WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

ЛАВРЕНТЬЕВА 

Ирина Николаевна

ШТАММ  «ОРЛОВ – Д»  ДЛЯ  ПОЛУЧЕНИЯ ЖИВОЙ

АТТЕНУИРОВАННОЙ ВАКЦИНЫ ПРОТИВ КРАСНУХИ

03.00.06 – вирусология

А в т о р е ф е р а т

Диссертации на соискание ученой степени

доктора медицинских наук

Москва - 2009 г

Работа выполнена в ФГУН «Санкт-Петербургский научно-исследовательский институт эпидемиологии и микробиологии имени Пастера»  Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека

Научный консультант:

Доктор медицинских наук, член-корреспондент РАМН

                                       Жебрун  Анатолий  Борисович

Официальные оппоненты:

Доктор биологических наук, профессор, академик РАМН

Зверев Виталий Васильевич

Доктор медицинских наук, профессор, академик РАМН

Лашкевич Василий Андреевич

Доктор медицинских наук, профессор Подчерняева Раиса Яковлевна

Ведущее учреждение:

ФГУН «Московский научно-исследовательский Институт эпидемиологии и микробиологии им. Г.Н.Габричевского» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека

Защита состоится «19» июня 2009 года в 10 часов на заседании диссертационного совета Д 001.026.01 при Институте полиомиелита и вирусных энцефалитов им. М. П. Чумакова РАМН (142782,  Московская область, п/о Институт полиомиелита).

С диссертацией можно ознакомиться в библиотеке ГУ Института полиомиелита и вирусных энцефалитов им. М. П. Чумакова (142782, Московская обл., п/о Институт полиомиелита).

Автореферат разослан «_______» мая 2009 г.

Ученый секретарь диссертационного совета,

кандидат биологических наук  О.А. Медведкина

ОБЩАЯ  ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы

Стратегический план Европейского регионального бюро ВОЗ  на 2005 – 2010 г.г. определяет борьбу с врожденной краснухой (ВК) в числе приоритетов и предусматривает элиминацию эндемичной краснухи и снижение заболеваемости ВК в странах региона  до уровня менее 1 случая на 100 тыс. живых новорожденных (целевая программа «Здоровье для всех в XXI веке»). В странах, где достигнут высокий охват населения профилактическими прививками против краснухи, эта задача успешно решается [Best, Banatlava, 2006].

В Российской Федерации иммунизация против краснухи детей первого –  второго года жизни введена в календарь  профилактических прививок  приказом МЗ РФ  от 27.12.97 г. № 375. В связи с отсутствием отечественной вакцины, прививки проводятся зарубежными препаратами,  зарегистрированными в установленном порядке [Бектемиров, 2004]. Их действующим началом является вакцинный штамм Wistar RA27/3  (автор – S. A. Plotkin).

В настоящее время, согласно приказу  Министерства здравоохранения и социального развития РФ от 30.10.2007 г. № 673, плановой иммунизации подлежат дети в возрасте 12 месяцев, 6  лет  и девочки 13 лет;  дополнительной  –  в рамках реализации Национального проекта в области здравоохранения – все дети от 1 до 17 лет не болевшие, не привитые или однократно привитые против краснухи; а также девушки 18 – 25 лет,  не болевшие и не привитые ранее.  C 1999 г., когда был зарегистрирован максимальный уровень заболеваемости краснухой (399,0 на 100 000 населения), этот показатель снизился более чем в 10 раз (21,7 на 100 000 населения в 2007 г.), что, в целом, свидетельствует об эффективности вакцинопрофилактики инфекции.

В то же время, специфическая профилактика краснухи в России связана с рядом проблем и вопросов, которые требуют изучения.

В  Государственном докладе «Актуальные вопросы обеспечения санитарно-эпидемического благополучия населения  Российской Федерации» (2007 г.) Главного государственного санитарного врача РФ Г.Г. Онищенко констатируется, что регламентированный ВОЗ  95 % уровень  охвата ревакцинирующими прививками  в стране не достигнут. Среди заболевших краснухой наметилась тенденция к увеличению доли взрослого населения, в том числе  женщин  репродуктивного возраста. Как отмечает Г.Г. Онищенко, отсутствие отечественной вакцины сдерживает охват прививками  всех подлежащих вакцинации контингентов.

       Изолированный на территории Российской Федерации вакцинный штамм вируса краснухи «Орлов» (автор – В.Н. Мешалова)  был получен в г. Ленинграде под руководством академика А.А. Смородинцева  в 70-ые годы XX века и депонирован в ГКМВ в 1979 г. Клинические испытания экспериментальных  серий вакцины, созданной на его основе, показали высокую иммуногенную активность (100 % сероконверсий в группе серонегативных привитых, СГТ  АТ – 8,1 lg2), низкую реактогенность препарата (1 % клинических реакций средней тяжести) [Мешалова и др., 1979].  В 1995 г., в рамках реализации Федеральной целевой программы «Вакцинопрофилактика» (руководитель программы – А.А. Ясинский),  вакцинный штамм «Орлов» был восстановлен нами до исходных показателей биологической активности, сертифицирован  в ГИСК им. Л.А.Тарасевича как вакцинный и  получил наименование «Орлов-В»  [Лаврентьева и др., 2003 г].

В большинстве стран, где осуществляется специфическая профилактика краснухи, преобладает циркуляция вирусов первой генетической линии, к которой принадлежит и  вакцинный штамм Wistar RA27/3. Россия определена экспертами ВОЗ, как единственная территория с эндемичным распространением вирусов генотипа 2с [WHO, Wkly epidemiol. report, 2005].  Несмотря на высокое антигенное  родство различных штаммов вируса краснухи, выделенных в разных регионах мира  [Десятскова, 1974., Зверев и др. 2002], филогенетические изменения вируса под прессом коллективного иммунитета представляются возможным событием и создают потенциальную угрозу возникновения его дрейфовых вариантов со значимыми мутационными изменениями генома, как это отмечено, в частности, в отношении вакцинных полиовирусов в ходе реализации программы ликвидации полиомиелита живой оральной вакциной [Облапенко, 2003, Онищенко и др., 2008].

Однако в отечественной научной литературе до последнего времени не было работ, посвященных изучению адаптационной изменчивости вируса краснухи в период вакцинопрофилактики инфекции; а также – определению  генетической принадлежности штамма «Орлов-В». Не было работ по определению генетической близости между современными штаммами и изолятами вируса краснухи, циркулирующими на территории РФ, и вакцинными штаммами, полученными более 30 лет тому назад. Не проводилась сравнительная генетическая характеристика отечественного и зарубежного вакцинных штаммов вируса краснухи. Решение этих вопросов представляет не только научный интерес, но и имеет непосредственное отношение к эффективности и безопасности специфической профилактики краснухи на территории Российской Федерации.

Штамм «Орлов-В» получен на первичной культуре клеток ППК.  Использование в качестве тканевого субстрата в производстве вакцины первично-трипсинизированных клеточных культур усложняет технологию получения вакцины, затрудняет стандартизацию качественных характеристик конечного продукта, повышает себестоимость препарата. Более экономичным,  технологичным, стабильным по биологическим свойствам  клеточным субстратом  для производства МИБП  являются полуперевиваемые (диплоидные) линии клеток человека, рекомендованные экспертами ВОЗ для производства, в частности,  вакцины против краснухи [Серия технических докладов ВОЗ, № 28, 1989].

При проведении в России массовой иммунизации детского населения и селективной вакцинации взрослых, существенное значение приобретает экономическая составляющая кампании. Использование для профилактики краснухи отечественного препарата, полученного на диплоидной линии клеток человека, позволило бы, ориентировочно, снизить затраты только на дополнительную иммунизацию населения в рамках реализации национального проекта «Здоровье»  в 1,7 раза и сэкономить около 187 млн. рублей. При проведении плановой иммунизации  экономия составила бы около 64 млн руб. ежегодно (в ценах 2008 г.). Экономическое преимущество такого препарата определяет актуальность разработки, так как его внедрение будет способствовать повышению охвата прививками всех декретированных контингентов и совершенствованию профилактики СКВ.

Вместе с тем, адаптация вируса к иной системе клеток-продуцентов  может сопровождаться мутациями вирусного генома с изменением молекулярно-генетических  свойств полученного варианта. Для оценки пригодности более технологичного варианта вакцинного вируса необходимо определить его генетическую стабильность in vitro, а также, в опытах in vivo – сохранность  основных биологических свойств, характеризующих штаммы для живых вакцин: специфическую и иммунологическую  безопасность; специфическую активность.

Вышеизложенное свидетельствует об актуальности настоящего исследования и  служит основанием для получения варианта эндемичного для России вакцинного штамма вируса краснухи, адаптированного к более технологичному тканевому субстрату, и его всестороннего изучения.

Цель работы:

Создание на основе вакцинного штамма вируса краснухи «Орлов» кандидата в вакцинный штамм и определение возможности его использования для профилактики  краснухи  на территории России.

Задачи исследования:

  1. Провести сравнительный генетический анализ  вакцинных штаммов вируса краснухи и современных штаммов и изолятов вируса.
  2. Определить возможные филогенетические изменения вируса краснухи в  период вакцинопрофилактики инфекции.
  3. Оценить чувствительность ряда диплоидных линий клеток  к вирусу краснухи и получить вариант исходного вируса краснухи, адаптированный к диплоидной культуре клеток «М-22»  (штамм «Орлов-Д»).
  4. Провести сравнительный генетический анализ штаммов Wistar RA27/3  и «Орлов-Д».
  5. Оценить возможность использования  диплоидной культуры клеток «М-22» в качестве тканевого субстрата для получения вакцины против краснухи.
  6. Изучить генетические изменения вируса краснухи в процессе аттенуации в культуре клеток ППК и при его адаптации к диплоидной линии клеток «М-22».
  7. Исследовать в опыте на обезьянах макака-резус специфическую безопасность штамма «Орлов-Д», включая контагиозность.
  8. Определить в испытаниях  на обезьянах  макака-резус специфическую и  протективную активность штамма «Орлов-Д».

9.  Изучить влияние иммунизации препаратом из штамма «Орлов-Д» на

показатели  врожденного иммунитета обезьян.

Научная новизна и теоретическая значимость исследования:

Впервые получены новые знания:

- о генетической принадлежности вакцинного штамма «Орлов-В», о  генетических маркерах, характеризующих ослабленные варианты вируса краснухи;

- о более тесном генетическом родстве штамма «Орлов-В» и российских изолятов вируса краснухи, чем это присуще  штамму Wistar RA27/3;

- об адаптационной изменчивости вируса краснухи в период вакцинопрофилактики инфекции;

В ходе исследования получен новый вариант вакцинного штамма «Орлов», адаптированный к более технологичному тканевому субстрату – штамм «Орлов-Д». Впервые проведена сравнительная генетическая характеристика штаммов «Орлов-Д» и Wistar RA27/3 и установлены различия между штаммами в  высоко консервативной области белка Е1,  отвечающей за поливалентную иммуногенную активность вируса.

Впервые  разработаны технологические подходы к получению живой ат-тенуированной краснушной вакцины на основе штамма «Орлов-Д» и ди-плоидной культуры клеток кожно-мышечных фибробластов  человека «М-22».

Впервые в эксперименте получены  сведения о специфической безопасности штамма  вируса краснухи «Орлов-Д», включая отсутствие контагиозных свойств, а также данные о  высоких показателях его иммуногенной активности и протективности, не уступающие по этим критериям препарату сравнения – штамму Wistar RA27/3; доказана иммунологическая безопасность штамма. Эти результаты являются научным обоснованием  перспективности использования штамма «Орлов-Д» для профилактики краснухи в России.

Практическая значимость:

Получение нового аттенуированного штамма для живой вакцины против краснухи и разработка способа получения вакцины на технологичном тканевом субстрате создает реальные предпосылки для получения вакцины против краснухи на основе эндемичного для России штамма вируса, что будет способствовать совершенствованию профилактики краснухи  и  СВК на территории Российской Федерации.

  Положения, выносимые на защиту:

1. Вакцинный штамм вируса краснухи «Орлов-В» идентифицирован как вирус генотипа 2с,  эндемичный  для территории РФ, и генетически более близок к циркулирующим на территории России изолятам  вируса краснухи, чем вакцинный штамм  Wistar RА27/3. Вакцинопрофилактика краснухи вызывает филогенетические изменения возбудителя.

2. Выбор диплоидной линии клеток фибробластов кожно-мышечного лоскута эмбриона человека «М-22» для получения штамма «Орлов-Д» обусловлен чувствительностью указанной культуры клеток к вакцинному штамму  вируса краснухи,  аналогичной чувствительности клеточной культуры ППК, использованной для аттенуации штамма «Орлов», а также наличием банка посевных клеток «М-22», рекомендованных ГИСК им. Л.А. Тарасевича для производства вакцинных препаратов. Данная культура клеток является технологичным субстратом и пригодна для промышленного выпуска краснушной вакцины.

3. Аттенуация штамма «Орлов» вируса краснухи в первичной культуре клеток ППК сопровождается  значимой мутацией в  структуре гена  Е1. В процессе многократного пассирования  штамма «Орлов-Д» в диплоидной культуре  клеток «М-22» сохраняется его генетическая  стабильность.

  1. Доклиническое изучение штамма «Орлов-Д» на обезьянах макака –

резус специфической  безопасности, специфической  активности и иммунологической безопасности свидетельствует о его пригодности для получения вакцины против краснухи.

Внедрение результатов исследования в практику:

1. Вакцинный штамм вируса краснухи «Орлов-В». Депонирован в ГКМВ (№

2326 от  04.04.1995 г.); свидетельство об аттестации штамма в ГИСК им.

Л.А. Тарасевича  № 01-33/8 от 29.03.95 г.

2. Штамм вируса краснухи «Орлов-Д». Депонирован в ГКМВ (№ 2347 от

29.12.1998 г.). 

3. Штамм вируса краснухи «Лебедев». Депонирован в ГКМВ (№  2365 от

  17.12.2004 г.).

4. Изоляты вируса краснухи, выделенные на территории Пермского края.

  Депонированы  в коллекцию  Международного генетического банка

  Национального центра биотехнологической информации (Национальный

  институт здоровья, США) (№№  EF210064 -  EF210075 от 21.04.07 г.).

5. Патент на изобретение РФ № 2081912 «Вакцинный штамм вируса краснухи

  Орлов-В». Приоритет от 22.05.1995 г.

6. Патент на изобретение  РФ № 2173344  «Вакцинный штамм вируса краснухи

«Орлов-Д» и способ получения вакцины против краснухи». Приоритет от 28.06.1999 г.

  1. Инструкция по изготовлению и контролю живой культуральной краснушной вакцины. Рассмотрена и одобрена Ученым Советом ФГУ  «Санкт-Петербургский НИИЭМ имени Пастера Министерства здравоохранения Российской Федерации»  (протокол № 10 от 14.11.2001г.) и утверждена директором Института  14.11.2001 г.

 

Апробация работы и публикации:

       Основные результаты исследовательской работы доложены и обсуждены на 18 научных форумах и конференциях: на юбилейной конференции НИИЭМ им. Пастера «Идеи Пастера в борьбе с инфекциями» (г. Санкт-Петербург, 1995 г.) ; на Международной конференции  «XXXI Dani preventive medicine» (Nis,  1997 г.), на Международной конференции «Modern Vaccinology»» (г. Уфа, 1996 г.);  на II Международной научной конференции «Идеи Пастера в борьбе с инфекциями» (г.Санкт-Петербург, 1998 г.); на Международной конференции «XXXII Dani preventive medicine» (Nis,  1998 г.),  на научной конференции с международным участием, посвященной 80-летию со дня рождения академика В.Д. Белякова «Достижения отечественной эпидемиологии в XX веке. Взгляд в будущее» (г. Санкт-Петербург, 2001 г.); на Международной научной конференции «Ликвидация и элиминация инфекционных болезней – прогресс и проблемы» (г. Санкт-Петербург, 2003 г.); на научно-практической конференции «Вакцинопрофилактика в XXI веке (Пермь, 2000 г.); на Всероссийской научной конференции «Актуальные вопросы вакцинно-сывороточного дела в XXI веке» (г. Пермь, 2003 г.);  на Всероссийской научной конференции с международным участием «Перспективные направления использования лабораторных приматов в медико-биологических исследованиях» (г. Адлер, 2006 г.); на Международной научной конференции «Фундаментальные и прикладные проблемы медицины и биологии в опытах на обезьянах» (г. Адлер, 2007 г.); на IX съезде Всероссийского научно-практического общества  эпидемиологов, микробиологов и паразитологов «Итоги и перспективы обеспечения эпидемического благополучия населения Российской Федерации» (г. Москва, 2007 г.); на Международном конгрессе «48th Annual Meeting of the Eurohean Society for Pediatric Research» (г. Прага, 2007 г.),  на Международном Российско-Норвежском семинаре «Совершенствование системы эпидемиологического надзора, диагностики и профилактики врожденной краснухи» (г. Санкт-Петербург, 2007 г.); на 3 заседаниях Санкт-Петербургского отделения Всероссийского научно-практического общества эпидемиологов, микробиологов и паразитологов (г. Санкт- Петербург, 2003, 2005, 2007 г.г.); на заседании Ученого Совета ГУ  ИПВЭ  им. М. П. Чумакова  РАМН (Московская область, 2007 г.).

       Диссертационная работа была апробирована на заседании проблемной комиссии по вирусологии (25.09.08 г.) и заседании Ученого Совета (02.10.08 г.) ФГУН «НИИЭМ имени Пастера»  Роспотребнадзора.

        Научные положения, изложенные в диссертации, опубликованы в 31 печатной работе в период с 1995 по 2008 г.г., включая монографию «Краснуха» (Пермь – Санкт-Петербург – Москва, 2002), аналитический обзор «Инфекционная заболеваемость в Северо- Западном федеральном округе России. Закономерности и особенности  эпидемического  процесса в  современный период» (СПб., 2007)  и  8 работ в журналах, которые рекомендованы ВАК для публикации основных научных результатов диссертаций на соискание ученой степени доктора наук. По материалам исследования получено два патента РФ  на изобретение.

Структура и объем диссертации

Диссертация изложена на 328 страницах машинописного текста, состоит из введения, главы обзора литературы, главы материалов и методов, трех глав собственных исследований, обсуждения полученных результатов, выводов, списка использованной литературы и приложений. Список литературы включает 297 работ, из них 113 отечественных и 184 зарубежных авторов. Работа иллюстрирована 4 рисунками и 20 таблицами.

СОДЕРЖАНИЕ  РАБОТЫ

Материалы и методы исследования

Исследование выполнено в ФГУН  «НИИЭМ имени Пастера»  Роспотребнадзора с 1995  по 2007  гг. в комплексе с ООО диагностический центр научно-производственная фирма (НПФ) «Хеликс» (г. Санкт-Петербург), ФГУЗ «Центр гигиены и эпидемиологии в Пермском крае» (г. Пермь); ГУ НИМП РАМН (г. Адлер-Сочи).

В работе использованы  следующие  группы вирусов:

1. Варианты вакцинного штамма вируса краснухи  «Орлов», полученные в ходе его аттенуации в культуре клеток ППК. Использованы 14, 17, 23 пассажи вируса в указанной культуре клеток. Штаммы получены из коллекции музейных вирусов лаборатории детских вирусных инфекций ФГУН «НИИЭМ имени Пастера» Роспотребнадзора.

2. Вакцинные  штаммы вируса краснухи:

-  Wistar RA27/3 (в составе вакцины Rudivax); 

- «Орлов» (36 пассажей в культуре клеток  ППК; получен из ГКМВ,  г. Москва); 

-  «Орлов-В» - получен нами проведением трех дополнительных пассажей штамма «Орлов» в культуре клеток ППК. Всего штамм «Орлов-В» прошел 39 пассажей в указанной культуре клеток.

3. Штамм вируса краснухи  «Лебедев», выделенный нами в 2001 г. от ребенка с СВК на перевиваемой культуре клеток BHK-21; в работе использован 3 – 4 пассаж вируса в указанной культуре клеток.

4. В ходе работы получен аттенуированный штамм вируса краснухи «Орлов-Д».

5. Вакцинные штаммы вируса кори Л-16 и вируса эпидемического паротита Л-3.

6. Вирусы ВВС, ВБН, ВЭМ.

Образцы крови, полученные на территории Пермского края в период 1999 – 2005 гг.,  от 13 пациентов с лабораторно подтвержденным диагнозом «краснуха».

Первичные (ППК), диплоидные (ДКЛЧ, ДКПЧ, «М-22»), перевиваемые (RК-13, ВНК-21, Vero, L-41, СПЭВ) культуры клеток.

Лабораторные животные: 130 беспородных взрослых и новорожденных мышей, 44 морские свинки, 75 взрослых и  1-3 дневных кроликов породы «Шиншилла», 35 обезьян макака-резус.

Для проведения исследования применялись вирусологические,  молекулярно-биологические, иммунологические, морфологические, гистологические методы исследования.

Определение биологической (инфекционной)  активности вирусов проводили титрованием на культуре клеток, используя десятикратные разведения образцов ВСЖ. Учет результатов производили по прямому ЦПД вируса на клетки или в реакции интерференции с рабочей дозой ВВС. Конечную концентрацию вирусов определяли по методу Рида и Менча.

Молекулярно-генетические исследования проводили на базе диагностического центра ООО НПФ «Хеликс».  Для выделения РНК  из сыворотки крови больных или из лиофилизированного штамма вируса краснухи  использовали набор реагентов «Рибо-сорб», производства ФГУН «Центральный НИИ эпидемиологии» Роспотребнадзора (г. Москва) в соответствии с инструкцией по применению.

Для проведения реакции обратной транскрипции (ОТ-ПЦР) использовали набор реагентов «Revert AidTM First Stand cDNA Sintesis Kit» (Fermentas); реакцию проводили  по стандартной схеме. Полученную кДНК использовали для проведения ПЦР. Для проведения ПЦР были подобраны 3 группы праймеров: 1. Для сравнительного генотипирования штаммов «Орлов-В»,  «Орлов-Д» и Wistar RA27/3  была использована пара праймеров, полностью фланкирующих  ген  Е1  и  дающих амплификат размером 1443 п. о. (с 8292 по 9653 н): Forward: 5’- CAC TCA AGC ACC TGT CCC  C– 3’; Reverse: 5’ – GCA CAG CAA GCG AGT AAG C- 3’. 2.  Для генотипирования штаммов и изолятов вируса краснухи был использован участок гена Е1 размером 739 п.о. (с 8731 по  9469 н.),  полученный в результате амплификации с другой пары праймеров: Forward: 5’- TCT GGG CTG TCA ACG CCT ACT CCT – 3’; Reverse: 5’ – ATC CAC TCG GGT ATT TCG – 3’. 3. Для сравнительного генотипирования пассажных вариантов штамма  «Орлов» - 14 пар праймеров, амплификаты которых суммарно перекрывают весь геном Rubella (9755 п.о.) (таблица 1).

Таблица 1

Последовательности праймеров, использованных для секвенирования генома вируса краснухи

Последовательность

Ta *

(°С)

Размер продукта (нк)

1

2

3

4

1

CGGACCTCGCTTAGGACTC

58

778

2

CCGGCAGGACTTGGTAGAT

3

CACGCATCTACCAAGTCCTGC

61

678

4

GCACGGTGTCCAAGTGGC

5

ACCTGGATCGTCCACGCAG

65

641

6

GGCAGGTCACGCACCGAGA

7

CTCGGTGCGTGACCTGCC

63

769

8

CGCAGCAGACCAGCCGTAG

9

GCTGGTCTGCTGCGGAGTC

62

701

10

GCACCCGGCACTCGTGTAG

11

TACACGAGTGCCGGGTGC

63

719

12

GCGAGCGGTTTCGTCAGC

13

ATCAAGAACGCCGCCACC

64

716

14

TCTTGGGCCTCGGGGATG

15

CCGCACTCTGGAGGAGCT

58

704

16

TGGCGTTGGTGGTGTAATG

17

GGTGGCAGGCCCATTACA

  60

762

18

TTAGTCGGCGTCGTGGAGA

19

CACGACGCCGACTAACGC

61

669

20

GCCCAGGTTGGTGAAATGC

21

TCACCAACCTGGGCACCC

66

723

22

CGGCGGTCGTGGAGTTCG

23

GCCGGCCTCAATGACAGC

62

649

24

CGCACGAGACATCAGTGGG

25

AGATCCCCACTGATGTCTCG

59

766

26

ATCCACTCGGGCATTTCG

27

AGTGCGGACTCCACATACG

57

718

28

GGGCAAGAACCTCATCTAGG

* Та – температура отжига

Последовательности праймеров группы 1, 2 и 3 были использовали для секвенирования соответствующих  амплификатов.

ПЦР  проводили по стандартной методике, адаптированной к соответствующей паре праймеров. Программа проведения ПЦР:  95° С – 3 мин + {94 ° С – 30 сек;  60 ° С – 30 сек;  72 ° С – 45 сек } х 35 циклов + 72 ° С – 5 мин.  Амплификацию проводили на приборе «Терцик» (ДНК-Технология). Секвенирование  в  4,25% полиакриламидном геле - на автоматическом секвенаторе ABI Prism 377 («Applied Biosystems», США)  с использованием реагентов «BigDyeTM Terminator Kit v.2.0» (Appliied Biosystems) Полученные хромотограммы анализировали с помощью программы Chromas 2.3 «Technelysium Pty Ltd» (Австралия). Для  построения филогенетического древа вируса краснухи использовали компьютерную программу MrBayes 3.1., в соответствии с рекомендациями ВОЗ (2005). Для  определения  степени  эволюционной близости штаммов и  изолятов  вируса краснухи использовали показатель генетической дивергенции, который складывался из доли нуклеотидных замен между образцами (%) и индекс генетической близости, который рассчитывали, используя эволюционную модель случайных нуклеотидных замен [Kimura, 1980]. Межгрупповые генетические различия определяли, используя внутригрупповые консенсусные последовательности. Для анализа мутационных изменений генома штамма «Орлов» в процессе аттенуации в качестве  референс-препарата  использована референс- последовательность NC_001545 [Dominguez et al., 1990].  Для оценки генетических различий между вакцинными штаммами вируса краснухи Wistar RA27/3 и «Орлов-Д» использовали компьютерную программу «Vector NTI 10.0» (Invirtogen USA).

Доклиническое изучение  штамма «Орлов-Д» проводили на базе ГУН НИИМП РАМН (г. Адлер-Сочи).

Контроль специфической безопасности штаммов вируса краснухи проводили определением остаточной нейровирулентности при интрацеребральном заражении серонегативных к краснухе обезьян макака-резус. Перед началом эксперимента животных погружали в глубокий наркоз, который достигался внутримышечным введением 10% раствора гексенала из расчета 1,0 мл на 1,0 кг массы животного.  Вируссодержащий материал вводили в зрительный бугор каждого полушария головного мозга в дозе, 10000 ТЦД50/0,5 мл. Клиническое наблюдение за обезьянами проводили 30 суток, в течение которых  отмечали наличие или отсутствие клинических симптомов поражения центральной нервной системы. По истечении периода клинического наблюдения у животных брали пробы крови для  определения в сыворотке вирусспецифических АТ, после чего умерщвляли под глубоким гексеналовым наркозом, проводили аутопсию, морфологическое  и гистологическое исследование тканей ЦНС  и других внутренних органов обезьян.

Специфическую активность штаммов вируса краснухи  определяли по критериям:

1. Иммуногенная активность – формирование вирусспецифических АТ через 28 суток после однократного внутримышечного введения серонегативным к краснухе обезьянам препаратов из исследуемых штаммов. Прививочная доза соответствовала 1 прививочной дозе для человека – не менее 1000 ТЦД50/0,5 мл. Определение титров АТ  проводили в РТГА, используя «Диагностикум краснушный антигенный сухой для РТГА» производства ФГУН «НИИЭМ имени Пастера» Роспотребнадзора  в соответствии с инструкцией по применению препарата.

2. Протективная  активность - устойчивость иммунизированных животных к трехкратному интраназальному заражению патогенным штаммом вируса краснухи «Лебедев» в дозе 10000 ТЦД50/0,5 мл. Группу контроля при этом составляли не иммунизированные, серонегативные к краснухе обезьяны, зараженные  по той же схеме. Развитие вирусемии регистрировали в ПЦР, исследуя сыворотки крови животных на разных сроках после заражения. Для выделения вирусной РНК использовали набор реагентов «АмплиСенс Rubella-302» производства ФГУН «Центральный НИИ эпидемиологии» Роспотребнадзора.

Контагиозность штаммов вируса краснухи  оценивали после 28 суток тесного контакта (нахождение в одной клетке) иммунизированных и не иммунных макаков, определяя у последних наличие вирусспецифических  АТ.

Интерфероновый статус и параметры клеточного иммунитета  обезьян определяли, исследуя гепаринизированную кровь, взятую из локтевой вены животных; - и - ИФН получали in vitro, используя различные индукторы (ВБН, Con-A). Титрование полученных цитокинов проводили в 96-луночных плоскодонных планшетах, маркированных «для работы с культурой клеток» с 24-часовой культурой монослоя клеток-мишеней СПЭВ против 100 цитопатических доз индикаторного вируса (ВЭМ). Параметры клеточного иммунитета определяли в тесте розеткообразования эритроцитов барана, меченых моноклональными антителами против различных субпопуляций лимфоцитов, а также против маркеров молекул HLA-DR. Использовали диагностический набор «Диагностикумы стабильные на основе моноклональных антител» Витебского государственного медицинского института в соответствии с инструкцией. Все манипуляции с обезьянами проводили после в/м  введения раствора калипсола из расчета 0,1 мл на 1 кг массы тела животного.

Статистическая обработка материала проведена  методами параметрической и непараметрической статистики  [3айцев, 2003] с использованием t-критерия Стьюдента для определения значимости различий между явлениями. Разность результатов считали статистически достоверной при  р < 0,05.

РЕЗУЛЬТАТЫ РАБОТЫ И ИХ ОБСУЖДЕНИЕ

На основании проведенных исследований сформулированы и представлены к защите четыре основные положения:

ПЕРВОЕ  ПОЛОЖЕНИЕ

Вакцинный штамм вируса краснухи «Орлов-В» идентифицирован как вирус генотипа 2с, эндемичный  для территории РФ, и генетически более близок к циркулирующим на территории России изолятам  вируса краснухи, чем вакцинный штамм  Wistar RА27/3. Вакцинопрофилактика краснухи вызывает филогенетические изменения возбудителя.

На первом этапе работы представлялось важным определить генетическую принадлежность современных изолятов вируса краснухи, выделенных на территории России; их генетическую близость к вакцинным штаммам Wistar RA27/3 и  «Орлов-В», полученным в 70-ые годы XX века.

Для этого, на  основе нуклеотидной последовательности фрагмента гена Е1 размером в 739 п.о. (с 8731 по 9653 н.), в  соответствии с рекомендациями ВОЗ по генотипированию «диких» штаммов вируса краснухи [WHO, Wkly epiod. Report, 2005] был проведен филогенетический анализ 13 изолятов вируса краснухи, идентифицированных на территории Пермского края в период с 1999 по 2005 гг. SLM17Perm-1999, SLM11Perm-2000, SLM13Perm-2000, SLM14Perm-2000, SLM16Perm-2000, SLM12Perm-2003, SLM3Perm-2003, SLM7Perm-2002, SLM8Perm-2002, SLM5Perm-2004, SLM9Perm-2004, SLM6Perm-2005, SLM15Perm-2005,  а также упомянутых выше вакцинных штаммов  вируса краснухи. В анализе использовали также имеющиеся в коллекции GenBank  последовательности 4 штаммов вируса краснухи, циркулировавших в России в  1967- 1997 гг..  По результатам исследования все изоляты вируса краснухи, выделенные на территории Пермского края, а также вакцинный штамм «Орлов-В» и 4 российские штамма, выделенные в период 1967 – 1997 гг., отнесены к генотипу 2с (рис. 1).

Штамм Wistar RA27/3 отнесен к  генетической линии 1. В ходе генетического анализа этого штамма было получено совпадение его положения в филогенетическом древе с установленным номером в GenBank, что подтверждает достоверность полученных результатов. Индекс генетической близости между современными изолятами вируса краснухи и вакцинными  штаммами «Орлов-В» и Wistar RA27/3  составил 0,74 и 0,99 соответственно. Эти показатели свидетельствуют о более тесном генетическом родстве современных изолятов вируса, выделенных на территории Западного Урала, российских изолятов более раннего периода выделения с вакцинным штаммов «Орлов-В», чем со штаммом Wistar RA 27/3.

Полученные результаты  коррелируют с данными ВОЗ, которая определяет РФ  как территорию с эндемичной циркуляцией вирусов краснухи генотипа 2с [WHO, Wkly Epidemiol. Rec., 2005]. Своего рода уникальность вирусов краснухи генотипа 2с, связанная с их эндемичным распространением  в России, может являться обоснованием, наряду с экономическим преимуществом, целесообразности использования в РФ вакцинного штамма,  выделенного на данной территории.

Группой ученых  [Frey et al., 1998, Zheng et al. 2003] было высказано предположение о том, что возрастающая изменчивость штаммов вируса краснухи является следствием введения в практику широкомасштабной вакцинации в разных странах мира. Очевидно, что надзор за краснушной инфекцией должен предусматривать наблюдение за эволюцией вируса в период вакцинопрофилактики. C этой целью были исследованы изоляты вируса краснухи, выделенные на территории Пермского края, где, вакцинопрофилактика краснухи проводится с 1995 г. За десятилетний период в крае были  использованы две стратегии: селективной вакцинации девушек и женщин репродуктивного возраста;  массовой вакцинации детей 1-2 года жизни.

В ходе исследования была выявлена низкая популяционная  изменчивость современных изолятов  по отношению к  референс-штаммам вируса краснухи, которая варьировала в интервале 0 – 1 %. Также несущественными оказались генетические различия между изолятами вируса краснухи, полученными в период селективной иммунизации на фоне эпидемического подъема заболеваемости (1999 – 2000 гг. и 2003 г.) и в межэпидемический период 2003 г. -  показатель  генетической дивергенции не превышал 0,6 – 2% (р > 0,05). 

Рис. 1. Генетическая характеристика изолятов вируса краснухи, циркулирующих на территории Пермского края  в  1999–2005 гг.

Изоляты: 5-SLM5Perm-2004, 6-SLM6Perm-2005,  7-SLM7Perm-2002, 8-SLM8Perm-2002, 9-SLM9Perm-2004, 11-SLM11Perm-2000,  12-SLM12Perm-2003, 13-SLM1ЗPerm-2000, 14-SLM14Perm-2000, 15-SLM15Perm-2005, 16-LM16Perm-2000, 17-SLM17Perm-1999. Референсные штаммы генного банка - AY 247015,  AY 247016,  AY 247017, AY 247019 (Россия, 1967-1997 гг.). Вакцинные штаммы вируса краснухи: «Орлов-В»; Wistar RA27/3 в составе вакцины Rudivax.

Напротив, массовая туровая иммунизация  детей  1 – 2 года жизни в течение 4-х лет применения,  при пороге привитости, равном 460,0 на 1000 детского населения (расcчитан на все население  г. Перми в возрасте от 1 до 17 лет) привела к достоверному увеличению показателя генетической дивергенции с  1,15 %  в  2000 – 2002 гг. до  3,14 % в 2004 – 2005 гг. (r = 0,76; t = 4,58 p<0,01 значимость F = 0,08, вероятность 92,0%  р<0,05). Полученные результаты свидетельствуют о воздействии вакцинопрофилактики краснухи на свойства взаимодействующих популяций макро- и микроорганизмов, и ее влиянии на биологический фактор эпидемического процесса; и, тем самым, корреспондируются с предположением Т. Frey и др. о влиянии специфической профилактики на генетическую дивергенцию вируса краснухи. Выявленные нуклеотидные замены в гене Е1 под влиянием вакцинации не были значимыми, ни в одном случае не вызвали изменения аминокислотного состава белка Е1, но дальнейшие исследования по воздействию вакцин, используемых при прививках, на молекулярно-генетические и фенотипические свойства вируса краснухи представляют несомненный научный и практический интерес.

В соответствии с задачами исследования, следующий этап работы был связан с получением варианта вакцинного штамма  «Орлов» - штамма «Орлов-Д».

Для получения штамма «Орлов-Д» первоначально была проведена работа по определению способности различных видов диплоидных линий клеток эмбриона человека поддерживать репродукцию вируса краснухи. В экспериментах были использованы: 4  линии клеток ДКЛЧ – 175/312, 275/6, 776/14, 780/25; 3  линии клеток ДКПЧ – 882/25, 1182/12, 1182/8. В числе других, была использована линия диплоидных клеток фибробластов кожно-мышечного лоскута эмбриона человека, «М-22», любезно предоставленная автором линии, профессором Л.Л. Мироновой (получена на уровне 19 пассажа). Максимальный уровень инфекционной активности вируса (4,9 -5,3 lg ТЦД50/мл),  в 10 раз превышавший показатель его репродукции в клетках ППК, регистрировали при использовании фибробластов легкого эмбриона человека (линии клеток ДКЛЧ); минимальный: 3,1-3,2 lg ТЦД50/мл –  в клетках фибробластов почки эмбриона человека (линии клеток ДКПЧ). Линия клеток «М-22» занимала промежуточное положение по чувствительности к вирусу краснухи. Тем не менее,  средние показатели инфекционной активности вируса  в клетках ППК и «М-22» практически совпадали и составили 3,9 lg ТЦД50/мл  и  4,2 lg ТЦД50/мл,  соответственно.

Неоспоримым преимуществом линии клеток «М-22»  перед другими исследованными линиями является наличие банка посевных клеток «М-22», сертифицированного в ГИСК им. Л.А. Тарасевича. Это обстоятельство  определило дальнейший ход исследования, в котором в качестве тканевого субстрата для разработки способа получения вакцины против краснухи была использована линия диплоидных клеток человека «М-22».

В ходе получения нового варианта штамма «Орлов»  адаптация вируса к иному тканевому субстрату не потребовалась: стабильный уровень репродукции, стабильный rct40 ±-фенотип  регистрировали с первого по десятый пассаж  вируса в клетках «М-22». Этот факт определил возможность получения нового штамма «Орлов-Д» проведением одного дополнительного пассажа вакцинного вируса в диплоидной линии клеток. 

Далее был проведен сравнительный генетический анализ  штаммов Wistar RA27/3  и полученного аттенуированого штамма «Орлов-Д». Анализ проводили по полной протяженности гена Е1 (1443 п.о.)  и кодируемого им полипептида, так как именно гликопротеид Е1 является наиболее иммунологически важным структурным белком вируса краснухи [Chayne et al., 1992]. В ходе исследования выявлено, что доля нуклеотидных замен в структуре гена Е1 исследованных штаммов составляет 6,7%. Треть  нуклеотидных замен (34,3%) явилась значимой,  определила  различия в аминокислотном составе белка Е1 между штаммами. Наиболее важными представляются различия, установленные в высоко консервативной области белка Е1, а именно  на участке от 208 до 239 аминокислотного остатка.  В указанной  области белка Е1 штамма «Орлов-Д» определяется аминокислотная последовательность,  практически идентичная  таковой у многих «диких» и аттенуированных штаммов вируса краснухи: Therien, Judith, M-33, HPV77  [Chay et al., 1992, Domingues  et al., 1999,  Yao et al., 1999]. Тогда как, согласно данным литературы [Zheng et al., 1989] и полученным  результатам, в указанном сайте белка Е1 штамма  Wistar RA27/3 регистрируется замена Y(тирозин) H (гистидин). Значимость данного участка белка Е1 для реализации иммуногенности вируса краснухи была показана в работе [Jerry et al., 1993] по получению пяти синтетических пептидов, полностью перекрывающих протяженность полипептида Е1,  и моноклональных антител к ним. В отличие от четырех других, антитела к  данному участку молекулы Е1 (пептид SP15) нейтрализовали в ИФА как все другие пептиды, так и вирус краснухи в целом.

Выявленные различия исследованных штаммов «Орлов-Д» и Wistar RA27/3 в высоко консервативном участке молекулы Е1, ответственном за поливалентность иммуногенной активности вируса, свидетельствуют о возможном преимуществе применения штамма “Орлов-Д” для профилактики краснухи в условиях популяционной изменчивости возбудителя краснухи. Полученные результаты послужили дополнительным основанием для разработки способа получения вакцины против краснухи на основе диплоидной линии  «М-22» и  штамма «Орлов-Д».

ВТОРОЕ ПОЛОЖЕНИЕ

Выбор диплоидной линии клеток фибробластов кожно-мышечного лоскута эмбриона человека «М-22» для получения штамма «Орлов-Д» обусловлен чувствительностью указанной культуры клеток к вакцинному штамму  вируса краснухи,  аналогичной чувствительности клеточной культуры ППК, использованной для аттенуации штамма «Орлов», а также наличием банка посевных клеток «М-22», рекомендованных ГИСК им. Л.А. Тарасевича для производства вакцинных препаратов. Данная культура клеток является технологичным субстратом и пригодна для промышленного выпуска краснушной вакцины.

Выбор в качестве тканевого субстрата для получения вакцины против краснухи диплоидной линии клеток человека обусловлен следующим: полуперевиваемые (диплоидные) линии  клеток в стадии активного роста обладают стабильным кариотипом, легко культивируются, формируются в банки посевных и производственных клеток, позволяют получить конечный продукт с стандартизованными характеристиками; рекомендованы экспертами ВОЗ для производства МИБП, вводимых людям и используются для получения вакцинных препаратов.  Наиболее известная из них – диплоидная линия  фибробластов кожи и мышц эмбриона человека, штамм Wistar 38,  - является  субстратом для получения вакцины против краснухи, кори и ряда других вакцин.

Возможность использования диплоидной линии клеток «М-22» в производственных целях оценивали, согласно действующему нормативному документу, МУ «Аттестация перевиваемых клеточных линий – субстратов производства и контроля медицинских иммунобиологических препаратов» (М., 1989 г.), регламентирующему порядок аттестации и использования диплоидных линий клеток.

Учитывая ограниченный срок жизни диплоидных клеточных линий и разные периоды жизнедеятельности (становления, активного роста, старения), чувствительность линии «М-22» к вирусу оценивали в диапазоне 20 – 41 пассаж культуры клеток, то есть в диапазоне культивирования производственной культуры. Заражение проводили в стационарных условиях при МИ=0,01 ТЦД50/кл. Средние результаты шести  экспериментов представлены в таблице 2.

Таблица  2

  Чувствительность клеток  «М-22»  к штамму «Орлов-Д» в зависимости от

количества пассажей диплоидной линии

Количество пассажей куль-туры клеток «М-22»

Инфекционная активность вируса (lgТЦД50/0,5 мл) через … суток  после инфицирования

6

10

14

20

4,0

4,4

4,2

22

3,8

4,3

4,5

25

4,0

4,1

4,5

29

3,9

4,5

4,3

31

4,0

4,2

4,2

35

4,0

3,8

3,5

41

3,0

3,3

2,5

Эксперименты показали, что на протяжении минимум 15-ти последовательных пассажей (c 20-го по 35-ый) линия клеток «М-22» обеспечивает стабильный  уровень репродукции штамма  «Орлов-Д», что является важным критерием пригодности клеточной культуры для ее использования в производственных целях.

Принимая во внимание преимущество  использования единого тканевого субстрата для получения ассоциированных препаратов, и, в частности, трехкомпонентной вакцины корь-паротит-краснуха, была определена чувствительность диплоидной линии клеток «М-22» к вакцинным штаммам вируса кори Л-16 и вируса эпидемического паротита (ЭП),  Л-3. Средние показатели инфекционной активности, полученные в пяти наблюдениях, представлены в таблице 3. Полученные результаты свидетельствуют о чувствительности диплоидной линии клеток  «М-22» к репродукции обоих вакцинных штаммов. Стабильный уровень репродукции как вируса кори, так и вируса ЭП сохранялся в диапазоне с 20 по 35 пассаж культуры клеток.

Таблица 3

Чувствительность клеток  «М-22»  к вакцинным штаммам  вирусов кори  и ЭП

в  зависимости от количества  пассажей  диплоидной линии

Количество пассажей

Культуры клеток «М-22»

Инфекционная активность (lg ТЦД 50/0,5 мл) вакцинных штаммов вирусов

кори, Л-16

ЭП, Л-3

20

4,0

4,0

22

5,5

4,2

25

5,5

4,5

29

6,0

5,0

31

6,0

5,0

35

5,5

4,7

41

3,5

3,2

Поскольку применение диплоидных линий клеток в производстве МИБП основано на использовании банков клеток-продуцентов,  важным условием пригодности клеточного субстрата для производственных целей является устойчивость клеточных пулов к криоконсервации. Для оценки диплоидной линии клеток «М-22» по данному критерию, клетки 20, 23, 27 пассажа подвергались глубокому замораживанию при температуре – 70 о С. Биологические свойства  восстановленных после криоконсервации пулов  клеток оценивали по индексу пролиферации и уровню инфекционной активности штамма «Орлов-Д» в  клетках «М-22». Результаты экспериментов представлены  в таблице 4 и свидетельствуют о сохранении биологических свойств линии клеток в заданных условиях.

Таблица 4

Устойчивость диплоидной линии клеток «М-22» к криоконсервации

Количество пассажей

культуры клеток

Индекс пролиферации

Средняя инфекционная акти-

вность вируса (lgТЦД50/0,5 мл)

20

3

4,0

23

3

4,1

27

3

4,1

Для определения параметров репродукции штамма «Орлов-Д» в указанном тканевом субстрате  проводили сравнительное изучение динамики репродукции вируса краснухи в диплоидной культуре клеток «М-22» и первичной культуре клеток ППК при использовании  оптимальной МИ, равной 0,01  ТЦД50/клетка. Средние показатели репродукции вируса краснухи в указанных культурах клеток, представлены на рисунке 2.

       

Инфицирование вирусом краснухи клеток ППК характеризовалась выраженным цитодеструктивным действием  вируса на клетки, что завершалось круглоклеточной дегенерацией клеточного пласта через 15 -18 суток после заражения и снижением количества инфекционных вирусных частиц до концентрации 3,0 lg ТЦД50/0,5 мл.  Репродукция штамма «Орлов-Д» в культуре клеток «М-22» не сопровождалась лизисом клеток и характеризовалась более интенсивной динамикой накопления инфекционных вирусных частиц.  В период с 5-ых  по 18-ые сутки после инфицирования клеток  «М-22» каждые 2 – 3 суток удавалось получить полезные вирусные сборы с инфекционной активностью не менее 3,5 lg ТЦД50/0,5 мл.  В целом, ОВС, полученный при соединении в одну производственную емкость полезных вирусных сборов, при заражении культуры клеток «М-22» в два раза превышал соответствующий объем, полученный при использовании первичной культуры ППК при равном количестве зараженных клеток ППК и «М-22».  Характер репродукции вируса в клетках-продуцентах оказывал влияние на содержание белка в ВСЖ, полученной  с первичных и диплоидных клеток:  в ОВС, полученных при инфицировании  первичной клеточной культуре ППК, его количество  достигало 500 - 780 мкг/мл; при инфицировании  диплоидных клеток  «М-22» –  от 100  до 230 мкг/мл.

В условиях промышленного производство вакцины сохранение биологической активности вакцинного и производственного штамма на протяжении длительного периода времени имеет важное значение. Для определения устойчивости вариантов вакцинного штамма «Орлов» к условиям длительного хранения проводили контроль инфекционной активности лиофилизированных препаратов из штаммов «Орлов-В» и «Орлов-Д». Препараты хранили при температуре минус 20 о С в течение десяти (штамм «Орлов-Д») - тринадцати (штамм «Орлов-В») лет.  Инфекционную активность обоих вариантов штамма «Орлов» определяли ежегодно  титрованием 2 –3 ампул лиофилизированных препаратов в перевиваемой культуре клеток RK-13.

За время наблюдения не отмечали существенных (более чем на 0,5 lg ТЦД50/0,5мл) колебаний  инфекционной активности вирусов. 

Таким образом, чувствительность клеток «М-22» к полученному варианту штамма «Орлов» аналогична чувствительности клеток ППК, к которой был адаптирован исходный вирус; указанная диплоидная линия клеток способна поддерживать стабильный уровень инфекционной активности штамма «Орлов-Д» на протяжении не менее пятнадцати пассажей линии в фазе активного роста; клетки устойчивы  к криоконсервации. Характер репродукции штамма «Орлов-Д»  в клетках  «М-22» позволяет получить удвоенное количество полезных вирусных сборов с содержанием остаточного белка в конечном продукте в 4-5 раз меньшим, чем при использовании первичной культуры клеток. Полученный на диплоидной линии клеток «М-22» штамм  «Орлов-Д» характеризуется стабильными показателями инфекционной активности на протяжении 10 лет хранении при температуре – 20 о С (срок наблюдения). Клетки «М-22» поддерживают также репродукцию вирусов кори и эпидемического паротита. Наличие банка посевных клеток «М-22» и перечисленные выше факторы создают условия  для многолетнего производства препарата.

В целом, полученные результаты характеризуют диплоидную линию клеток «М-22»  как пригодную (по изученным параметрам) для использования в качестве тканевого субстрата в производстве моно- и ассоцированных вакцин для профилактики краснухи. 

ТРЕТЬЕ  ПОЛОЖЕНИЕ

Аттенуация штамма «Орлов» вируса краснухи в первичной культуре клеток ППК сопровождается  значимой мутацией в  структуре гена  Е1. В процессе многократного пассирования  штамма «Орлов-Д» в диплоидной культуре  клеток «М-22» сохраняется его генетическая  стабильность.

Учитывая, что  процесс производства живой вакцины предусматривает многократное культивирование вакцинного вируса в тканевом субстрате (вакцинный штамм производственный штамм посевной вирус серия вакцины),  контроль генетической стабильности аттенуированного вируса в  процессе культивирования в системе клеток-продуцентов - необходимый этап оценки его пригодности для использования в качестве вакцинного штамма.

Известно, что даже единичные пассажи вируса в иной системе хозяйских клеток могут привести к гиператтенуации или реверсии патогенных свойств  вакцинного штамма [Бойчук и др. 1968, Жилова и др. 1969].

Для понимания значимости тех или иных изменений вирусного генома при адаптации вируса к иной системе клеток хозяина, необходимо иметь сведения о том, какие именно нуклеотидные и аминокислотные замены приводят к изменению уровня вирулентности вируса для человека. Наиболее адекватной моделью для такого рода исследований являются так называемые «промежуточные варианты» вакцинных штаммов с документированным уровнем реактогенности для людей, полученные в ходе аттенуации исходных  вирусов.

При получении вакцинного штамма вируса краснухи «Орлов» клиническим испытаниям на волонтерах были подвергнуты шестнадцатый («Орлов»-16) и тридцать шестой пассаж вируса («Орлов»-36) в культуре клеток ППК. Первый из испытанных вариантов («Орлов»-16) вызывал 30% клинических реакций средней тяжести. Снижение реактогенных свойств штамма до допустимого нормативным документом уровня (2% клинических реакций средней тяжести)  было достигнуто проведением дополнительных 20 пассажей вируса в той же системе клеток [Мешалова и др., 1979]. Для определения генетических маркеров аттенуации штамма «Орлов» были использованы промежуточные варианты, полученные после проведения 14, 17, 23 пассажей выделенного от больного «дикого» вируса в первичной культуре клеток ППК и  вакцинный штамм «Орлов-В» (39 пассажей вируса в ППК). Из таблицы 5  видно, что в процессе аттенуации вируса, между 15 и 17, а также 18 и 23  пассажем  произошли незначимые  замены  нуклеотидного состава гена, кодирующего неструктурный белок NS1: С G. А  также, между  18 и 23 пассажем,  – значимые  замены в структуре гена Е1. Последнее событие привело к замене в структуре поверхностного белка Е1 (пятьдесят седьмой аминокислотный остаток) V I (валин на  изолейцин).

Таблица 5

Нуклеотидные и аминокислотные замены в структуры вириона вариантов вакцинного штамма вируса краснухи «Орлов»

№ нуклеотида

/ген

**AA

замены

№ пассажа штамма «Орлов» в культуре клеток

ППК /нуклеотидные замены

14

17

23

39

728MatPet1

  -

С

С

Т

Т

3854MatPet1

  -

 

С

Т

Т

Т

8419 Е1

V-I

С

С

Т

Т

9186 Е1

-

С

С

Т

Т

9342 Е1

-

С

С

G

  G

* порядковый номер нуклеотида в нуклеотидной последовательности гена определялся по референс-последовательности NC_001545; ** аминокислотное замещение в белке Е1

Полученные результаты свидетельствуют  о том, что замена в структуре белка Е1: валин изолейцин  (57  АА -остаток) привела к полной аттенуации реактогенного (30% клинических реакций средней тяжести) варианта вируса и получению ареактогенного вакцинного штамма «Орлов». Значимые замены нуклеотидов в процессе аттенуации штамма «Орлов» были определены только в гене, кодирующем поверхностный гликопротеин  Е1.  Исходя из этого, сравнение  двух вариантов штамма  «Орлов» - вакцинного штамма «Орлов-В» и штамма «Орлов-Д»  - было проведено  по нуклеотидной последовательности гена Е1. В анализе использован штамм «Орлов-Д» после проведения пяти дополнительных пассажей в культуре клеток «М-22», т.к., согласно рекомендациям ВОЗ, культивирование вируса от вакцинного штамма до серии вакцины не должно  превышать пяти пассажей  в клетках-продуцентах [WHO. Technical Report Series, 1988].

При  секвенировании амплификатов, полученных в результате фланкирования нуклеотидной последовательности гена Е1 (1443 п.о.), была выявлена полная идентичность нуклеотидных последовательностей обоих вариантов. Генетическая стабильность штамма «Орлов-Д» при многократном (не менее 5 пассажей) культивировании в диплоидной линии клеток «М-22»  была подтверждена также стабильным rct40 ±- фенотипом штамма «Орлов-Д» на уровне 1-го, 5-го и 10-го пассажа вируса в культуре  клеток  «М-22». 

Полученные результаты характеризует штамм «Орлов-Д»  как генетически стабильный и пригодный для производства вакцины.

ЧЕТВЕРТОЕ ПОЛОЖЕНИЕ

Доклиническое изучение штамма «Орлов-Д» на обезьянах макака-резус специфической  безопасности, специфической  активности и иммунологической безопасности свидетельствует о его пригодности для получения вакцины против краснухи.

Доклиническое изучение штамма «Орлов-Д» проведено на базе ГУН НИИ медицинской приматологии РАМН, г. Адлер-Сочи. Методология проведения доклинических испытаний новых МИБП представлена в нормативном документе «Государственные испытания и регистрация новых иммунобиологических препаратов» (СП 3.3.2.561 – 96)  и использована в данном разделе исследования. Выбор в качестве лабораторной модели макаков-резусов обусловлен тем, что приматы и, в частности, низшие приматы – единственный вид лабораторных животных, у которых можно моделировать инфекционный процесс, вызванный вирусом краснухи, сходный с таковым у человека по показателям продолжительности инкубационного периода и вирусовыделения, наличия вирусемии, динамики формирования вирусспецифических антител. В исследовании использованы клинически здоровые животные в  возрасте 3-5 лет, массой 4 – 5 кг, самцы. Перед началом эксперимента  обезьяны были выделены из стада, изолированы, обследованы на отсутствие заболеваний вирусными гепатитами, SIV-инфекцией герпетическими инфекциями, туберкулезом;  карантинированы в течение 45 суток.

Согласно  СП 3.3.2.561 –96, (п. 5.1.7.) в опыте использованы препараты сравнения однонаправленного действия: краснушная вакцина Rudivax (производства  Санофи-Пастер, Франция), действующее начало препарата – вакцинный штамм Wistar RA27/3 и отечественный вакцинный штамм вируса краснухи «Орлов-В».

Исследование штамма «Орлов-Д» включало определение: специфической безопасности (определение остаточной нейровирулентности, контагиозности); специфической активности (определение иммуногенной и протективной активности); иммунологической безопасности.

Для контроля остаточной нейровирулентности в опыте были использованы 10 серонегативных к краснухе обезьян, каждая из которых была заражена одним из трех препаратов: штаммом «Орлов-Д» – обезьяны №№ 33639, 33551, 33669, 33211; № 33421; штаммом «Орлов-В» – обезьяны №№ 33364, 33213, 33736, 33830; штаммом Wistar RA27/3 (в составе вакцины Rudivax) – обезьяна № 33776. Заражение, вскрытие, морфологическое и гистологическое исследование органов и тканей обезьян проведено проф. Л.А. Яковлевой.

Исследуемый материал вводили интрацеребрально в область зрительных бугров обоих полушарий головного мозга. По окончании периода клинического наблюдения у животных брали образцы крови для определения антител к вирусу краснухи, после чего животных умерщвляли под глубоким гексеналовым наркозом, производили аутопсию и гистологическое исследование тканей ЦНС, региональных лимфатических узлов, легкого, печени, селезенки

На протяжении периода клинического наблюдения у инфицированных животных ни в одном случае не отмечали пареза конечностей, нарушения  типичных движений (прыжки, лазанье, захват предметов),  координации; не отмечали также патологических реакций на внешние раздражители, каких-либо других нарушений со стороны ЦНС, нарушения аппетита и сна.  При пальпировании мышц конечностей в спокойном состоянии и при сгибании-разгибании ни в одном случае не отмечали нарушения  мышечного тонуса. Тремор и  гиперкинезы не регистрировали.

Морфологическое исследование. На вскрытии мозговых оболочек, а также ткани головного и спинного мозга с поверхности и на разрезе, как и при осмотре серозных полостей и внутренних органов грудной и брюшной полости, никаких патологических изменений  обнаружено не было. Также не было обнаружено заметных следов в области трепанации черепа, за исключением одного случая (макак № 33830), в котором в теменной области правой половины имелось припаивание оболочек мозга к внутреннему апоневрозу черепа.

Гистологическое  исследование включало в себя исследование тканей: головного мозга  – передняя центральная извилина, задняя центральная извилина, зрительный бугор, продолговатый мозг; спинного мозга – шейное и поясничное утолщение. А также лимфатических узлов: затылочных задне- шейных, подчелюстных. Тканей легкого, печени, селезенки.

В тканях головного и спинного мозга патологических изменений в нейронах и глиальных клетках в исследованных областях выявлено не было. Нервные клетки имели четкие контуры, светлое пузырьковидное ядро с крупной центрально расположенной нуклеолой и отчетливые глыбки нисслевского вещества в цитоплазме. В нервной ткани головного и спинного мозга, а также в их оболочках каких-либо признаков воспаления или гиперемии не обнаружено. У половины животных (№№ 33830,  33551, 33211, 33639, 33736)  были обнаружены признаки умеренной активации подчелюстных лимфатических узлов, а также ткани селезенки (№№ 33669, 33830, 33551, 33213, 33736), в основном в В-клеточном звене (увеличение размеров и количества лимфоидных фолликулов; преобладание бластных элементов – центробластов и иммунобластов и увеличение количества митозов). В тканях печени и легкого ни в одном случае никаких патологических изменений не обнаружено.

При исследовании сывороток крови обезьян в РТГА с 4 ГАЕ краснушного антигенного диагностикума  было установлено, что у всех обезьян, зараженных  вакцинными штаммами вируса краснухи, через 30 суток после инфицирования, определялись вирусспецифические антитела в титрах  от 1:160 до 1 : 1280.

Исходя из критериев, изложенных в нормативном документе, а именно: отсутствие  у всех подопытных животных клинических проявлений поражения ЦНС; отсутствие  вирусспецифических поражений нейронов и глиальных клеток при гистологическом исследовании тканей головного и спинного мозга; выработка вирусспецифических АТ  не менее чем у 80% интрацеребрально зараженных животных, и  на основании полученных результатов, можно сделать заключение об отсутствии остаточной нейровирулентности штамма вируса краснухи «Орлов-Д». Аналогичные результаты получены в отношении препаратов сравнения. Образование вирусспецифических антител  у 100%  интрацеребрально зараженных животных, подтверждает факт их инфицирования штаммами вируса краснухи.

Иммуногенную  активность штамма «Орлов-Д» оценивали по двум показателям: количеству сероконверсий и напряженности  поствакцинального иммунитета в ответ на однократную иммунизацию вакцинным препаратом в дозе, составляющей  не менее одной прививочной дозы для человека, то есть не менее 1000 ТЦД50. Параллельно проводили контроль контагиозных свойств исследуемого вируса.

В опыте были использованы 23 серонегативных к краснухе обезьяны, разделенные на три группы, каждая из которых была иммунизирована: препаратом из штамма «Орлов-Д» - 12 обезьян (№№ 34411, 36481, 34455, 34766, 36157, 34654, 35108, 35095, 34815, 34057; 32834, 32937); препаратом из штамма «Орлов-В» - 4 обезьяны (№№ 33385, 33309, 32923, 33238); вакциной Rudivax (Wistar RA27/3)  – 3 обезьяны ( №№ 33719, 33730, 34469). Для контроля контагиозности штамма «Орлов-Д» были использованы 3 серонегативные обезьяны, каждая из которых на протяжении 28 суток наблюдения  находилась в одной клетке с привитым животным.

В ходе  эксперимента установлено, что  однократная иммунизация  сопровождалась 100% сероконверсией. В то же время, по окончании периода наблюдения (28 суток) в сыворотке крови контактных  животных специфические антитела не определялись,  что свидетельствует об утрате контагиозных свойств  штаммом «Орлов-Д». Напряженность иммунитета во всех трех группах привитых животных  характеризовалась высокими показателями: титры антигемагглютининов  регистрировали на уровне  1: 160 и выше. При этом СГТ  АТ во всех трех группах привитых практически совпадала (таблица 6).

Таблица 6

Показатели напряженности иммунитета у животных, привитых вакцинными штаммами вируса краснухи

Вводимый материал

Инфекционная

активность препарата

СГТ титров АТ  в

обратных величинах/lg2

«Орлов-Д»

3,5 lg ТЦД50/0,5 мл 

1: 388 / 8,57

«Орлов-В»

3,3 ТЦД50/0,5 мл 

1: 362 / 8,49

Wistar RA27/3

4,1 ТЦД50/0,5 мл 

1: 388 / 8,57

У 5 привитых животных удалось оценить поствакцинальный иммунитет спустя 4 года после иммунизации (период наблюдения). Уровень антигемаггютининов составлял, в основном, 1: 80, (в одном случае 1:40) и существенно превышал защитный титр антител (1 : 20).

Протективную активность  определяли в группе из 13 животных, иммунизированных: штаммом «Орлов-Д» – 8 макаков (№№  34411, 36481, 34455, 34815, 34654, 35108, 35095, 36157); штаммом «Орлов-В» – 2 макака (№№ 33385, 33309); штаммом Wistar RA 27/3 (в составе вакцины Rudivax) – 3 макака (№№ 33719, 33730, 34469). Группу контроля составили 6 серонегативных к краснухе животных, которым патогенный штамм вводили по той же схеме, что и иммунизированным обезьянам. Поскольку низшие приматы переносят краснушную инфекцию в бессимптомной форме, наличие инфекционного процесса определяли по развитию у зараженных животных вирусемии, которую регистрировали в ПЦР в интервале от 4 до 24 суток после инфицирования.  Результаты представлены в таблице 7 и свидетельствуют о том, что иммунизация как штаммом «Орлов-Д», так и препаратами  сравнения защитила животных от проникновения  вируса  в кровяное русло; в то время как в контрольной группе  обезьян в ответ на  заражение патогенным штаммом “Лебедев”  в 100% случаев в период с 4-7 по 17-20 сутки  регистрировалась вирусемия, что свидетельствует о развитии краснушной инфекции.

Таблица 7

Выявление РНК вируса краснухи (в ПЦР) в сыворотке крови обезьян после заражения патогенным штаммом вируса

Коли-

чество

обезьян

(номер)

Вакцин-ный

штамм

Наличие  РНК* вируса в сыворотке крови через …

суток  после заражения патогенным штаммом вируса краснухи

4

7

11

14

17

20

  24

2

Орлов-В

-

-

-

-

-

-

-

8

Орлов-Д

-

-

-

-

-

-

-

3

RA27/3

-

-

-

-

-

-

-

1/34089

н/и**

±

±

+

+

+

+

-

1/33559

н/и

-

+

+

+

±

-

-

1/32763

н/и

-

+

+

+

±

±

-

1/32985

н/и

±

+

+

+

± 

±

-

1/35595

н/и

-

+

+

+

+

+

  -

1/35194

н/и

±

±

+

+

+

-

  -

*  « + »  более 1000 копий /мл; « ± »  100 – 1000 копий /мл; « - » менее 100 копий /мл

** - не иммунизировали

В целом, полученные результаты характеризуют штамм «Орлов-Д» как аттенуированный вирус с высокой специфической активностью, не менее выраженной, чем у препаратов сравнения – вакцинных штаммов  Wistar RА27/3 и «Орлов-В».

Определение иммунологической  безопасности  штамма проводили, контролируя  изменения в системе иммунокомпетентных клеток иммунизированных животных. Согласно  нормативному документу, неспецифическое влияние вакцинного препарата на иммунную систему должно удовлетворять следующим требованиям:

- продолжительность изменений иммунологических показателей не должна превышать 45 дней с момента введения вакцины;

- изменение величины показателя численности и функциональной активности иммунокомпетентных клеток не должны отличаться более чем в 1,5 раза от исходных показателей  и  аналогичного показателя в группе, получавшей плацебо и обследованной в те же сроки (СП  3.3.2.561 – 96, п. 12.2.4.).        

Влияние иммунизации на факторы клеточного иммунитета  и уровень ИНФ изучали в группе из 9 животных:  5 -  привитых штаммом «Орлов-Д» (№№ 34455, 35108, 35095, 34411, 36157); 2 –  штаммом Wistar RA 27/3 (№№ 34469, 34467); 2 – контрольные  обезьяны: №№ 36481, 34766 (группа плацебо).

Количественные характеристики CD-антигенов (АГ) подсчитывали до иммунизации, через 7, 14, 28 и 45 суток после  введения препаратов. Значительные колебания исходных величин каждой субпопуляции лимфоцитов у опытных и контрольных животных не позволили провести статистическую обработку результатов. Тем не менее,  спустя  7 – 28  суток после иммунизации у всех привитых животных определилась тенденция к активации натуральных киллеров (CD-16); маркеров В-клеточного звена иммунитета (CD-19, CD-22),  ответственных за выработку  специфических  антител; маркеров молекул ГКГ (HLA-DR). Так, в отдельных случаях количество натуральных киллеров (CD-16) повышалось в 3 – 4 раза (№№ 34467, 34469), количество  CD-19 АГ превышало исходные показатели в 8 раз  (№ 35095), CD-22 – в  10 раз (№ 34411), HLA-DR – в 4-6 раз (№№ 34455, 34411, 34467, 34469). Что касается маркеров молекул Т-клеточного звена иммунитета, то первичная встреча с вирусным антигеном не оказала существенного влияния на уровень Т-лимфоцитов, но привела,  по-видимому, к премированию Т-клеток, о чем можно судить по активации маркеров молекул  ГКГ (HLA-DR), принимающих участие в этом процессе. Через 45 суток после иммунизации количественные показатели активности иммунокомпетентных клеток возвращались к исходным величинам и не отличались от них более чем в 1,5 раза. ИФН-статус определяли регистрацией уровня -ИФН, - ИФН. Уровень цитокинов контролировали до иммунизации,  через 14 и  28 суток после нее. Через 14 суток после вакцинации у всех иммунизированных животных, включая обезьян, получивших препарат сравнения,  отмечали не продолжительное 4-8- кратное снижении уровня - и -ИФН.  Исходный их уровень восстанавливался к 28 суткам  после введения препарата.

Иммунологические сдвиги в системе врожденного иммунитета в контрольной группе не иммунизированных обезьян не наблюдались.

В целом, результаты свидетельствуют о иммунологической безопасности штамма «Орлов-Д».

Таким образом, доклиническое изучение полученного в ходе работы аттенуированного вируса краснухи показало (в пределах использованных методов), что по отсутствию остаточной нейровирулентности для приматов; высокой специфической активности, отсутствию контагиозности; иммунологической безопасности, не уступающим по вышеозначенным критериям  препаратам сравнения, штамм  «Орлов-Д»  пригоден для получения на его основе вакцины против краснухи.

ВЫВОДЫ

       1. Сравнительный филогенетический анализ современных изолятов вируса краснухи, циркулирующих на территории Пермского края, вакцинных штаммов «Орлов-В», Wistar RA27/3  и четырех  штаммов вируса краснухи, выделенных на других территориях  России в 1967- 97 г.г. показал, что российские штаммы относятся к одной генетической  группе и идентифицированы как вирусы  генотипа 2с; вакцинный штамм  Wistar RA27/3  относится к вирусам Rubella  1 генетической линии. Установлено более тесное генетическое родство между российскими изолятами и штаммом «Орлов-В» по отношению к штамму Wistar RA27/3: индекс генетической  близости составляет  0,74 и  0,99, соответственно.

2. Массовая иммунизация против краснухи детей 1-2 года жизни,  проведенная на территории  Пермского края вакциной Rudivax (действующее начало – вакцинный штамм Wistar RA27/3) оказала влияние на биологический фактор эпидемического процесса.  Создание коллективного иммунитета в группе детей младшего  возраста  при пороге  привитости, равном  460,0 на 1000 детского населения в течение четырех лет  применения вакцины вызвало достоверное увеличение  генетической  дивергенции  изолятов вируса краснухи (коэффициент корреляции r = 0,76; t = 4,58; р<0,01) с 1,15%  (2000 – 2002 гг.) до 3,14 % ( 2004 – 2005 гг.) (р<005).

3. Диплоидные линии клеток фибробластов легкого, почек, кожно-мышечного лоскута эмбриона человека обеспечивают репродукцию вируса краснухи.  Чувствительность диплоидной линии клеток кожно-мышечного лоскута эмбриона человека «М-22» к вакцинному штамму «Орлов-В»  соответствует чувствительности первичной культуры клеток ППК, к которой  адаптирован указанный штамм. Средние показатели инфекционной активности вируса  в  первичной (ППК) и диплоидной  («М-22») культурах клеток составляют 3,9 lg ТЦД50/мл  и  4,2  ТЦД50/мл,  соответственно.

4.  Проведением одного  дополнительного пассажа штамма «Орлов-В» в диплоидной линии  клеток «М-22» получен аттенуированный штамм  вируса краснухи «Орлов-Д». Репродукция штамма «Орлов-Д» не требует  адаптации  вируса к данному  тканевому  субстрату: инфекционную активность, равную 4,0 – 4,2 lg ТЦД50/мл, стабильный rct40 ± фенотип регистрировали с первого по десятый пассаж  вируса в указанной культуре клеток.

5. Сравнительный генетический анализ штаммов Wistar RA27/3 и «Орлов-Д» выявил, что доля нуклеотидных замен в структуре гена Е1 исследованных штаммов составляет 6,7 %. При этом 34,3 % из них является значимыми, обуславливают различия в структуре поверхностного глико-протеина Е1. Наиболее важным различием между штаммами является замена в положении 208  аминокислоты  тирозин (штамм «Орлов-Д»)  на гистидин (штамм Wistar RA 27/3) в высоко консервативном участке молекулы Е1.

6. Диплоидная  линия клеток «М-22»  - тканевой субстрат, не требующий специальных условий  культивирования, устойчива  к  криоконсервации; характеризуется стабильной  чувствительностью к вирусу краснухи на протяжении  длительного периода жизнедеятельности клеток  в фазе их активного  роста ( 20 - 35 пассаж линии клеток).  Линия «М-22» поддерживает также репродукцию вакцинных штаммов вируса кори Л-16 (4,0-6,0 lg ТЦД50/0,5 мл) и вируса эпидемического паротита Л-3 (4,0 -5,0 lg ТЦД50/0,5 мл).

7.  Репродукция штамма «Орлов-Д» в диплоидной линии клеток «М-22» не сопровождается цитодеструктивным действием вируса на клетки, характеризуется более интенсивной динамикой формирования инфекционных вирусных частиц по отношению к его репродукции в первичной культуре клеток ППК. Указанные особенности позволяют получить удвоенный объем вакцинного препарата с более низким содержанием белка (100 - 230 мкг/мл) по сравнению с препаратом, полученном на первичных клетках ППК (500-780 мкг/мл) при равном  количестве инфицированных клеток. Лиофилизированный  штамм  «Орлов-Д»  характеризуется  стабильной биологической  активностью (3,4 – 3,8 lg ТЦД50/0,5 мл)  в  условиях хранения при температуре  –  20о С  на  протяжении 10 лет  наблюдения. Это обстоятельство, а также наличие банка посевных клеток «М - 22» может обеспечить многолетнюю потребность в вакцине против краснухи на территории  РФ.

8. Снижение реактогенности  штамма  «Орлов»  с 30% до 2% клинических  реакций средней тяжести в процессе аттенуации вируса в первичной культуре клеток ППК сопровождается заменой в положении 57 белка Е1 аминокислоты валин на изолейцин. Штамм «Орлов-Д» характеризуются  стабильностью структуры  гена Е1 при культивировании в культуре клеток  «М-22»  на  протяжении  минимум  5  пассажей вируса в указанной линии  клеток.

9. В доклиническом изучении на обезьянах макака-резус установлено,  что  штамм «Орлов-Д не обладает остаточной нейровирулентностью,  контагиозностью  и по параметрам специфической безопасности  соответствует  требованиям, предъявляемым к штаммам для живых противовирусных вакцин.

10.  Однократное введение серонегативным к краснухе обезьянам макака-резус препарата из  штамма  «Орлов-Д» с инфекционной активностью 1000 ТЦД 50/0,5 мл вызывает 100% сероконверсии и  формирование вирусспецифических антител в высоких титрах (в РТГА  1 : 160 - 1 : 1280 ). Препарат из штамма «Орлов-Д» обладает  протективностью, защищает иммунизированных животных от заражения патогенным вирусом краснухи (штамм «Лебедев»); характеризуется  иммунологической безопасностью: продолжительность изменения активности иммунокомпетентных клеток и интерферонового статуса под влиянием вакцинации не превышает 45 суток после введения препарата. По изученным параметрам  штамм «Орлов-Д» не уступает препаратам сравнения - вакцинным штаммам вируса краснухи «Орлов-В» и Wistar RA27/3.

11.  Полученные результаты свидетельствуют о возможности получения живой аттенуированной вакцины против  краснухи на  основе штамма «Орлов-Д» и  диплоидной  линии клеток «М- 22» и  целесообразности ее применения на территории с эндемичной  циркуляцией вируса краснухи генотипа 2с.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

1.  Вакцинопрофилактика краснухи/ И.Н. Лаврентьева //  Журнал микробиологии, эпидемиологии и иммунобиологии. - 1996. - № 1. –  С. 37 –  45.

2. Этиология  и  профилактика краснухи / И. Н.  Лаврентьева  //  Краснуха.

Синдром Врожденной краснухи. Информационный сборник  Pasteur Merieux  Connaught. –  М. – СПб., 1997. –  С. 5 – 17.

3.  Вакцинопрофилактика  краснухи. Анализ зарубежного опыта / И.Н. Лаврентьева  // Матер. VII съезда всероссийского науч.-практ. общества эпидемиологов, микробиологов и паразитологов. – М.,  1997. – С. 104 -105.

4.Усовершенствование методов определения биологической активности вирусов кори, паротита и краснухи в моно- и ассоциированных препаратах / И.Н. Лаврентьева, Л.Ю. Тарос, Л.П. Сухобаевская, Е.А. Николаева // Матер.VII Съезда всероссийского науч.-практ. общества эпидемиологов, микробиологов  и паразитологов – М.,1997.- С. 105 –  106.

5.  Характеристика альтернативной клеточной культуры для производства моно- и ассоциированных вакцин против детских вирусных инфекций / И.Н.  Лаврентьева, Л.П. Сухобаевская, Л.Ю. Тарос, Н.Б. Румель // Матер. VII   съезда всероссийского науч.-практ.общества эпидемиологов, микробиологов и паразитологов. – М.,1997. – С. 106 –  107.

6. Краснуха в России: стратегия и тактика вакцинации / В.В. Семериков, Л.И Мельчукова, А.Я. Колобов, В.Ф. Попов, И.Н. Лаврентьева // Матер. VII съезда всероссийского науч.-практ. общества эпидемиологов, микробиологов  и паразитологов. – М., 1997. – С. 139 – 140.

7. Эпидемиологический надзор за краснухой в Санкт-Петербурге /А.А.  Соболевская,  О. В. Парков, И.Н. Лаврентьева,  В, П. Рыбков, С.С. Вашукова / Идеи Пастера в борьбе с инфекциями: Матер. II Междунар. конфер. – СПб., 1998. –  С. 25.

8. Изучение чувствительности диплоидных линий клеток человека к вирусам кори, паротита и краснухи для совершенствования технологии производства детских противовирусных вакцин / И.Н. Лаврентьева,  Л.П. Сухобаевская, Л.Ю. Тарос, Н.Б. Румель, Л.Ф. Литвинчук //Идеи Пастера в борьбе с инфекциями: матер. II  Междунар. конфер. – СПб., 1998. –  С. 49.

9. Разработка отечественной вакцины против краснухи / И.Н. Лаврентьева  //  вирусные  инфекции на пороге XXI века: эпидемиология и профилактика: Матер. науч. конфер. с международ. участием, посвященной 200-летию ВМА. – СПб., 1999. – С. 223.

10.  Вакцинопрофилактика краснухи. Стратегия и тактика/ И.Н. Лаврентьева, В.В. Семериков // Вакцинопрофилактика в XXI веке: матер. науч-прак. конф. Западно- Уральского региона. – Пермь, 2000 г. –  С. 35 – 37.

11. Rubella in Russian Federation epidemiological feature and control measures to prevent  the  Congenetal rubella syndrome / V.V. Semericov, I.N. Lavrentyeva, V.F. Popov // Epidemiol. infect. – 2000. – v. 125. –  359 – 366 p.

12. Эпидемиологический надзор и контроль за краснушной инфекцией / В.В. Семериков, И.Н. Лаврентьева // Достижения отечественной эпидемиологии в XX  веке. Взгляд в будущее: матер. науч. конференции, посвященной 80-летию академика  В.Д.Белякова. –  СПб., 2001. – С. 92 –  93.

13. Краснуха / В.В Семериков, И.Н. Лаврентьева, В.К. Таточенко, Л.Л. Нисевич,  И.В.  Фельдблюм. – Пермь - СПб- М., 2002. – 175 с.

14. О перспективах развития вакцинопрофилактики краснухи /В.В. Семериков, И.Н. Лаврентьева,  И.В. Фельдблюм // Ликвидация и элиминация инфекционных болезней - прогресс и проблемы: Матер. 3-ей международ. конф., посвященной 80-летию института имени Пастера. – СПб., 2003 г. – С. 34.

15.  Штаммы вируса краснухи для живой аттенуированной вакцины / И.Н.  Лаврентьева, Л.П. Сухобаевская, В.З. Агрба, Л.А. Яковлева, Ю.А. Радюкевич,  А.Б. Жебрун // Эпидемиология и вакцинопрофилактика.- 2003. - № 4.- С.  7 - 10.

16.  Краснуха: Направления эпидемиологического надзора и профилактики/ В.В. Семериков, И.Н. Лаврентьева, И.В. Фельдблюм // Актуальные вопросы вакцинно-сывороточного дела в XXI веке: Матер. Всерос. науч. конф.,  посвященной 105-летию Пермского НПО «Биомед».- Пермь., 2003 г.- С.73 – 76.

17.  Результаты доклинического изучения  вариантов вакцинного штамма  вируса краснухи «Орлов» для получения живой аттенуированной вакцины  /

И. Н. Лаврентьева, Л.А. Яковлева, В.В. Семериков // Пермский медицинский журнал. –  2005. - № 1. – С.  78 – 81.

18. Актуальные вопросы и перспективы специфической профилактики краснухи в России/ И.Н. Лаврентьева, Л.П. Сухобаевская, А.Б. Жебрун // Теоретические и практические аспекты элиминации кори: сб. научных трудов к 145-летию со дня рождения Г.Н. Габричевского. –  М., 2005. – С. 61 – 65.

19. Обезьяны макака-резус как модель для доклинического изучения вакцинных штаммов вируса краснухи/ И.Н. Лаврентьева, А.Б. Жебрун, В.З. Агрба, Л.А. Яковлева // Перспективные направления использования лабораторных приматов в медико-биологических исследованиях: Матер. Всерос. науч. конф. – Сочи-Адлер, 2006. –  С. 38 –  43.

20Доклиническое изучение вариантов вакцинного штамма вируса краснухи «Орлов» / И.Н. Лаврентьева, Л.П. Сухобаевская, В.З. Агрба, Л.А. Яковлева, А.В. Семенов //  Биопрепараты. – 2006. - № 1. – С. 19 – 22.

21. Laboratoire des infections  infantiles  virales  /  I.  Lavrenieva,  L. Soukhobaevskaya, A. Antipova / Rapport D’Active des departments de recherch en 2006 – 2007. – Institut Pasteur de Saint-Peterbourg., 2007. – P. 43 – 47. 

22.  Доклиническое изучение вакцинных штаммов вируса краснухи / И.Н.  Лаврентьева, Л.П. Сухобаевская, В.З. Агрба, Л.А. Яковлева, А. Б. Жебрун // Итоги и перспективы  обеспечения эпидемического благополучия населения российской Федерации: материалы IX съезда Всерос. научно-практического общества  эпидемиологов, микробиологов и  паразитологов. – М., Санэпидемиа.,  2007. – Т.2.  –  С. 151 –  152.

23Влияние иммунизации против краснухи на формирование специфических и  неспецифических факторов иммунитета в опыте на обезьянах макака-резус / И.Н. Лаврентьева, А.Б.Жебрун, Л.П. Сухобаевская, В.З. Агрба, Д.Д. Карал-Оглы // Фундаментальные и прикладные  проблемы  медицины и биологии в опытах на  обезьянах: Материалы междунар.  научн. конф. - Сочи – Адлер, 2007. –  С.86  – 94.

24. Генетическая характеристика вируса краснухи в период вакцинопрофилактики/ И. Н. Лаврентьева, В. В. Семериков// в кн.: Инфекционная заболеваемость в Северо- Западном федеральном округе России. Закономерности и особенности  эпидемического  процесса в  современный период. –  СПб., 2007. –  С. 33 – 37.

25. Молекулярно-биологические механизмы аттенуации вируса краснухи / И.Н. Лаврентьева, А.В. Марков // Вестник Российской военно-медицинской академии. –  2008. -  №2. – С. 112 – 113.

26. Краснуха в России: изменчивость возбудителя в период вакцинопрофилактики инфекции /И.Н. Лаврентьева, В.В. Cемериков, А.Б. Жебрун, И.В. Фельдблюм,  А.В. Марков // Журнал микробиологии, эпидемиологии и иммунобиологии. – 2008. - № 3. – С. 26 – 31.

27. Молекулярно-биологические свойства аттенуированных штаммов вируса  краснухи / И.Н. Лаврентьева // Журнал микробиологии, эпидемиологии и иммунобиологии. – 2008. - № 4. – С. 55 – 59

28Поствакцинальный иммунитет при иммунизации против краснухи штаммом Орлов-Д» в эксперименте / И.Н. Лаврентьева, В.В. Семериков, В.З. Агрба, Л.П. Сухобаевская, А.Ю. Антипова // Пермский медицинский журнал. – Пермь. -  2008. -  №  4. – С. 68 – 75.

29. Генетические маркеры аттенуации вируса краснухи / И.Н. Лаврентьева, А.В. Марков, Л.П. Сухобаевская, А.Ю. Антипова // Идеи Пастера в борьбе с инфекциями: Матер. IV-ой  Междунар.  конф. Института им.  Пастера. – СПб., 2008. – С. 17.

30.  Генетическая стабильность вируса краснухи при адаптации к новой системе клеток / И.Н. Лаврентьева, А.В. Марков, Л.П. Сухобаевская, А.М. Мартынова // Идеи Пастера в борьбе с инфекциями: Матер. IV-ой Международ. конф. Института им. Пастера. – СПб., 2008.  – С. 18.

31Изменчивость возбудителя краснухи в период вакцинопрофилактики краснушной инфекции / В.В. Семериков, И.Н. Лаврентьева, А.В. Марков // Создание и перспективы применения медицинских иммунобиологических препаратов: Материалы Всеросс. науч.-практ. Конф., посвященной 110-летию филиала ФГУП «НПО Микроген» «Пермское научно-производственное объединение «Биомед». – Пермь, 2008. – С. 46 – 48.

Автор выражает глубокую признательность научному консультанту, доктору медицинских наук, члену-корреспонденту РАМН, профессору А.Б. Жебруну за идею настоящей работы. Глубокую благодарность  рецензентам – доктору медицинских наук, профессору С.Л. Мукомолову, доктору медицинских наук А.Ж. Василенко. Сердечная благодарность  - руководителю лаборатории клеточных культур ГУ ИПВЭ им. М. П. Чумакова, доктору медицинских наук, профессору Л.Л. Мироновой.  Особую признательность – директору НИИМП, академику РАМН Б.А. Лапину и сотрудникам института: доктору медицинских наук, профессору В. З. Агрба, доктору медицинских наук, профессору Л.А. Яковлевой. Автор благодарит также зав. кафедрой эпидемиологии Пермской медицинской академии им. Вагнера, доктора медицинских наук, профессора И. В. Фельдблюм, главного эпидемиолога-эксперта ФГУЗ «Центр гигиены и эпидемиологии в Пермском крае», доктора медицинских наук В.В. Семерикова; заместителя директора по инновационным проектам Санкт-Петербургского диагностического центра ООО НПФ «Хеликс», А.В.Маркова, заместителя главного врача клиники ФГУН НИИДИ ФМБА, кандидата биологических наук А. В. Семенова. Особая благодарность – сотрудникам лаборатории детских вирусных инфекций ФГУН «НИИЭМ имени Пастера»  Роспотребнадзора.

  СПИСОК СОКРАЩЕНИЙ

BHK-21 – перевиваемая культура клеток почки сирийский хомяка

С – цитозин

G – гуанин

L – 41 – перевиваемая  культура клеток костного мозга человека, больного лейкемией

RK-13 – перевиваемая культура клеток почки кролика

Vero  - перевиваемая культура клеток почки зеленой мартышки

T – тимин

АГ – антиген

АТ - антитело

ВОЗ – Всемирная организация здравоохранения

ВСЖ – вируссодержащая жидкость

ВБН – вирус болезни Ньюкасла

ВВС – вирус везикулярного стоматита

ВЭМ – вирус  энцефаломиокардита мышей

ГИСК – Государственный институт стандартизации и контроля

ГКМВ – Государственная коллекция музейных вирусов

ДКЛЧ – диплоидные клетки фибробластов легкого эмбриона человека

ДКПЧ – диплоидные клетки фибробластов почки эмбриона человека

ИНФ – интерферон

МИ – множественность инфицирования

МИБП – медицинские иммунобиологические препараты

МУ – методические указания

НИИЭМ – научно исследовательский институт эпидемиологии и микробиологии

НИИМП – научно-исследовательский институт медицинской приматологии

ОВС – объединенный вирусный сбор

П.о – пара оснований

ППК – первично-трипсинизированная культура клеток почки кролика

ПЦР – полимеразная цепная реакция

РТГА – реакция торможения гемагглютинации

СПЭВ – перевиваемая культура клеток почки свиньи

ТЦД50 – пятидесятипроцентная тканевая цитопатогенная доза

ЦНС – центральная нервная система

ЦПД – цитопатогенное действие




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.