WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

БАРЛЕВ Николай Анатольевич

РОЛЬ САЙТ-СПЕЦИФИЧЕСКОГО АЦЕТИЛИРОВАНИЯ И МЕТИЛИРОВАНИЯ В РЕГУЛЯЦИИ ОНКОСУПРЕССОРА Р53 У ЧЕЛОВЕКА

03.00.25 - гистология, цитология, клеточная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени доктора биологических наук

Санкт-Петербург 2009

Работа выполнена в Учреждении Российской академии наук Институт цитологии РАН

Официальные оппоненты: доктор биологических наук, профессор, член-корреспондент РАН, Петр Михайлович Чумаков, Институт молекулярной биологии им.

В.А. Энгельгардта, РАН, Москва доктор медицинских наук, профессор, Евгений Наумович Имянитов, НИИ онкологии им. проф. Петрова, МЗ РФ, Санкт-Петербург доктор биологических наук, профессор, Валерий Анатольевич Поспелов, Институт цитологии РАН, Санкт-Петербург

Ведущая организация: НИИ канцерогенеза ГУ РОНЦ им. Н.Н, Блохина РАМН, Москва

Защита состоится «04» декабря 2009 года в 14 часов на заседании Диссертационного совета Д.002.230.01 при Институте цитологии РАН по адресу: 194064, Санкт-Петербург, Тихорецкий пр., д. Сайт института: www.cytspb.rssi.ru Адрес электронной почты института: cellbio@mail.cytspb.rssi.ru Факс института (812) 297-03

С диссертацией можно ознакомиться в библиотеке Института цитологии РАН.

Реферат разослан «___» ноября 2009 г.

Ученый секретарь Диссертационного совета, Кандидат биологических наук Е.В. Каминская

Общая характеристика работы

Актуальность исследования. За последние 10-15 лет достигнут существенный прогресс в понимании этиологии и механизмов раковых заболеваний. Бесконтрольный рост клеток часто связан с потерей функции определенных белков - онкосупрессоров.

Одним из важнейших онкосупрессоров человека является транскрипционный фактор р53.

О его ведущей роли в защите клеток от трансформации, вызываемой генотоксическим стрессом, свидетельствует тот факт, что р53 мутирован в более чем половине всех раковых заболеваний у людей (Harris 1993).

р53 - это короткоживущий белок, который в нормальном состоянии быстро расщепляется протеасомой по убиквитин-зависимому пути. В клетках, в которых нарушена целостность ДНК, происходит стабилизация белка р53 за счет различных посттрансляционных модификаций (ПТМ). Поскольку р53 является транскрипционным фактором, он выполняет функцию онкосупрессора в основном через регуляцию экспрессии генов, чьи белковые продукты вызывают остановку клеток в фазах G1/S и G2/M клеточного цикла и/или апоптоз.

Несмотря на огромный интерес молекулярной онкологии к р53-специфическим ПТМ, влияющим на его функции, до сих пор многие вопросы в этой области остаются невыясненными. Например, существует ряд литературных данных, свидетельствующих о том, что фосфорилирование аминоконцевого участка молекулы р53 вызывает усиление его транскрипционной функции. С другой стороны, существуют данные о том, что мутантный белок р53, в котором все сайты фосфорилирования искусственно заменены на нефосфорилирующиеся остатки аланина, способен выполнять свои функции на таком же уровне, что и белок дикого типа. Говорит ли это о том, что ПТМ не являются абсолютно необходимым элементом регуляции р53, или же другие ПТМ, например, лизинспецифическое метилирование и ацетилирование способны компенсировать отсутствие фосфорилирования в условиях генотоксического стресса? Скорее всего, ПТМ нужны для тонкой «подстройки» р53 к определенным клеточным условиям, возникающим в результате генотоксического стресса того или иного типа. На сегодняшний день также непонятно, существуют ли взаимоотношения между многочисленными модификациями в р53, или они возникают хаотично, независимо друг от друга. Соответственно возникает вопрос о специфичности «ассортимента» ПТМ в белке р53 в ответ на определенные формы стресса.

Недавно был выявлен новый механизм р53-зависимого антитуморогенного ответа через регуляцию экспрессии некодирующих малых РНК (миРНК). В зависимости от степени комплементарности к последовательностям генов-мишеней, миРНК могут работать как по механизму малых интерферирующих РНК, вызывая деградацию соответствующих информационных РНК, так и на уровне трансляции, подавляя формирование полирибосом. Было показано, что в ответ на повреждения ДНК рактивирует транскрипцию как минимум трех вариантов миРНК-34. Последние, в свою очередь, ингибируют экспрессию анти-апоптозного белка Вс1-2, вызывая, тем самым, усиление апоптоза раковых клеток в ответ на генотоксический стресс. Тем не менее, этот механизм вряд ли является универсальным, поскольку в различных трансформированных клеточных линиях, обладающих нормальным р53-зависимым ответом, уровень экспрессии миРНК-34 различается в десятки раз. Данный факт свидетельствует о том, что помимо миРНК-34, скорее всего, существуют другие миРНК, которые также регулируются р53 и участвуют в клеточном ответе на повреждения ДНК.

Цели и задачи. Целью данного исследования являлось изучение молекулярных механизмов регуляции транскрипционной активности р53 в опухолевых клетках, в частности, в ответ на повреждения ДНК.

Для достижения поставленной цели предстояло решить следующие основные задачи:

1). Исследовать влияние ацетилирования на функцию р53 в процессах остановки клеточного цикла и апоптоза опухолевых клеток в ответ на ионизирующую радиацию.

2). Изучить роль лизин-специфического метилирования в регуляции активности рпри генотоксическом стрессе, вызываемом противоопухолевым препаратом доксорубицином.

3). Установить механизм активации р53 за счет лизин-специфического метилирования и выяснить, существует ли взаимосвязь между ковалентными модификациями метилирования и ацетилирования в карбоксильном конце молекулы р53.

4). Определить спектр р53-зависимых миРНК, участвующих в клеточном ответе на генотоксический стресс, а также охарактеризовать механизм их регуляции и роль в остановке клеточного цикла и апоптозе.

Научная новизна. Впервые показано, что ковалентное ацетилирование карбоксильного конца р53 в ответ на повреждения ДНК приводит не только к усилению его связывания с хроматином, как считалось ранее, но и к повышению афинности р53 к гистон-ацетилтрансферазе (ГAT) СВР/рЗ00, которая специфически ацетилирует р53 по лизинам К373 и К382. Последнее приводит к стабилизации комплекса СВР/р300-р53 на промоторах р53-зависимых генов, ремоделированию хроматина и, в конечном итоге, к активации транскрипции генов, чьи продукты участвуют в остановке клеточного цикла и апоптозе.

Открыта новая ковалентная модификация р53 - метилирование по лизину К3(К372-ЛМ). Предположение о существовании этой модификации у р53 было сделано на основе нашей гипотезы о возможности предсказывать новые ПТМ р53 на основе спектра ПТМ гистонов в участках связывания р53 с хроматином.

Определена лизин-метилтрансфераза, ответственная за метилирование р53. Ею оказался фермент Set7/9, который ранее был охарактеризован как К4-гистон НЗспецифическая метилтрансфераза. Оказалось, что, вопреки ранее существовавшему мнению, Set7/9 не является К4-гистон НЗ-специфической метилтрансферазой, но представляет собой хроматин-независимую фактор-специфическую лизиновую метилтрансферазу.

Получены первые данные о механизмах регуляции ферментативной активности Set7/9 в ответ на генотоксический стресс. Показано, что активность Set7/9 возрастает за счет его фосфорилирования, индуцируемого повреждениями ДНК.

Удалось впервые показать механизм стабилизации и активации р53 за счет метилирования. Оказалось, что К372-ЛМ предшествует и способствует ацетилированию р53 по лизинам К373 и К382. В результате кооперирования между этими модификациями происходит ингибирование другой ковалентной модификации, убиквитинирования, которое конкурирует с метилированием и ацетилированием за те же лизины, что приводит к стабилизации р53 на белковом уровне.

Впервые продемонстрирован новый р53-зависимый механизм активации апоптоза за счет изменения экспрессии двух миРНК в ответ на обработку клеток доксорубицином:

индукции миРНК-26а и репрессии 16-2. Поскольку миРНК-16-2 вызывает временную остановку клеточного цикла в G1 фазе, давая раковым клеткам возможность осуществить репарацию поврежденной ДНК, то его ингибирование с помощью р53 приводит к неправильному делению поврежденных клеток и, как следствие, к клеточной смерти.

Нами впервые было показано, что KMT Set7/9 участвует в репрессии транскрипции гена миРНК-16-2 в ответ на генотоксический стресс за счет К372-специфического метилирования р53, что в результате приводит к остановке клеточного цикла в фазе G2 и апоптозу.

Научно-практическое значение. Очевидно, что поскольку ген ТР53, кодирующий белок-онкосупрессор р53, мутирован в половине всех человеческих опухолей, то любая новая информация о самом гене и соответствующем ему белке является чрезвычайно важной для молекулярной и клинической онкологии. То, что ацетилирование рповышает его стабильность и транскрипционную активность, учитывается в клинической практике при сочетанном лечении опухолей генотоксическими препаратами и ингибиторами деацетилаз.

Обнаруженная нами новая посттрансляционная модификация р53, лизиновое метилирование, наряду с ацетилированием, может служить диагностическим маркером транскрипционного статуса р53, так как эти ковалентные модификации преимущественно затрагивают ДНК-связанный и транскрипционно-активный р53.

В ходе выполнения проекта нами были получены поликлональные антитела, специфически узнающие р53, монометилированный по остатку лизина в положении К372.

Теперь эти антитела коммерчески доступны через компанию Abсam Ltd (Cambridge, UK).

Одной из наиболее полно описанных функций миРНК является их участие в онкогенезе. В зависимости от роли генов-мишеней в этом процессе, миРНК могут как усиливать, так и тормозить трансформацию клеток. В связи с этим, обнаруженные нами две новые р53-зависимые миРНК - 26а и 16-2 (регулирующие соответственно апоптоз и G1 фазу клеточного цикла) могут представлять интерес для молекулярной онкологии в плане разработки новых подходов в лечении опухолей, например, методом сочетанной химио- и генной терапии. В связи с этим, нами было показано, что одновременная обработка клеток остеосаркомы ингибитором миРНК-16 и генотоксическим препаратом доксорубицином (ингибитор топоизомеразы II) приводила к их массовому апоптозу.

Наоборот, искусственная задержка клеток в G1 фазе за счет сверхэкспрессии миРНК-16 в момент обработки доксорубицином снижала уровень апоптотических клеток.

Основные положения, выносимые на защиту.

1. рЗ00/СВР-зависимое ацетилирование р53 приводит не только к стабилизации последнего, но и к усилению взаимодействия между этими белками за счет возникновения нового контакта между ацетилированными лизинами р53 и бромодоменами рЗ00/СВР.

2. В ответ на генотоксический стресс р53 претерпевает новую ковалентную посттрансляционную модификацию - метилирование по лизину КЗ72, которое осуществляется ферментом лизин-специфической метилтрансферазой Set7/9.

3. К372-специфическое метилирование ведет к стабилизации белка р53 в ответ на обработку клеток остеосаркомы доксорубицином и вызывает остановку клеточного цикла и апоптоз.

4. Стабилизация и активация белка р53 за счет К372-специфического метилирования происходит в результате усиления другой модификации, ацетилирования, которая появляется после метилирования.

5. В ответ на повреждения клеточной ДНК, вызывамые доксорубицином, в клетках остеосаркомы меняется экспрессия нескольких р53-зависимых миРНК. Кроме активации миРНК-34 происходит активация миРНК-26 и репрессия миРНК-16-2.

6. Одновременное повышение уровня миРНК-26a и понижение миРНК-16-2 в зависимости от р53 приводит к усилению апоптоза раковых клеток.

7. На основе полученных данных нами выдвигается следующая модель участия миРНК в р53-зависимом ответе: поскольку миРНК-16-2 опосредует временную остановку клеточного цикла в G1 фазе, который защищает раковые клетки от гибели, давая им возможность осуществить репарацию поврежденной ДНК, то за счет р53-зависимого подавления экспрессии миРНК-16-2, поврежденные клетки не успевают провести репарацию и умирают в результате митотической катастрофы.

Апробация работы. Результаты работы регулярно обсуждались на лабораторных семинарах, а также на многочисленных российиских и международных симпозиумах: The p53 International Workshop, Нью-Йорк, США, 2006, и Шанхай, Китай 2008; The EMBL Transcription meeting, Гейдельберг, Германия, 2008; мини-симпозиум по проблемам р53 и микро-РНК, Лестер, 2008; Chromatin Structure and Function, Пунта Кана, Доминиканская Республика, 2006, и Канкун, Мексика, 2004; The Keystone meeting on chromatin regulation, Сноубёрд, США, 2005; Symposium LXIX: Epigenetics, Cold Spring Harbor Laboratories, Колд Спринг Харбор, США,2004; Mechanisms of Eukaryotic Transcription, Cold Spring Harbor Laboratories, Колд Спринг Харбор, США 1997, 2001, 2003, 2005;

Summer Sуmposium on Molecular BioloГр, Стейт Колледж, США, 1995, 1999; 6th FASEB International Congress on Cell BioloГр, Сан-Франциско, США, 1996; Петровские чтения по вопросам онкологии, Санкт-Петербург, 2008, 2009.

Публикации по теме диссертации. По материалам диссертации опубликовано статей в рецензируемых отечественных и зарубежных профильных журналах, а также тезисы 12 докладов на международных конференциях и съездах.

Объем и структура диссертации. Диссертация объемом ____страниц состоит из Введения, Обзора литературы, Описания материалов и методов исследования, Результатов, Обсуждения, Выводов и Списка цитируемой литературы. Личный вклад автора являлся определяющим на всех этапах работы и заключался в постановке задач исследования, участии в проведении экспериментов и обработке данных, анализе, обобщении и изложении результатов. Работа была выполнена автором при финансовой поддержке от организаций NCI-NIH (США), FAMRI (США), AICR (Англия) и МКБ (Россия).

Материалы и методы исследования Клеточные культуры. В работе оспользовали следующие трансформированные клеточные линии: клетки остеосаркомы человека U2OS (АТСС НТВ-96), эпителиальные клетки почки эмбриона человека, трансформированные Ad5, HEK293 (АТСС CRL-1573), клетки карциномы легкого человека Н1299, лишенные р53 (АТСС CRL-5803), раковые клетки прямой кишки человека (НСТ116 р53+ и р53- получены от проф. В. Vogelstein).

Клеточные линии культивировали в среде DMEM с добавлением 10 % FBS и 100 нМ глутамина и пенициллина-стрептомицина (Gibco) в атмосфере 5 % СО2. Конструкция U2OS клеточной линии с пониженной и восстановленной экспрессией Set7/9. Клетки U2OS, стабильно экспрессирующие 6His-Set7/9-Flag белок дикого типа, его каталитический мутант Н297А, а также shRNA-Set7/9 были получены, как описано ранее (Chuikov et al. 2004). Контрольная линия U2OS была получена с помощью стабильного инфецирования клеток неспецифической shRNA, как было описано ранее (Chuikov et al.

2004). Устойчивая к воздействию shRNA, экспрессирующая конструкция 6His-Set7/9-Flagresist была получена с помощью направленного мутагенеза с использованием олигонуклеотидов: 5'-GCG GTG CAA GGG CAT TTA GAC GAT GGC CTG CCG CAC GGG TTC TGC-3'. Получение Tet-off H1299 клеточных линий, индуцибельно экспрессирующих р53. Для получения Tet-off индуцибельных линий был использован бицистронный вектор ЕС1214А (подарок профессора H.-J. Xu, MD Anderson Cancer Center, USA). Этот вектор несет в себе кодирующую последовательность как Tetpeпpeccopa, так и последовательность Tet оператора впереди сайтов клонирования, что позволяет создавать стабильные Tet-off-индуцибельные клеточные линии в один шаг.

Клеточные линии на основе Н1299 (р53-), индуцибельно экспрессирующие р53 дикого типа и его мутанты по сайтам ацетилирования, были получены, как описано ранее в (Barlev et al. 2001). Анализ р53-зависимой транскрипции. Транскрипционную активность р53 белков, слитых с гетерологическими ДНК-связывающими доменами, определяли по экспрессии репортивного гена люциферазы под промотором гена Elb, в который были вставлены сайты связывания с дрожжевым активатором Gal4, по ранее описаной методике (Barlev et al. 2001). Анализ клеточного цикла и апоптоза.

Распределение клеток по клеточному циклу после различных ДНК-повреждающих обработок определяли по окрашиванию пропидием йода с помощью метода проточной цитометрии и программного обеспечения CellQuest и ModFit, как описано ранее (Ivanov et al. 2007). Уровень клеточного апоптоза определяли цитофлуорометрически с помощью двойного окрашивания пропидием йода и FITC-конъюгированными антителами к Аннексину-5 (Chuikov et al. 2004). Этот белок обычно находится на внутренней стороне мембраны и становится доступным для антител только в результате переворачивания мембраны, свидетельствуя об апоптозе. Экспрессия рекомбинантного белка р53 и его очистка. Для биохимических исследований влияния посттрансляционных модификаций на функции белка р53 in vitro мы разработали несколько способов очистки этого белка из бактерий. В связи с тем, что бактериальный белок р53 нерастворим при 37° С, биомасса бактерий наращивали при пониженной температуре (17° С), чтобы замедлить время синтеза белка и, соответственно, увеличить время фолдинга белков. Для очистки белка использовали аффинную хроматографию либо на хелатном Ni2+ носителе (в случае белка р53, слитого с шестью гистидинами), либо на Глутатион-сефарозе (в случае р53, слитого с Глутатион-S-трансферазным доменом). Ацетилирование р53 in vitro. Реакцию ацетилирования р53 in vitro проводили в присутствии полноразмерного очищенного СВР или очищенного ГАТ домена фермента PCAF при 30° С в течение 1 часа. Донором ацетильных групп служил [3Н]-меченый ацетилкоэнзим A (Amersham Pharmacia Biotech).

Реакцию останавливали буфером Laemmli, образцы разделяли методом ДСН-ПААГ. Для визуализации белков гели окрашивали Кумасси, высушивали, и экспонировали либо с рентгеновской пленкой, либо в кассете [3H]-PhosphoImager (Molecular Dymanics) для определения эффективности реакции ацетилирования. Метилирование р53 и гистонов. В качестве субстратов в реакции Set7/9-зависимого метилирования были использованы рекомбинантный р53, смесь гистонов после экстракции ацетоном, а также нуклеосомные гистоны. Донором метильных групп служил [3H]аденозил-S-метионин (Amersham).

Последующий анализ метилирования проводили как описано выше.

Убиквитинилирование р53 in vivo. Клетки Н1299 (р53-) были ко-трансфецированы плазмидами, кодирующими различные варианты р53, а также 6His-убиквитин, в присутствии или отсутствие ЕЗ-убиквитин лигазы HDM2 (любезно предоставлена доктором А.Киневым, University of North Carolina, USA) в присутствии ингибитора протеасом MG132. Белки, содержащие в своем составе 6-His-убиквитин, очищали на хелатном Ni2+ носителе аффинной хроматографией в денатурирующих условиях, чтобы избежать реакции де-убиквитилирования. Степень убиквитилирования р53 анализировали иммуноблоттингом с использованием моноклональных антител против р53 (Аb-6, Oncogene). Взаимодействие между модификациями в р53. Исследование взаимодействия между ковалентными модификациями метилирования и ацетилирования проводили с использованием различных карбоксильно-концевых пептидов р53, меченных биотином, как было описано ранее (Chuikov et al. 2004). В реакциях использовались следующие пептиды: р53 -SHLKSKKGQSTSRHKKLMFK (биотин); р53-ацетилК373/К382 -CSHLKSKK-(Ac)GQSTSRHKK-(Ac)LMFK (биотин); и р53-метил-К372CSHLKSK-(Me)2-KGQSTSRHKKLMFK (биотин). Модифицированные пептиды преципитировали сефарозой, конъюгированной с стрептавидином (Pharmacia Biotech).

Степень их ацетилирования-метилирования определяли по уровню включения [3Н] ацетила или метила, которое, в свою очередь, определяли с помощью жидкостной сцинтиляции. Анализ связывания р53 с ДНК. Эффективность связывания р53 с Рмеченым олигонуклеотидом размером 30 н.п., содержащим сайт связывания р53 в промоторе гена р21 оценивали с помощью нативного электрофореза в полиакриламидном геле в трис-глициновом буфере, как было ранее описано (Waterman et al. 1996; Barlev et al.

2001). Определение аффинности Set7/9 к пептидам р53. Константы диссоциации определяли с помощью флуорометрического анализа в эксперименте по конкуренции немеченных р53 и НЗ пептидов с данзил-меченым НЗ пептидом (ARTKQTARKY), заранее связанным с очищенным белком Set7/9 (Chuikov et al. 2004). Белок-белковые взаимодействия. Немодифицированные либо ацетилированные in vitro GST-p53 белки инкубировали с коактиваторными белковыми комплексами, изолированными из клеток HeLa. Иммунопреципитированные комплексы, содержащие р53, анализировали иммуноблоттингом, используя специфические антитела. Непрямая иммунофлуоресценция. Клетки выращивали на покровных стеклах, обрабатывали ДНКповреждающими агентами, фиксировали, пермеабилизировали и красили специфическими антителами на интересующие белки. ДНК окрашивали красителем HOECHST. Анализ внутриклеточного распределения белков проводили с помощью инвертированного конфокального микроскопа (Leitz). ОТ-ПЦР. Тотальную РНК выделяли с помощью реагента TRIzol (Invitrogen) в соответствии с указаниями производителей. Однонитевую кодирующую ДНК синтезировали с применением олиго(dТ) затравки и набора Ready-To-Go You-Prime First-Strand Beads, содержащими обратную транскриптазу (Amersham Biosciences). КоличественнаяПЦР в реальном времени. Количественная ПЦР в реальном времени проводили в присутствии красителя CYBERGREEN на системе DNA Engine Opticon 2 (MJ Research), согласно инструкции производителя. В работе использовали следующие праймеры: р21: 5' CACCGAGACACCACTGGAGG и З'-GAGAAGATCAGCCGGCGTTT, GAPDH: 5'GGGAAGGTGAAGGTCGGAGT и 3' -TTGAGGTCAATGAAGGGGTCA миРНК-16: Чипгибридизация (microarray). Оценку экспрессии генов микро-РНК проводили с помощью гибридизации на микрочипах, содержащих 560 различных человеческих миРНК.

Клеточную РНК превращали в ДНК с помощью реакции обратной транскрипции в присутствии биотинилированных оснований и гибридизовали с микрочипами (в сотрудничестве с доктором G. Calin, Ohio State University). Анализ сигналов гибридизации проводили, используя Atlas Image software. Клонирование ДНК. Для GST-C-концевой конструкции белка р53 С-конец (а.к. 290-393) был клонирован в PGEX3 векторе (Promega). Для обнаружения сайта метилирования различные пептиды р53 (а.к. 290-235, 340-364, 364-393) были клонированы в векторе Petl02 (Invitrogen) и экспрессированы в E.сoli в виде белков, слитых с тиоредоксином. Направленные замены в р53 и Set7/проводили методом сайт-направленного мутагенеза с помощью набора Chameleon (Stratagene). Антитела. В работе использовали следующие антитела следующих компаний: анти-НА, анти-р53 и анти-(Ацет) р53 (К373/382), анти-СВР (Santa Cruz); антир53 амино- (АЬ-6) и карбоксильный конец р53 (Ab-1) (Oncogene); анти-Flag (Sigma); анти(Ацет) гистоны НЗ, Н4; (Abсam) анти-(Мет) К4 гистон НЗ (Millipore-Upstate);

самодельные антитела против TRRAP, Set7/9, (Мет)-р53К372. Иммунопреципитацию хроматина проводили согласно описанной ранее методике (Barlev et al. 2001).

Преципитированную ДНК анализировали методом количественной ПЦР, используя следующие праймеры:

р21 - 5'-CCAGCCCTTGGATGGTTT; 3'-GCCTCCTTTCTGTGCCTGA;

GAPDH - 5'-AAAAGCGGGGAGAAAGTAGG; 3'-CTAGCCTCCCGGGTTTCTCT.

Результаты и их обсуждение 1. Роль ацетилирования в регуляции активности р53.

р53 является одним из важнейших онкосупрессоров человека. р53 играет решающую роль в регуляции пролиферации клеток, «сканируя» человеческий геном с целью выявления повреждений молекул ДНК и остановки клеточного цикла перед делением. В случае невозможности репарации поврежденной ДНК клетки направляются на путь апоптоза, который также опосредован р53.

р53 является сиквенс-специфическим ДНК-связывающим транскрипционным фактором и выполняет свою функцию «геномного контролёра» в основном за счет активации или репрессии транскрипции генов-мишеней. р53 регулирует транскрипцию нескольких сотен генов, включая такие, как p21/WAF/CIPl, GADD45, Вах, Puma, Noxa, Mdm2, продукты которых регулируют прохождение по клеточному циклу, апоптоз либо функционирование р53 самого по себе.

Активность белка р53 регулируется посредством множественных посттрансляционных модификаций, которые преимущественно происходят на амино- и карбокси-концевых участках молекулы белка. В результате повреждения ДНК рстановится сильно фосфорилированной молекулой. Несколько киназ, включая Chk2, Cdkактивированную киназу САК, члены семейства фосфоинозитол-З-зависимых киназ ATM, ATR, DNA-РК, фосфорилируют р53 в его аминоконце, что приводит к стабилизации белка.

Фосфорилирование также происходит на карбоксильном концевом участке молекулы р53, что стимулирует связывание белка с молекулой ДНК in vitro.

В зависимости от природы источника повреждения ДНК (гамма-радиация или ультрафиолетовое излучение) в клетках соответственно возникают двухцепочечные или одноцепочечные разрывы, что приводит к активации различных киназных каскадов. В случае двухцепочечных повреждений ДНК индуцируется ATM/Chkl каскад, а в случе одноцепочечных разрывов активируется ATR/Chk2 каскад, что приводит к фосфорилированию р53 по остаткам серинов и треонинов в позициях 15, 18, 20, 33 в аминоконце и Ser366, Ser378, and Thr387 в карбоксильном конце молекулы р53. Помимо этих каскадов киназ р53 дополнительно фосфорилируется MAP киназой р38 по серину и JNK по треонину 81. Гиперфосфорилирование приводит к индукции транскрипционной активности р53, а также к его стабилизации на уровне белка.

Тем не менее, существуют данные, свидетельствующие о том, что мутантный белок р53, в котором все сайты фосфорилирования в амино- и карбоксильных концах молекулы искусственно заменены на нефосфорилирующиеся остатки аланина, способен выполнять свои транскрипционные функции на таком же уровне, что и белок дикого типа.

Эти данные говорят о том, что, скорее всего, существуют другие пост-трансляционные ковалентные модификации, которые способны компенсировать отсутствие фосфорилирования (Ashcroft et al. 1999).

Ацетилирование является еще одной ковалентной пост-трансляционной модификацией р53, которая наблюдается в ответ на повреждение ДНК и существенно регулирует его активность. р53 ацетилируется с карбоксильного конца, в определенных регуляторных участках, которые окружают домен тетрамеризации. Степень ацетилирования р53 является важным параметром функционирования белка, поскольку его деацетилирование посредством повышенной экспрессии гистоновых деацетилаз, коррелирует с понижением способности р53 индуцировать остановку клеточного цикла и апоптоз (Luo et al. 2000). Было показано, что ацетилирование р53 in vitro способствует его связыванию с короткими фрагментами ДНК. Вероятно, это происходит вследствие изменения конформации карбоксильного участка р53, что ведет к снятию негативной регуляции ДНК-связывающей активности (Gu and Roeder 1997). Однако на момент начала нашей работы роль ацетилирования в процессе регуляции функции р53 in vivo была еще не изучена.

Чтобы выяснить этот вопрос, мы исследовали роль ацетилирования р53 в опытах in vivo, используя специально сконструированные мутантные белки р53, которые не способны ацетилироваться в ответ на повреждения ДНК. Используя метод иммунопреципитации хроматина, мы проанализировали статус р53, коактиваторов и гистонов, связанных с промоторной областью гена p21/WAF в различных типах трансформированных клеток до и после повреждения ДНК. Наши данные указывают на то, что ацетилирование является одной из важнейших модификаций р53 в опытах in vivo и что данная модификация помогает привлекать коактиваторы/ГАТ к промоторным областям р53-зависимых генов.

1.1. Характеристика in vitro мутантных по ацетилированию белков р53.

Для выяснения роли ацетилирования в регуляции активности р53 генноинженерным путем были сконструированы несколько мутантов р53, в которых ацетилируемые лизины были заменены на аргинины. Аргинины, как и лизины, имеют положительный заряд, но не могут ацетилироваться (Рис. 1 А). Нами и другими было показано, что ацетилирование р53 по остаткам лизина осуществляется двумя классами молекул коактиваторов/ацетилтрансфераз: СВР/рЗ00 ацетилируют р53 по лизину (К)-3и, в меньшей степени, по К-373, Lys-381; PCAF/hGcn5 ацетилирует по К-320 (Рис 1Б). Для этих коактиваторов было показано, что они являются гистоновыми ацетилтрансферазами (ГAT) и что в качестве ГАТ они привлекаются к специфическим промоторам с целью модификации амино-концевых участков коровых гистоновых белков в нуклеосомах, что приводит к дерепрессии хроматина. Известно также, что СВР/рЗ00 и PCAF/hGcn5, помимо гистонов, ацетилируют различные транскрипционные факторы (Sterner and Berger 2000). Недавно было установлено, что ДНК-связывающий домен р53 ацетилируется еще одним ГАТ ферментом - Tip60, что приводит к селективной активации р53-зависимых апоптотических генов (Sykes et al. 2006; Tang et al. 2006).

Рис. 1. In vitro ацетилирование и биохимические свойства р53 дикого типа и его мутантной формы с заменами в сайтах ацетилирования. (А) Схематическое изображение доменной структуры белка р53.

Использованы следующие аббревиатуры: AD - активационный домен, OD - домен олигомеризации, DBD домен связывания ДНК, RD - домен репрессии. На схеме также указаны остатки лизина, которые были заменены на аргинины (КR) (Б) In vitro ацетилирование рекомбинантного очищенного p53wt и p53mut с заменами лизиновых аминокислотных остатков на аргинины (K320/373/381/382R). Очищенный полноразменый СВР или HAT домен фермента PCAF были использованы для ацетилирования равных количеств p53wt и p53mut в опытах in vitro. Наверху показаны результаты окраски геля Кумасси, внизу показана флуорограмма. Процент ацетилирования подсчитан относительно максимально возможного.

(В) Анализ электрофоретической подвижности в геле белка р53 дикого типа (p53wt) и мутированного р(p53mut: K320/373/381/382R). Белок р53 был проинкубирован с ДНК размером 30 н. п. меченной Р и содержащей сайт связывания р53 в области промотора р21. Как отмечено на рисунке, были добавлены моноклональные антитела 421, распознающие С-концевой участок белка, и олигомер - конкурент. Для более четкого разделения р53 от р53 в комплексе с ДНК электрофорез вели дольше обычного времени, поэтому несвязавшаяся меченная ДНК вышла из геля. (Г) Анализ p53wt и p53mut методом гель-фильтрации. Степень олигомеризации определяли с помощью эксклюзионной хроматографии. Пик элюции был определен измерением поглощения на 280. Положение пика элюции для стандартов молекулярной массы также указано на рисунке.

Как свидетельствуют данные эксперимента по гель-ретардации в присутствии антител, активирующих связывание ДНК, оба белка р53 (нормальный и мутантный по всем четырем сайтам ацетилирования) проявляли сопоставимую способность связываться с ДНК (Рис. 1В). Другое свойство р53 - тетрамеризоваться в растворе - было исследовано методом гель-фильтрационной хроматографии. Оба белка в одинаковой степени были способны образовывать тетрамеры, о чем можно судить по молекулярной массе комплексов (в районе 250 кДа) (Рис. 1 Г). Таким образом, на основании этих критериев, мы заключили, что замены лизинов на аргинины в сайтах ацетилирования р53 не влияют на его структурную целостность и биохимические свойства.

1.2. р53-зависимая транскрипция гена p21/WAFl зависит от ацетилирования.

Поскольку р53 осуществляет свои функции в клетке в осовном как транскрипционный фактор, мы решили изучить эффект ацетилирования на способность белка р53 активировать транскрипцию гена-мишени p21/WAF. Для этого р53 дикого типа и его мутантная неацетилируемая форма с заменами в сайтах ацетилирования (K320/373/381/382R) были трансфецированы в р53- клетки Н1299. Чтобы индуцировать ацетилирование р53, клетки облучали гамма-лучами. Анализ транскрипции методом ОТПЦР показал, что мутантный р53 в 2,5 раза слабее активировал транскрипцию гена p21/WAF по сравнению с р53 дикого типа (Рис. 2А). Количество белка р53 дикого типа было сопоставимым с количеством мутантного р53 (Рис. 2Б). Таким образом, результат этого эксперимента свидетельствует о том, что ацетилирование белка р53 является необходимым условием для его полной транскрипционной активности.

1.3. Остановка клеток в G1 фазе зависит от ацетилирования р53.

В ответ на повреждение ДНК р53 индуцирует остановку клеток в G1 и G2 фазах для возможности репарировать возникающие одно- и двухцепочечные разрывы, а также нуклеотидные сшивки, перед прохождением клеточного деления. Остановка клеток в Gфазе осуществляется р53 за счет повышения экспрессии гена p21/WAF, чей продукт ингибирует активность циклин-зависимых киназ, необходимых для перехода клеток в фазу репликации. Тот факт, что ацетилирование влияло на транскрипционную активность р53 по отношению к экспрессии эндогенного гена p21/WAF (Рис. 2), давало нам основание предположить, что ацетилирование р53 может быть также необходимым для остановки клеток в фазе G1 в ответ на повреждение ДНК. Чтобы проверить наше подозрение, мы решили исследовать распределение клеток по циклу, используя метод проточной цитофлуометрии. В эксперименте были использованы клетки Н12трансфецированные р53 дикого типа или мутантным р53 с заменами по всем сайтам ацетилирования (K320R/373R/381R/382R) (Рис.3). Сравнение графиков распределения трансфецированных клеток по клеточному циклу до и после обработки гамма-радиацией показало, что ацетилирование усиливает способность р53 вызывать остановку клеток в Gфазе (Рис. ЗГ). Полученные результаты хорошо согласуются с нашими ранее полученными данными о том, что неацетилируемый мутант р53 намного слабее активирует транскрипцию p21/WAF - ингибитора циклин-зависимых киназ и, соответственно, не способен вызывать полную остановку клеток.

, Рис. 2. Сравнение транскрипционной активности р53 дикого типа и его неацетилируемого мутанта.

(А) р53 дикого типа или мутантный р53 с заменами в сайтах ацетилирования K320/373/381/382R были трансфецированы в клетки Н1299. После облучения (15 Гр) из клеток была выделена тотальная РНК и проведена ОТ-ПЦР. Уровень ПЦР сигнала для р21 был подсчитан относительно сигнала для GAPDH (взят за 100%).

(Б) Уровни экспрессии р53 дикого типа и мутантного р53 были определены иммуноблоттингом с использованием антител DО(Аb-6) против р53.

1.4. Ацетилирование регулирует транскрипционную активность р53 независимо от его связывания с ДНК.

Ранее было показано, что ацетилирование in vitro способствует связыванию р53 с ДНК (Sakaguchi et al. 1998; Liu et al. 1999; Gu et al. 2004). Соответственно можно было предположить, что те дефекты транскрипции гена p21/WAF, которые мы наблюдали в случае использования неацетилируемого мутанта р53, являлись результатом пониженного связывания этого мутанта с промотором гена p21/WAF. Мы решили сравнить силу связывания р53 дикого типа и его неацетилируемого мутанта с промотером гена р21 в клетках после гамма-облучения.

Рис.3 Влияние ацетилирования р53 на эффективность остановки клеток в фазе G1 в ответ на повреждение ДНК. Клетки Н1299 были трансфецированы вектором (контроль) (Рис. ЗА, В), р53 дикого типа (p53wt) (Рис. ЗБ, Г) и мутантным р53 (K320/373/381/382R) (Рис. ЗД).

Часть трансфецированных клеткок были подвергнуты облучению гамма-радиацией дозой в 15 Гр (Рис. ЗВ, Г и Д), а другая часть оставлена для контроля (Рис. ЗА и Б).

Эффективность трансфекции проверяли непрямой иммунофлуоресценцией после окрашивания клеток НА-специфическими антителами, узнающими химерный белок р53НА (панели справа). Уровень экспрессии белка р53 определяли иммуноблоттингом (Рис. ЗЕ).

Распределение клеток по циклу определяли с помощью проточной цитометрии Плазмиды, экспрессирующие р53 дикого типа и его мутант с заменами во всех сайтах ацетилирования, были временно трансфецированы в клетки HI299. Чтобы избежать артефактов гиперэкспрессии, мы подобрали условия, в которых уровень экспрессии р53 в Н1299 клетках был сопоставим с уровнем экспрессии эндогенного белка р53 в клетках U2ОS после облучения (Рис.4А). К нашему удивлению, мы обнаружили, что р53 дикого типа и его мутант связываются с промотором p21/WAF примерно одинаково, т.е. каждый из белков продемонстрировал увеличение связывания на 50 % после облучения. При этом связывание было довольно специфичным, потому что исследуемые белки не связывались с промотором контрольного гена GAPDH, при сопоставимых количествах дикого и мутантного белка р53 в клетках. Таким образом, результаты наших экспериментов in vivo расходятся с ранее опубликованными данными in vitro о том, что ацетилирование русиливает его связывание с ДНК. Практически одновременно с публикацией наших наблюдений появилось несколько статей, подтверждающих наши выводы (Espinosa and Emerson 2001; Kaeser and Iggo 2002). Описанные выше результаты показывают, что несмотря на то, что неацетилируемый мутант р53 связывается с ДНК, тем не менее, он не способен активировать транскрипцию и осуществлять остановка клеток клеток в фазе G1.

Этот результат дал нам основание предположить, что ацетилирование влияет не на связывание ДНК, а на какие-то другие функциональные свойства р53.

Для того, чтобы определить эффект ацетилирования на способность р53 к трансактивации независимо от его связывания с ДНК, дикий и мутантный белки р53 были слиты с гетерологичным ДНК-связывающим доменом дрожжевого активатора Gal4.

Химерный белок Gal4-p53 дикого типа активировал транскрипцию репортивной плазмиды в 12 раз сильнее, чем Gal4 сам по себе, и в 3 раза выше, чем Gal4-p53 неацетилируемый мутант (Рис.4В), хотя оба слитых белка экспрессировались на сопоставимом уровне (Рис.

4Г). Эти данные подтверждают гипотезу о том, что ацетилирование является важной модификацией, регулирующей активность белка р53 вне контекста его связывания с ДНК.

1.5. Ацетилирование р53 является необходимым условием для привлечения коактиваторов и ацетилирования гистонов Каким же образом ацетилирование контролирует р53-опосредованную активацию транскрипции? Ранее было показано, что способность р53 активировать транскрипцию усиливается за счет присутствия коактиваторов СВР/рЗ00 и PCAF/hGcn5 (Gu et al. 1997;

Scolnick et al. 1997). Поэтому мы решили выяснить, привлекаются ли эти коактиваторы к промоторной области гена p21/WAF после повреждения ДНК и, если это так, является ли ацетилирование белка р53 необходимым условием для этого процесса.

Рис.4. Ацетилирование не влияет на ДНК-связывание р53, но регулирует его трансактивацию.

(А) Сравнение уровней экспрессии р53 в клетках U2ОS (после облучения) и в клетках Н12трансфецированных дикой и мутантной формой р53. (Б) В реакции иммунопреципитации хроматина использовали антитела к р53 в клетках Н1299, трансфецированных пустым вектором (контроль), р53 дикого типа и мутантным р53. ПЦР преципитированных фрагментов проводили используя праймеры специфичные к промотору гена р21. В качестве контроля на специфичность связывания использовали фрагмент гена GAPDH, количество которого определяли методом ПЦР.

(В) Анализ влияния ацетилирования на р53-зависимую трансактивацию. Клетки Н1299 были трансфецированы репортивной плазмидой, несущей ген люциферазы под контролем вирусного промотора Е1В, содержащего 5 сайтов связывания Gal4. В эти же клетки были введены следующие конструкции: пустой вектop-Gal4DBD, GaWDBD -p53wt (дикий тип), Gal4DBD -p53mut (мутант). Клетки были облучены дозой Гр, после чего измеряли люциферазная активность. Активность подсчитывали относительно контрольного значения люциферазной активности в образцах, содержащих пустой вектор. (Г) Количество экспрессированного белка в трансфецированных клетках определяли методом иммуноблоттинга с использованием антител.

Рис.5. Иммунопреципитация хроматин-ассоциированных белков-коактиваторов и гистонов в промоторной области гена p21/WAF. (А) Анализ экспрессии белков-коактиваторов СВР и TRRAP в U2ОS и Н1299 клетках, трансфецированных р53 дикого типа или его неацетилируемым мутантом после гамма-радиации. Уровни экспрессии эндогенного СВР, TRRAP и тубулина, взятого в качестве контроля, оценивали методом иммуноблотинга, используя специфические антитела. (Б) Иммунопреципитация эндогенного ацетилированного р53, связанного с промотором гена p21/WAF после обработки клеток U2ОS гамма-радиацией. (В) Иммунопреципитация коактиваторов СВР и TRRAP, а также ацетилированных гистонов НЗ и Н4 в клетках U2ОS до и после облучения. Иммунопреципитация белка-репрессора РВР была использована в качестве контроля на специфичность. (Г) Иммунопреципитация коактиваторов СВР и TRRAP, а также ацетилированных гистонов НЗ и Н4 в клетках Н1299 после облучения. Клетки Н1299 были трансфецированы вектором (контроль), р53 дикого типа или мутантным р53, затем облучены и проанализированы методом иммунопреципитации хроматина.

Методом иммунопреципитации хроматина мы проверили рекрутирование двух коактиваторных белков: СВР, который сам по себе является ГАТом, и TRRAP (McMahon et al. 1998; McMahon et al. 2000). TRRAP является компонентом двух ГАТ-содержащих комплексов: STAGA/TFTC, в котором присутствует ГАТ PCAF/hGcn5 (Vassilev et al. 1998;

Ikura et al. 2000), и NuA4, содержащий ГАТ Tip-60 (Ikura et al. 2000). Как и ожидалось, облучение U2ОS клеток вызывало усиление связывания ацетилированного р53 с промотором p21/WAF (Рис. 5Б). Параллельно этому событию происходило увеличение количества СВР и TRRAP на промоторе, а также повышение ацетилирования гистонов НЗ и Н4 (Рис. 5В). При этом облучение не вызывало повышения экспрессии этих коактиваторов (Рис. 5А), что дает основание говорить о специфическом накоплении этих белков на промоторе. По-видимому, это р53-зависимый процесс, поскольку, в отличие от СВР и TRRAP, облучение не меняло количество РВР (р53-независимый коактиватор гормон-зависимого рецептора) на промоторе гена p21/WAF (Rachez and Freedman 2000) (Рис. 5В). Таким образом, наши данные косвенно подтверждают гипотезу о том, что в ответ на повреждения ДНК р53 направленно рекрутирует специфические ГАТсодержащие комплексы к промотору p21/WAF. Схожий анализ был проведен в р53негативных клетках Н1299, которые были трансфецированы р53 дикого типа или его неацетилируемым мутантом. Данные этого эксперимента позволили нам установить прямую зависимость между ацетилированием р53 и эффективностью рекрутирования ГАТ к промотору p21/WAF (Рис. 5Г и 6). Мы также показали, что обогащение промотора коактиваторами-ГАТ ведет к усилению ацетилирования гистонов и, соответственно, к более пермиссивной для транскрипции организации хроматина в этой области. Детальный Рис.6. Корреляция между присутствием ацетилированного и неацетилированного р53 на промоторе p21/WAF и рекрутированием коактиваторов и ацетилированием гистонов.

механизм этого феномена до конца не известен, но следует отметить, что, наряду с Gcn5-содержащим комплексом STAGA/TFTC, р53 также привлекает белок Ada2b, который, помимо Gcn5, взаимодействует еще и с хроматинремоделирующим комплексом Swi/Snf (Barlev et al. 1995; Barlev et al. 2003; Gamper and Roeder 2008).

Нам также удалось показать, что in vitro ацетилированный р53сильнее взаимодействует с коактиваторами, нежели его немодифицированный вариант. Стоит отметить, что в дальнейшем был выяснен молекулярный механизм преимущественного взаимодействия ацетилированного р53 с белками СВР и Gcn5.

Оказалось, что оба эти белка содержат в себе определенные структурные элементы, называемые бромодоменами (БРД). Эти консервативные домены обладают способностью специфически связываться с ацетилированными лизинами в составе гистонов, а также р53 (Mujtaba et al. 2004). Очевидно, что ковалентное ацетилирование р53 не может происходить изолированно от других посттрансляционных модификаций, возникающих при повреждениях ДНК. Например, в ответ на генотоксический стресс р53 претерпевает фосфорилирование по множественным сайтам, расположенным преимущественно в его аминоконце.

Результатом этой модификации является стабилизация белка р53. Каков механизм этого явления? Эксперименты in vitro (Lambert et al. 1998) показали, что фосфорилирование мешает взаимодействию р53 с ЕЗ-убиквитин лигазой HDM2, которая вызывает убиквитинилирование р53 в его карбоксильном конце и последующую деградацию по 26S-протеасомному пути. В дополнение к тому, что фосфорилирование нарушает взаимодействие между р53 и HDM2, оно еще и приводит к усилению аффинности ГАТ СВР/р300 к аминоконцу р53. Таким образом, можно предположить, что фосфорилирование р53 стимулирует его ацетилирование в карбоксильном конце, что, в конечном итоге, приводит к стабилизации белка при генотоксическом стрессе (Sakaguchi et al. 1998). Узнавание ацетилированных лизинов КЗ73 и КЗ82 бромодоменами СВР может стабилизировать этот комплекс на промоторе p21/WAF и индуцировать ремоделирование хроматина для запуска транскрипции.

2. Роль лизинового метилирования в регуляции активности р53.

Как уже неоднократно упомяналось, в ответ на генотоксический стресс рпретерпевает широчайший спектр посттрансляционных модификаций, который включает в себя фосфорилирование, ацетилирование, гликозилирование, АДФ-рибозилирование, сумоилирование,неддилирование и убиквитилирование. Функции и специфичность этих модификаций до сих пор остаются до конца невыясненными. В этом аспекте полезной может являться информация, полученная в ходе исследования посттрансляционных модификаций гистонов. Гистоны, как одни из наиболее активно экспрессирующихся белков, являются идеальной моделью для изучения белковых модификаций. Если сравнить спектры модификаций р53 и гистонов, то они, за редким исключением, практически совпадают. Поскольку, как мы уже показали, посттрансляционные модификации ручаствуют в каскаде передачи клеточного сигнала с транскрипционных факторов на гистоны, то логично предположить, что по модификациям гистонов в областях связывания р53 можно вычислить возможные модификации в самом р53. Более того, описанные в гистонах взаимодействия между различными модификациями потенциально могут служить «дорожной картой» для расшифровки взаимоотношений между ковалентными модификациями в молекуле р53. Гистоны подвергаются метилированию по остаткам аргининов и лизинов в нескольких положениях. На тот момент, когда мы начинали наши эксперименты, ни лизиновое, ни аргининовое метилирование у рнайдено еще не было. Руководствуясь нашей гипотезой о том, что гистоновые модификации могут служить ориентиром для поиска новых модификаций р53, мы осуществили биохимический скрининг различных метилтрансфераз на их способность метилировать р53 in vitro (Рис. 7).

Рис.7. Set7/9 метилирует белок р53 в опытах in vitro. A. 3 мкг рекомбинантных гистоновых октамеров (рекомбинантные нуклеосомы для Set8), полноразмерный белок р53 и БСА были протестированы в качестве субстратов для метилирования ферментами Set7/9, Suv39Hl, Set8 и PRMT1. Б. Метилирование полноразмерного р53 WT и мутантного белка K372R ферментом Set7/9. Наверху показана авторадиография геля. Внизу представлена окраска Кумасси.

2.1. Гистоновая метилтрансфераза Set7/9 специфически метилирует р53 по лизину К372 in vitro.

Мы обнаружили, что из нескольких протестированных нами гистоновых метилтрансфераз (ГМТ), включающих в себя Suv39Hl, мишенью которой является лизин 9 гистона НЗ (К9НЗ), Set8, которая метилирует К20-Н4, аргининовая метилтрансфераза PRMT1, метилирующая R3-H4, только лишь Set7/9, метилирующая К4-НЗ, была способна метилировать белок р53 в опытах in vitro (Рис.7а). При этом метилирование оказалось весьма специфичным, поскольку другие лизин-содержащие белки (цитохром с, Gal4-VP16, бычий сывороточный альбумин (БСА) и -глобулин) не являлись субстратами для Set7/9.

Сначала мы определили положение аминокислотного остатка, по которому Setметилирует белок р53. Мы сконструировали серию делеционных мутантов р53 и обнаружили, что метилирование происходит в карбоксильном конце молекулы. Затем мы заменили в этом фрагменте остатки всех лизинов на аргинины и установили, что Set7/метилирует остаток лизина в положении К372 (Рис. 7Б).

Сравнив аминокислотные последовательности гистона НЗ, р53 и TAF10 (еще одного субстрата для метилирования Set7/9), мы обнаружили, что все три белка имеют сходные последоватльности вокруг сайта метилирования, R/K-T/S-K. Поиск по базе данных потенциальных субстратов метилирования с такой последовательностью выявил около 1000 белков! Выбрав несколько наиболее интересных для нас белков (TAF1, PCAF, рецептор эстрогенового гормона и др.), мы проверили их на способность метилироваться in vitro с помощью фермента Set7/9. К нашему удивлению, ни один из этих белков не метилировался Set7/9. Мы еще раз более тщательно сравнили последовательности известных субстратов и обнаружили, что за две аминокислоты слева от консенсусного мотива в р53 и TAF10 располагается положительно заряженная аминокислота гистидин или аргинин, которая необходима для узнавания субстрата ферментом Set7/9. В вышеперечисленных белках в этой позиции отсутствуют положительно заряженные аминокислоты и поэтому неудивительно, что они не метилируются. Таким образом, консенсусным мотивом для метилирования Set7/9 является последовательность: H/R-XR/K-T/S-K, где Х - это любая аминокислота.

2.2. p53 метилируется ферментом Set7/9 in vivo Для того чтобы изучить роль метилирования р53 in vivo, мы получили поликлональные антитела из кролика, которые специфически узнают монометилированный остаток К372 белка р53. Анти-р53К372-монометил (1Ме-р53) антитела специфически узнавали очищенный из бактерий рекомбинантный р53, метилированный ферментом Set9 in vitro, но не узнавали немодифицированный р53 (Рис. 8).

Для того чтобы ответить на вопрос, метилирует ли фермент Set7/белок р53 in vivo, мы решили индуцировать повреждения ДНК, которые, как известно, вызывают различные ковалентные модификации р53. Мы предположили, что р53-К372 метилирование также будет меняться в ответ на генотоксический стресс. Клетки 293F и U2ОS, экспрессирующие эндогенный р53, были обработаны ионизирующей радиацией и доксорубицином, ингибитором топоизомеразы 2, также вызывающим двухцепочечные разрывы, и соответствующие клеточные экстракты были проанализированы на присутствие метилированного р53. Как видно на Рис. 9, и доксорубицин, и гаммарадиация вызывали повышение уровня метилирования р53 по К372. При этом важно отметить, что уровень клеточного Set7/9 не изменялся при индукции повреждений ДНК.

В 293F клетках, в отличие от U2ОS, уровень р53 не повышался в ответ на обработку доксорубицином, поскольку р53 в этих клетках уже стабилизирован за счет присутствия аденовирусных белков. Еще один важный момент состоит в том, что метилирование белка р53 по К372 в ответ на повреждение ДНК, скорее всего, является общим механизмом для большинства типов клеток, поскольку оно наблюдается во всех типах клеток, которые мы проверяли (U2ОS, НЕК293, НСТ116 MCF-7).

Рис. 9. Повреждения ДНК вызывают усиление метилированияр53.

А. Иммунопреципитация метилированного р53 с помощью anti-p53-K372me антител из ядерного экстракта клеток 293F, обработанных и не обработанных доксорубицином.

ИП-иммунопреципитация.

Б. Анализ метилирования р53 в U2ОS клетках, обработанных доксорубицином и гамма-радиацией. Уровни экспрессии Set7/9, p53, а также метилированного рбыли определены иммуноблоттингом с использованием специфических антител.

Уровень белка Кu80 в пробах служил в качестве контроля количества вносимого материала..

2.3. Метилирование р53 по К372 вызывает стабилизацию и активацию р53 in vivo.

Чтобы выяснить функциональные последствия метилирования р53 ферментом Set7/9 in vivo, мы решили проверить влияние Set7/9 на динамику накопления р53 и его основной транскрипционной мишени p21/WAF/CIP в ответ на повреждение ДНК. Для этой цели мы сконструировали две изогенные клеточные линии на базе U2ОS, одна из которых стабильно экспрессировала неспецифическую малую интерферирующую РНК (контроль), а другая - малую интерферирующую РНК, специфичную к последовательности Set7/(shSet7/9). Оба типа клеток были подвергнуты воздействию доксорубицина для активации метилирования р53 (Рис. 10). Как и следовало ожидать, повреждения ДНК, вызываемые доксорубицином, в контрольных клетках стабилизировали р53, вызывая индукцию экспрессии гена p21/WAF. В клетках shSet7/9 накопление р53 происходило с запозданием, что приводило к пониженной, относительно клеток дикого типа, экспрессии p21/WAF.

Результаты этого эксперимента дают основания предполагать, что метилирование р53К372 участвует в стабилизации белка при генотоксичексом стрессе.

Логично было предположить, что экзогенная сверхэкспрессия Set7/9 должна еще более эффективно стабилизировать белок р53 и, соответственно, приводить к гиперэкспрессии p21/WAF. Проведенные нами эксперименты подтвердили это предположение (Рис. 11).

Поскольку р53 также участвует в запуске апоптоза, мы решили проверить влияние сверхэкспрессии Set7/9 дикого типа и его каталитически неактивного мутанта на эту функцию р53 (Рис. 12). Для этого мы сравнили количества образующихся Аннексин Vположительных апоптотических клеток после обработки доксорубицином в контрольной линии и в двух полученных из нее производных клеточных линий, экспрессирующих либо Set7/9 дикого типа, либо его каталитически неактивный мутант.

Рис. 11. ОТ-ПЦР анализ экспрессии Рис.10. Ингибирование экспрессии Set7/9 p21/WAF в исходных клетках U2ОS и ослабляет стабилизацию р53 и экспрессию стабильно экспрессирующих Set7/9 после белка p21/WAF в ответ на повреждение ДНК. обработки клеток доксорубицином. За Анализ Set7/9, p53, p21 и Кu80 методом единицу брался уровень сигнала экспрессии иммуноблоттинга в клетках U2OS, стабильно p21/WAF в контрольных клетках, не инфицированных неспецифической обработанных доксорубицином.

интерферирующей shRNA (контроль) и специфичной к Set 7/9 интерферирующей shRNA (shRNA-Set7/9). Обе клеточные линии были протестированы на экспрессию указанных выше белков на различных временных точках после повреждения ДНК доксорубицином.

Клетки, сверх-экспрессирующие Set7/9 дикого типа, более интенсивно окрашивались Аннексином, по сравнению с исходными клетками. При этом клетки, экспрессирующие каталитически неактивный фермент Set7/9 не претерпевали апоптоз даже в ответ на повреждение ДНК (Рис. 12А, сравнить панели 3 и 4 с 5 и 6). По всей видимости, метилтрансферазная активность Set7/9 является необходимым условием для индукции р53-зависимого апоптоза. Длительная экспрессия мутантного Set7/9 в U2ОS клетках приводила к уменьшению уровня р53, что подкрепляет предположение о функциональном взаимодействии между р53 и Set7/9 (Рис.12Б).

2.4. р53-К372 метилирование - это ранняя ковалентная модификация, возникающая в ответ на генотоксический стресс.

В связи с тем, что в ответ на повреждения ДНК р53 претерпевает множество посттрансляционных модификаций, разнесенных по времени и выполняющих разные функции, представлялось важным изучить динамику р53-К372 метилирования. Для решения этой задачи мы решили проследить кинетику р53-специфической метилирующей активности фермента Set7/9, выделенного из клеток, обработанных доксорубицином и собранных через различные временные промежутки (Рис. 13). Мы обнаружили, что активность Set7/9 под действием доксорубицина изменяется нелинейно и имеет два пика, один на 45 минуте после генотоксического стресса, а другой - через 4.5 часа.

Рис. 12. BлияниеSet7/9 на апоптоз в клетках U2ОS. А.

Контрольные клетки U2ОS (1, 2), клетки,стабильно экспрессирующие Set7/9 дикого типа (3, 4), или его неактивный мутант были обработаны доксорубицином в концентрации 2 мкМ в течение 24 часов, чтобы вызвать апоптоз. Уровень апоптоза измеряли проточной цитометрией после окрашивания клеток Annexin V-FITC и пропидием иода, чтобы исключить некротические клетки. Б.

Анализ содержания р53 в изогенных клеточных линиях до и после обработки доксорубицином. В качестве контроля использовали сигнал на тубулин.

При этом, ни уровень белка, ни внутриклеточная локализация Set7/9 не изменялись.

Наши последующие эксперименты показали, что, по-видимому, активность Set7/регулируется фосфорилированием за счет одной из пока не определенных киназ, активируемых повреждениями ДНК.

Несмотря на то, что фермент Set7/9 был открыт как гистон-специфическая метилтрансфераза, он оказался не способен метилировать нуклеосомные гистоны, которые являются физиологическим субстратом для аутентичных гистон-трансфераз. Поскольку КМТазная активность эндогенного Set7/9 увеличивалась после повреждения ДНК, мы перепроверили способность Set7/9, выделенного из доксорубициновых клеток, метилировать нуклеосомные гистоны. Мы обнаружили, что даже после повреждения ДНК Set7/9 не мог эффективно метилировать этот субстрат. Исходя из этих результатов, мы Рис.13. Динамика изменения активности Set7/после генотоксического стресса, вызванного доксорубицином. Иммунопреципитированный Set7/9 на разных временных точках проверялся на метилирующую активность с использованием рекомбинантного р53 в качестве субстрата.

предлагаем впредь называть Set7/9 не гистон-специфической, а фактор-специфической метилтрансферазой. Тем не менее, в литературе существуют данные о том, что Set7/регулирует метилирование К4-НЗ при активации гена инсулина в бета-клетках (Chakrabarti et al. 2003). Скорее всего, авторы этих публикаций столкнулись с опосредованным влиянием Set7/9 на метилирование К4-НЗ за счет деградации ДНКспецифической метилтрансферазы DNMT1, активность которой репрессирует появление этой ковалентной модификации в гистоне НЗ (Esteve et al. 2009; Wang et al. 2009).

2.5. Метилирование по остатку К372 стабилизирует и активирует р53 за счет усиления его ацетилирования.

Метилирование р53 в ответ на повреждение ДНК приводит к стабилизации белка.

Один из возможных механизмов заключается в том, что метилирование белка р53 по положению КЗ72 напрямую конкурирует с убиквитинированием пяти других остатков лизина, расположенных в карбоксильной части молекулы. Мы экспериментально проверили эту возможность, сравнив степень убиквитилирования в метилированном и неметилированном р53, выделенным из клеток после трансфекции соответствующими плазмидами. Мы не обнаружили значительной разницы по убиквитилированию между диким типом и мутантным р53. Таким образом, наши результаты свидетельствуют о том, что метилирование лишь одного из пяти потенциальных сайтов убиквитилирования напрямую не влияет на эффективность убиквитилирования р53.

Каким же образом метилирование К372 оказывает влияние на стабильность р53? Если учесть, что (а) К372 находится в непосредственной близости к сайтам ацетилирования (КЗ73, К381, КЗ82), и (б) ацетилирование напрямую конкурирует с убиквитинированием, то вполне логично предположить, что метилирование по КЗкаким-то образом влияет на эффективность ацетилирования р53. Более того, известно, что в случае гистона НЗ метилирование по остатку К4 приводит к увеличению ацетилирования аминокислотных остатков К9 и К14.

В связи с этим, мы решили проверить, влияет ли метилирование р53 по К372 на его ацетилирование. Для этого мы сравнили динамику накопления ацетилированного р53 в U2ОS клетках с нормальной и подавленной экспрессией метилазы Set7/9 (Рис. 14) в ответ на обработку доксорубицином. Поскольку в клетках с пониженной экспрессией Set7/уровень р53 ниже, чем в контрольных клетках, нам пришлось сначала нормализовать полученные экстракты по уровню экспрессии р53, а уже только затем сравнивать их по уровню сигнала ацетилирования р53. В согласии с ранее полученными данными, р53 К372специфическое метилирование является ранней модификацией в ответ на повреждение ДНК и предшествует появлению ацетилирования. Как и ожидалось, метилирования р53 не наблюдалось в клетках с низким уровнем экспрессии Set7/9. Важно отметить, что уровень ацетилирования р53 в этих клетках был также значительно ниже уровня соответствующей модификации в контрольных клетках. При этом количества р53 в обоих вариантах были Рис.14. Динамика метилирования и ацетилирования р53 в ответ на повреждение ДНК. Клетки U2OS, экспрессирующие контрольную (контр.) и Set7/9-специфическую shRNA (shRNA-Set7/9) обрабатывали доксорубицином в течение указанных промежутков времени и соответствующие клеточные экстракты нормализовали по уровню экспрессии р53 методом иммуноблоттинга. Затем эти же, но уже нормализованные по р53, экстракты анализировали на присутствие модификаций метилирования и ацетилирования.

выравнены.

Полученные результаты косвенно подтверждают нашу гипотезу о том, что метилирование р53 усиливает его ацетилирование.

Чтобы более детально изучить этот вопрос, мы также провели серию экспериментов in vitro с химически ацетилированными и метилированными карбоксильно-концевыми пептидами р53 (а.к. 367-386). Используя эти пептиды, мы сравнили кинетику Set7/9-опосредованного метилирования фрагмента р53, предварительно ацетилированного по позициям К373 и К382, с кинетикой метилирования немодифицированного пептида. Мы также выполнили реципрокный эксперимент, в котором мы сравнили эффективность рЗ00-зависимого ацетилирования преметилированного по К372 пептида р53 по отношению к немодифицированному пептиду.

Рис. 15. Мутации в сайте метилирования К372 приводят к уменьшению ацетилирования р53. Клетки Н1299 (р53-) были трансфецированы р53 дикого типа или его неметилирующимся мутантом K372R. После обработки доксорубицином клетки были фракционированы на растворимую и нерастворимую фракции.

Содержание белка р53 в обеих фракциях было выравнено иммуноблоттингом. Уровни ацетилирования р53 были проанализированы иммуноблоттингом, используя антитела к ацетилированному р53. За единицу принимались значения уровней содержания и ацетилирования р53 дикого типа.

Мы обнаружили, что ацетилирование ингибировало последующее метилирование р53.

Наоборот, предварительное метилирование, не только не ингибировало, но и слегка усиливало последующее ацетилирование р53 с помощью рЗ00. На основании результатов этих экспериментов модификации могут существовать на одной молекуле р53, и 2) В этом случае, метилирование должно предшествовать ацетилированию. Эти данные подтверждают наши первоначальные выводы о том, что метилирование рспособно усиливать его последующее ацетилирование. Чтобы непосредственно продемонстрировать влияние р53-К372 метилирования на ацетилирование, мы сравнили уровни ацетилирования р53 дикого типа и его неметилируемого мутанта в клетках Н1299, обработанных доксорубицином (Рис. 15). Поскольку наиболее сильное метилирование рмы наблюдали в нерастворимой фракции клеточного экстракта, которая обогащена хроматином, мы решили расфракционировать экстракты трансфецированных клеток на растворимую и нерастворимую фракции и раздельно проанализировать полученный материал на присутствие ацетилированного белка р53. Мы не заметили большой разницы между ацетилированием метилируемого и неметилируемого р53 в растворимых фракциях.

При этом мы наблюдали большое различие в уровнях ацетилирования между р53 дикого типа и его мутантом в нерастворимой фракции (Рис.15, верхняя левая панель). Этот результат прямо указывает на то, что метилирование необходимо для эффективного ацетилирования той фракции белка р53, которая ассоциирована с хроматином и, соответственно, транскрипционно-активна.

Наши эксперименты по иммунопреципитации хроматина, отражающей связывание р53 с ДНК, подтвердили этот вывод, показав, что р53, ассоциированый с промотором гена p21/WAF, претерпевает модификации метилирования и ацетилирования в ответ на обработку клеток доксорубицином. Более того, количество ацетилированного р53, связанного с ДНК, зависит от присутствия в клетках активной метилазы Set7/9 и, соответственно, метилирования р53.

Таким образом, есть все основания утверждать, что существует положительная связь между метилированием лизина К372 и ацетилированием лизинов К373 и 382 в карбоксильном конце молекулы р53. Сходная ситуация наблюдается в аминоконцевой последовательности гистона НЗ, где метилирование К4 ослабляет репрессирующее метилирование К9 и дает возможность ГAT Gcn5 проацетилировать К9 и К14. Продолжая аналогию с гистонами, Недавно было показано, что р53 метилируется не только Set7/9, но и еще как минимум двумя лизин-специфическими метилтрансферазами: Smydметилирует р53 по лизину К370 (Huang et al. 2006), a Set8 - по лизину К382 (Shi et al.

2007). В отличие от К372, метилирование по обоим этим сайтам ведет к транскрипционной репрессии р53. Любопытен тот факт, что в результате генотоксического стресса метилирование по К370 снижается за счет повышения метилирования р53 по К372. Последнее, по всей видимости, разрушает субстратферментное связывание р53 с Smyd2 (Huang et al. 2006).

Необходимо также упомянуть, что, в соответствии с нашими предсказаниями о ковалентных модификациях р53 на основе гистоновых модификаций в местах его связывания с хроматином, недавно была обнаружена новая модификация р53 аргининовое метилирование (Jansson et al. 2008).

Неясным остается вопрос о взаимодействии метилирования и ацетилирования с другими посттрансляционными модификациями р53, например, фосфорилированием.

Несмотря на то, что этот аспект регуляции р53 не входил в рамки данного исследования, основываясь на полученных результатах по кинетике метилирования, можно предположить, что фосфорилирование предшествует или протекает одновременно с метилированием. Поэтому вполне вероятно, что фосфорилирование может участвовать в регуляции каскада метилирования-ацетилирования р53 в ответ на повреждения ДНК.

3. Роль К372-специфического метилирования и ацетилирования р53 в регуляции экспрессии микро-РНК.

Некодирующие малые РНК (микро-РНК) играют важную роль в ключевых процессах развития и жизнедеятельности многоклеточных организмов. В зависимости от степени комплементарности к последовательностям генов-мишеней, эти короткие двухцепочечные РНК могут работать как по механизму малых интерферирующих РНК, вызывая деградацию соответствующих иРНК, так и на уровне трансляции, подавляя формирование полирибосом.

Одной из наиболее полно описанных функций микро-РНК является их участие в онкогенезе. В зависимости от роли генов-мишеней в этом процессе, микро-РНК могут как усиливать, так и тормозить трансформацию клеток. Недавно было показано, что р53, один из важнейших онкосупрессоров у человека, активирует транскрипцию как минимум трех вариантов микро-РНК 34 (Hermeking 2007). Эти микро-РНК подавляют экспрессию генов пролиферации (CDK4, циклин D1) и ингибиторов клеточной смерти (Вс12) и, тем самым, кооперируются с р53 в процессах индукции остановки клеточного цикла и апоптоза в ответ на повреждения ДНК. Вышеописанный механизм объясняет давно известный феномен репрессии транскрипции многих генов при активации р53 в результате генотоксического стресса.

Тем не менее, этот механизм вряд ли является универсальным, потому что многие раковые клеточные линии, обладающие «нормальным» р53-зависимым ответом в ответ на генотоксический стресс, либо вообще не экспрессируют микро-РНК семейства 34, либо делают это на очень низком уровне. Данный факт свидетельствует о том, что помимо микро-РНК-34, скорее всего, существуют другие микро-РНК, которые также регулируются р53 и участвуют в клеточном ответе на повреждения ДНК.

3.1. р53 активирует транскрипцию миРНК-26а и репрессирует миРНК-16-2 в ответ на повреждение ДНК.

Исходя из вышесказанного, мы предприняли попытку идентифицировать новые микро-РНК, участвующие в р53-регулируемом ответе на генотоксический стресс. В поисках р53-зависимых микро-РНК, мы сравнили экспрессию 550 известных микро-РНК в клетках U2ОS, нормально экспрессирующих р53, с клетками, в которых экспрессия рбыла понижена за счет стабильно экспрессирующейся специфической малой интерферирующей РНК (Рис. 16).

Рис. 16. Уровень экспрессии р53 в клетках U2ОS с нормальной (контроль) и пониженной за счет специфической малой интерферирующей РНК (shRNAp53) экспрессией р53 в ответ на обработку доксорубицином.

Таблица 1. Результаты геномного анализа экспрессии ми-РНК, зависящих от р53 и повреждений ДНК.Клетки U2ОS, экспрессирующие неспецифическую (U2ОS) и специфическую к рмалую интерферирующую РНК (U2ОS-KDp53), были обработаны доксорубицином в течение часов. После чего из обеих линий была выделена РНК, превращена в кДНК, помечена Су3 и гибридизована с микрочипами, содержащими 5различных миРНК в виде проб. Результаты экспрессии р53-зависимых миРНК представлены в таблице.

В результате геномного анализа экспрессии микро-РНК с помощью гибридизации на микрочипах мы обнаружили несколько новых микро-РНК, регулируемых р53 в ответ на повреждения ДНК (Таблица 1). р53 разнонаправленно регулировал экспрессию этих микро-РНК, активируя транскрипцию одной (миРНК-26a) и репрессируя транскрипцию другой микро-РНК (миРНК-16-2). Данные гибридизации на микрочипах были независимо подтверждены количественным ОТ-ПЦР в реальном времени.

3.2. миРНК-26a и миРНК-16-2 оказывают разнонаправленное влияние на р53зависимый апоптоз.

Для того, чтобы изучить вклад этих ми-РНК в процессы р53-зависимой остановки клеточного цикла и апоптоза, мы искусственно сверхэкспрессировали в U2ОS клетках либо соответствующие предшественники ми-РНК 16-2 и 26а, либо их антисмысловые гомологи. Трансфецированные клетки затем обрабатывали доксорубицином и анализировали проточной цитофлуометрией. Результаты этих экспериментов показали, что миРНК-26a и миРНК-16-2 воздействуют на апоптоз разнонаправленно: миРНК-26a усиливает, а миРНК-16-2 репрессирует р53-зависимый апоптоз (Рис. 16 А и Б соответственно). Полученные нами данные о том, что миРНК-16-2 подавляет апоптоз, вызывая временную остановку клеток в G1 фазе, оказались для нас весьма неожиданными, поскольку они противоречили ранее опубликованным результатам о том, что одной из главных мишеней миРНК-16, по-крайней мере в Б-лимфоцитах, является анти-апоптотический белок Вс1-2 (Cimmino et al. 2005). В процессе подготовки материалов для публикации вышло несколько статей, ставящих под сомнение опубликованные ранее результаты о миРНК-16-зависимой репрессии bcl-2 (Linsley et al.

2007; Liu et al. 2008). В этих статьях описывались новые мишени миРНК-16, включающие в себя несколько важнейших регуляторов клеточного цикла: CDK6, циклин D1, циклин Е1.

Соответственно, сверхэкспрессия миРНК-16 в клетках в НСТ116 вызывала остановку клеток в G1 фазе, но не апоптоз.

Предшественник миРНК Предшественник миРНК Рис. 16. миРНК-26a и миРНК-16-2 разнонаправленно влияют на р53-зависимый апоптоз. А.

Неспецифическая ми-РНК (SCR), предшественник миРНК-26 a (P26), миРНК-34 (P34) и их соответствующие антагонисты (А26 и А34) были трансфецированы в р53+ и р53- клетки НСТ116.

Трансфецированные клетки обрабатывали доксорубицином, окрашивали пропидием йода и анализировали проточной цитофлуометрией. Столбиками представлены доли апоптотических клеток в каждом случае. Б.

Те же клетки были трансфецированы контрольной ми-РНК и предшественниками миРНК-15 (P15), миРНК16 (P16) и миРНК26 (P26) и их соответствующими антагонистами. Последующую обработку и анализ клеток проводили как описано.

3.3. К372-специфическое метилирование р53 необходимо для эффективной репрессии миРНК-16.

Как мы показали ранее, К372 метилирование и ацетилирование р53 являются необходимыми условиями активации р53. Нужно также отметить, что р53 способен не только активировать транскрипцию генов-мишеней, но и репрессировать их. Хотя молекулярные механизмы этого феномена еще плохо изучены, но известно, что для эффективной репрессии р53 должен быть ацетилирован и, возможно, метилирован (Basile et al. 2006). Также известно, что р53 способен напрямую репрессировать определенные гены.

Мы решили выяснить, является ли активация миРНК-26a и репрессия миРНК-16-следствием непосредственного связывания р53 с промоторными областями этих генов, или же опосредованы другими механизмами. Результаты иммунопреципитации хроматина показали, что р53 напрямую связывается с промоторами обоих генов. Более того, р53, связанный с промоторами миРНК-26a и миРНК-16-2, оказался ацетилирован и метилирован. Таким образом, возможно один и тот же спектр модификаций присутствует как в «активирующей», так и в «репрессирующей» форме белка р53.

Поэтому до сих пор непонятно, что является ключевым моментом, определяющим способность р53 активировать одни гены и репрессировать другие. Одним из объяснений специфичности действия р53 может служить организация его сайтов связывания с ДНК в промоторах конкретных генов, т.е. зависимость от организации хроматина и перекрывания с сайтами связывания других транскрипционных факторов (например, с репрессором NF-Y) (Imbriano et al. 2005). Другая возможность состоит в том, что «активирующую» и «репрессирующую» форму р53 может отличать какая-нибудь новая, пока не изученная, ковалентная модификация. Будущие эксперименты должны определить, какая из этих гипотез наиболее правомерна.

3.4. Ингибирование экспрессии Set7/9 вызывает реактивацию экспрессии миРНК-16.

Мы решили оценить вклад метилирования в эффективности р53-зависимой репрессии миРНК-16-2. Для этого мы определили уровни экспрессии миРНК-16-2 в U2ОS клетках с нормальной и пониженной экспрессией Set7/9 (shRNA-Set7/9) до и после обработки доксорубицином. Если метилирование важно для р53-опосредованной репрессии миРНК-16-2, то отсутствие Set7/9 должно привести к активации миРНК-16-2 и, соответственно, преимущественному остановка клетоку клеток в G1 фазе.

Рис.17. Уровень экспрессии миРНК-16 зависит от присутствия р53 и Set7/9. Контрольные U2OS клетки и их производные с пониженной экспрессией Set7/9(U2OSshRNASet7/9) и р53 (U2OS-shRNAp53) обрабатывали доксорубицином и анализировали методом ОТ-ПЦР в реальном времени, используя праймеры для миРНК-16.

Уровень сигнала нормализован по уровню сигнала гена домашнего хозяйства GAPDH.

Как видно на рисунке 17, подавление Set7/9 приводило к активации экспрессии миРНК-16, означая, что р53-К372 метилирование функционально значимо. Нужно признать, что существует теоретическая вероятность того, что Set7/9 может регулировать экспрессию миРНК-16-2 независимо от р53. Тем не менее, наши данные о том, что Set7/не влияет на уровень транскрипции миРНК-16-2 в отсутствие р53, делают такой вариант маловероятным.

3.5. Ингибирование экспрессии Set7/9 вызывает остановку клеток в Gфазе, фенотипически схожее с действием миРНК-16.

Еще одно следствие, вытекающее из нашей гипотезы, состоит в том, что в отсутствие Set7/9-опосредованного метилирования р53 должен терять способность к репрессии миРНК-16-2 и, соответственно, должно происходить снижение уровня экспрессии циклинов Dl, E1 и киназы CDK6, которые являются мишенями миРНК-16-2.

Если снижение экспрессии этих белков будет достаточно значительным, то клетки, после повреждения ДНК доксорубицином, вместо преимущественной остановки в G2 фазе, должны будут останавливаться в G1 фазе. Сравнительный анализ экспрессии циклинов Е и Dl, a также циклин-зависимой киназы Cdk6 в клетках с нормальной и пониженной экспрессией Set7/9 подтвердил верность наших предположений (Рис. 18). Важно отметить тот факт, что экспрессия гена CDK4, который не является мишенью миРНК-16, практически не менялся в отстутствие Set7/9, что свидетельствует о миРНК-16специфическом эффекте.

Рис. 18. Экспрессия белков, участвующих в клеточном цикле, зависит от присутствия Set7/9. Контрольные U2ОS клетки и их стабильно-трансфецированные производные с пониженной экспрессией Set7/9 были проанализированы на предмет экспрессии указанных белков методом иммуноблоттинга до и после обработки доксорубицином.

Чтобы проверить наше предположение о том, что репрессия Set7/9 может вызывать миРНК-16-опосредованное влияние на клеточный цикл, мы проверили распределение U2ОS клеток с нормальной и пониженной экспрессией Set7/по клеточному циклу до и после обработки доксорубицином. Результаты этого эксперимента убедительно доказывают правомочность нашей гипотезы, так как наблюдается существенная задержка клеток с пониженным содержанием Set7/9 в G1 фазе по сравнению с контрольными клетками (Рис. 19). Важно отметить, что в клетках с пониженным содержанием Set7/9 p21/WAF экспрессируется на очень низком уровне и поэтому не может служить причиной задержки клеточного цикла в G1 фазе (Ivanov et al.

2007).

Рис. 19. Анализ распределения U2ОS клеток с нормальным (контроль) и пониженным содержанием Set7/9 (shRNASet7/9) по клеточному циклу до и после обработки доксорубицином.

Заключение Трудно переоценить значение р53 в клетке. Этот белок обладает чрезвычайно широким спектром действия, участвуя в репарации ДНК, регуляции репликации, клеточного цикла и апоптоза. Соответственно, механизмы, контролирующие его активность, также чрезвычайно разнообразны и сложны. Пост-трансляционные ковалентные модификации (ПТМ) играют важную роль в регуляции стабильности р53.

Поскольку свою основную функцию - поддержание стабильности генома в условиях генотоксического стресса - р53 выполняет как транскрипционный фактор, то ПТМ также влияют и на транскрипционную активность р53.

Активность транскрипционного фактора определяется его способностью связываться с ДНК и привлекать к промоторам транскрипционные комплексы. Ядерная ДНК упакована в хроматин, делая её недоступной для свободного связывания с транскрипционной машинерией. Степень подвижности хроматина и, в свою очередь, доступность ДНК определяется такими ПТМ как ацетилирование и метилирование.

Соответственно, одна из задач транскрипционного фактора - это привлечь гистонспецифические ацетилазы и метилазы к регуляторным областям гена, чтобы вызвать ремоделирование хроматина. Определенный набор ПТМ в амино-концах гистонов способен также привлекать АТФ-зависимые ремоделирующие комплексы, которые позволяют связаться РНК полимеразе с ДНК и начать транскрипцию. В связи с этим, нами и другими было показано, что ацетилирование влияет не только на стабильность р53, но и на его способность эффективно рекрутировать гистон-ацетилирующие комплексы, которые, изменяя физико-химические свойства хроматина, способствуют запуску транскрипции.

В последнее время появляется все больше публикаций о том, что гистонспецифические ферменты bona fide таковыми не являются и способны модифицировать многие негистоновые белки, в частности транскрипционные факторы. Поскольку последние непосредственно контактируют с хроматином, то, основываясь на инфомации о присутствующих модификациях гистонов в области связывания транскрипционного фактора, можно с большой степенью вероятности предсказать возможные модификации этого транскрипционного фактора. Используя именно этот подход, мы открыли новую ПТМ р53 - лизиновое метилирование. Оказалось, что в ответ на повреждение ДНК лизинспецифическая метилтрансфераза Set7/9 осуществляет метилирование р53 по К372.

Метилирование р53 стимулирует появление другой ПТМ - ацетилирования, что ведет к стабилизации и активации белка.

Учитывая важность модификации К372 метилирования для активации р53, можно было предположить, что этот сайт будет мутирован в злокачественных опухолях. Анализ базы данных мутаций в гене р53 в различных опухолях не дал положительного результата.

Нужно отметить, что наряду с сайтом метилирования важнейшие сайты фосфорилирования (S20) и ацетилирования (КЗ82) р53 также не подвержены мутациям в опухолях. Этот факт свидетельствует о том, что различные пост-трансляционные модификации могут функционально перекрываться. Поэтому одиночная мутация по сайту метилирования, если бы она и появилась в результате спонтанного мутагенеза, не дала бы преимущества для роста опухолевых клеток. Это связано с тем, что полной инактивации р53 (как в случае с мутациями в ДНК-связывающем домене) не произошло бы в связи с тем, что активирующая модификация ацетилирования, хотя и на низком уровне, в рсохранилась бы.

Метилирование по К372 и ацетилирование по К373/К382 необходимы как для р53зависимой трансактивации, так и для репрессии. Нами было обнаружено, что в ответ на генотоксический стресс р53 репрессирует транскрипцию ми-РНК-16-2. Эффективность репрессии зависела от метилирования р53 ферментом Set7/9.

В ответ на двухцепочечные повреждения ДНК раковые клетки в основном претерпевают остановка клеточного цикла а не апоптоз. Молекулярные причины этого феномена до сих пор остаются до конца не выясненными. В последнее время появилось много публикаций, описывающих распределение клеток по циклу в зависимости от экспрессии различных микро-РНК. В частности, было показано, что в эпителиальных клетках миРНК-16 вызывает остановку клеточного цикла в G1 фазе.

В связи с этим, наши данные могут представлять интерес для молекулярных онкологов: нам удалось показать, что сочетаное воздействие ДНК-повреждающего препарата доксорубицина с репрессией ми-РНК-16 усиливает гибель раковых клеток от апоптоза. Мы объясняем этот феномен тем, что отсутствие (или сокращение) фазы Gклеточного цикла, за счет уменьшения количества ми-РНК-16, не дает возможности раковым клеткам осуществить репарацию поврежденной ДНК перед репликацией и, соответственно, ведет к неправильному митозу и смерти.

Выводы 1. Роль рЗ00/СВР-зависимого ацетилирования состоит не только в стабилизации белка р53, но и приводит к усилению взаимодействия между вышеупомянутыми белками, в результате которого повышается ацетилирование гистнов в промоторной области гена p21/WAF.

2. Анализ спектров модификаций гистонов, располагающихся в промоторных областях р53-зависимых генов, позволяет предсказать возможные модификации в самом р53. Используя данный подход, была обнаружена новая ковалентная пост-трансляционная модификация р53 - метилирование по лизину КЗ72.

3. К372-специфическое метилирование осуществляемое лизин-специфической метилтрансферазой Set7/9, приводит к стабилизации белка р53 в ответ на обработку клеток доксорубицином и вызывает остановку клеточного цикла и апоптоз.

4. Метилирование по К372 - это ранняя модификация р53, которая способствует появлению другой модификации, ацетилирования, за счет которой и происходит стабилизация белка.

5. Повреждение ДНК за счет обработки клеток доксорубицином вызывает изменения экспрессии нескольких р53-зависимых миРНК: повышается уровень миРНК-26 и снижается уровень миРНК-16-2.

6. Одновременное повышение уровня миРНК-26а и понижение миРНК-16-2 в зависимости от р53 приводит к усилению апоптоза раковых клеток в ответ на обработку клеток доксорубицином.

7. р53, связанный с промоторами генов миРНК-26а и миРНК-16-2, ацетилируется и метилируется. Эффективность р53-зависимой репрессии миРНК-16-2 зависит от его метилирования.

8. Ингибирование экспрессии Set7/9 в клетках, обработанных доксорубицином, приводит к повышению уровня экспрессии миРНК-16, снижению уровней циклинов Е1 и D1, циклин-зависимой киназы Cdk6 и, как следствие, остановке клеток в фазе Gнесмотря на низкий уровень экспрессии p21/WAF.

Список цитируемой литературы Ashcroft, М., М.Н. Kubbutat, and K.H. Vousden. 1999. Regulation of p53 function and stability by phosphorylation. Mol Cell Biol 19: 1751-8.

Barlev, N.A., R. Candau, L. Wang, P. Darpino, N. Silverman, and S.L. Berger. 1995.

Characterization of physical interactions of the putative transcriptional adaptor, ADA2, with acidic activation domains and TATA-binding protein. J Biol Chem 270: 19337-44.

Barlev, N.A., A.V. Emelyanov, P. Castagnino, P. Zegerman, A.J. Bannister, M.A. Sepulveda, F.

Robert, L. Tora, T. Kouzarides, B.K. Birshtein, and S.L. Berger. 2003. A novel human Ada2 homologue functions with Gcn5 or Brgl to coactivate transcription. Mol Cell Biol 23: 6944-57.

Barlev, N.A., L. Liu, N.H. Chehab, K. Mansfield, K.G. Harris, T.D. Halazonetis, and S.L. Berger.

2001. Acetylation of p53 activates transcription through recruitment of coactivators/ histone acetyltransferases. Mol Cell 8: 1243-54.

Basile, V., R. Mantovani, and С Imbriano. 2006. DNA damage promotes histone deacetylase nuclear localization and repression of G2/M promoters, via p53 C-terminal lysines. J Biol Chem 281:2347-57.

Chakrabarti, S.K., J. Francis, S.M. Ziesmann, J.С Garmey, and R.G. Mirmira. 2003. Covalent histone modifications underlie the developmental regulation of insulin gene transcription in pancreatic beta cells. J Biol Chem 278: 23617-23.

Chuikov, S., Y. Kurash, J.R. Wilson, B. Xiao, N. Justin, G. Ivanov, K. McKinney, P. Tempst, С.

Prives, S. Gamblin, N. Barlev, and D. Reinberg. 2004. Regulation of p53 activity through lysine methylation. Nature 432: 353-360.

Cimmino, A., G.A. Calin, M. Fabbri, M.V. Iorio, M. Ferracin, M. Shimizu, S.E. Wojcik, R.I.

Aqeilan, S. Zupo, M. Dono, L. Rassenti, H. Alder, S. Volinia, C.G. Liu, T.J. Kipps, M.

Negrini, and CM. Croce. 2005. miRNA-15 and miRNA-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci USA 102: 13944-9.

Espinosa, J.M. and B.M. Emerson. 2001. Transcriptional regulation by p53 through intrinsic DNA/chromatin binding and site-directed cofactor recruitment. Mol Cell 8: 57-69.

Esteve, P.O., H.G. Chin, J. Benner, G.R. Feehery, M. Samaranayake, G.A. Horwitz, S.E.

Jacobsen, and S. Pradhan. 2009. Regulation of DNMT1 stability through SET7-mediated lysine methylation in mammalian cells. Proc Natl Acad Sci USA 106: 5076-81.

Gamper, A.M. and R.G. Roeder. 2008. Multivalent binding of p53 to the STAGA complex mediates coactivator recruitment after UV damage. Mol Cell Biol 28: 2517-27.

Gu, W., J. Luo, C.L. Brooks, A.Y. Nikolaev, and M. Li. 2004. Dynamics of the p53 acetylation pathway. Novartis Found Symp. 259: 197-205; discussion 205-7, 223-5.

Gu, W. and R. Roeder. 1997. Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90: 595-606.

Gu, W., X.L. Shi, and R.G. Roeder. 1997. Synergistic activation of transcription by СВР and p53.

Nature 387: 819-823.

Harris, C.C. 1993. p53: at the crossroads of molecular carcinogenesis and risk assessment.

Science 262: 1980-1.

Hermeking, H. 2007. p53 enters the microRNA world. Cancer Cell 12: 414-8.

Huang, J., L. Perez-Burgos, B.J. Placek, R. Sengupta, M. Richter, J.A. Dorsey, S. Kubicek, S.

Opravil, T. Jenuwein, and S.L. Berger. 2006. Repression of p53 activity by Smyd2mediated methylation. Nature 444: 629-32.

Ikura, Т., V.V. Ogryzko, M. Grigoriev, R. Groisman, J. Wang, M. Horikoshi, R. Scully, J. Qin, and Y. Nakatani. 2000. Involvement of the TIP60 histone acetylase complex in DNA repair and apoptosis. Cell 102: 463-73.

Imbriano, C, A. Gurtner, F. Cocchiarella, S. Di Agostino, V. Basile, M. Gostissa, M. Dobbelstein, G. Del Sal, G. Piaggio, and R. Mantovani. 2005. Direct p53 transcriptional repression: in vivo analysis of CCAAT-containing G2/M promoters. Mol Cell Biol 25:3737-51.

Ivanov, G.S., T. Ivanova, J. Kurash, A. Ivanov, S. Chuikov, F. Gizatullin, E.M. Herrera-Medina, F. Rauscher, 3rd, D. Reinberg, and N.A. Barlev. 2007. Methylation-Acetylation Interplay Activates p53 in Response to DNA Damage. Mol Cell Biol 27: 6756-69.

Jansson, M., S.T. Durant, E.C. Cho, S. Sheahan, M. Edelmann, B. Kessler, and N.B. La Thangue.

2008. Arginine methylation regulates the p53 response. Nat Cell Biol 10: 1431-9.

Kaeser, M.D. and R.D. Iggo. 2002. Chromatin immunoprecipitation analysis fails to support the latency model for regulation of p53 DNA binding activity in vivo. Proc Natl Acad Sci USA 99: 95-100.

Lambert, P.F., F. Kashanchi, M.F. Radonovich, R. Shiekhattar, and J.N. Brady. 1998.

Phosphorylation of p53 serine 15 increases interaction with СВР. J Biol Chem 273:3304853.

Linsley, P.S., J. Schelter, J. Burchard, M. Kibukawa, M.M. Martin, S.R. Bartz, J.M. Johnson, J.M.

Cummins, C.K. Raymond, H. Dai, N. Chau, M. Cleary, A.L. Jackson, M. Carleton, and L.

Lim. 2007. Transcripts targeted by the microRNA-16 family cooperatively regulate cell cycle progression. Mol Cell Biol 27: 2240-52.

Liu, L., D.M. Scolnick, R.C. Trievel, H.B. Zhang, R. Marmorstein, T.D. Halazonetis, and S.L.

Berger. 1999. p53 sites acetylated in vitro by PCAF and p300 are acetylated in vivo in response to DNA damage. Mol. Cell. Biol. 19: 1202-1209.

Liu, Q., H. Fu, F. Sun, H. Zhang, Y. Tie, J. Zhu, R. Xing, Z. Sun, and X. Zheng. 2008. miRNA 16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 36: 5391-404.

Luo, J., F. Su, D. Chen, A. Shiloh, and W. Gu. 2000. Deacetylation of p53 modulates its effect on cell growth and apoptosis. Nature 408: 377-81.

McMahon, S.B., H.A. Van Buskirk, K.A. Dugan, T.D. Copeland, and M.D. Cole. 1998. The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell 94: 363-374.

McMahon, S.B., M.A. Wood, and M.D. Cole. 2000. The essential cofactor TRRAP recruits the histone acetyltransferase hGCN5 to c-Myc. Mol Cell Biol 20: 556-62.

Mujtaba, S., Y. He, L. Zeng, S. Yan, O. Plotnikova, Sachchidanand, R. Sanchez, N.J. ZeleznikLe, Z. Ronai, and M.M. Zhou. 2004. Structural mechanism of the bromodomain of the coactivator СВР in p53 transcriptional activation. Mol Cell 13: 251-63.

Rachez, С and L.P. Freedman. 2000. Mechanisms of gene regulation by vitamin D(3) receptor: a network of coactivator interactions. Gene 246: 9-21.

Sakaguchi, K., J.E. Herrera, S. Saito, T. Miki, M. Bustin, A. Vassilev, C.W. Anderson, and E.

Appella. 1998. DNA damage activates p53 through a phosphorylation-acetylation cascade.

Genes Dev. 12: 2831-2841.

Scolnick, D.M., N.H. Chehab, E.S. Stavridi, M.C. Lien, L. Caruso, E. Moran, S.L. Berger, and T.D. Halazonetis. 1997. CREB-binding protein and p300/CBP-associated factor are transcriptional coactivators of the p53 tumor suppressor protein. Cancer Res. 57: 36933696.

Shi, X., I. Kachirskaia, H. Yamaguchi, L.E. West, H. Wen, E.W. Wang, S. Dutta, E. Appella, and O. Gozani. 2007. Modulation of p53 function by SET8-mediated methylation at lysine 382. Mol Cell27: 636-46.

Sterner, D.E. and S.L. Berger. 2000. Acetylation of histones and transcription-related factors.

Microbiol Mol Biol Rev 64: 435-59.

Sykes, S.M., H.S. Mellert, M.A. Holbert, K. Li, R. Marmorstein, W.S. Lane, and S.B. McMahon.

2006. Acetylation of the p53 DNA-binding domain regulates apoptosis induction. Mol Cell 24: 841-51.

Tang, Y., J. Luo, W. Zhang, and W. Gu. 2006. Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis. Mol Cell 24: 827-39.

Vassilev, A., J. Yamauchi, T. Kotani, С Prives, M.L. Avantaggiati, J. Qin, and Y. Nakatani. 1998.

The 400 kDa subunit of the PCAF histone acetylase complex belongs to the ATM superfamily. Molecular Cell 2: 869-875.

Wang, J., S. Hevi, J.K. Kurash, H. Lei, F. Gay, J. Bajko, H. Su, W. Sun, H. Chang, G. Xu, F.

Gaudet, E. Li, and T. Chen. 2009. The lysine demethylase LSD1 (KDM1) is required for maintenance of global DNA methylation. Nat Genet 41: 125-9.

Waterman, M., J. Waterman, and T. Halazonetis. 1996. An engineered four-stranded coiled coil substitutes for the tetramerization domain of wild type p53 and alleviates transdominant inhibition by tumor-derived p53 mutants. Cancer Res. 56: 158-163.

Список публикаций по теме диссертации 1. Barlev, N.A. and Borchsenius, S.N. 1991. Continuous distribution of Mycoplasma genome sizes. Biomed. Sci. 2: 641-645.

2. Nikonov, A.V., Barlev, N.A., and Borchsenius, S.N. 1992. Molecular biological differences between strains of mycoplasma gallisepticum. Цитология 34: 107-112.

3. Barlev, N.A*., Chen, Y.*, Westergaard, O., and Jakobsen, B.K. 1993. Identification of the C-terminal activator domain in yeast heat shock factor: independent control of transient and sustained transcriptional activity. EMBO J. 12: 5007-5018.(*co-first authors).

5. Barlev, N.A., Candau, R., Wang, L., Darpino, P., Silverman, N., and Berger, S.L.

1995. Characterization of physical interactions of the putative transcriptional adaptor, ADA2, with acidic activation domains and TATA-binding protein. J. Biol. Chem.

270: 19337-19344.

6. Candau, R., Moore, P., Wang, L., Barlev, N.A., Ying, C, and Berger, S.L. 1996.

Identification of functionally conserved human homologues of the yeast adaptors ADA2 and GCN5. Mol Cell Biol 16: 593-602.

7. Wang, L., Mizzen, C, Ying, C, Candau, R., Barlev, N., Brownell, J., Allis, С D., and Berger, S.L. 1997. Histone acetyltransferase activity is conserved between yeast and human GCN5, and is required for complementation of growth and transcriptional activation. Mol Cell Biol Г7: 519-527.

8. Barlev, N.A., Poltoratsky, V., Owen-Hughes, Т., Ying, C, Liu, L., Workman, J., and Berger, S.L. 1998. Regulation of GCN5 histone acetyltransferase activity via bromodomain-mediated binding and phosphorylation by the Ku/DNA-PK complex.

Mol Cell Biol 18: 1349-1358.

9. Jensen, D. E., Proctor, M., Marquis, S. Т., Gardner, H. P., Ha, S. I., Chodosh, L. A., Ishov, A. M., Tommerup, N., Vissing, H., Sekido, Y., Minna, J., Borodovsky, A., Schultz, D. C, Wilkinson, K.D., Maul, G.G., Barlev, N., Berger, S. L., Prendergast, G.

C, and Rauscher, F. J. 3rd. (1998) "BAP1: a novel ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances BRCA1-mediated cell growth suppression", Oncogene 16, pp. 1097-112.

10. Barlev, N. A., Workmann, J. L., and Berger S. L. and (1999) "Regulation of GCNhistone acetyltransferase (HAT) activity by phosphorylation mediated by DNAdependent protein kinase", Methods Enzynwl, 304, pp.696-715.

11. Anafi, M., Yang,Y. F., Barlev, N. A., Govindan, M. V., Berger, S. L., Butt, T. R., and Walfish, P. G.(2000) "GCN5 and ADA adaptor proteins regulate triiodothyronine/GRIPl and SRC-1 coactivator-dependent gene activation by the human thyroid hormone receptor", Mol. Endocrinol., 14, pp.718-32.

12. Yan, Y., Barlev, N. A., Haley, R. H, Berger, S. L, and Marmorstein, R. (2000) "Crystal structure of yeast esal suggests a unified mechanism for catalysis and substrate binding by histone acetyltransferases", Mol. Cell, 6, pp. 1195-205.

13. Barlev, N. A., Liu, L., Chehab, N. H., Mansfield, K., Halazonteis, T. D., and Berger, S. L. (2001) "Acetylation of p53 activates transcription through recruitment of coactivators/hi stone acetyltransf erases", Mol. Cell,_&, pp. 1243-1254.

14. Goo Y.H., Sohn Y.C., Kim D.H., Kim S.W., Kang M.J., Jung D.J., Kwak E., Barlev N.A., Berger S.L., Chow V.T., Roeder R.G, Azorsa D.O., Meltzer P.S., Suh P.G, Song E.J., Lee K.J., Lee Y.C., Lee J.W. (2003)"Activating Signal Cointegrator 2 Belongs to a Novel Steady-State Complex That Contains a Subset of Trithorax Group Proteins" Mol Cell Biol, 23, pp. 140-149.

15. Barlev, N. A., Emelyanov, A., Castagnino, P., Bannister, A., Birshtein, В., Kouzarides, Т., and Berger, S. L. (2003) "Identification of a new homologue of yeast putative adaptor ADA2 in humans: novel mechanism of transcriptional co-activation" Mol. Cell. Biol, 23_, pp. 6944-57.

16. Chuikov S., Kurash J.K., Wilson J.R., Xiao В., Justin N., Ivanov G.S., McKinney K., Tempst P., Prives C, Gamblin S.J., Barlev N.A.*, and Danny Reinberg (2004) "Regulation of p53 activity through lysine methylation" Nature 432, pp.353-60. * cocorresponding author.

17. Morgunkova A., and Barlev N.A. (2006) "Lysine methylation goes global" Cell Cycle 5:pp. 1308-12.

18. Ivanov, G, Ivanova, Т., Kurash J.K, A. Ivanov, S. Chuikov, D. Proja, С Kuperwasser, F.

Rauscher, D. Reinberg, and N. A. Barlev (2007) " DNA damage activates p53 through a methylation-acetylation cascade" Mol. Cell Biol, 27, pp. 6756-69.

19. A. G. Mittenberg, T.N. Moiseeva, and N. A. Barlev (2008) "Role of proteasomes in transcription and their regulation by covalent modifications" Frontiers in Biosciences 13, pp.7184-20. Barlev N., Sayan В., Candi E., Okorokov A. "The MicroRNA and p53 families join forces against cancer" (2009) Cell Death&Differentiation, в печати.

21. Моисеева Т.Н., Миттенберг А.Г., Барлев Н.А. (2009). «Влияние протеасом на транскрипцию и их регуляция посттрансляционными модификациями».

Цитология. 51(0):000-000. В печати.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.