WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

ОГАРКОВА Ольга Александровна

Разработка методологии идентификации функции генов Arabidopsis thaliana.

Специальность 03.00.15 – Генетика

АВТОРЕФЕРАТ

Диссертации на соискание ученой степени доктора биологических наук

Москва – 2008

Работа выполнена в лаборатории изменчивости генома Института общей генетики им. Н.И. Вавилова Российской Академии Наук

Официальные оппоненты:

Доктор биологических наук, профессор Бурьянов Ярослав Иванович Институт биоорганической химии им.М.М.Шемякина и Ю.А.Овчинникова РАН Доктор биологических наук, профессор Пухальский Виталий Анатольевич Институт общей генетики им. Н.И.Вавилова РАН Доктор биологических наук Гапоненко Александр Константинович Институт биологии развития им. Н.К.Кольцова РАН

Ведущая организация:

Всероссийский научно-исследовательский институт сельскохозяйственной биотехнологии РАСХН

Защита состоится «____»_____________2008 года в «______» часов на заседании Диссертационного совета Д 002.214.01 при Институте общей генетики им. Н.И. Вавилова РАН по адресу: 119991 ГСП-1, Москва, ул. Губкина, д. 3. Факс: (499) 132-89-

С диссертацией можно ознакомиться в библиотеке Института общей генетики им. Н.И.Вавилова РАН

Автореферат разослан «______» ____________ 2008 года

Ученый секретарь Диссертационного совета Полухина Г.Н.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность темы. Проблема гена, его структурной и функциональной организации является центральной на всем протяжении существования генетики как экспериментальной науки. После фундаментальных открытий, касающихся роли ДНК как материального носителя наследственности, расшифровки ее структуры и генетического кода, принципиальным шагом в решении этой проблемы стало создание технологии клонирования фрагментов ДНК самых разнообразных видов. Это открыло широкие перспективы для перехода исследований гена на молекулярный уровень. Трудно переоценить значимость открытия возможности клонирования отдельных генов. В частности, оно привело к расшифровке нуклеотидных последовательностей геномов целого ряда видов, включая человека. Последнее событие произошло в 2000 году и на его фоне достаточно громко прозвучало другое событие – в этом же году впервые была расшифрована полная нуклеотидная последовательность генома одного из видов высших растений, а именно Arabidopsis thaliana.

Однако функции уже расшифрованных нуклеотидных последовательностей в большинстве случаев остаются невыясненными. В результате основная проблема генетики сегодня связана с выяснением функции генов, нуклеотидный состав которых известен.

Следует отметить, что число локализованных, клонированных и секвенированных генов высших растений на порядок меньше, чем у животных, в первую очередь млекопитающих и в том числе у человека. Эта ситуация была характерна для конца 90-х годов прошлого столетия и она сохраняется до настоящего времени. Вместе с тем, высшие растения позволяют в полной мере реализовать идеи и методы генной инженерии на пути создания методологии направленной модификации геномов для получения видов с заданным набором хозяйственно – полезных признаков.

При реализации этого подхода ключевую роль играет A. thaliana - модельный объект высших растений, для которого определена полная нуклеотидная последовательность генома. Перспективы использования A.

thaliana в качестве основного источника генов для модификации хозяйственно - ценных культур очевидны (Flavell R.B. Crop Improvement – The Role of Discoveries in Model Species. Plant & Animal Genomes XIII Conference. January 15-19, 2005. San Diego, CA).

Цели исследований:

1). Создание методологии идентификации функции генов A. thaliana.

2). Проведение генетического и молекулярно-генетического анализа идентифицированных генов A. thaliana.

Задачи исследований:

1). Получение и скрининг клонотек Arabidopsis thaliana и Pisum sativum.

2). Клонирование и изучение структурной организации фрагментов хпДНК P. sativum и A. thaliana, имеющих гомологию с ДНК хромосом растительной клетки.

3). Разработка методологии изучения структурно-функциональной организации генома A. thaliana, включающая создание эффективной системы агробактериальной трансформации, получение новых систем векторов для проведения трансформации, создание представительной коллекции инсерционных мутантов.

4). Идентификация функциональной роли ранее не исследованных генов A.

thaliana.

Научная новизна:

1. Впервые показано, что природа последовательностей «смешанной» ДНК, представленных одновременно в ядерном и хлоропластном геномах A.

thaliana, связана с наличием нескольких семейств консервативных нуклеотидных последовательностей размером 17-32 п.н., которые идентифицированы также в геномах млекопитающих, насекомых и цианобактерий.

2. Впервые показано различие в протекании процесса энзиматического метилирования ДНК в ядерном и хлоропластном геномах P. sativum и A.

thaliana.

3. Развита методология получения и отбора инсерционных мутантов A.

thaliana, а также локализации инсерции в геноме. С использованием этой методологии созданы коллекции трансгенных растений и инсерционных мутантов A. thaliana.

4. Разработан метод компенсации гормонального дисбаланса для спасения инсерционных летальных мутантов и мутантов со сниженной жизнеспособностью и фертильностью у A. thaliana.

5. Идентифицированы возможные функции ряда генов A. thaliana.

6. Показана функциональная значимость ретротранспозонов.

Научно - практическая значимость работы:

Создана коллекция инсерционных Т-ДНК мутантов, являющаяся основой для изучения структурно-функциональной организации генома A.

thaliana. При создании этой коллекции были использованы разные векторные системы для индукции либо исключительно «nul»-мутаций», которые позволяют изучать функции только стабильно экспрессирующихся в ходе развития растений генов, либо смеси, состоящей из «nul»-мутаций и мутаций, вызывающих суперэкспрессию «молчащих» генов, которые участвуют в контроле ответа на абиотические и биотические стрессы.

Разработан метод компенсации гормонального дисбаланса для спасения инсерционных летальных мутантов A. thaliana и мутантов со сниженной жизнеспособностью и фертильностью, что позволяет проводить идентификацию фенотипа и генетический анализ этих мутантов.

Показана функциональная значимость ретротранспозонов.

Клонированы, идентифицированы и функционально охарактеризованы не известные ранее гены A. thaliana, которые могут быть использованы для фундаментальных исследований в области генетического контроля процессов развития растений, а также для поиска гомологичных генов у сельскохозяйственных видов растений и для анализа экспрессии генов устойчивости к стрессовым воздействиям в трансгенных растениях. В международной базе данных «Gen Bank» зарегистрировано 9 векторов для трансформации растений и 26 линий инсерционных мутантов A. thaliana.

Апробация работы. Материалы диссертации представлены на VII Всесоюзн. Симпозиуме «Молекулярные механизмы генетических процессов» (Москва, 1990); II Всесоюзн. Съезде физиологов растений (Минск, 1990); I Всесоюзн. Симпозиуме «Новые методы биотехнологии растений» (Пущинона-Оке, 1991); Internation. Symposium «Plant Biotechnology and Genetic Engineering» (Киев, 1994); VII Межд. Конференции «Биология клеток in vitro, биотехнология и сохранение генофонда» (Москва, 1997); Межд. Симпозиуме «Молекулярные механизмы стрессовых ответов у растений» (Москва, 1998);

II Съезде Вавиловского общества генетиков и селекционеров (С.-Петербург, 2000); Internat. Conf. «Genetik collections, isogenic and alloplasmic lines» ( Novosibirsk, 2001); Междунар. Симпозиума «Молекулярные механизмы генетических процессов и биотехнология» (Москва, 2001); EMBO сonference/FEBS Advanced Course «EuroPhosphatases» (Barselona, Spain, 2003);

Physiological Society Spring Workshop Hungarian Academy of Sciences «Receptors and Cell Signalling in Oxidative Stress» (Budapest, Hungary, 2003);

NATO/OTAN Advanced Research Workshop «Frontiers in Neurodegenerative Disorders and Aging: Fundamental Aspects, Clinical Perspectives and New Insights» (Antalya, Turkey, 2003); NATO Advanced Study Institute «Forces, Growth and Form in Soft Сondensed Matter: At the Interface between Physicsand Biology» (Geilo, Norway, 2003); Proceedings of international scientific practicalconference «Biotechnology of vegetable, flower and not widely spread crops» (Moscow, 2004); «Plant Genomics European Meetings» (Venice, 2006);

FEBS Special Meeting «ATP-Binding Cassette (ABC) Proteins: From Multidrug Resistance to Genetic Diseases» (Innsbruck, 2006); Международном конгрессе «Биотехнология: состояние и перспективы развития» (Москва, 2007).

Основные положения, выносимые на защиту:

1. Установлено, что гены Synechocystis PCC 6803 - suhB, кодирующий экстрагенный супрессор SuhB из семейства инозитол монофосфатаз, и petF, продуктом которого является ферредоксин, участвуют в контроле фотосинтеза.

2. Показано, что природа «смешанной» ДНК связана с наличием в ядерном и хлоропластном геномах высших растений нескольких семейств консервативных нуклеотидных последовательностей размером 17-32 п.н.

3. Показано, что хлоропластная ДНК растений либо не метилирована совсем, либо метилирована в очень малой степени.

4. Создана методология получения и отбора инсерционных мутантов A.

thaliana, которая включает в себя разработку эффективной системы агробактериальной трансформации, конструирование векторных систем для индукции «nul» мутантов и мутантов, обусловленных суперэкспрессией генов, и использование технологии ПЦР-анализа для создания коллекции трансгенных линий и инсерционных мутантов A. thaliana.

5. Разработан метод компенсации гормонального дисбаланса для A.

thaliana. Это позволило провести молекулярно-генетический анализ ряда условно летальных мутантов и мутантов со сниженной фертильностью.

6. Установлена функциональная значимость ретротранспозонов на примере рецессивного летального мутанта гипокотиля у A. thaliana. Ген At2g09920, инактивация которого инсерцией Т-ДНК приводит к возникновению мутантного фенотипа, представляет собой ретротранспозон.

7. Идентифицированы функции гена At1g12860 у A. thaliana, в структуру которого входит F-box домен, играющий ключевую роль в убиквитинзависимом протеолизе, и транскрипционный активатор типа «спираль-петляспираль». Показано, что катаболическая функция связана с контролем развития семядолей, тогда как его анаболическая функция - с контролем ответа на холодовой стресс.

8. Показано, что потеря функции гена At1g78950, кодирующего фермент из семейства оксидоскваленциклаз, приводит к дефектам развития проростков у A. thaliana.

9. Установлено, что суперэкспрессия гена At1g33390, контролирующего синтез АТФ-зависимой хеликазы из семейства DEAD-box белков, обусловливает образование фасциированного стебля у растений A. thaliana.

10. Показано, что суперэкспрессия гена At5g10080, кодирующего белок Акласса аспартил протеаз, приводит к замедлению развития растений A.

thaliana, изменению их окраски и снижению фертильности.

Структура и объем работы. Диссертация изложена на 264 страницах, включает 39 таблиц и 55 рисунков. Материал представлен в виде общего введения, двух частей (первая состоит из 4-х глав, вторая – из 3-х глав), каждая из которых включает обзор литературы, результаты и обсуждение, общего заключения, выводов, списка основных опубликованных по теме диссертации работ, списка цитируемой литературы (352 наименования) и приложения, в которое вошел раздел «Материалы и методы». Работа выполнена в лаборатории изменчивости генома Института общей генетики им. Н.И.Вавилова РАН. Экспериментальные результаты получены автором лично и совместно с коллегами из лаборатории, с кафедры генетики Биологического факультета Московского государственного университета им. М.В. Ломоносова, а также с аспирантами и студентами, работавшими под руководством диссертанта. Соискателю принадлежат разработка программы исследований, схема основных экспериментов, теоретическое обобщение полученных результатов.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ Часть I. Создание и скрининг клонотек высших растений Глава I. Введение в проблему С начала семидесятых годов прошлого столетия, после открытия и введения в практику генетических исследований эндонуклеаз рестрикции, американскими учеными Коэном и Чангом (Cohen, Chang, 1973) была разработана стратегия клонирования, то есть перемещения отдельных фрагментов ДНК из генома одного организма в геном другого вне зависимости от их видовой принадлежности. Реализация этой принципиальной возможности для высших растений на первом этапе была связана с получение полноразмерных геномных клонотек и клонотек кДНК, а также с поиском и созданием зондов для анализа этих клонотек. В рамках этого подхода решающим стала проблема специфичности зондов для скрининга созданных клонотек.

В этой связи первая часть настоящей работы была связана главным образом с изучением фрагментов ДНК цианобактерий, содержащих гены фотосинтеза, с целью определения целесообразности их использования в качестве зондов для скрининга клонотек геномов Arabidopsis thaliana и Pisum sativum. Однако проведенные исследования показали низкий уровень специфичности использовавшихся зондов. В этой связи для идентификации не известных ранее генов нами был использован другой подход, связанный использованием Т-ДНК инсерционного мутагенеза.

Следует отметить, что развитие целого ряда методов, таких как определение нуклеотидной последовательности генов и геномов в целом, ПЦР-анализ, генетическая трансформация, инсерционный мутагенез и т.д., существенным образом повлияло на стратегию исследований, направленных на идентификацию генов высших растений - центр тяжести проблемы сместился в сторону изучения функций уже расшифрованных последовательностей ДНК генов и отдельных их частей. Параллельное развитие компьютерных методов привело к созданию алгоритмов для идентификации генов, основанных на характеристиках нуклеотидных последовательностей (Rogic et al., 2001; Griffiths, Stotz, 2006). В результате же создания многочисленных представительных коллекций инсерционных мутантов A. thaliana и расшифровки в конце 2000г. полной нуклеотидной последовательности этого вида (Arabidopsis Genome Initiative, 2000) сделали его основным модельным объектом в исследовании структурнофункциональной организации геномов высших растений.

Использование разработанной нами методологии получения и отбора инсерционных мутантов, а также локализации инсерции в геноме A. thaliana позволило идентифицировать ряд ранее не известных генов.

Глава II. Идентификация гена suhB и его локализация в геноме Arabidopsis thaliana 2.1. Создание клонотек генома A. thaliana и P. sativum В конце 80-х годов нами была создана полноразмерная клонотека ядерного генома A. thaliana в фаговом векторе замещения EMDL3.

Фрагментированную ядерную ДНК размером ~15-20 т.п.н. получали путем неполной рестрикции мелкощепящей рестрицирующей эндонуклеазой MboI.

Клонотека включала в себя порядка 14500 рекомбинантных клонов. Таким образом, каждый фрагмент яДНК присутствовал в ней 3,8 раза.

Кроме того, была получена клонотека хпДНК P. sativum. В этом случае в плазмидный вектор pUC19 клонировали HindIII-фрагменты хпДНК размером от 0.3 до 13 т.п.н. Всего было выделено 142 рекомбинантных клона.

2.2. Скрининг клонотеки генома A. thaliana Хотя сам факт создания полноразмерных геномных клонотек представлял собой достаточно трудоемкую процедуру, основная проблема в реализации этой стратегии заключалась в выборе специфических зондов для их скрининга. На первом этапе для скрининга в качестве гетерологичных зондов мы использовали клонированные фрагменты ДНК цианобактерии Synechocystis 6803, содержащие гены фотосинтеза (банк таких фрагментов к этому времени был получен на кафедре генетики Биологического факультета МГУ). В этом случае мы столкнулись не с отсутствием чувствительности используемых зондов, что можно было ожидать, а с отсутствием в подавляющем большинстве случаев их специфичности.

Учитывая тот факт, что у высших растений, в отличие от цианобактерий, гены, контролирующие фотосинтез, расположены как в хлоропластном, так и в ядерном геномах, на следующем этапе работы мы решали задачу, в каком из геномов находятся гены, гомологичные клонированным генам цианобактерии. При этом использовали прямой скрининг фаговой клонотеки ядерного генома A. thaliana, скрининг плазмидной клонотеки хлоропластного генома P. sativum, методы дот- и блот-гибридизации. Оказалось, что основная часть более чем 40 фрагментов гибридизовалась со многими клонами как ядерного, так и хлоропластного геномов. Наблюдаемое отсутствие специфичности зондов могло быть связано с тем, что достаточно протяженные клонированные фрагменты цианобактерий могли содержать несколько близко сцепленных генов (или их частей), которые, однако, у высших растений расположены в разных геномах – ядерном или хлоропластном. Чтобы исследовать эту возможность мы провели серию субклонирований, результаты которых представлены на примере 4 фрагментов (рис. 1, табл. 1).

Рисунок 1. Рестрикционные карты рекомбинантных плазмид р31, р1624, р744 и р39, трансформирующих к фотоавтотрофности фотосинтетические мутанты Synechocystis sp. PCC 6803. E или RI - EcoRI; B-BamHI; S- SmaI; P— PvuII; H-HindIII Таблица 1. Локализация в пределах отобранных фрагментов ДНК цианобактерии участков гомологии с ядерной или хлоропластной ДНК P. sativum и A. thaliana Фрагмент Плазмида Субфрагменты Сайты клонирования Сигнал блот(т.п.н.) (т.п.н.) субфрагментов гибридизации с яДНК с хпДНК 5.6 P31 2.85 BamH1 – Hind III - - 2.75 Hind III – BamH1 + + 8.8 P1624 2.1 BamH1 – Hind III - - 1.9 Hind III – Hind III - - 2.3 Hind III – Hind III - - 2.5 Hind III – BamH1 + + 5.7 P744 1.7 BamH1 – Hind III + - 1.6 Hind III – Hind III + - 2.4 Hind III – BamH1 + - 11.0 P39 1.5 BamH1 – Hind III - - 2.3 Hind III – Hind III + - 1.9 Hind III – Hind III + - 1.2 BamH1 – Hind III - - 2.0 Hind III – BamH1 + - 2.3. Идентификация генов suhB и petF В составе рекомбинантной плазмиды р1624.4 нами был выделен и субклонирован HindIII - BamHI фрагмент ДНК размером 2.5 т.п.н., восстанавливающий способность к фотоавтотрофному росту при трансформации одного из фотосинтетических мутантов и гибридизующийся с хпДНК и яДНК P. sativum и A. thaliana. Более точно область гомологии была локализована в пределах HindIII-HincII участка ДНК размером 0.т.п.н., входящего в состав этого субфрагмента и имеющего внутренний сайт рестрикции Cfr101. После определения нуклеотидной последовательности этого фрагмента и примыкающих к нему участков ДНК (1140 п.н.) оказалось, что он несет в своем составе ген suhB, размером 628 п.н., кодирующий «экстрагенный супрессор SuhB» из семейства инозитол монофосфатаз размером 288 аминокислот. Таким образом, ген suhB является новым, ранее не идентифицированным геном цианобактерий.

В тот период времени, когда проводилась эта работа, полные нуклеотидные последовательности геномов A. thaliana и Synechocystis sp.

PCC 6803 еще не были расшифрованы. Позднее, после их расшифровки мы идентифицировали в геноме Synechocystis sp. PCC 6803 непосредственно перед геном suhB на расстоянии 70 п.н. от стоп-кодона ген petF, продуктом которого является ферредоксин – белок, участвующий в транспорте электронов.

Анализ нуклеотидной последовательности A. thaliana с помощью базы данных TAIR на сервере NCBI для поиска гомологий с секвенированным фрагментом цианобактериальной ДНК показал, что уровень гомологии фрагмента цианобактериальной ДНК с геномной ДНК A. thaliana недостаточен для идентификации генов. Полное совпадение нуклеотидного состава возможно лишь для 18-19 п.н. Кроме того, было установлено наличие трех коротких последовательностей по 17-18 п.н., имеющих 95-100% гомологию с генами A. thaliana: последовательность GATTGTTCTCCTCGGATC – с 60 генами, последовательность GAGATTTGGTTACGGAAG – с 43 генами и последовательность CACCACCAACTTTGCCA – с 50 генами.





Сравнение аминокислотного состава продукта цианобактериального гена suhB с белковыми продуктами генов A. thaliana позволило установить, что геном A. thaliana содержит по крайней мере три гена, кодирующих белки семейства инозитол монофосфатаз. Это семейство представлено в большом количестве организмов, главным образом прокариот, причем у более чем видов прокариот уровень гомологии белков составляет от 100 до 37%.

Компьютерный анализ аминокислотной последовательности белкового продукта гена petF Synechocystis sp. PCC 6803 позволил идентифицировать в геноме A. thaliana по крайней мере четыре гена, белковые продукты которых имеют достаточно высокий уровень гомологии с цианобактериальным геном petF. Как и в случае гена suhB, существенной гомологии секвенированного цианобактериального фрагмента с нуклеотидной последовательностью генома A. thaliana выявить не удалось.

Таким образом, нам удалось идентифицировать гены A. thaliana, имеющие высокий уровень гомологии по аминокислотному составу белковых продуктов с генами suhB (At1g31190, At3g02870, At4g39120) и petF (At4g14890, At1g10960, At5g26990, At3g55530 и четыре не идентифицированных гена) Synechocystis sp. PCC 6803.

Глава III. Исследование гомологии между ядерной и хлоропластной ДНК различных видов семейства Fabaceae и Arabidopsis thaliana Когда в результате проведенных исследований стало ясно, что если не вся нуклеотидная последовательность генов Synechocystis sp. PCC 6803, то, по крайней мере, ее часть представлена как в ядерном, так и в хлоропластном генома, возникла достаточно старая проблема существования так называемой «смешанной» ДНК, то есть ДНК, которая одновременно присутствует в ядерном и хлоропластном геномах растений. Это явление связывали с эндосимбиотическим происхождением хлоропластов и в этой связи на следующем этапе работы мы пытались разобраться в природе «смешанной» ДНК.

3.1. Скрининг генома хпДНК Из клонотек хлоропластных генома P. sativum был выделен и клонирован фрагменты ДНК размером около 700 п.н., показавший гомологию с ядерным геномом этих видов. Наличие такого рода фрагментов было обнаружено нами и у ряда видов двудольных растений, главным образом сем. Fabaceae: P. sativum, Vicia sativa, Lathyrus sativum, Lens esculenta, Cicer arietinum, а также A. thaliana (рис. 2).

Было установлено, что яДНК пяти их шести исследовавшихся видов (кроме Lens esculenta) имеет области гомологии с 0.7 т.п.н. фрагментом хпДНК P. sativum, причем число и места расположения участков гомологии в ядерном геноме меняются при переходе от одного вида к другому.

Зонд хлДНК гороха Блот-гибридизация с (0.7 т.п.н) ядДНК и хлДНК гороха, вики, чины, чечевицы, нута и арабидопсиса.

Блот-гибридизация Р-меченого 0.7 т.п.н.фрагмента хпДНК P. sativum с HindIIIфрагментами хлДНК и яДНК P. sativum (1,2), L.

sativus (3,4), V. sativa (5,6) и A. thaliana (7,8): 1, 3, 5, 7 – HindIII-фрагменты хлДНК; 2, 4, 6, 8 - HindIIIфрагменты яДНК. Размер указан в т.п.н.

Рисунок 2. Обнаружение «смешанной» ДНК Из результатов нашей работы, как и из данных других авторов (Ayliffe et al., 1988), следует, что явление «смешанной» ДНК достаточно широко распространено среди растений сем. Chenopodiaceaea и сем. Fabaceae. Судя по выявленным различиям в степени гомологии, числе и размерах гомологичных фрагментов, «смешанная» ДНК в составе яДНК находится в разном окружении.

Изучавшийся фрагмент ДНК является высоко консервативной структурой, так как в хпДНК даже у таких филогенетически удаленных видов, как P. sativum и A. thaliana он имеет высокую степень гомологии и представлен фрагментами сходного размера.

Анализ числа и размеров гомологичных хлоропластных последовательностей ДНК в составе яДНК представителей сем. Fabaceae позволяет предположить, что процесс обмена генетической информацией между хлоропластами и ядром является относительно недавним событием, произошедшим после эволюционного обособления этих видов.

3.2. Клонирование и молекулярный анализ последовательностей хпДНК P. satinum и A. thaliana Было установлено, что 0.7 т.п.н. - фрагмент хпДНК P. sativum и A.

thaliana несут в своем составе часть гена rpl2, кодирующего белок L большой субъединицы рибосомы хлоропластов, часть гена rps19, кодирующего белок S19 малой субъединицы рибосомы хлоропластов и спейсер между этими генами. Это А-Т богатые последовательности, в спейсере выявлено значительное количество прямых и обратных повторов.

Компьютерный анализ секвенированного фрагмента хпДНК A. thaliana позволил установить наличие гомологичных ему последовательностей разного размера в ядерном геноме A. thaliana (табл. 2) – это девять коротких последовательностей (от 17 до 32 п.н.), на 93 - 100% гомологичных яДНК, которые присутствуют в количестве от 2 до 38 копий. Были идентифицированы 33 гена A. thaliana, несущие короткие фрагменты «смешанной» ДНК, а также кодируемые ими белковые продукты.

Таблица 2. Нуклеотидный состав и частота встречаемости в ядерном геноме A. thaliana и геноме фрагментов «смешанной» ДНК в составе фрагмента хпДНК A. thaliana размером 670 п.н.

№ Последовательность нуклеотидов Позиция на Встречап/п (размер п.н.) фрагменте емость в геноме 1 TCTTTATTTTTCTTAATAAATGA (23 п.н.) 3-27 2 GATTTTTTATTCGTGAA (17 п.н.) 41-57 3 TGTCATAGTTAATTATTCCTCCTATAAA (28 п.н.) 60-87 4 CTATAAATAACTAAAAAAGT (20 п.н.) 81-99 5 AAAAAAGTTAATTTTGTTCTCTTATATTCCAATT (34 п.н.) 92-125 6 AAATTGCTATTTTCTTTTGTA (21п.н.) 173-193 7 GTAAAGAGGAAGAAACAAATTCTATTTTAT (30 п.н.) 191-220 8 TTTTTCTGGTTCTTCTTC (18 п.н.) 283-300 9 AAACGGACCTCGCCAGAAGGTAATTTTAATGT (32 п.н.) 524-555 Сравнительный анализ этих девяти коротких последовательностей нуклеотидов из фрагмента хпДНК с нуклеотидными последовательностями геномов Drosophila melanogaster, Mus musculus и Homo sapiens показал, что одни и те же короткие нуклеотидные последовательности в составе фрагмента хпДНК A. thaliana встречаются не только в ядерном геноме A.

thaliana и Synechocystis sp. PCC 6803, но и в геномах разных видов эукариот (на примере человека, мыши, дрозофилы). Не исключено, что их наличие связано с посттранскрипционной регуляцией генной активности и определяет существование в клетках miРНК и siРНК - некодирующих РНК размером 2030 п.н., которые, наряду с рРНК, мРНК и тРНК, негативно регулируют экспрессию их генов-мишеней в растениях и животных, играя важную каталитическую, структурную и регуляторную роль в клетках.

3.3. Уровень метилирования генома хлоропластов у некоторых видов двудольных растений В пользу эндосимбиотической гипотезы происхождения хлоропластов свидетельствует не только наличие «смешанной» ДНК, но и особенности организации и функционирования генома хлоропластов. Данный раздел работы посвящен выяснению вопроса, содержат ли хпДНК и яДНК растений остатки m6A, могут ли у этих ДНК быть in vivo метилированными остатки аденина в последовательности GATC. Для этой цели использовали сравнительный анализ продуктов действия чувствительных и нечувствительных к метилированию адениновых остатков рестриктаз (CfuI, MboI и Sau3A, соответственно) на хпДНК и яДНК P. sativum и V. sativa.

Рисунок 3. Электрофореграмма в 2% агарозном геле: 1-3 –хпДНК P. sativum, обработанные MboI (1), Sau3A (2) или CfuI (3); 4-6- хпДНК V. sativa, обработанные MboI (4), Sau3A (5) или MboI (1), Sau3A (2) или CfuI (3); (6); – ДНК фага , обработанная CfuI; 8-10 – яДНК P. sativum, обработанные MboI (8), Sau3A (9) или CfuI (10); 11-13 – яДНК V. sativa, обработанные MboI (11), Sau3A (12) или MboI (13) На рис. 3 можно видеть, что хпДНК гороха (дорожка 3) и вики (дорожка 6) не гидролизуются рестриктазой CfuI, которая расщепляет ДНК по Gm6ATC-, но не GATC-сайтам. Не подвергаются заметному гидролизу под действием этой рестриктазы и яДНК этих же бобовых (дорожки 10 и 13, соответственно; рис. 4, дорожка 5). Как хпДНК, так и яДНК данных видов бобовых гидролизуются рестриктазами MboI и Sau3A, то есть они содержат GATC-последовательности, в которых адениновые остатки не метилированы.

Фермент Sau3A гидролизует ДНК как по Gm6ATC-, так и по GATC-сайтам, но не гидролизует по GATm5C-сайтам. Поскольку в хпДНК m5C не найден, гидролиз этой нуклеазой дает представление о суммарном количестве GATCсайтов. Фермент MboI гидролизует GATC-, но не Gm6ATC-сайты. Сходство продуктов гидролиза хпДНК рестриктазами MboI и Sau3A свидетельствует о том, что у этих ДНК во всех последовательностях GATC адениновые остатки не метилированы. На это же однозначно указывает и выявленная устойчивость хпДНК к эндонуклеазе CfuI. Значит, действительно хпНК P.

sativum и V. sativa лишены метилированных Gm6ATC-участков.

Рисунок 4. Электрофореграмма в 0.6% агарозном геле ДНК и продуктов их деградации эндонуклеазой CfuI, гидролизующей ДНК по Gm6ATC-сайтам: – хпДНК P. sativum, обработанная CfuI; 2 – хпДНК P. sativum; 3 – ДНК фага ; 4 - ДНК фага , обработанная CfuI; 5 – яДНК P. sativum; 6 – яДНК P.

sativum, обработанная CfuI При выявленном отсутствии метилированных остатков аденина в GATC-сайтах обнаруженные нами заметные различия по продуктам гидролиза яДНК рестриктазами MboI и Sau3A могут указывать на то, что в отличие от хпДНК у яДНК бобовых растений имеются GATm5Cпоследовательности. Таким образом, нами впервые было установлено, что в хпДНК P. sativum нет метилированных цитозиновых остатков, по крайней мере, в ССGG сайтах и метилированных адениновых остатков в GATC сайтах. Это является отличительным признаком хпДНК и, наряду с секвенированием, это важно для дискриминации ДНК из разных геномов растительной клетки.

Глава 4. Взгляд на использование методологии гибридизации при идентификации новых генов Оставаясь в рамках проблемы специфичности зондов при скрининге клонотек для идентификации новых генов, следует подчеркнуть, что наличие коротких повторяющихся нуклеотидных последовательностей накладывает существенные ограничения на использование гетерологичных зондов.

Фактически, при использовании такого рода зондов необходимо иметь не только клонированные гены – кандидаты на роль зондов, но и знать их подробную структурно-функциональную организацию для выбора уникальных последовательностей в пределах гена, которые могут быть эффективно использованы в качестве зондов.

Развитие техники анализа ДНК путем разного типа ПЦР, а также увеличение числа генов, нуклеотидный состав которых известен, существенно облегчили работу по созданию специфических зондов. Это направление продолжает развиваться, тем ни менее практика использования такого рода подходов в течение двадцати с лишним лет показала очевидное наличие трудностей при их реализации.

Определение полной нуклеотидной последовательности геномов целого ряда видов, включая A. thaliana, открыло принципиально новые возможности для проведения функционального описания неизвестных генов, структура и продукт которых определяются при помощи специальных компьютерных баз данных (http//www.ncbi.nlm.nih.gov) по их гомологии с генами и продуктами этих генов у других организмов. Этот подход включает в себя индукцию инсерционных мутантов. В случае бактерий, цианобактерий, млекопитающих широко используется ген-направленный мутагенез, связанный с замещением в геноме нормальной копии гена на мутантную в результате протекания гомологичной рекомбинации. Для высших растений этот подход не может быть использован в силу низкой эффективности протекания процесса гомологичной рекомбинации по сравнению с незаконной рекомбинацией. В этой связи в изучении функциональной организации генома A. thaliana основную роль играют коллекции инсерционных мутантов. Процесс создания такого рода мутантов начался в конце 80-х – начале 90-х годов прошлого столетия и примерно в это же время подобные работы начались у нас.

ЧАСТЬ II. ПОЛУЧЕНИЕ И АНАЛИЗ ИНСЕРЦИОННЫХ МУТАНТОВ ARABIDOPSIS THALIANA Глава I. Коллекции инсерционных мутантов Для создания представительных коллекций инсерционных мутантов необходима прежде всего высокая частота получения растений – трансформантов, а это, в свою очередь, требует разработки эффективной системы генетической трансформации растений, удобных векторных систем для селекции и последующей идентификации генов, в которые встроилась инсерция, а также для локализации инсерции в геноме. Когда нами были начаты работы по созданию коллекции инсерционных мутантов A. thaliana, предполагалось клонировать, а затем определять нуклеотидный состав генов, в которые встроилась инсерция.

1.1. Конструирование бинарных векторов для агробактериальной трансформации A. thaliana В случае бинарной векторной системы для генетической трансформации (использующейся в работе) функции по ферментативному обеспечению процесса интеграции Т-ДНК в геном растений и перемещающаяся структура Т-ДНК разделены. В интегрирующейся в геном Т-ДНК существенным для процесса перемещения является наличие концевых «бордерных» участков размером 25 п.н. Это позволяет вводить в ее структуру самые разные нуклеотидные последовательности, которые не имеют отношения к функции перемещения Т-ДНК, но оказываются удобными для других целей. В частности, эти последовательности могут нести маркеры резистентности, использующиеся для отбора трансформантов, полилинкеры, репортеры и т.д., а также элементы, создающие удобные условия для последующего клонирования мутантных генов, несущих в своей структуре Т-ДНК. К числу последних относятся бактериальные ori-сайты, которые обеспечивают репликацию кольцевых структур ДНК, содержащих эти сайты в клетках E. coli, а также гены резистентности к бактериальным ядам, в частности, к антибиотикам, находящиеся под контролем бактериальных промоторов.

Рисунок 5. Схема конструирования бинарных векторов pLD3, pLD4, pGO Именно для этих целей нами на базе вектора pBI121были сконструированы три бинарных вектора pLD3, pLD4 и pGO, несущие в Тобласти выражающиеся в клетках E. coli бактериальные гены резистентности к антибиотикам – хлорамфениколу, тетрациклину и ампициллину (рис. 5).

На рис. 6 представлена подробная карта векторной плазмиды pLD3, дальнейшее использование которой для генетической трансформации прорастающих семян A. thaliana позволило нам получить около 400 растений – трансформантов.

Рисунок 6. Карта векторной плазмиды pLDОднако в связи с развитием техники ПЦР-анализа и расшифровкой полной нуклеотидной последовательности генома A. thaliana были развиты и успешно используются в настоящее время более эффективные и экономичные методы локализации инсерции Т-ДНК в геноме A. thaliana.

1.2. Системы векторов для индукции суперэкспрессии генов В векторных системах такого типа Т-область содержит энхансер. В этом случае, наряду с генами, в которые произошло встраивание инсерции, могут быть идентифицированы гены, расположенные на некотором расстоянии от инсерции. Использование энхансерных векторов значительно расширяет спектр получаемых при проведении инсерционного мутагенеза мутаций.

В своей работе мы использовали бинарный вектор pPCVRN4 (Kncz et al., 1994), несущий в Т-области маркерный ген hpt, который обеспечивает резистентность растений к гигромицину, фрагмент из плазмиды pBR322, содержащий маркерный ген bla, обусловливающий резистентность агробактерий к карбенициллину, и точку ori, создающую возможность клонирования в клетках E. coli участков геномной ДНК растения, прилегающих к Т-ДНК инсерции. В Т-ДНК вектора pPCVRN4 присутствуют четыре копии энхансерного домена промотора 35S РНК CAMV.

Cледует отметить, что когда структура инсерции содержит энхансер, могут возникать мутации двух типов: nul-мутации, связанные с инактивацией гена при встраивании в него инсерции, и мутации, обусловленные наличием энхансера в структуре инсерции. При массовом получении и анализе инсерционных мутаций, полученных с помощью такого рода векторов, необходимо иметь относительно простую и эффективную систему идентификации nul-мутаций и мутаций, связанных с суперэкспрессией генов.

Нами была создана принципиально новая, не имеющая аналогов в мире, система для массовой индукции и отбора инсерционных мутантов, обусловленных суперэкспрессией генов у A. thaliana. Эта система включает в себя плазмиду pEnLox (рис. 7) для индукции инсерционных мутантов при агробактериальной трансформации двудольных растений и тестерную линию A. thaliana, в геном которой включен ген cre в составе плазмиды pCre (рис. 8).

Рисунок 7. Карта вектора pEnLox Рисунок 8. Карта вектора pCre Продукт этого гена осуществляет контролируемую экспериментально специфическую рекомбинацию по прямым повторам lox-сайтов. В свою очередь энхансер (тетрамер промотора 35S РНК вируса мозаики цветной капусты) в составе Т-ДНК плазмиды, использующейся для получения инсерционных мутантов, окаймлен lox-сайтами в прямой ориентации. В результате, при скрещивании инсерционных мутантов с тестерной линией происходит удаление энхансера из структуры Т-ДНК, интегрированной в геном мутантного растения. Если при этом исчезает мутантный фенотип, то это означает, что он обусловлен суперэкспрессией близлежащего по отношению к инсерции гена (рис. 9). Учитывая тот факт, что частота вырезания cre – рекомбиназой фрагментов ДНК, заключенных между lox – сайтами, составляет более 90%, восстановление инсерционным мутантом фенотипа растения дикого типа происходит уже во втором поколении.

Рисунок 9. Мутантная линия с фасциированным стеблем Слева - электрофореграмма ПЦР продуктов, полученных с реакции обратной транскрипции на ген At1g33390: M 1kb+ Invitrogen ДНК маркер; 1 –мутант; – растение дикого типа. Справа - сравнение фенотипов морфологического мутанта линии (A), «двойного мутанта» (С) и растения дикого типа (B).

Возраст 7 недель.

Таким образом, созданная система позволяет индуцировать инсерционные мутации и дифференцировать мутантные фенотипы, которые могут быть связаны либо с подавлением функции гена при встраивании в него инсерции, либо с суперэкспрессией близлежащих генов за счет наличия в структуре инсерции энхансерной последовательности.

1.3. Разработка эффективной системы генетической трансформации у A. thaliana Несмотря на то, что к концу прошлого столетия были разработаны самые различные методы генетической трансформации A. thaliana, о которых мы говорили ранее, одним из наиболее перспективных для массового получения инсерционных мутантов на наш взгляд являлся метод трансформации прорастающих семян, предложенный Фельдманном и Марксом (Feldmann, Marks, 1987). Суть метода сводится к сокультивированию предварительно замоченных в жидкой питательной среде семян A. thaliana с ночной культурой штамма A. tumefaciens, использовавшегося для трансформации. По окончании экспозиции семена тщательно промываются водой и нестерильно высеваются в почву. Через 910 недель с выросших фертильных растений (поколение Т1) собирают зрелые семена (поколение Т2). Отбор растений – трансформантов проводится стерильно в Т2-поколении.

К преимуществам этого метода следует отнести отсутствие стадии работы с культурой ткани, исключающее возникновение сомаклональной изменчивости, эпигенетических изменений и морфозов, возможность проводить трансформацию сразу большого количества растений, короткие сроки получения трансформантов. Все это делает его удобным для работы с A. thaliana. Недостатком метода является низкая частота трансформации (около 0,1%).

Как известно, агробактерии проникают в растение через микропиле (Feldmann, 1995), и логично было бы предположить, что, облегчив им доступ внутрь семян, можно существенно повысить выход трансформантов. В связи с этим нами была разработана модификация метода Фельдмана и Маркса, связанная с нанесением незрелым проросткам A. thaliana перед сокультивированием с агробактериями микроповреждений с помощью ультразвука.

Модификация оригинального метода заключалась в озвучивании семян, которое проводили в двух вариантах.

1. Выборку семян (500 штук) подвергали воздействию ультразвуком частотой 44 кГц и мощностью 400 Вт на ультразвуковом дезинтеграторе УЗДН-1 в течение 1 мин.

2. Равноценную выборку семян подвергали воздействию ультразвуком частотой 44 кГц и мощностью 400 Вт на ультразвуковом дезинтеграторе УЗДН-1 в течение 1 мин. в присутствии равной по весу семян навески окиси алюминия Al2O3.

В качестве контрольного варианта использовали равноценную выборку семян, проведенных через стадии стерилизации, замачивания и сокультивирования с агробактериями наряду с опытными выборками, но не подвергавшихся воздействию ультразвуком.

Детальное описание стерилизации семян, их озвучивания и сокультивирования с агробактериями, а также отбор растений трансформантов представлено в Приложении, гл. «Материалы и Методы».

Таким образом, были получены три варианта:

1) прорастающие семена A. thaliana, культивировавшиеся с агробактериями без предварительной обработки;

2) семена A. thaliana, подвергшиеся воздействию ультразвуком;

3) семена A. thaliana, подвергшиеся воздействию ультразвуком в присутствии окиси алюминия.

В результате оценки данных по процентному содержанию трансформантов в Т2-поколении для каждого режима обработки семян Т1поколения при использовании вектора pLD3 было установлено, что обработка семян ультразвуком увеличивала эффективность трансформации до 0.66%, то есть почти в 2 раза по сравнению с контрольным вариантом.

Обработка семян ультразвуком с окисью алюминия позволила достигнуть эффективности трансформации равной 1.15%, что более чем в 3 раза превысило контрольный показатель (табл. 3).

Таблица 3. Оценка эффективности трансформации A. thaliana в зависимости от режима обработки семян Т1-поколения перед сокультивированием с A. tumefaciens Метод обработки семян Выборка Количество трансформантов Т1- поколения семян Тпоколения* штук % Без обработки 2800 10 0,(контроль) Ультразвук 3200 21 0,Ультразвук + 2000 23 1,Окись алюминия *Выборка семян Т2–поколения, тестированных на среде с Km.

1.4. Отбор растений - трансформантов Эффективность и простота процедуры отбора трансформированных растений зависит от присутствующего в Т-ДНК маркера, по которому проводится отбор.

Отбор трансформированных растений по критерию резистентности к канамицину в наших экспериментах при использовании вектора pLD3 не давал результатов, полностью совпадающих с результатами последующих гистохимического и ПЦР анализов. Невозможность жесткого отбора на канамицине в результате определила стратегию использования ступенчатой системы отбора. В частности, на первом этапе в Т2-поколении мы отбирали резистентные к канамицину растения, на втором этапе определяли наличие активности GUS у отобранных вариантов растений и на третьем этапе наличие инсерции в геноме Km-резистентных растений Т2, давших GUSокрашивание, подтверждалось ПЦР-амплификацией участка размером 6п.н. гена uidA Т-ДНК, встроенного в геном растения. Для оценки эффективности cтупенчатой системы отбора растений-трансформантов и определения числа Т-ДНК инсерций в геноме проводили блот-гибридизацию по Саузерну геномной ДНК независимых линий трансформантов, обработанной рестрицирующей эндонуклеазой BamH1, с меченным Р фрагментом ДНК гена uidA размером 608 п.н.

В настоящей работе для агробактериальной трансформации использовались также два других вектора, несущих в составе Т-ДНК энхансер - pPCVRN4 и pEnLox. Бинарный вектор pPCVRN4, в Т-области содержит маркерный ген hpt под контролем промотора pnos гена нопалинсинтетазы, который обеспечивает резистентность растений к гигромицину. В Т-области вектора pEnLox находится ген bar под контролем промотора нопалин-синтетазы, обеспечивающий трансгенным растениям устойчивость к гербициду BASTA, что позволяет проводить отбор в нестерильных условиях в почве или на песке.

В случае вектора pPCVRN4, благодаря высокой селективной эффективности гигромицина, отбор трансформантов проводили только по резистентности растений к этому антибиотику. Кроме того, ДНК отобранных на гигромицине вариантов анализировали путем ПЦРамплификации фрагмента Т-области. Количество инсерций определяли методом блот-гибридизации.

1.5. Получение коллекции растений - трансформантов A. thaliana Трансформации были подвергнуты 200 тысяч семян A. thaliana: 1тысяч семян расы Kln трансформировали с помощью вектора pLD3 и 1тысяч семян расы Dijon – c помощью вектора pPCVRN4. С каждого зрелого растения Т1-поколения было собрано от 300 до 500 семян. Таким образом, с учетом 50% всхожести семян Т1-поколения, было получено около миллионов семян Т2-поколения.

Далее, 130 тысяч семян (30 тысяч трансформированных вектором pLD3 и 100 тысяч – вектором pPCVRN4) Т2-поколения было проанализировано на наличие генетических маркеров Т-области. В результате осуществлявшегося в Т2 - поколении отбора, описанного выше, было получено 2175 линий трансгенных растений (табл. 4).

Видно, что эффективность трансформации прорастающих семян в случае вектора pPCVRN4 примерно в 1.5 раза выше, чем у вектора pLD3. Повидимому, это связано с наличием у вектора pPCVRN4 энхансера.

Таблица 4. Коллекция трансгенных растений A. thaliana Векторная Количество Количество Количество плазмида трансформирован- проанализирован- растенийных семян Т1, ных семян Т2, трансформантов штук штук штук %* pLD3 100.000 30.000 396** 1.pPCVRN4 100.000 100.000 1779*** 1.pEnLox **** 2.600 157 6.*Относительно числа проанализированных семян Т2.

**Проростки Т2, резистентные к канамицину, экспрессирующие -глюкуронидазу и давшие сигнал при ПЦР-анализе.

***Растения Т2, резистентные к гигромицину, часть из которых была проанализирована методом ПЦР.

****При работе с этим вектором трансформацию проводили методом «floral dip».

Кроме линий трансформантов, полученных методом агробактериальной трансформации прорастающих семян с использованием двух векторов (pLD3 и pPCVRN4), методом трансформации «floral dip» с помощью описанной выше оригинальной системы индукции и отбора инсерционных мутантов с суперэкспрессией генов была получена серия из 157 линий трансформантов. Подробное описание этой части работы не входило в наши задачи.

Таким образом, созданная нами коллекция трансгенных растений A.

thaliana состоит из 2332 линий.

1.6. Отбор морфологических мутантов Следующий этап работы заключался в отборе из полученной коллекции трансгенных растений линий, имеющих визуально регистрируемые морфологические изменения. Этот отбор осуществляли в первом (Т1), втором (Т2) и третьем (Т3) после агробактериальной трансформации поколениях. Регистрируемые изменения касались главным образом морфологии растений, но включали также и такие показатели, как скорость развития, степень фертильности и жизнеспособность. Все полученные мутации были отнесены к семи общим фенотипическим классам (табл. 5).

Таблица 5. Классификация морфологических инсерционных мутантов по Фельдману (Feldmann, 1991) № Фенотип 1 Летальные проростки* 2 Мутанты измененного размера** 3 Эмбриональные летали 4 Мутанты со сниженной фертильностью, стерильные 5 Мутанты пигментации:

желто-зеленые альбиносы 6 Мутанты с измененными органами:

цветковые корневые *** мутанты трихом/опушения мутанты листьев/семядолей мутанты гипокотиля мутанты с нарушенной дифференцировкой органов 7 Физиологические мутанты времени цветения Другие * К данному классу отнесены мутанты, характеризовавшиеся летальностью. В возрасте до 2-х недель, не формировавшие настоящих листьев.

** В данный класс не включены микромутанты и мутанты, уменьшенный размер которых был обусловлен общими значительными изменениями морфологии.

***В данный фенотипический класс не включены мутанты с нарушениями морфологии корня, которые являлись, по-видимому, вторичным эффектом.

1.6. Генетический анализ морфологических мутантов A. thaliana Получение в ходе отбора фенотипически измененных вариантов требовало выяснения характера наследуемости наблюдаемых морфологических изменений. Поэтому для каждого изучаемого морфологического мутанта проводили генетический анализ расщепления потомства в последующих поколениях (Т3, Т4, Т5). Одновременно каждое последующее поколение исходного мутанта анализировали с помощью косегрегационного анализа, то есть проверяли сцепленность наследования мутантного признака с наличием в геноме растения инсерции Т-ДНК, используя ПЦР. Всего нами было проанализировано 348 растений, из них 1полученных с помощью вектора pLD3, 209 и 157 – с помощью энхансерных векторов pPCVRN4 и pEnLox, соответственно (табл. 6).

Таблица 6. Отбор морфологических мутантов из коллекции линий трансформантов A. thaliana Проанализиро- Отобрано Отобрано линий, Отобрано вано растений несущих линий, Вектор линий в Т2 и Т2,Т3, штук доминантныe несущих Т3, штук мутации, штук рецессивные мутации, штук pLD3 100 16 0 pPCVRN4 209 59 5 pEnLox 39 3 3 Всего: 348 78 8 Было установлено, что большинство отобранных морфологических мутантов характеризовалось либо летальностью, либо резко сниженной фертильностью вплоть до стерильности (табл. 7).

Таблица 7. Классификация выщеплявшихся в Т3-поколении линий рецессивных мутантов A. thaliana по их жизнеспособности и фертильности Классификация рецессивных Количество, штук мутантов Т3-поколения Вектор для трансформации pLD3 pPCVRNЛетальные 9 Стерильные 2 фертильные 6 Всего 17 Стерильность данных мутантов явилась, по-видимому, следствием общих значительных нарушений в развитии органов. Следует отметить, что в литературе широко представлены данные, свидетельствующие о том, что такого рода мутации, связанные с глобальными изменениями морфологии растения, часто являются доминантными и обусловлены нарушением функции генов, вовлеченных в сигнальную трансдукцию, в частности, в формирование гормонального сигнала или ответа. Большинство этих генов остаются не охарактеризованными, что увеличивает ценность отбора и исследования генома таких мутантов. Вместе с тем известно, что проведение сегрегационного анализа сопровождается появлением ложных спонтанных леталей, обусловленных неблагоприятным воздействием на семена разнообразных факторов окружающей среды. Поэтому необходимо определить природу наблюдаемых леталей, а это, в свою очередь, определяет необходимость проведения дальнейшего генетического анализа выщепляющихся летальных растений.

1.7. Использование экзогенных фитогормонов для спасения условно летальных мутантов A. thaliana и мутантов со сниженной жизнеспособностью и фертильностью Значительная часть возникающих инсерционных морфологических мутаций характеризуется пониженной жизнеспособностью либо фертильностью. По крайней мере частично это явление определяется косвенными причинами, связанными с дисбалансом процесса развития мутантных растений. С другой стороны установлено, что процессы роста и дифференцировки (либо дедифференцировки при образовании каллуса) определяются балансом в клетках растений различных фитогормонов. При этом реализуется генетическая потенция, имеющаяся у клеток, и путь этой реализации зависит от соотношения концентраций фитогормонов в растительной клетке, причем в отношении каждого гормона могут возникать морфологические изменения, характерные для повышенного или пониженного уровня гормона либо нарушения транспорта данного гормона в организме растения.

В том случае, когда мутации приводят к нарушению синтеза гормонов, их дефицит в растении может быть функционально компенсирован путем введения экзогенных гормонов. В связи с этим данный раздел работы посвящен разработке метода «спасения» инсерционных мутантов A. thaliana со сниженной жизнеспособностью и фертильностью путём культивирования их на синтетических средах с экзогенным ауксином и цитокинином.

1.7.1. Подбор гормональных сред для спасения летальных инсерционных мутантов A. thaliana и мутантов со сниженной жизнеспособностью и фертильностью На основании результатов предварительных опытов были подобраны условия для компенсации летального эффекта или нарушений генеративной функции морфологических мутантов A. thaliana. Гибнущие проростки и экспланты стерильных мутантов культивировали в течение 2-3 недель на агаризованной среде Квитко с сахарозой, витаминами и экзогенными гормонами ИМК (2.0 мг/л) и 6-БАП (0.5 мг/л), после чего пересаживали на среду того же состава, но без гормонов.

1.7.2. Спасение условно летальных мутантов Летальные проростки. Класс «летальные проростки» составляет 3-5% от всех получаемых инсерционных мутантов. К этому фенотипическому классу отнесли линии растений, которые в Т3-поколении показывали расщепление по фенотипу на нормальные и морфологически измененные формы, представлявшие собой проростки замедленного развития, прекращавшие рост на стадии семядолей, не формировавшие первую пару настоящих листьев и характеризовавшиеся летальностью в возрасте до 2-4 недель.

Рисунок 10. Аномалии в морфологии семядолей рецессивных летальных мутантов A. thaliana: верхняя (а) и нижняя (б) поверхность семядоли проростка; проростки двух других линий (в) и (г). Масштаб: (а) - бар = 1мкм; (б) – бар = 120 мкм; (в), (г) – бар = 300 мкм Растения нормальной морфологии к 10-м суткам проращивания имели значительно больший по сравнение с морфологически измененными формами размер, к 14-м суткам у них, в отличие от морфологически измененных форм, образовывалась первая пара настоящих листьев.

Семядоли мутантных проростков имели нарушения клеточной дифференцировки, аномальное развитие клеток эпидермиса (рис. 10) часто приводило к практически полному их отсутствию (рис. 10б). Семядоли были неправильной формы (рис. 10в), часто пережатые в основании (рис. 10г), встречались варианты проростков с измененным количеством семядолей (рис. 11а). Изменения морфологии касались также уменьшения размеров гипокотиля (не более 5мм) и полной или частичной редукции корня (рис. 11) часто сопровождавшейся его некрозами.

а б в г Рисунок 11. Общий вид рецессивных летальных 10-суточных проростков A.

thaliana линий 27 (а), 1955 (б), 1603 (в) и корень проростка дикого типа того же возраста (г). Масштаб: (а) – бар = 600 мкм; (б), (в), (г) – бар = 800 мкм Проростки мутантного фенотипа на 3-10-е сутки проращивания помещали на среды с экзогенными гормонами, где уже через трое суток из апикальной меристемы начинали образовываться листья, а через 2-3 недели - побеги, которые переносили на среду без гормонов, где они развивались в фертильные растения, дававшие через 5-10 недель семена.

Использование экзогенных фитогормонов позволило с высокой эффективностью функционально компенсировать генетические дефекты (в из 13 случаев), лежащие в основе мутации типа «летальный проросток». Это в свою очередь определило возможность проведения дальнейшего генетического и молекулярно-генетического анализа спасенных мутантов.

Летальные мутанты гипокотиля. У растений, в Т2-поколении фенотипически не отличавшихся от растений дикого типа, в последующих поколениях происходило выщепление летальных проростков с морфологическими изменениями гипокотиля. Это были проростки с изогнутым редуцированным гипокотилем длиной не более 3мм, погибавшие на стадии семядолей или первой пары настоящих листьев, в случае одной линии, или проростки с фенотипически нормальными семядолями, укороченным, но в целом нормальным корнем и извитым гипокотилем, образующим один или несколько левоспиральных витков, в случае второй линии. Они погибали на стадии семядолей или первой пары настоящих листьев. Спасение двух таких летальных мутантов гипокотиля позволило провести косегрегационный анализ этих линий.

Таким образом, разработанный метод культивирования на средах с экзогенными фитогорионами позволил «спасти» 8 (45%) мутантов и провести их фенотипический и генетический анализ.

Глава II. Локализация инсерций и идентификация генов A. thaliana, маркированных инсерцией Т-ДНК 2.1. Использование методов ПЦР-анализа для локализации генов A. thaliana, маркированных инсерцией Т-ДНК В нашей работе при идентификации генов, маркированных инсерцией, использовали метод TAIL-PCR (thermal asymmetric interlaced) (Liu et al., 1995). Специально для этого метода с помощью компьютерного анализа нуклеотидной последовательности геномов различных видов были подобраны и синтезированы серии стандартных наборов таких вырожденных праймеров. Каждый набор серии содержит семейство коротких (14-16 п.н.) последовательностей, по крайней мере один из которых с высокой степенью вероятности присутствует в любом участке генома размером в несколько сотен нуклеотидов. Этот метод не требует рестрикционной фрагментации геномной ДНК исследуемого мутантного растения. Использование по крайней мере трех специфических праймеров позволяет контролируемо регулировать на величину шага размер фрагмента в процессе его амплификации и таким образом выделять его среди неспецифически амплифицирующихся фрагментов геномной ДНК. Таким образом удается амплифицировать короткие фрагменты ДНК (95-120 п.н.), примыкающие к инсерции.

2.2. Идентификация ранее не известных генов A. thaliana Определение нуклеотидного состава фрагментов ДНК вблизи инсерции, позволило нам с помощью компьютерных баз данных, доступных на специальных серверах (http://www.arabidopsis.org/;

http/mutant.lse.okstate.edu/; http/kazusa.or.jp/; http://www.ncbi.nlm.nih.gol/), идентифицировать ряд генов, характеристики которых представлены в табл.11.

Таблица 11. Идентифицированные гены A. thaliana № Структура Локализация/Ориентация Ген/Размер Описание продукта линии гена инсерции F-box домен;

2-членный домен- детерминанта 1 At1g128внутриядерной 5 экзонов 1-ый экзон (137) 4438 п.н.

локализации;

«спмраль-петляспираль» 2 At3g31320 Белок неизвестен. 1-ый экзон 6 экзонов (27) 1987 п.н. Доменов нет 3 At1g78950 Оксидосквален- 32-ой экзон 33 экзона (76) 9698 п.н. циклаза Ретротранспо- Протяженный Нет данных 4 At2g099зон терминальный (176) 2500 п.н.

повтор 5 Белок неизвестен. 1-ый экзон At1g157(281) Доменов нет 1 экзон 609 п.н.

Белок семейства 43 Инсерция за 200п.н. до старт6 AT5G672гликозил-трансфераз 3 экзона кодона. Энхансер направлен (Е1) 2202 п.н.

на старт-кодон Флавин- Инсерция в середине 2-го 7 AT1G68050 связывающий, Келч- экзона. Энхансер направлен 2 экзона (Е4) 2214 п.н. домен содержащий F на старт-кодон.

-box белок Белок вовлеченный в Инсерция за 450 п.н. до 8 AT4g27260 ауксиновый ответ и старт-кодона. Энхансер 3 экзона (Е7) 2587 п.н. гомеостаз направлен в обратную сторону Белок семейства Инсерция за 400п.н. до старт9 AT5G100аспартилпротеаз 9 экзонов кодона. Энхансер направлен (E9) 2538 п.н.

на старт-кодон Инсерция за 800 п.н. до 10** AT5G067Белок неизвестен 5 экзонов старт-кодона. Энхансер (Е10) 2553 п.н.

направлен на старт-кодон Инсерция за 50 п.н. после 11 AT3G151Белок неизвестен 2 экзона стоп-кодона. Энхансер (Е12) 1498 п.н.

направлен на стоп-кодон Псевдоген семейства AT2G12740 ретротранспозонов Нет данных Нет данных (E13) Джипси Инсерция в конце ORF.

13 At3g301Псевдоген Нет данных Энхансер направлен на (E14) 2367п.н.

промотер.

F-box белок схожий со специфической Инсерция в конце 1-ого 14 AT5G029лиазой апуриновых 3 экзона экзона. Энхансер направлен (Е15) 1957п.н.

сайтов на промотор.

рибосомальной РНК Инсерция в начале 1-ого 15 AT2G45750 Предполагаемая 5 экзонов экзона. Энхансер направлен (Е17) 2929п.н. метилтрансфераза на стоп-кодон.

Инсерция в 800п.н. после 16 AT5G070Сульфотрансфераза 1 экзон старт-кодона. Энхансер (Е18) 1429п.н. и направлен на старт-кодон.

Белок семейства Basic Инсерция в 5’-UTR.

17 AT1G058helix-loop-helix 6 экзонов Энхансер направлен на старт(Е20) 2920п.н.

(bHLH) кодон Инсерция за 1.8т.п.н. до 18 At1g77880 Циклин-подобный F1 экзон старт-кодона. Энхансер (Е21) 393п.н. box белок направлен на старт-кодон.

Инсерция нескольких 19 AT4G02733 Циклин-подобный F- нуклеотидах до старт-кодона.

5 экзонов (E23) 1340п.н. box белок Энхансер направлен на стопкодон.

Предполагаемая Инсерция за 50 п.н. до старт20 AT1G06840 лейцин богатая кодона. Энхансер направлен 20 экзонов (Е30) 5626п.н. трансмембранная на старт-кодон предыдущего протеин-киназа гена At1g06830 (bZIP транскрипционный фактор), который расположен в 1.т.п.н.

Белок семейства Инсерция за 100п.н. до старт21 AT4G285NAM 3 экзона кодона. Энхансер направлен (E31) 1253п.н.

на старт-кодон Центромерн 22 ый район (Е35) 4ой хромосомы Инсерция в 8-ом интроне.

23 At2g257Белок неизвестен 32 экзона Энхансер направлен на старт(Е37) 15979п.н.

кодон.

Белок, содержащий Инсерция за 200 п.н. до 24 AT1G566пентатрикопептид 1 экзон старт-кодона. Энхансер (Е40) 2115п.н.

(PPR) направлен на старт-кодон DEAH-box АТФ- Инсерция за 530 п.н. до 25 AT1G333зависимая хеликаза старт-кодона. Энхансер 8 экзонов (E78) 4371 п.н.

направлен на старт-кодон Неизвестный белок Энхансер расположен за 226 AT5G137содержащий богатый 5 экзонов п.н. до старт- кодона и (E134) 2922 п.н.

пролином домен направлен на него * Мутантный фенотип проявлялся в первом после трансформации поколении на стадии отбора на селективном маркере гербициде BASTA ** Красным цветом выделены варианты, в которых энхансер в составе инсерции направлен на старт-кодон Таким образом, нами было идентифицировано 26 генов В настоящее время нами идентифицировано 26 генов A. thaliana.

В их число входят пять генов, содержащих F-box домены, три псевдогена типа ретротранспозонов. Четыре идентифицированных гена кодируют неизвестные белки, не несущие никаких доменов, пятый ген кодирует неизвестный белок, содержащий богатый пролином домен.

2.3. Генетический и фенотипический анализ мутантов A. thaliana с измененной морфологией В этом разделе работы представлены результаты, полученные для ряда наиболее подробно изученных мутантов.

Так, на примере рецессивного летального мутанта гипокотиля A.

thaliana была установлена функциональная значимость ретротранспозонов.

Ген At2g09920, инсерция в который привела к возникновению мутантного фенотипа, представляет собой ретротранспозон, несущий в своей структуре один протяженный терминальный повтор.

Особый интерес представляет ген At1g12860, инсерция Т-ДНК в который приводит к возникновению некрозов семядолей на ранних стадиях развития растений. В его структуру входит F-box домен, играющий ключевую роль в распознавании белков в процессе их убиквитин-зависимого протеолиза, а также транскрипционный активатор типа «спираль-петляспираль», который полностью гомологичен таковому в гене ICE1 - одном из ключевых регуляторов ответа на холодовой стресс. Эти данные предполагают, что ген At1g12860 включен в ответ на холодовой стресс у A.

thaliana. Таким образом, катаболическая функция гена At1g12860 связана с контролем развития семядолей, в то время как его анаболическая функция связана с контролем ответа на холодовой стресс.

Потеря функции гена At1g78950, относящегося к семейству генов, кодирующих ферменты класса оксидоскваленциклаз, катализирующих превращение (S)-2,3-эпоксисквалена в стерольные и тритерпеновые соединения, обусловливает морфологически регистрируемые дефекты развития проростков (рецессивный летальный проросток).

Установлено, что суперэкспрессия гена At1g33390, кодирующего АТФзависимую хеликазу из семейства DEAD-box белков, играющих важную роль в метаболизме РНК, и гена At5g10080, кодирующего белок А1 класса аспартил протеаз, обусловливает изменения структуры стебля. В случае гена At1g33390 повышение экспрессии приводит к образованию фасциированного стебля (рис. 9), а в случае гена At5g10080 - к замедленному темпу развития растений, изменению их окраски, уменьшению габитуса и понижению фертильности.

Суперэкспрессия гена At1g33390, кодирующего АТФ-зависимую хеликазу из семейства DEAD-box белков, играющих важную роль в метаболизме РНК, и гена At5g10080, кодирующего белок А1 класса аспартил протеаз, обусловливает изменения структуры стебля. В случае гена At1g33390 повышение экспрессии приводит к образованию фасциированного стебля, а в случае гена At5g10080 - к замедленному темпу развития растений, изменению их окраски, уменьшению габитуса и понижению фертильности.

ЗАКЛЮЧЕНИЕ.

Как уже говорилось, центральной проблемой генетики на протяжении всего ее развития являлась проблема гена – установления связи между конкретными генетическими детерминантами и соответствующими признаками организма. Разработка методологии клонирования фрагментов ДНК открыла принципиально новые возможности для решения этой проблемы. Казалось, что реализация подхода, связанного с созданием полноразмерных клонотек геномов разных видов организмов и их скринингом с помощью специфических зондов не имеет ограничений и позволит решить проблему идентификации генов у всех видов организмов, включая высшие растения. При этом принципиальные трудности при реализации этого подхода были связаны с получением специфических зондов, которые используются при скрининге клонотек. В этой связи первая часть данной работы связана с анализом клонированных фрагментов ДНК цианобактерии Synechocystis PCC 6803, содержащих гены, контролирующие процессы фотосинтеза (и их растительных гомологов), которые предполагалось использовать в качестве зондов при скрининге клонотек геномов A. thaliana и P. sativum.

Проведенный анализ нуклеиновых последовательностей использовавшихся фрагментов позволил нам идентифицировать два новых гена, включенных в контроль фотосинтеза у цианобактерии. Это ген suhB, кодирующий экстрагенный супрессор SuhB из семейства инозитол монофосфатаз, и ген petF, продуктом которого является ферредоксин.

Анализ созданных клонотек геномов A. thaliana и P. sativum показал, что подавляющее большинство фрагментов (и субфрагментов) ДНК Synechocystis PCC 6803 характеризовалось низкой специфичностью. Эти фрагменты, имевшие области гомологии с клонами, содержащими различные фрагменты генома A. thaliana, были представлены одновременно в хлоропластном и ядерном геномах P. sativum. Компьютерный анализ, проведенный после расшифровки в 2000г. полной нуклеотидной последовательности генома A. thaliana, показал, что отсутствие необходимого уровня специфичности использовавшихся гетерологичных зондов связан с наличием нескольких семейств консервативных нуклеотидных последовательностей размером 17-32 п.н., представленных в геноме цианобактерий, а также в ядерном и хлоропластном геномах высших растений, включая A. thaliana.

В этой связи в конце 80-х – начале 90-х годов нами были начаты работы, связанные с другим подходом - использованием инсерционного мутагенеза для идентификации генов у модельного объекта высших растений - A. thaliana. Результаты этих исследований изложены во второй части диссертации.

Нами был разработан метод агробактериальной трансформации A.

thaliana, связанный с использованием ультразвука и окиси алюминия для обработки семян перед сокультивированием их с агробактериями. При этом предполагалось клонировать гены, инактивация которых обусловливает мутантный фенотип. Для этих целей было сконструировано семейство векторов, в Т-ДНК которых были введены гены резистентности к антибиотикам, экспрессирующиеся в клетках E. coli.

Создание технологии ПЦР-анализа и расшифровка полной нуклеотидной последовательности генома A. thaliana принципиальным образом изменили методологию идентификации нуклеотидных последовательностей генов, изменение функции которых лежит в основе фенотипа мутантов.

Для индукции и отбора мутантов A. thaliana, фенотип которых обусловлен суперэкспрессией генов, нами была создана новая, не имеющая аналогов система, включающая в себя плазмиду pEnLox и тестерную линию A. thaliana, в геном которой введен ген cre в составе плазмиды pCre.

При скрещивании полученных с использованием вектора pEnLox инсерционных мутантов, фенотип которых обусловлен суперэкспрессией генов, с тестерной линией происходит удаление энхансера из структуры ТДНК, интегрированной в геном мутантного растения, в результате чего исчезает мутантный фенотип.

С использованием разработанных векторных систем нами были созданы коллекции трансгенных линий растений и инсерционных мутантов A. thaliana. Проведенный генетический и молекулярно-генетический анализ ряда мутантов с измененной морфологией позволил идентифицировать гены, участвующие в контроле различных этапов развития растений.

ВЫВОДЫ:

1. Показано существование последовательностей ДНК, представленных одновременно в ядерном и хлоропластном геномах A. thaliana. Природа такого рода «смешанной» ДНК связана с наличием нескольких семейств консервативных нуклеотидных последовательностей размером 17-32 п.н., которые идентифицированы также в геномах млекопитающих, насекомых и цианобактерий.

2. При анализе фрагментов ДНК Synechocystis PCC 6803, использовавшихся в качестве зондов при скрининге геномной клонотеки A. thaliana, идентифицированы новые гены, участвующие в контроле фотосинтеза. Это ген suhB, кодирующий экстрагенный супрессор SuhB из семейства инозитол монофосфатаз, и ген petF, продуктом которого является ферредоксин.

3. Впервые показано различие в протекании процесса энзиматического метилирования ДНК в ядерном и хлоропластном геномах P. sativum и A.

thaliana. Установлено, что хлоропластная ДНК растений либо не метилирована совсем, либо метилирована в очень малой степени. Это является ее отличительным признаком, который важен для дискриминации ДНК из разных геномов растительной клетки.

4. Развита методология получения и отбора инсерционных мутантов A.

thaliana, а также локализации инсерции в геноме. Она включает в себя разработку эффективной системы агробактериальной трансформации, конструирование векторов для индукции «нуль» - мутантов и мутантов, фенотип которых обусловлен суперэкспрессией генов, и применение технологии ПЦР-анализа для локализации инсерции. С использованием этой методологии созданы коллекции трансгенных растений и инсерционных мутантов A. thaliana с измененной морфологией.

5. Разработан метод компенсации гормонального дисбаланса для A. thaliana, что обеспечило проведение фенотипического, генетического и молекулярногенетического анализа условно летальных мутантов и мутантов со сниженной фертильностью.

6. Установлена функциональная значимость ретротранспозонов на примере рецессивного летального мутанта гипокотиля A. thaliana. Ген At2g09920, инсерция в который привела к возникновению мутантного фенотипа, представляет собой ретротранспозон, несущий в своей структуре один протяженный терминальный повтор.

7. Идентифицированы функции гена At1g12860. В его структуру входит Fbox домен, играющий ключевую роль в распознавании белков в процессе их убиквитин-зависимого протеолиза, а также транскрипционный активатор типа «спираль-петля-спираль». Показано, что катаболическая функция гена At1g12860 связана с контролем развития семядолей, в то время как его анаболическая функция связана с контролем ответа на холодовой стресс.

8. Показано, что потеря функции гена At1g78950, относящегося к семейству генов, кодирующих ферменты класса оксидоскваленциклаз, катализирующих превращение (S)-2,3-эпоксисквалена в стерольные и тритерпеновые соединения, обусловливает морфологически регистрируемые дефекты развития проростков.

9. Установлено, что суперэкспрессия гена At1g33390, кодирующего АТФзависимую хеликазу из семейства DEAD-box белков, играющих важную роль в метаболизме РНК, и гена At5g10080, кодирующего белок А1 класса аспартил протеаз, обусловливает изменения структуры стебля. В случае гена At1g33390 повышение экспрессии приводит к образованию фасциированного стебля, а в случае гена At5g10080 - к замедленному темпу развития растений, изменению их окраски, уменьшению габитуса и понижению фертильности.

СПИСОК ОСНОВНЫХ ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ:

1. Мазин А.Л., Бойко Л.М., Огаркова О.А., Ванюшин Б.Ф. Потеря динуклеотидов CpG из ДНК. VI. Метилирование генов митохондрий и хлоропластов // Молекуляр. Биол. 1988. Т. 22. Вып. 6. С. 1688-1696.

2. Ванюшин Б.Ф., Александрушкина Н.И., Огаркова О.А.

Цитокинины заметно не изменяют метилирование адениновых остатков ДНК в культуре клеток Escherichia coli B // Биохимия. 1989. Т. 54. Вып. 10. С.

1666-1672.

3. Ванюшин Б.Ф., Огаркова О.А. Отсутствие содержащих метилированный аденин Gm6ATC-последовательностей в хлоропластных и ядерных ДНК бобовых растений // Биохимия. 1990. Т. 55. Вып. 5. С. 946-951.

4. Лысенко Е.С., Гапеева Т.А., Ермакова С.Ю., Еланская И.В., Огаркова О.А., Тарасов В.А. Гомология клонированных фрагментов ДНК цианобактерии Synechocystis 6803 с хлоропластной и ядерной ДНК высших растений // Генетика. 1991. Т. 27. № 4. С. 581-588.

5. Тарасов В.А., Огаркова О.А., Денисенко Ю.В. Гомология между ядерной и хлоропластной ДНК у некоторых видов двудольных растений // Сборник докладов VII Всесоюзного симпозиума «Молекулярные механизмы генетических процессов». М. 1990. С. 140-151.

6. Котлярова Е.Г., Денисенко Ю.В., Огаркова О.А., Тарасов В.А.

Гомология между хлоропластной и ядерной ДНК различных видов сем.

Fabaceae и Arabidopsis thaliana // Генетика. 1992. Т. 29. № 9. С. 5-10.

7. Лысенко Е С., Огаркова О.А., Тарасов В.А. Локализация клонированных генов фотосинтеза цианобактерии Synechocystis sp. PCC 6803 в ядерном и хлоропластной геномах высших растений // Генетика. 1993.

Т. 29. № 2. С. 348-353.

8. Лысенко Е.С., Огаркова О.А., Еланская Е.В., Тарасов В.А., Шестаков С.В. Новая открытая рамка считывания в геноме цианобактерии Synechocystis sp. PCC 6803 // Генетика. 1995. Т. 31. № 2. С. 162-169.

9. Гапеева Т.А., Огаркова О.А., Тарасов В.А., Волотовский И.Д.

Новые вектора для трансформации двудольных растений // Генетика. 1995. Т.

31. № 8. С. 1085-1091.

10. Огаркова О.А., Хадеева Н.В., Гордон Н.Ю., Гапеева Т.А., Тарасов В.А. Инсерционный мутагенез Arabidopsis thaliana: получение морфологических мутантов // Генетика. 1997. Т. 33. № 2. С. 223-228.

11. Огаркова О.А., Хадеева Н.В., Яковлева Е.Ю., Тарасов В.А.

Трансгенные линии табака для регистрации индуцированной рекомбинации по прямым повторам ДНК // Генетика. 1998. Т. 34. № 3. С. 435-437.

12. Ежова Т.А., Огаркова О.А., Солдатова О.П. Инсерционный мутагенез у растений // Методическое пособие к практикуму по генетики растений на кафедре генетики и селекции Биологического факультета МГУ.

Москва. ДИАЛОГ МГУ. 1997. 43 С.

13. Томилов A.A, Томилова Н.Б., Огаркова О.А., Тарасов В.А.

Инсерционный мутагенез Arabidopsis thaliana: Увеличение эффективности трансформации прорастающих семян в результате предобработки их ультразвуком // Генетика. 1999. Т. 35. № 9. С. 1214-1222.

14. Tomilov A.A., Tomilova N.B., Ogarkova O.A., Tarasov V.A.

Insertional mutagenesis in Arabidopsis thaliana: Presonication of germinating seeds increases the efficiency of their transformation // http://www.shef-acpress.co.uk/subis 15. Томилов A.A, Томилова Н.Б., Огаркова О.А., Тарасов В.А.

Идентификация гена, включенного в контроль развития корневой системы у Arabidopsis thaliana // Генетика. 2001. Т. 37. № 1. С. 36-16. Томилова Н.Б., Томилов A.A, Огаркова О.А., Тарасов В.А.

Идентификация гена, мутация в котором обуславливает возникновение некрозов семядолей при развитии проростков Arabidopsis thaliana // Генетика. 2001. Т. 37. №1. С. 36-45.

17. Огаркова О.А., Томилова Н.Б., Томилов A.A, Тарасов В.А.

Создание коллекции морфологических инсерционных мутантов Arabidopsis thaliana // Генетика. 2001. Т. 37. № 8. С. 1081-1087.

18. Томилова Н.Б., Томилов А.А., Огаркова О.А., Солдатова О.П., Тарасов В.А. Гормон-зависимые инсерционные мутанты Arabidopsis thaliana со сниженной жизнеспособностью и фертильностью. Генетика. 2001. Т. 37.

№ 9. С.1251-1257.

19. Ezhova T.A., Soldatova O.P., Ondar U.N., Penin A.A., Ogarkova O.A., Tomilov A.A., Tomilova N.B., Tarasov V.A. Genetic collection of Arabidopsis thaliana development mutants. In: Internat. Conf. “Genetic collections, isogenic and alloplasmic lines”. Novosibirsk. Russia. 2001. C. 149153.

20. Ежова Т.А., Лебедева О.В., Огаркова О.А., Пенин А.А., Солдатова О.П., Шестаков С.В. Arabidopsis thaliana – модельный объект генетики растений // Учебно-методическое пособие по генетике растений.

Москва. МАКС Пресс. 2003. 220 С.

21. Огаркова О.А., Томилов А.А., Томилова Н.Б., Тарасов В.А.

Cпасение инсерционных рецессивных летальных мутантов Arabidopsis thaliana // Онтогенез. 2004. Т.35. №.3. С.220-228.

22. Фурсова О.В., Погорелко Г.В., Авсюк А.Ю., Томилова Н.Б., Томилов А.А., Тарасов В.А., Огаркова О.А. Идентификация потенциального гена – регулятора развития семядолей у проростков Arabidopsis thaliana// Докл. Акад. Наук. 2004. Т. 395. №. 5. С. 1-3.

23. Ogarkova O.A., Tomilov A.A., Tomilova N.B., Pogorelko G.V., Fursova O.V., Tarasov V.A. Insertional mutagenesis in Arabidopsis thaliana :

Collection of morphological insertion mutants // In: Proceedings of international scientific practical conference ”Biotechnology of vegetable, flower and not widely spread crops”. Moscow. 2004. P. 138-141.

24. Ogarkova O.A., Fursova O.V., Tomilova N.B., Tomilov A.A., Pogorelko G.V., Avsiuk A.Yu., Tarasov V.A. Insertional mutagenesis in Arabidopsis thaliana : Identification of a novel gene implicated in cotyledon development // In: Proceedings of international scientific practical conference ”Biotechnology of vegetable, flower and not widely spread crops”. Moscow. 2004.

P. 142-145.

25. Огаркова О.А., Томилов А.А., Томилова Н.Б. Тарасов В.А.

Идентификация гена, мутация в котором приводит к возникновению рецессивных летальных проростков у Arabidopsis thaliana // Онтогенез. 2005.

Т. 36. №. 3. С. 222-224.

26. Огаркова О.А., Томилов А.А., Томилова Н.Б., Тарасов В.А.

Идентификация гена, мутация в котором приводит к тропизму гипокотиля у Arabidopsis thaliana // Генетика. 2005. Т. 41. № 3,. С. 427-429.

27. Огаркова О.А., Томилов А.А., Томилова Н.Б., Погорелко Г.В.,Тарасов В.А. Идентификация гена, мутация в котором приводит к морфологическим изменениям гипокотиля у Arabidopsis thaliana // Генетика.

2005. Т. 41. № 2. С. 166-170.

28. Погорелко Г.В., Фурсова О.В., Огаркова О.А., Тарасов В.А.

Новая система векторов для индукции суперэкспрессии генов у двудольных растений // Генетика. 2007. Т. 43. № 2. С. 194-201.

29. Pogorelko G.V., Fursova O.V., Ogarkova O.A., Tarasov V.A. A new technique for activation tagging in Arabidopsis // Gene. 2008. V. 44. P. 67-75.

СОКРАЩЕНИЯ:

яДНК - ядерная ДНК хпДНК - хлоропластная ДНК ПЦР - полимеразная цепная реакция мтДНК - митохондриальная ДНК п.н.(пн, bp) - пара нуклеотидов т.п.н. (тпн) - тысяча пар нуклеотидов ИМК - -индолил-3-масляная кислота НУК - -нафтилуксусная кислота 6-БАП - 6-бензиламинопурин кДа (kD) - килодальтон GUS - -глюкуронидаза






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.