установлены согласно CLSI (www.clsi.org) критериям.

Сиквен-тип по MLST N (%) преобладающий фенотип чувствительности схеме типирования изолятов (доля изолятов с данным фенотипом, %) пенициллин тетрациклин ципрофлоксацин 1595 8 (7,8) *S/I S (87,5) S (100,0) 1892 8 (7,8) S (87,5) S (87,5) S (100,0) 1901 11 (10,7) I (100) R (90,1) R (100,0) 1905 11 (10,7) I (81,8) R (81,8) S (100,0) 6716 25 (24,3) I (84,0) R (65,0) R (100,0) 6720 5 (4,8) S/I S (100,0) S (100,0) * - равное соотношения изолятов Сопоставление данных молекулярного типирования гонококка с профилем устойчивости клинических изолятов позволило установить определенную закономерность в распространении резистентности для данной выборки. Изоляты, относящиеся к шести наиболее крупным кластерам, идентифицированным согласно международному протоколу MLST, имели сходный профиль устойчивости к пенициллину, тетрациклину, ципрофлоксацину внутри каждой группы (табл. 7).

Малый объем выборки не позволил сделать выводы о существовании в российской популяции гонококка крупных клональных комплексов с характерным фенотипом. Однако, опираясь на собственные данные, мы можем предполагать преимущественное распространение сиквенс-типов 6716 и 1901, для представителей которых характерны снижение чувствительности к пенициллину, устойчивость к тетрациклину и фторхинолонам.

Полученные результаты в полной мере отражают ситуацию, существующую в сфере молекулярного типирования гонококка. Поскольку обе схемы мультилокусного секвенирования – NG-MAST и MLST, были предложены почти одновременно, идет лавинообразное накопление информации о популяционной изменчивости гонококка в разных странах – Австралии [Martin, 2004], Швеции [Olsen, 2008], Китае [Yang, 2006].

Имеются даже сведения о NG-MAST типировании 76 образцов, изолированных на территории Архангельска [Unemo, 2007]. Закономерно, что среди исследованных изолятов также преобладали вновь идентифицированные сиквенс-типы – 37/(77 %). Из них три сиквенс-типа – 1534, 1544 и 1548 встретились среди проанализированной нами выборке и также относились к изолятам, выделенным в Архангельске.

В настоящий момент сложно сформулировать однозначное мнение о границах применимости использованных в настоящем исследовании методов типирования гонококка. Была продемонстрирована актуальность использования por-типирования и/или NG-MAST для отслеживания путей передачи инфекции между половыми партнерами [Bilek, 2007; Liao, 2009], имеются указания на клональность распространения лекарственной устойчивости в популяции гонококка Южной Африки и Шотландии [De Jongh, 2008; Palmer, 2008]. В тоже время мультилокусное секвенирование, имеющее дело с консервативными фрагментами генома и фиксирующее более «древние» и стабильные генетические изменения, в большей степени отвечает задачам популяционной геномики по изучению микроэволюции микроба [Martin, 2008].

Таким образом, полученные данные вносят важный вклад в создание наиболее информативной, стандартизированной системы молекулярного типирования N. gonorrhoeae. Примечательно, что в основе всех методов, адекватных задачам молекулярно-эпидемиологического мониторинга гонококка (por-типирование, NG-MAST, мультилокусное секвенирование) лежит выявление аллельных полиморфизмов нуклеотидной последовательности ДНК, что открывает возможность применения новых, более дешевых высокопроизводительных технологий сканирования бактериальных геномов.

В частности, уже продемонстрирована возможность использования направленной деградации нуклеиновых кислот с последующей МАЛДИ массспектрометрической детекцией для анализа нуклеотидной последовательности 7-ми локусов геномной ДНК N. meningitidis, необходимых для осуществления типирования возбудителя и установления его секвенс-типа [Honisch, 2007].

2.3. Сравнительная протеомика гонококка для выявления новых механизмов формирования лекарственной устойчивости.

В ходе молекулярно-генетического мониторинга гонококка были отобраны клинических изолята со сниженной чувствительностью к цефтриаксону (МПК= 0,06 – 0,12 мг/л) и один изолят с МПК пенициллина 0,25 мг/л и генотипом penAmut. Для этого генотипа не установлена достоверная ассоциация с фенотипической устойчивостью и, возможно, в этом случае бактериальные клетки реализуют некие неизвестные способы защиты от воздействия АМП. Оба рассматриваемых препарата относятся к лактамным антибиотикам, что позволяет предположить возможную общность механизмов устойчивости. В качестве контроля выбран клинический изолят, чувствительный ко всему спектру тестируемых АМП и не имеющий нуклеотидных перестроек в генах, вовлеченных в процессы формирования антибиотикорезистентности гонококка, и обладающий сходным с изолятами опытной группы Por-типом (табл. 8).

Таблица 8. Микробиологическая и генетическая характеристика штаммов, отобранных для протеомного исследования.

Маркерный Контроль Опыт параметр е03.04 i19.05 ch37.06 k51.пенициллин 0,015 0,25 2 цефтриаксон <0,005 <0,005 0,06 0,тетрациклин 0,03 0,25 2 ципрофлоксацин 0,001 0,002 16 спектиномицин 32,0 32,0 32 азитромицин 0,06 0,5 0,12 0,Por-тип P1B3 P1B3 P1B2 P1BblaTEM1 - - - - penA (ПСБ 2) wt Asp345a Asp345a Asp345a ponA (ПСБ 1) wt wt Leu421Pro Leu421Pro Gly120Lis; Gly120Lis;

penB (PorB1b) wt wt Ala121Asn Ala121Asp penC (PilQ) wt wt wt wt mtrR промотор; MtrR wt wt delA-35; wt delA-35; wt tetM - - - - rpsJ (RS10) wt wt Val57Met Val57Met Ser91Phe, Ser91Phe, gyrA (GyrA) wt wt Asp95Gly Asp95Gly parC (ParC) wt wt Ser87Arg Ser87Arg rrs (16S рРНК) wt wt wt wt Поскольку именно протеомные методы рассматриваются сейчас как один из основных инструментов изучения живых систем, в рамках данной работы был проведен сравнительный анализ растворимой фракции клеточных белков изолятов e03.04 и i19.05, что позволило обнаружить белок порин на 2D карте изолята i19.05 (рис. 7, табл. 9).

Порин (PorB1 белок) является компонентом внешней мембраны клетки, который формирует каналы для пассивной диффузии небольших молекул, включая антибиоМПК (мг/л) Генетические маркеры лекарственой устойчивости тики, в периплазматическое пространство. Поскольку визуализация мембранных белков требует специальных условий экстракции и проведения 2D электрофореза, которые не были выполнены в данном эксперименте, факт обнаружения значительных количеств порина на протеомной карте изолята i19.05 потребовал адекватных объяснений.

Порин (PorB1) Рисунок 7. Электрофореграммы растворимой фракции клеточных белков изолятов N.

gonorrhoeae e03.04 (А) и i19.05 (В) после культивирования на шоколадном GC агаре в стандартных условиях. Окраска серебром.

Таблица 9. Фрагмент сравнительной характеристики белкового профиля изолята i19.05 относительно e03.04. Серым выделены дифференциальные белки, идентифицированные как порин.

Количественное соотношеNCBI ID Наименование белка ние белка (i19.05/e03.04) 2827064 PorB precursor (предшественник белка внешней мембраны 1) 30369,59801382 -фактор РНК-полимеразы 1662,54043055 PorB (белок внешней мембраны 1, порин) 1411,59801813 НАДФН-зависимая-флавинмононуклеотидредуктаза 515,59801766 белок теплового шока 257,59802457 3-кетоацилредуктаза 160,59800521 АТФаза 115,54043055 PorB (белок внешней мембраны 1, порин) 93,59802114 фактор реассоциации рибосомы (RRF - ribosome recycling factor) 81,59801106 изопролилмалатизомераза 76,54043055 PorB (белок внешней мембраны 1, порин) 41,59800747 фенилаланин-тРНК-синтетаза 17,59801418 белок-шаперон СlpB 5,59800797 урацилфосфорибозилтрансфераза 5,7225623 пролиндегидрогеназа 5,Мы предположили, что это явление может быть вызвано нарушением процесса интеграции PorB1 во внешнюю мембрану, в результате чего белок накапливается в цитоплазме, или периплазматическом пространстве. В таком случае уменьшение доли порина в составе наружной мембраны приводит к снижению проницаемости клеточной стенки для АМП и формированию устойчивости к пенициллину в синергизме с мутацией в гене penA.

Поскольку через порины в микробную клетку поступает также тетрациклин, в пользу выдвинутой нами гипотезы свидетельствовал факт повышения МПК тетрациклина у изолята i19.05 (0,25 мг/л) при отсутствии известных хромосомных мутаций. Экспериментально измеренное накопление пенициллина и тетрациклина клетками изолята i19.05 было в три раза меньше по сравнению с изолятом е03.04 и лабораторным штаммом АТСС 49226.

Анализ транскриптов подтвердил 10-ти кратное превышение уровня экспрессии мРНК порина в изоляте i19.05 по сравнению с е03.04. Однако, для изолята i19.не было зафиксировано отличий в нуклеотидной последовательности промоторной области гена porB, способных объяснить различия в экспрессии. Кроме того, отсутствие мутаций в области сигнального пептида PorB, включающего первые 20 а.о. полипептидной цепи, показало, что со стороны порина нет препятствий к его встраиванию во внешнюю мембрану.

Процессы биогенеза белков внешней мембраны рассмотрены нами на примере N. meningitidis (рис. 8). Анализ транскриптов всех генов, потенциально вовлеченных в биогенез порина, продемонстрировал для большинства из них гиперэкспрессию в изоляте i19.05 по сравнению с е03.04, однако гены secA и surA экспрессировались одинаково (табл. 10).

Рисунок 8. Модель биогенеза белков наружной мембраны. Инициирующую роль в этом процессе играет белок SecA, связывающийся при участии SecB с сигнальным пептидом белка-предшественника (prePorB1, prePilQ и т.п.). Образуемый совместно с белками Sec D, E, F, G, Y Secтранслокон проталкивает белок наружной мембраны сквозь внутреннюю мембрану клетки. В ходе транслокации сигнальный пептид отщепляется сериновой протеазой, и по выходу из Secканала белок передается двумя шаперонами Skp и SurA на периплазматический фрагмент мембранного белка Omp85, завершающего процесс интеграции.

В ходе анализа нуклеотидных последовательностей были обнаружены отличия в кодирующих областях генов surA и omp85 изолятов i19.05 и е03.04 (табл. 10). Данный факт позволяет предположить функциональную недостаточность соответствующих белков, обеспечивающих терминальные стадии интеграции порина в структуру внешней мембраны. В этом случае невстроенные в мембрану молекулы порина накапливаются в периплазме, что позволяет обнаружить их во фракции растворимых белков при протеомном анализе.

Описанный нами механизм устойчивости гонококка не является специфическим в отношении пенициллина, а затрагивает широкий спектр АПМ, что объясняет факт повышения МПК тетрациклина и азитромицина для изолята i19.05. Интересно, что указанные нарушения проницаемости внешней мембраны никак не сказываются на чувствительности данного изолята к цефтриаксону, что дает основание предположить существование альтернативных путей проникновения этого антибиотика в бактериальную клетку.

Таблица 10. Генетический анализ элементов метаболического пути, ответственного за транслокацию белков внешней мембраны гонококка, для изолятов i19.05 и е03.04. Серым выделены гены, экспрессия которых не отличается в тестируемых изолятах.

Белок Соотношение концентрации Ген (п.н.) Мутации, отличные для изолята кДНК изолятов i19.05 и е03.04 i19.05 по сравнению с e03.SecA 1 secA (2751) нет SecB 11,2 secB (444) нет SecD 31,1 secD (1857) нет SecE 4,6 secE (279) нет SecF 58,1 secF (936) нет SecG 54,2 secG (351) нет SecY 17,5 secY (1311) нет Сериновая протеаза 17,5 NGO0138 (1500) нет SurA 1 surA (1002) Asn105Ser, Lys206Glu, Ala230Thr Omp85 16 omp85 (2379) Leu568Trp Феномен устойчивости к цефалоспоринам исследован на основании регистрации изменений белковых фракций изолятов е03.04, ch37.06 и k51.05, возникающих при добавлении в среду низких концентраций цефтриаксона. В данном случае применение дифференциального протеомного анализа было продиктовано существенными отличиями в генетическом профиле между опытной группой изолятов со сниженной восприимчивостью к цефтриаксону – ch37.06, k51.05, и контролем – е03.04.

Хотя основное внимание в формировании устойчивости к цефалоспоринам уделяется мозаичности ПСБ 2 [Takahata, 2006; Lindberg, 2007; Ochiai, 2008], по результатам полноразмерного секвенирования гена penA изолятов ch37.06, k51.05, е03.04 и штамма АТСС 49226 (два последних образца служили контролем), мы не обнаружили мутаций, объясняющих снижение чувствительности к цефтриаксону изолятов ch37.06 и k51.05.

Исследование изменений, происходящих в клетках N. gonorrhoeae под действием цефтриаксона, с помощью 2D электрофореза с дифференциальным окрашиванием белковых фракций флуоресцентными красителями Cy3-DIGE и Cy5-DIGE (табл. 11) позволило сделать заключение о схожести наблюдаемого метаболического ответа.

Среди зарегистрированных изменений обращают на себя внимание выраженное увеличение экспрессии АВС-транспортеров и цистеинсинтазы на фоне резкого снижения экспрессии ферментов, обеспечивающих включение глутамата в основные метаболические пути клетки: глутаматдегидрогеназы, -кетоглутаратдекарбоксилазы, глутаминсинтетазы, карбомоилфосфатсинтетазы, что также согласуется со снижением уровня ферментов цикла трикарбоновых кислот. В целом, под влиянием цефтриаксона наблюдается общее угнетение основных метаболических путей бактериальной клетки, что особо подчеркивает значимость белков, продукция которых возрастает.

На основании наблюдаемой картины выдвинута гипотеза, что молекулярные события, разворачивающиеся в клетке в процессе нарушения целостности пептидогликана под действием -лактамных антибиотиков, напоминают ситуацию, возникающую при гиперосмотическом стрессе [Сsonka, 1989]. Ионам глутамата, наряду с ионами калия, отводится ведущая роль в осморегуляции бактерий. С учетом того, что значительная часть обнаруженных нами дифференциальных изменений затрагивает метаболизм глутамата, следует рассмотреть возможные пути утилизации этой аминокислоты гонококком (рис. 9).

Таблица 11. Фрагмент сравнительной характеристики изменений белкового профиля изолятов е03.04, ch37.06 и k51.05, происходящих под действием цефтриаксона. Маркерные для построения рабочей гипотезы белки выделены цветом: серый – снижение продукции белка в изолятах под действием антибиотика, черный – усиление.

Соотношение интенсивности свечения опыт/контроль для Биохимический процесс в Название белка NCBI изолятов прокариотической клетке e03.04 ch37.06 k51.глутаматдегидрогеназа, 59801706 0,1 0,32 0,2 Метаболизм глутамата КФ: 1.4.1.3.

глутаминсинтетаза, Метаболизм глутамата, синтез 59801928 0,13 0,КФ: 6.3.1.2 клеточной стенки Рефолдинг белков с ошибочной шаперонин GroEL 59802396 0,15 0,35 0,конформацией при стрессе изоцитратдегидрогеназа 59801449 0,22 0,37 Цикл трикарбоновых кислот -кетоглутаратдекарбо- Метаболизм глутамата, цикл 59801313 0,3 0,22 0,ксилаза, КФ: 1.2.4.2. трикарбоновых кислот ДНК-зависимая-РНК59802172 0,38 0,34 РНК полимераза полимераза Фактор элонгации G 59802164 0,39 0,33 0,44 Трансляция и биогенез сукцинатдегидрогеназа 59801317 0,39 0,79 Цикл трикарбоновых кислот полинуклеотидфосфорила59800780 0,4 0,46 Деградация мРНК прокариот за/полиаденилаза фосфоенолпируватсинтаза 59800653 0,41 0,45 0,2 Метаболизм пирувата белок семейства перокси59801322 0,41 2,73 Антиоксидантная защита редоксинов/глутаредоксин инозитол-559801213 0,45 0,46 0,41 Метаболизм пуринов монофосфатдегидрогеназа 2-метилизоцитратдегид59801590 0,47 0,39 0,17 Цикл трикарбоновых кислот ратаза карбомоилфосфатсинтета59800515 0,48 0,47 Метаболизм глутамата за, КФ: 6.3.5.рибосомальный белок 59802173 0,48 0,29 Трансляция и биогенез L7/Lфосфопируватгидратаза 59801045 0,48 0,4 Гликолиз/Глюконеогенез сукцинил–КоА-синтетаза 59801308 0,23 Цикл трикарбоновых кислот Дигидролипоамидацетил59801312 0,27 0,18 Цикл трикарбоновых кислот трансфераза форматтетрагидрофолат- Метаболизм дикарбоновых 59800526 0,28 0,лигаза кислот Периплазматический АВС-транспортер 59800816 2,69 3,31 2,28 транспорт широкого диапазона веществ цистеинсинтаза, Метаболизм цистеина, 59800785 3,5 2,КФ: 2.5.1.47 синтез эндогенного глутатиона ГМФ синтетаза/глутаминамидотрансфараза, 59802458 2,02 Метаболизм глутамата КФ: 6.3.5.пептидилпролилизомераза 59801584 3,68 1,96 Биогенез белковых молекул При осмострессе глутамат, в избытке присутствующий в питательной среде, аккумулируется бактериальной клеткой [Csonka, 1989; Wood, 2007]. Вероятно, в этом процессе задействованы АВС транспортеры, активация которых видна у всех исследованных изолятах. Кроме того, анализ существующих метаболических путей глутамата и цистеина позволил выдвинуть гипотезу о вовлечении этих аминокислот в синтез глутатиона, и об участии последнего в процесс формирования толерантности N.

gonorrhoeae к цефтриаксону.

Рисунок 9. Возможные пути метаболизм глутамата в клетках N. gonorrhoeae. Функциональные белки (ферменты) обозначены розовыми кружками, нефункциональные белки и аминокислоты - зелеными. Белки, чья концентрация снижается на фоне индукции цефтриаксоном, обведены зеленым цветом, повышается – красным. Исследованные гены ферментов указаны в прямоугольниках.

Глутатион (L--глутамил-L-цистеинилглицин), синтезируется микробными клетками в ходе последовательных реакций, катализируемых глутамилцистеинсинтазой (-GCS, КФ: 6.3.2.2) и глутатионсинтетазой (GS, КФ:

6.3.2.3). Сегодня место эндогенного глутатиона в жизнедеятельности бактерий является предметом активного изучения. Основная роль глутатиона логично отводится редокс-регуляции и адаптации бактерий к оксидативному стрессу [Masip, 2006]. Однако, показано его участие в адаптации микробов к солевому шоку путем негативной регуляции калиевых каналов, а также в модулировании чувствительности бактерий к антибиотикам. Причем влияние глутатиона не однозначно. Так, для Е. coli продемонстрировано снижение чувствительности к фторхинолонам [Goswami, 2006] и стрептомицину [Goswami, 2007] в присутствии восстановленного глутатиона, и одновременное возрастание чувствительности к -лактамам [Goswami, 2007]. Роль эндогенного глутатиона в метаболизме гонококка, его участие в ответе микроба на воздействие АМП исследованы плохо. Имеется указание на влияние восстановленного глутатиона на рост гонококка [Gould, 1944], есть данные об использовании его в системах защиты N. gonorrhoeae от оксидативного стресса [Seib, 2006].

Нами была выдвинута гипотеза о снижении чувствительности N. gonorrhoeae к цефалоспоринам за счет активации синтеза эндогенного глутатиона. Частично эта гипотеза была подтверждена снижением чувствительности к цефтриаксону и цефиксиму изолятов ch37.06 и k51.05, выращенных на среде с добавлением 10 мМ восстановленного глутатиона, тогда как для изолята е03.04 и лабораторного штамма АТСС 49226 данный эффект отсутствовал.

Анализ нуклеотидной последовательности генов ферментов, участвующих в синтезе глутатиона, позволил обнаружить мутацию, приводящую к аминокислотной замене Glu221Lys в глутатионсинтетазе изолятов ch37.06 и k51.05, в отличие от е03.04 изолята. Интересно, что чувствительный ко всем антибиотикам штамм FA10имеет последовательность, идентичную е03.04, тогда как в недавно аннотированном геноме мультирезистентного изолята NCCP11945 [Chung, 2008] ген глутатионсинтетазы также содержит замену Glu221Lys.

Поскольку среди исследованной коллекции не было выявлено устойчивых к спектиномицину клинических изолятов N. gonorrhoeae, путем селекции на возрастающих концентрациях антибиотика штамма АТСС 49226 и изолята е03.04, относящихся к разным сероварам N. gonorrhoeae, были получены штаммы 49226mut и 03mut, обладающие выраженной устойчивостью к данному АМП (МПК > 256 мг/л).

Для визуализации изменений, возникающих в клетках N. gonorrhoeae под действием спектиномицина построены дифференциальные протеомные карты лабораторных штаммов 49226mut и 03mut в сравнении с исходными АТСС 49226 и е03.(рис. 10).

При детальном рассмотрении дифференциальных белков в обоих случаях обращает на себя внимание факт появления в мутантных штаммах большого количества модифицированных по сравнению с нативной формой белков, вовлеченных в различные, часто ничем не связанные, метаболические процессы. Этот эффект более ярко проявляется в штамме 49226mut и менее выражен для штамма 03mut.

Несмотря на давнюю историю использования спектиномицина в терапии гонококковой инфекции, точный механизм его действия остается малоизученным. Показано, что антибиотик связывается с участком 30S-субъединицы в районе 1060-11н.о. 16S рРНК (согласно нуклеотидной последовательности рРНК E.coli). Соответствующий район 16S рРНК контактирует с белками S5, S4 и S8 [Wirmer, 2006].

Секвенирование генов rrs, rpsD, rpsE, rpsH, кодирующих структуру 16S рРНК и рибосомальных белков S4, S5, S8, соответственно, установило наличие нуклеотидной мутации в кодирующей области белка S5, приводящей к аминокислотной замене Thr24Pro у штаммов 49226mut и е03.04mut (рис. 11). Мутаций в генах остальных рибосомальных белков обнаружено не было.

А. 49226mut/АТСС 49226 B. 03mut/e03.C. 49226mut/АТСС 49226 D. 03mut/e03.Рисунок 10. Дифференциальное протеомное картирование гонококка. Белки «родительских» штаммов окрашены Cy3 (зеленое свечение); белки модифицированных штаммов с приобретенной устойчивостью к спектиномицину, окрашены Cy5 (красное свечение).

А. Сопоставление белковых профилей штаммов 49226mut и АССТ 49226.

В. Сопоставление белковых профилей штамма 03mut и изолята е03.04.

С. и D. Увеличенное изображение изменений белкового профиля штаммов 49226mut и 03mut, возникших в процессе адаптации к спектиномицину.

1 Rps5_ATCC49226 MAKHEIEERG DGLIEKMVAV NRVTKVVKGG RIMAFSALTV VGDGDGRIGM Rps5_e03.04 MAKHEIEERG DGLIEKMVAV NRVTKVVKGG RIMAFSALTV VGDGDGRIGM Rps5_49226mut MAKHEIEERG DGLIEKMVAV NRVPKVVKGG RIMAFSALTV VGDGDGRIGM Rps5_03mut MAKHEIEERG DGLIEKMVAV NRVPKVVKGG RIMAFSALTV VGDGDGRIGM Rps5_FA1090 MAKHEIEERG DGLIEKMVAV NRVTKVVKGG RIMAFSALTV VGDGDGRIGM Rps5_E.coli_K12 MA-H-IEKQA GELQEKLIAV NRVSKTVKGG RIFSFTALTV VGDGNGRVGF Рисунок 11. Сравнительный анализ аминокислотной последовательности N-концевого домена рибосомального белка S5 гонококка и E. coli. Черным обозначена область обнаруженной в штаммах 49226mut и 03mut мутации Thr24Pro. Подчеркнуты аминокислотные позиции, замены в которых приводят к формированию устойчивости к спектиномицину у Е. coli [Kirthi, 2006].

Факт обнаружения перестроек именно в рибосомальном белке S5 позволил логично объяснить феномен «сдвига» белковых пятен, наблюдаемый на дифференциальных 2D картах. Нарушение клеточного роста, изменение процесса сворачивание 16S рРНК, снижение точности трансляции полипептидной цепи – все эти явления описаны для штаммов E. coli, имеющих мутации в белке S5, обуславливающие устойчивость к спектиномицину [Kirthi, 2006]. Пул «неправильных» белковых молекул, образующихся в результате сдвига рамки считывания или преждевременной терминации трансляции, в мутантных штаммах E. coli был достоверно выше. Подобные процессы, происходящие в мутантных штаммах гонококка, в свою очередь могут приводить к снижению жизнеспособности клеток, что отчасти объясняет низкий процент устойчивых к спектиномицину изолятов N. gonorrhoeae в природной популяции.

Секвенирование генов rrs, подтвержденное процедурой минисеквенирования с последующей МАЛДИ ВМС, зафиксировало наличие в исходном штамме ATCC 49226 мутаций Т459С и G1215A во всех четырех копиях этого гена. Интересно, что в штамме 49226mut эти мутации отсутствовали, равно как в штаммах 03mut и e03.04.

Этот факт объясняет наблюдаемые в эксперименте более глубокие отличия в белковых профилях штаммов 49226mut и АССТ 49226 по сравнению с парой 03mut и e03.04. Вероятно, гонококки, несущие мутации как в 16S pРНК, так и в рибосомальных белках, оказались нежизнеспособными и были элиминированы в ходе селекции.

Таким образом, совокупность выявленных молекулярных изменений позволяет предположить существование у N. gonorhoeae не описанного ранее механизма формирования устойчивости к спектиномицину за счет изолированной мутации в Nконцевом домене рибосомального белка S5. В пользу этого предположения свидетельтвует факт обнаружения идентичной аминокислотной замены в обоих мутантных штаммах, отличающихся по своему антигенному составу гонококках и полученных в независимых экспериментах, а также локализация обнаруженной мутации в области связывания антибиотика с рибосомой. И хотя феномен формирования устойчивости к спектиномицину исключительно путем модификации рибосомальных белков до настоящего времени не описан, для родственного антибиотика – стрептомицина – такой путь известен давно, в частности, около 60 % изолятов M. tuberculosis реализуют устойчивость к стрептомицину исключительно за счет мутаций в рибосомальном белке S12 и только 10 % из них имеют мутации в 16S pРНК [Spies, 2008].

ЗАКЛЮЧЕНИЕ Сходство молекулярной организации микроорганизмов и универсальность современных методов анализа биомолекул позволили выстроить строгую логичную систему геномно-протеомного типирования патогенов, направленную на решение практических задач, связанных с реализацией средств молекулярного мониторинга клинически-значимых возбудителей бактериальной и вирусной природы, с одной стороны, и способствующую получению новых знаний в области молекулярной микробиологии, в частности в сфере расшифровки неизвестных механизмов лекарственной устойчивости бактерий, с другой.

Унификация приборной базы, развитие коммуникационных технологий предопределяет наступление новой эры в клинической микробиологии – эры сочетания рутинных и исследовательских процедур на базе одной технологической платформы, что и было продемонстрировано в ходе данной работы. Дистанция между фенотипическим описанием устойчивости бактерий и нашими знаниями о молекулярных механизмах, предопределяющим эту резистентность, стремительно сокращается, что позволяет прогнозировать наступление эры «быстрой микробиологии», практически не нуждающейся в культивировании микроорганизмов.

В тоже время, высокопроизводительные системы скрининга известных генетических маркеров резистентности на большой выборке клинических изолятов позволили нам отобрать клинические изоляты, устойчивый фенотип которых невозможно было объяснить на основании регистрируемых изменений в геномной ДНК. Надо отметить, что количество таких изолятов невелико, что указывает на принципиальную возможность разработки и внедрения измерительных систем нового поколения. С другой стороны, выявление клинических изолятов, реализующих не изученные механизмы устойчивости, позволяет расшифровывать их и возвращать эти новые знания в виде тестов в практику, не отставая от изучаемых объектов по скорости ответа на применение новых АМП. Такая идеология постепенно должна заменить традиционное мышление и стать главенствующей, поскольку основой современной жизни является способность быстро отвечать на разнообразные вызовы, возникающие в разных областях, в том числе и медицине.

Фундаментальные аспекты нашей работы были сфокусированы в области расшифровки новых молекулярных механизмов формирования резистентности. Изложенный алгоритм построения исследования – отбор изолятов на основании широкомасштабного микробиологического и молекулярно-генетического мониторинга гонококка, привлечение методов протеомного картирования в сочетании с генетическим анализом и системным подходом к функционированию бактериальной клетки, показал свою эффективность в изучении биохимических процессов, снижающих восприимчивость N. gonorrhoeae к пенициллину, цефтриаксону, спектиномицину.

Описанные новые механизмы устойчивости гонококка вносят существенный вклад в общее понимание феномена резистентности и расширяют наши представляния о биохимических основах функционирования микробной клетки.

ВЫВОДЫ 1. Оптимизирован и внедрен в практику протокол прямого МАЛДИ массспектрометрического профилирования бактерий для видовой идентификации грамположительных (S. pneumoniae) и грамотрицательных (N. gonorrhoeae, N. meningitidis) микроорганизмов.

2. В ходе клинической апробации разработанных ДНК-микроматриц продемонстрорована возможность выявления анаэробной флоры при обследовании пациентов с дисбиотическими явлениями урогенитального тракта – бактериальный вагиноз женщин, неспецифический баланопостит мужчин, что особенно важно в оценке эффективности специфической терапии.

3. На основе МAЛДИ масс-спектрометрии фрагментов нуклеиновых кислот, сопряженной с последовательными реакциями амплификации и минисеквенирования, разработаны высокопроизводительные системы обнаружения однонуклеотидных полиморфизмов в геномах бактерий и вирусов, пригодные для оценки лекарственной устойчивости S. pneumoniae, M. tuberculosis, N. gonorrhoeae и генотипирования вирусов гепатита В и С, как в культуре микроорганизмов, так и непосредственно в клиническом материале.

4. Молекулярный мониторинг больших и географически неоднородных выборок изолятов S. pneumoniae, M. tuberculosis, N. gonorrhoeae позволил объяснить наблюдаемый устойчивый фенотип микробов на основании обнаруживаемых перестроек в геномной ДНК. В зависимости от возбудителя и рассматриваемой группы АМП прогностическая значимость регистрируемых маркеров генетическидетерминированной лекарственной устойчивости составила от 82 % до 96 %.

5. Осуществленное генотипирование вирусов гепатита В и С доказывает универсальность разработанного способа регистрации однонуклеотидных полиморфизмов, базирующегося на масс-спектрометрическом анализе ДНК, и открывает перспективы широкомасштабным эпидемиологическим исследованиям в этой области.

6. Расшифрован механизм формирования устойчивости N. gonorrhoeae к спектиномицину за счет изолированной мутации в рибосомальном белке S5; объяснен феномен снижения чувствительности гонококка к пенициллину, обусловленный недостаточностью пориновых каналов, вызванной нарушением интеграции белков внешней мембраны; показано, что невосприимчивость гонококка к сублетальным концентрациям цефтриаксона обеспечивают механизмы, ответственные за выживание бактериальной клетки в условиях осмотического стресса.

Список работ, опубликованных по теме диссертации.

1. Афанасьев М.В., Боровская А.Д., Ильина Е.Н., Смирнова Т.Г., Ларионова Е.Е., Кузьмин А.В., Андреевская С.Н., Черноусова Л.Н., Говорун В.М. Выявление мутаций в 306 кодоне embB гена для молекулярно-генетической характеристики клинических штаммов Mycobacterium tuberculosis. // Пробл. Тубер. Болезн. Легких. - 2009. - № 5. - C. 48 - 52.

2. Малахова М.В., Ильина Е.Н., Говорун В.М., Шутько С.А., Дудина К.Р., Знойко О.О., Климова Е.А., Ющук Н.Д. Масс-спектрометрическое генотипирование вируса гепатита В. // Бюлл.

Экспер. Биол. мед. – 2009. – Т. 147. – № 2. – С. 181 - 187.

3. Ильина Е.Н., Говорун В.М. Масс-спектрометрия нуклеиновых кислот в молекулярной медицине. // Биоорганическая химия. – 2009. – Т. 35. – №. 2. – C. 149 - 164.

4. Владимиров Г.Н., Кононихин А.С., Ильина Е.Н., Говорун В.М., Николаев Е.Н. Точное измерение масс продуктов полимеразно-цепной реакции как метод генотипирования. // Труды МФТИ. – 2009. – Т. 1. - № 1. – C. 36 – 40.

5. Ilina EN, Borovskaya AD, Malakhova MM, Vereshchagin VA, Kubanova AA, Kruglov AN, Svistunova TS, Gazarian AO, Maier T, Kostrzewa M, Govorun VM. Direct bacterial profiling by matrixassisted laser desorption-ionization time-of-flight mass spectrometry for identification of pathogenic Neisseria. // J Mol Diagn. – 2009. – V. 11 – No 1. – P. 75 - 86.

6. Ilina E., Shitikov E., Borovskaya A., Maier T., Kostrzewa M., Govorun V. Comparative application of modern molecular methods for Neisseria gonorrhoeae typing. // P135 in Abst. book of 16th International Pathogenic Neisseria Conference. – 2008. – Rotterdam – P. 203.

7. Ilina E., Borovskaya S., Sidorenko S., Kubanova A., Maier T., Kostrzewa M., Govorun V. A mass spectrometry based approach for Neisseria gonorrhoeae species identification. // Abst. 18th European Congress of Clinical Microbiology and Infectious Diseases and 26th International Congress of Chemotherapy. – 2008. – Barselona.– O. 178.

8. Afanas`ev MV, Ilina EN, Smirnova TG, Larionova EE, Kuz’min AV, Andreevskaya SN, Chernousova LN, Govorun VM. MIRU-VNTR genotyping of Mycobacterium tuberculosis strains from Central region of Russia. // Abst. 18th European Congress of Clinical Microbiology and Infectious Diseases and 26th International Congress of Chemotherapy. – 2008. – Barselona. – P. 1559.

9. Ikryannikova LN, Shitikov EA, Zhivankova DG, Il'ina EN, Edelstein MV, Govorun VM. A MALDI TOF MS-based minisequencing method for rapid detection of TEM-type extended-spectrum betalactamases in clinical strains of Enterobacteriaceae. // J Microb Meth. – 2008. – V. 75 – No 3. – P.

385-91.

10. Ilina E.N., Vereshchagin V.A., Borovskaya A.D., Malakhova M.V., Sidorenko S.V., Al-Khafaji N.C., Kubanova A.A., Govorun V.M. Relation between Genetic Markers of Drug Resistance and Susceptibility Profile of Clinical Neisseria gonorrhoeae Strains. // Antimicrob Agents Chemother. – 2008. – V. 52. – No. 6 – P. 2175-2182.

11. Reinert RR, Filimonova OY, Al-Lahham A, Grudinina SA, Ilina EN, Weigel LM, Sidorenko SV.

Mechanisms of macrolide resistance among Streptococcus pneumoniae isolates from Russia. // Antimicrob Agents Chemother. – 2008. – V. 52. – No. 6 – P. 2260 - 2262.

12. Малахова М.В., Верещагин В.А., Ильина Е.Н., Говорун В.М., Филимонова О.Ю., Грудинина С.А., Сидоренко С.В. Применение метода MALDI-TоF масс-спектрометрии для анализа генетически детерминированной устойчивости S.pneumoniae к фторхинолонам. //Антибиот. Химиотер. – 2007.- Т. 52. – № 1 - 2. – С. 10 – 17.

13. Мудрак Д.Е., Икрянникова Л.Н., Сидоренко С.В., Ильина Е.Н. Изучение распространенности и молекулярных механизмов антибактериальной резистентности у грамотрицательных возбудителей нозокомиальных инфекций в стационарах Москвы и Перми. // Антибиот. Химиотер. - 2007.- Т. 52. – № 7 - 8. – С. 10-16.

14. Afanas'ev MV, Ikryannikova LN, Il'ina EN, Sidorenko SV, Kuz'min AV, Larionova EE, Smirnova TG, Chernousova LN, Kamaev EY, Skorniakov SN, Kinsht VN, Cherednichenko AG, Govorun VM.

Molecular characteristics of rifampicin- and isoniazid-resistant Mycobacterium tuberculosis isolates from the Russian Federation. // J Antimicrob Chemother. – 2007. – V. 59. – No. 6. – P. 1057 - 1064.

15. Vereshchagin V., Ilina E., Atroshkina M., Serebryakova M., Maier T., Kostrzewa M., Govorun V. A new mass-spectrometric approach to antibacterial susceptibility testing. // Abst. 17th European Congress of Clinical Microbiology and Infectious Diseases and 25th International Congress of Chemotherapy. – 2007. – Munich – P. 1648.

16. Ikryannikova LN, Afanas'ev MV, Akopian TA, Il'ina EN, Kuz'min AV, Larionova EE, Smirnova TG, Chernousova LN, Govorun VM. Mass-spectrometry based minisequencing method for the rapid detection of drug resistance in Mycobacterium tuberculosis. // J Microb Meth. – 2007. – V. 70. – No.

3. – P. 395 - 405.

17. Ильина Е.Н., М.В. Малахова, В.А. Верещагин, В.М. Говорун, Т.В. Припутневич, А.А. Кубанова. Прямая оценка параметров лекарственной устойчивости гонококка. // Бюлл. Экспер.

Биол. Мед. – 2007. – Т. 144, - № 8. – C. 194 - 197.

18. Афанасьев М.В., Икрянникова Л.Н., Ильина Е.Н., Смирнова Т.Г., Ларионова Е.Е., Кузьмин А.В., Черноусова Л.Н., Камаев Е.Ю., Скорняков С.Н., Киншт В.Н., Чередниченко А.Г., Говорун В.М. Применение реакции мини-секвенирования с последующим MALDI-TOF массспектрометрическим анализом для оценки устойчивости к рифампицину и изониазиду штаммов Mycobacterium tuberculosis // Пробл. Тубер. Болезн. Легких. - 2007. - № 7. - C. 37 - 42.

19. Плахова К.И., Гомберг М.А., Атрошкина M.E., Ильина Е.Н., Говорун В.М. Идентификация микробного состава выделений из влагалища методами генодиагностики. // Вест. Дермат. Венерол. – 2007. – № 6. – C. 9 - 13.

20. Плахова К.И., Гомберг М.А., Атрошкина М.Е., Ильина Е.Н., Говорун В.М. Роль Atopobium vaginae при рецидивировании бактериального вагиноза // Вест. Дермат. Венерол. - 2007. – № 5. – C. 10 - 13.

21. Боровская А.Д., Малахова М.В., Верещагин В.А., Ильина Е.Н., Говорун В.М., Припутневич Т.В., Аль-Хафаджи Н., Кубанова А.А. Анализ вклада молекулярных механизмов в формирование устойчивости гонококка к тетрациклину. // Бюлл. Экспер. Биол. Мед. – 2007. – Т. 144. – № 3. – С. 432 - 437.

22. Малахова М.В., Верещагин В.А., Ильина Е.Н., Говорун В.М., Зубков М.М., Припутневич Т.В., Кисина В.И., Кубанова А.А. Анализ генетических маркеров резистентности N. gonorrhoeae к -лактамным антибиотикам. // Бюлл. Экспер. Биол. Мед. – 2006. – Т. 141. – № 5. – С. 549 - 554.

23. Кубанова А.А., Говорун В.М., Ильина Е.Н., Верещагин В.А., Фриго Н.В., Припутневич Т.А.

Первый опыт применения метода прямого белкового профилирования для идентификации и типирования N.gonorrhoeae. // Вест. Дермат. Венерол. – 2006. – № 5. – C. 25 - 29.

24. Ильина Е.Н., Малахова М.В., Генерозов Э.В., Говорун В.М., Арчаков А.И., Покровский В.И.

Масс-спектрометрический анализ для типирования вируса гепатита C. // Биомед. химия. – 2005. – Т. 51. – № 1. – С. 41 - 47.

25. Момыналиев К.Т., Cелезнева О.В., Козлова А.А., Верещагин В.А., Ильина Е.Н., Говорун В.М.. А2144G – основная мутация в гене 23S rRNA Helicobacter pylori, ассоциированная с устойчивостью к кларитромицину // Генетика. – 2005. – Т.41. – №10. – С. 1338 - 1344.

26. Ильина Е.Н., Малахова М.В., Степанова Ю.Н., Кубанова A.A., Говорун В.М. Идентификация бактериальной флоры c применением технологии днк-макрополей. // Мол. Медицина. – 2005.

– № 2. – C. 41 - 45.

27. Ilina EN, Malakhova MV, Generozov EV, Nikolaev EN, Govorun VM. Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry for Hepatitis C Virus Genotyping. // J Clin.

Microbiol. – 2005. – Vol. 43. – No. 6. – P. 2810 – 2815.

28. Верещагин В.А., Ильина Е.Н., Зубков М.М., Припутневич Т.В., Кубанова А.А., Говорун В.М.

Использование MALDI-TOF масс-спектрометрии для выявления в генах gyrA и parC Neisseria gonorrhoeae однонуклеотидных замен, определяющих формирование устойчивости к фторхинолонам // Мол. Биол. – 2005. – Т. 39. - № 6. – С. 923 - 932.

29. Верещагин В.А., Ильина Е.Н., Малахова М.В., Зубков М.М., Сидоренко С.В., Кубанова А.А., Говорун В.М. Устойчивость к фторхинолонам среди Российских изолятов Neisseria gonorrhoeae // Мол. Ген. Микробиол. Вир. – 2005 – № 1. – С. 23 - 27.

30. Vereshchagin V.A., Ilina E.N., Malakhova M.V., Zubkov M.M., Sidorenko S.V., Kubanova A.A., Govorun V.M. Fluoroquinolone-resistant Neisseria gonorrhoeae isolates from Russia: molecular mechanisms implicated // J. Antimicrob. Chem. – 2004. – Vol. 53. – P. 653 – 656.

31. А.А. Кубанова, М.М. Васильев, В.М. Говорун, О.А. Терман, Е.Н. Ильина, Т.В. Припутневич.

Современные подходы к типированию штаммов N.gonorrhoeae. // Вест. Дермат. Венерол. – 2004. – № 1. – C. 4 - 8.

32. Ильина Е.Н. Особенности генодиагностики трансфузионных вирусных гепатитов. // Гепатология, приложение к журналу Экспер. Клин. Гастроэнтер. – 2003. – № 1. – C. 28 – 36.

33. Ильина Е.Н., Малахова М.В., Верещагин В.А., Говорун В.М., Сергиенко В.И., Зубков М.М., Васильев М.М., Кубанова А.А. Молекулярное типирование штаммов N. gonorrhoeae, распространенных на территории РФ // Бюлл. экспер. биол. мед. – 2003. – Т. 136. – № 8. – С. 205-208.

34. Ильина Е.Н., Говорун В.М., Иваников И.О. Некоторые аспекты лабораторной диагностики вирусных гепатитов В и С. Обзор. // Тер. архив. – 2003. – T. 75. – № 4. – C. 84 - 86.

35. Ильина Е.Н., Говорун В.М., Климова Е.А., Гаджикулиева М.М., Ющук Н.Д. Изменчивость генома вируса гепатита С при лабораторном мониторинге больных острым вирусным гепатитом. // Росс. Журн. Гастроэнтер. Гепат. Колопроктол. – 2002. – № 1. – C. 30 – 37.

36. Ильина Е.Н., Артемов Е.К., Говорун В.М., Иванова Л.М., Иваников И.О. Генотипирование РНК вируса гепатита С аллельспецифичной амплификацией. // Кремлевская Медицина. Клинический вестник. – 2002. – № 1. – C. 38 – 41.

37. Ющук Н.Д., Знойко О.О., Климова Е.А., Огиенко О.Л., Говорун В.М., Гущин А.Е., Ильина Е.Н. Роль персистенции HCV в плазме и лейкоцитах при хронической HCV инфекции. // Росс.

Журн. Гастроэнтер. Гепат. Колопроктол. – 2000. – № 4. – C. 59 - 64.

38. Ильина Е.Н., Гущин А.Г., Говорун В.М., Знойко О.О., Климова Е.А., Ющук Н.Д. Новый подход в генотипировании вируса гепатита С. // Эпидем. Инфекц. Болезни. – 1999. – № 5. – C. 2326.

39. Ющук Н.Д., Климова Е.А., Гаджикулиева М.М., Кареткина Г.Н., Говорун В.М., Гущин А.Е., Ильина Е.Н., Соколова М.В., Елисеева И.Я., Чешик Д.С., Малышев Н.А. Распространенность маркеров герпесвирусных инфекций у больных парентеральными гепатитами. // Росс. Журн.

Гастроэнтер. Гепат. Колопроктол. – 1999. – № 5. – C. 36 - 41.

Список сокращений а.о. – аминокислотный остаток АМП – антимикробный препарат ВГВ – вирус гепатита В ВГС – вирус гепатита С ВМС – времяпролетная масс-спектрометрия ДНК – дезоксирибонуклеиновая кислота ДТТ – дитиотрейтол МАЛДИ – матрично-активированная лазерная десорбция/ионизация МПК – минимальная подавляющая концентрация ПСБ – пенициллин связывающий белок ПЦР – полимеразная цепная реакция РНК – рибонуклеиновая кислота ddNTP – дидезоксинуклеозидтрифосфаты dNTP – дезоксинуклеозидтрифосфаты EMB – этамбутол INH – изониазид MDR (multidrug resistant) – применительно к М. tuberculosis, изолят устойчивый как минимум к рифампицину и изониазиду MLST (multilocus sequencing typing) –типирование мультилокусным секвенированием NG-MAST (N. gonorrhoeae multiantigen sequence typing) – мультиантигенное типирование гонококка QRDR (quinolone resistance-determining region) – область, определяющая устойчивость к хинолонам.

RIF – рифампицин RRDR (rifampicin resistance determinant region) – область, определяющая устойчивость к рифампицину SSC (20x) – буферная смесь 3M NaCl и 0,3M цитрата натрия (pH 7,0) VNTR (variation number tandem repeats) – вариации числа повторяющихся фрагментов ДНК







© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.