WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

Потокина Елена Кирилловна

ПРИКЛАДНЫЕ АСПЕКТЫ СТРУКТУРНОЙ И ФУНКЦИОНАЛЬНОЙ ГЕНОМИКИ РАСТЕНИЙ  (НА ПРИМЕРЕ РОДОВ VICIA L. И HORDEUM L.)

Специальности:         03.01.15 – генетика

03.00.05 – ботаника

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук

Санкт-Петербург

2008

Работа выполнена в Государственном научном центре РФ Всероссийском научно-исследовательском институте растениеводства имени Н.И.Вавилова (г. Санкт-Петербург) и Институте генетики культурных растений (Гатерслебен, Германия) в 1997-2007 гг.

Научный консультант:         доктор биологических наук Чесноков Юрий Валентинович

Официальные оппоненты:  доктор биологических наук, профессор

член-корреспондент РАСХН Яковлев Александр Федорович

доктор биологических наук Борисов Алексей Юрьевич

доктор биологических наук Родионов Александр Викентьевич

Ведущая организация:         Санкт-Петербургский государственный университет

Защита диссертации состоится  “ 15  “ октября  2008 г. в 14 часов на заседании Диссертационного совета Д 006.041.01 при Государственном научном центре Всероссийском научно-исследовательском институте растениеводства им. Н.И.Вавилова по адресу: 190000, г.Санкт-Петербург, ул. Большая Морская, 44; тел/факс +7(812)571-8728.

С диссертацией можно ознакомиться в библиотеке ГНЦ РФ Всероссийского научно-исследовательского института растениеводства им. Н.И.Вавилова

Автореферат разослан “____ “  ____________ 2008 г.

Ученый секретарь диссертационного совета

доктор биологических наук                                                                В.А.Гаврилова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Нуклеотидные вставки, делеции, а также нуклеотидные замены определяют разнообразие аллелей большинства генов. В этой связи главным объектом исследований генетики и прикладной ботаники становится разнообразие генетических ресурсов растений, выявляемое на уровне ДНК. Полиморфизм ДНК в масштабе целого генома можно изучать, опираясь на информацию о нуклеотидной последовательности всей геномной ДНК (полное секвенирование геномов) или, используя альтернативную технологию молекулярного маркирования.

       В большинстве случаев молекулярные маркеры, используемые для анализа внутривидового и межвидового разнообразия у растений (RFLP, RAPD, AFLP, SSR), представляют собой анонимные ДНК-фрагменты, отражающие полиморфизм участков генома, выбранных случайным образом (Varshney et al., 2004). Репрезентативное количество идентифицированных с их помощью полиморфных геномных локусов и относительная простота лабораторных процедур позволяют эффективно использовать эти маркеры при оценке геномного сходства близкородственных таксонов культивируемых видов и решении вопросов таксономии. В настоящей работе возможности методов молекулярного маркирования при решении спорных вопросов систематики культурных растений и оптимизации коллекций генных банков проанализированы на примере видов Vicia L., представляющих практический интерес как кормовые травы и зернобобовые культуры.

Для целей прикладной генетики и селекции более эффективным является использование не анонимных, а функциональных молекулярных маркеров, которые идентифицируют полиморфизм в транскрибируемых кодирующих последовательностях ДНК – генах (Andersen, Lbberstedt, 2003). Базовым ресурсом для исследований функциональной геномики являются коллекции EST (Expressed Sequence Tags), представляющие собой секвенированные неполные копии генов, точнее фрагменты кодирующих последовательностей ДНК длиной 500-700 н.п. (Сойфер, 2000). Создание коллекций EST обусловило также развитие чип-технологий, основной задачей которых является сравнительный мониторинг уровня генных транскриптов в экспериментальных образцах. Анализ экспрессии генов с использованием чип-технологий, называют также транскриптомным анализом. По аналогии с геномом, подразумевающим совокупность всех генов организма, говоря о транскриптоме, имеют ввиду совокупность всех генов, которые транскрибируются в данной ткани, на данном этапе развития организма (Spellman et al., 1998). Потенциальное значение транскриптомного анализа для генетико-селекционных исследований очевидно: транскрипция генов является ключевым этапом для последующего белкового синтеза, поэтому изменения в генной экспрессии могут непосредственно влиять на биохимические и физиологические процессы и, как следствие, отражаться на фенотипе.

Среди объектов современных транскриптомных исследований особое место принадлежит  ячменю. Усилиями лабораторий разных стран к концу 2002 года были созданы 84 библиотеки кДНК из разных тканей растений ячменя на разных этапах онтогенеза, в результате чего было получено около 350 тысяч EST (Close et al., 2004). На этой базе был создан геночип яменя (Affymetrix 22K Barley GeneChip), позволяющий анализировать экспрессию практически всех известных на сегодняшний день кодирующих последовательностей ячменя. Накопленная обширная научная информация и современные исследовательские ресурсы позволяют перейти к разработке новых методологических подходов для выявления генетических факторов, определяющих изменчивость хозяйственно-ценных признаков, на основе новых технологий функциональной геномики.

Цель исследования.  Выявить возможные пути использования достижений современной структурной и функциональной геномики для решения прикладных проблем генетики и ботаники, на примере представителей родов Vicia  и Hordeum.

Задачи исследования.  Для достижения поставленной цели необходимо было решить следующие задачи:

1. Изучить возможности методов молекулярного маркирования для систематики культурных растений, оценив с их помощью геномное сходство видов Vicia subgenus Vicia и, сравнив полученные результаты с существующими версиями филогенетической системы подрода.

2. Разработать метод оптимизации обширных коллекций ex situ с применением  молекулярных маркеров на примере генофонда культурного вида V.sativa.

3. Разработать метод идентификации генов, определяющих изменчивость хозяйственно-ценных фенотипических признаков, на примере признаков пивоваренного качества у ячменя, с помощью транскриптомного анализа. Для этого:

а) в качестве первого этапа создать экспериментальную базу для транскриптомного анализа генотипов ячменя различного пивоваренного качества, сконструировав библиотеки кДНК из тканей прорастающего ячменного семени и, создав на их основе кДНК-макрочип (EST на нейлоновом фильтре);

б) изучить ткане- и стадийно-специфичную активность генов в прорастающем семени ячменя, используя кДНК-макрочип. В ходе исследований получить экспериментальное подтверждение воспроизводимости результатов применяемой кДНК-чип технологии, путем использования альтернативных молекулярно-биологических методов (Нозерн-блоттинг).

в) используя кДНК-макрочип, осуществить транскриптомный анализ генотипов ячменя, различающихся по параметрам солодования и протестировать гипотезу о том, что наблюдаемые различия по пивоваренному качеству могут обуславливаться изменчивостью уровня экспрессии определенных генов-кандидатов.

4. Разработать метод картирования генетических локусов, регулирующих уровень экспрессии возможных генов-кандидатов с использованием техники Real-Time PCR.

5. Разработать стратегию создания функциональных молекулярных маркеров-помощников селекции, выявляющих желательную повышенную или пониженную экспрессию гена-кандидата, детерминирующего изменчивость хозяйственно-ценного признака, для использования селекционной практике.

6. Проанализировать общегеномные закономерности регуляции экспрессии генов ячменя, картировав генетические факторы (eQTL), влияющие на уровень транскрипции генов, используя Affymetrix 22K Barley GeneChip.

Научная новизна. Предложен оригинальный метод классификации внутривидового разнообразия возделываемого вида, сохраняемого ex situ, по результатам молекулярного маркирования генома путем расчета коэффициентов генетической оригинальности образцов (КГО) по Смирнову (1969).

Впервые предложен метод, позволяющий на основе кДНК-чип технологий идентифицировать спектр генов-кандидатов, определяющих изменчивость хозяйственно-ценных признаков. В качестве примера идентифицированы возможные гены-кандидаты, влияющие на формирование пивоваренного качества у ячменя.

Разработана методика поиска молекулярного маркера-помощника селекции, выявляющего желательную повышенную или пониженную экспрессию гена-кандидата.

Создана коллекция 27512 EST (секвенированных фрагментов кодирующих последовательностей ДНК), выделенных из тканей семени ячменя на разных этапах прорастания. Нуклеотидные последовательности созданных EST и их функциональные аннотации доступны для пользователей через Интернет (http://pgrc.ipk-gatersleben.de/cr-est/index.php).

Впервые с использованием микрочипа Affymetrix 22K Barley GeneChip на генетической карте ячменя установлено местоположение 3029 транскрибируемых генов, а также картированы 

регуляторные локусы для 12987 генов.

Впервые экспериментально показано, что естественный нуклеотидный полиморфизм, существующий между двумя генотипами ячменя, может достоверно влиять на уровень экспрессии более 80% транскрибируемых генов.

Получено экспериментальное подтверждение наличия в геноме ячменя транс-регуляторных локусов, влияющих на транскрипцию не одного, а целого кластера генов. Установлено, что позиции этих транс-регуляторных локусов на генетической карте совпадают с позициями некоторых QTL для параметров пивоваренного качества.

Впервые на примере генома ячменя экспериментально показано, что эффект унаследованных цис-регуляторных мутаций, заключающийся в активировании или ингибировании транскрипции гена, может быть ограничен конкретной тканью или проявляться у потомства по достижении организмом определенной физиологической стадии.

Теоретическая и практическая значимость. Предложенный метод расчета КГО применим к анализу генетического разнообразия возделываемых видов растений, генофонд которых представлен преимущественно местными сортами, сорнополевыми и дикорастущими популяциями, с привлечением любого типа молекулярных маркеров. Практическим результатом его применения является классификация образцов коллекций генбанков по 5-балльной шкале, которая может быть отражена в дескрипторах паспортных баз данных и использована для оптимизации коллекций ex situ.

Метод выявления генов-кандидатов, определяющих изменчивость хозяйственно-ценных признаков, основан на гипотезе, что наблюдаемые различия в фенотипе могут обуславливаться вариациями в уровне экспрессии определенных генов. Метод приложим к анализу любого количественного признака, не требует создания экспериментальных популяций, необходимых для рекомбинационного анализа. Метод лишь анализирует генетическое разнообразие, выявляемое среди существующих селекционных линий и сортов, используя возможности кДНК-чип технологий.

Экспериментально показано, что повышенная/пониженная экспрессия гена-кандидата в результате цис-регуляторной мутации, может быть ассоциирована с присутствием определенных аллелей в структурной части гена. Это дает возможность упростить работу селекционера, создав молекулярный маркер, выявляющий желательную повышенную или пониженную экспрессию гена-кандидата для диагностики и скрининга генетического разнообразия, а также маркерной помощи отбору.

Созданная коллекция EST была использована при разработке микрочипа Affymetrix 22K Barley GeneChip, позволяющего анализировать экспрессию практически всех известных на сегодняшний день кодирующих последовательностей ячменя. По результатам экспериментов с Affymetrix 22K Barley GeneChip создан каталог, содержащий информацию о линейной последовательности 3029 транскрибируемых генов на хромосомах ячменя и генетических расстояниях между ними. Полученная генетическая карта Hordeum vulgare является самой насыщенной на сегодняшний день, она позволяет детально изучить синтению хромосом ячменя и риса – вида с секвенированным геномом. Информация о последовательностях генов в соответствующем блоке на физической карте генома риса значительно облегчает задачу клонирования генов у ячменя.

Основные положения диссертации, выносимые на защиту.

1. Классификацию внутривидового разнообразия возделываемого вида, сохраняемого ex situ,  можно осуществлять при помощи коэффициентов генетической оригинальности образцов по Смирнову, рассчитанными по результатам молекулярного маркирования генома.

2. Используя современные методы функциональной геномики (кДНК-чип технологии), можно идентифицировать спектр генов-кандидатов, определяющих изменчивость хозяйственно-ценных признаков.

3. Желательную с точки зрения селекционной практики повышенную или пониженную экспрессию гена-кандидата в результате цис-регуляторной мутации можно маркировать с помощью полиморфных сайтов в структурной части гена.

4. Используя подход «генетической геномики» с применением микрочипа Affymetrix 22K Barley GeneChip, можно локализовать на генетической карте ячменя более 15% генов, транскрибируемых в конкретной ткани. Одновременно, в рамках того же эксперимента можно картировать регуляторные локусы для 80% транскрибируемых генов.

5. Общегеномное картирование регуляторов экспрессии генов ячменя с помощью Affymetrix позволяет локализовать транс-регуляторные локусы, регулирующих транскрипцию целого кластера генов, среди которых могут оказаться также гены, определяющие важные фенотипические характеристики.

Конкурсная поддержка работы. Исследования были поддержаны международными грантами Vavilov-Frankel Fellowship, 1999 (IPGRI, Италия); Science and Technology Agency of  Japan, 1999 (Цукуба, Япония); BMBF, №0312282, 2001 (GABI-SEED, Германия); BBC5030971, 2005 (BBSRC, Англия). 

Апробация работы. Основные результаты работы были представлены на X-ой, XII-ой и XV-ой Международных Конференциях “Plant & Animal Genomes” (San-Diego, 2002, 2004, 2007); 3rd UK Cereal Genetics and Genomics Workshop (Norwich, 2006); III-м Съезде ВОГиС “Генетика в XXI веке: современное состояние и перспективы развития” (Москва, 2004); 9th International Barley Genetics Symposium (Kromeriz, 2004); Plant Genomics European Meetings (Lyon, 2004; Berlin, 2002); 9th International Symposium on Plant Seeds: Seeds in the -omics Era (Meisdorf, 2004); VIII European Society for Agronomy Congress (Copenhagen, 2004); XI-ом Делегатском Съезде Русского Ботанического Общества (Барнаул, 2003); XI-ой Международной конференции “Plant Reproduction: From Mendel to Molecular Biology” (Brno, 2003); 6th Gatersleben Research Conference (Gatersleben, 2002); XVIth EUCARPIA Congress (Edinburgh, 2001); International Symposium "Rudolf Mansfeld and Plant Genetic Resources" (Gatersleben, 2001); 3rd International Crop Science Congress (Hamburg, 2000); 7th MAFF International Workshop on Genetic Resources (Tsukuba, 2000). Результаты диссертации обсуждались на заседании кафедры генетики и селекции Санкт-Петербургского Государственного Университета, на семинаре лаборатории кариологии и молекулярной систематики Ботанического института им. В.Л.Комарова РАН, а также на Вавиловском семинаре ВНИИ растениеводства им.Н.И.Вавилова.

Публикации. По теме диссертации опубликованы 32 работы, в том числе в зарубежных изданиях – 25.

Объем и структура диссертации. Диссертация изложена на 265 страницах, содержит 35 таблиц и 57 рисунков и состоит из введения, обзора литературы (глава 1), описания объектов и методов исследования (глава 2), 4-х глав экспериментальной части, заключения, выводов, списка литературы, включающего 285 источников, и приложения.

СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы исследования

Филогенетический анализ подрода Vicia осуществлялся с использованием 54 образцов 29 видов Vicia, относящихся к секциям Atossa, Hypechusa, Peregrinae, Wiggersia, Vicia, Bithynicae, Narbonensis и Faba sensu Maxted (1995). Образцы получены из коллекций Всероссийского Института растениеводства (ВИР), Института генетики культурных растений Гатерслебена (IPK, Gatersleben, Germany), а также собственных сборов автора, выполненных в период экспедиционных работ 1987-1993 по Кавказу, Крыму и Средней Азии. Возможности методов молекулярного маркирования при идентификации предковой формы возделываемого вида V. faba L. анализировались на материале 46 местных популяций бобов коллекции ВИР, собранных в 1916-1928 годах экспедициями Н.И.Вавилова и его коллег. Методология применения молекулярного маркирования для оптимизации работы с обширными коллекциями генбанков изучена на примере мирового генофонда культурного вида V.sativa (1122 образца).

Суммарные препараты ДНК из листьев Vicia получали стандартным методом CTAB (Williams et al., 1993). Полимеразную цепную реакцию (ПЦР) проводили по стандартному протоколу с использованием Taq ДНК-полимеразы (MBI Fermentas, CША). Для RAPD анализа видов Vicia использовали 20 декамерных олигонуклеотидных праймеров. Полиморфизм генов хлоропластной ДНК (rbcL, rpoB, 16S, psaA, trnK) анализировался по протоколу Tsumura et al. (1995). Для обнаружения нуклеотидных замен в хлоропластных генах у видов Vicia, амплифицированная ДНК обрабатывалась отдельно одной из 11 рестриктаз (BamHI, BglII, DraI, EcoRI, EcoRV, HaeIII, MspI, PstI, RsaI, XbaI, XhoI). Процедура AFLP проводилась по методу Vos et al. (1995) с использованием 6 наиболее полиморфных комбинаций  праймеров (E37-M52; E38-M53; E39-M49; E40-M56; E40-M58; E41-M57). Филогенетический анализ подрода Vicia по результатам RAPD и RFLP-PCR хлоропластных генов осуществлялся методом невзвешенного парно-группового кластерного анализа с арифметическим усреднением (UPGMA) программного пакета  NTSYS-pc (Rholf, 1992), а также методом максимальной экономии (Phylogenetic Analysis Using Parsimony, Swofford, 1991) и методом максимального правдоподобия (Restriction Sites Maximum Likelihood Program, Phylip 3.5, Felsenstein, 1992). При анализе внутривидового разнообразия V.sativa L. по результатам AFLP частота встречаемости AFLP-фрагментов в  региональных выборках была подсчитана  с помощью опции FREQ программы NTSYS-pc (Rholf, 1992). Генетические дистанции между выборками расчитаны по Nei (1972). Структура внутривидового разнообразия V.faba L. анализировалась методом главных координат (Principal Coordinates Analysis, PCoA) с помощью опций DOUBLE CENTER и EIGENVECTOR пакета NTSYS-pc (Rholf, 1992), а также с использованием факторного анализа (Statistica 5.0).

Для создания экспериментальной базы транскриптомного анализа у ячменя, библиотеки кодирующих последовательностей ДНК (кДНК) конструировались из РНК, выделенной из тканей семян ярового пивоваренного сорта ячменя Барке (Barke) на четырех стадиях прорастания (библиотеки HS,HT,HU,HV, http://pgrc.ipk-gatersleben.de/cr-est/index.php). Суммарная РНК выделялась с помощью кита Gentra RNA Isolation Kit (Biozym). Поли(А)-последовательности РНК экстрагировались из суммарной РНК с помощью олиго(Т)-парамагнитных корпускул (Dynal). Для конструирования библиотек кДНК выделенная иРНК использовалась для синтеза первой цепи кДНК реакцией обратной транскрипции с помощью pBluescript II XR cDNA Library Construction Kit (Stratagene), позволяющем  встраивать и размножать молекулы кДНК в плазмидном векторе pBluescript II SK. При создании кДНК-макрочипа вставки кДНК амплифицировались из плазмидной ДНК с помощью универсальных праймеров и наносились на нейлоновые мембраны (BiodyneB, Pall, Germany) с помощью робота Biogrid иглами нанесения диаметром 0.4 мм (Biorobotics, Cambridge, UK). Анализ экспрессии генов у сортов ячменя разного пивоваренного качества осуществлялся путем гибридизации проб кДНК, выделенных из семян каждого сорта на кДНК-микрочип. Для приготовления проб синтез первой цепи кДНК проводился с помощью обратной транскриптазы (Superscript II, Gibco), вторая цепь синтезировалась с использованием радиоактивно-меченых нуклеотидов (33Р) (Megaprime Labeling Kit, Amersham). Гибридизация радиоктивно меченых проб кДНК на мембраны проводилась в течении 14ч при 65С. Время экспозиции для оценки интенсивности свечения радиоактивных сигналов составило 3-6ч. Имиджи фотопластин анализировались с помощью Fuji BAS2000 (Fuji Photo Film) и импортировались программой Array Vision (Imaging Research) для идентификации сигналов и оценки их интенсивности. Нозерн-блоттинг проводился с использованием мембран HybondN+ (Amersham). Мембраны гибридизовались с радиоактивно меченой пробой (32Р) выделенной для индивидуальной кДНК. Мечение пробы проводилось с использованием рандомных праймеров Rediprime (Amersham). Сигнал инспектировался с помощью фосфо-имиджера Fuji BAS2000 (Fuji Photo Film).

Методические подходы идентификации генов, определяющих изменчивость хозяйственно-ценных признаков, разрабатывались на примере признаков пивоваренного качества у ячменя. Параметры солодования и уровень экспрессии генов анализировались для 10 генотипов, полученных от семенной компании Cebeco Seeds B.V. (Нидерланды). Компания предоставила информацию о показателях шести параметров солодования у генотипов. Уровень экспрессии 1440 генов у тех же генотипов анализировался с использованием кДНК-макрочипа. Мантель-тест (Mantel,1967) использовался для оценки корреляции между двумя матрицами попарных расстояний по Манхеттену, описывающими одну и ту же выборку 10 генотипов. Одна из матриц была рассчитана по данным экспрессии генов, другая - по данным параметров солодования. Для оценки достоверности корреляции между матрицами использовался калькулятор Мантель-теста (Mantel Nonparametric Test Calculator for Windows, version 2.00, Liedloff, 1999).        

Оценку уровня транскрипции гена-кандидата Cxp1 (Acc. Y09603), в прорастающих семенах дигаплоидных линий от скрещивания генотипов Steptoe/Morex проводили методом количественной ПЦР в режиме реального времени (Real-Time PCR) в термоциклере GeneAmp 5700 Sequence Detection System  (SDS; Applied Biosystems) с использованием интеркалирующего красителя SYBR Green I. Праймеры для проведения RT-PCR были сконструированы таким образом, чтобы хотя бы один из них «перекрывал» интрон-экзонную границу в нуклеотидной последовательности гена. Оценку стартового количества кДНК в экспериментальных образцах проводили методом калибровочного графика, как описано в User Bulletin #2 for ABI Prism 7700 SDS (http://docs.appliedbiosystems.com/pebiodocs/04303859.pdf). CAPS маркер для картирования гена-кандидата Cxp1 был разработан на основе одиночной нуклеотидной замены (SNP, Single Nucleotide Polymorphism), выявленной при сравнении последовательностей геномной ДНК у генотипов Steptoe и Morex с помощью программы RestrictionMapper (http://www.restrictionmapper.org/). Картирование генов и QTL проводилось в популяциях дигаплоидных линий от скрещивания Steptoe/Morex (Kleinhofs et al., 1993) и Oregon Wolfe  Dom/Rec (Costa et al., 2001) с использованием программ MAPMAKER v.2 (Lander et al., 1987), QGENE v.3.0 (Nelson, 1997) и Windows QTL Cartographer 2.5 (http://statgen.ncsu.edu/qtlcart/WQTLCart.htm).

Общегеномное картирование регуляторов транскрипции генов ячменя с использованием Affymetrix 22K Barley GeneChip (Affymetrix product #900515 GeneChip® Barley Genome Array) проводилось на материале проб РНК, выделенных из трех биологических повторностей родительских генотипов Steptoe и Morex и из одной повторности каждой дигаплоидной линии от их скрещивания. В исследование были включены два типа ткани, соответствующие также двум разным последовательным стадиям развития растения: 1) ткани зародыша прорастающего семени (96ч после намокания) и 2) листья 12-и дневных проростков. РНК, выделенная из листьев проростков анализироваласть только для 30 дигаплоидных линий. РНК, выделенная из тканей зародыша, анализировалась для 139 дигаплоидных линий. Процедура выделения РНК и гибридизации на микрочип описана Caldo et al. (2004). Приготовление тканевых проб, и выделение РНК проводилось в Институте культурных растений в Данди (Scottish Crop Research Institute, SCRI, Dundee). Мечение проб, гибридизация и сканирование геночипов проводилось в университете Йова, США (Iowa State University, USA, http://www.biotech.iastate.edu/ facilities/genechip/Genechip.htm). Анализ результатов гибридизаций (CEL files) осуществлялось нами с помощью пакета статистических программ Bioconductor (www.bioconductor.org), доступного в системе программирования R (www.r-project.org).

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ И ИХ ОБСУЖДЕНИЕ

1. Возможности методов молекулярного маркирования при решении проблем прикладной ботаники и оптимизации коллекций ex situ (на примере Vicia L.)

С помощью методов RAPD и RFLP-PCR хлоропластных генов проанализирована степень геномного сходства 29 видов подрода Vicia и по результатам исследования очерчен круг возможных близкородственных таксонов для важнейших культивируемых видов вики. Полученные результаты не подтвердили традиционной точки зрения многих систематиков о том, что современные культивируемые бобы (V.faba) филогенетически более всего близки к видам секции Narbonensis (Ball, 1968; Plitmann, 1970; Maxted, 1992). По полученным данным, в пределах подрода Vicia,  V.faba филогенетически более всего близка к V.bithynica, и эти два вида могут иметь общего предка с видами секции Peregrinae. Результаты также показали, что V.faba, имея определенную степень родства с ныне существующими видами подрода Vicia, не может считаться одомашенной формой одного из них.

Для дальнейшего исследования вопроса о происхождении культуры бобов методом RAPD было проанализировано генетическое разнообразие местных популяций бобов, собранных в 1916-1928 годах экспедициями ВИР в разных частях света во времена, когда современные аграрные технологии еще не заместили традиционных местных способов ведения сельского хозяйства. Обнаружено, что образцы культурных бобов, собранные в начале прошлого века в горах Алжира и Морокко, на уровне ДНК демонстрируют явную генетическую дивергенцию от остального внутривидового разнообразия V.faba.  Из тех же географических пунктов северо-африканского побережья ранее был описан вид V. Pliniana (Trabut)Murat, незначительно отличающийся от современных форм V.faba, и рассматриваемый монографом культуры бобов Муратовой (1931) в качестве возможного предка этой культуры. Приняв во внимание гипотезу Cubero (1974), который объясняет отсутствие дикорастущих растений бобов тем, что в районах своего произрастания они непосредственно переводятся человеком в культивируемое состояние, выдвинуто предположение, что генетически обособленные северо-африканские популяции бобов могут представляют собой сравнительно недавно окультуренные формы дикорастущей V.faba, которую ботаники прошлого века описывали как V.Pliniana. Результаты проведенного исследования позволяют предположить, что дикорастущий предок культурных бобов, очень незначительно отличающийся морфологически от современных форм V.faba, в историческое время был широко распространен в Средиземноморье и на Ближнем Востоке. В этой связи сделан вывод о том, что видовое и формовое разнообразие Vicia в горах Алжира и Западного Морокко заслуживает специального подробного исследования для получения более точной информации о феномене V. Pliniana, возможно имеющем непосредственное отношение к дикорастущему предку культивируемых бобов.

Коэффициенты генетической оригинальности образцов коллекций генбанков по результатам молекулярного маркирования

Для рациональной организации и практического использования коллекций ex situ необходимо оценить генетические различия многочисленных образцов местных сортов и сорнополевых форм, собранных из одного эколого-географического региона и сходных по своим морфолого-физиологическим характеристикам. На примере образцов вики посевной (Vicia sativa L.) коллекции ВИР нами разработан математический алгоритм, позволяющий оценить степень генетической оригинальности образца в системе местного генофонда с использованием результатов молекулярного маркирования.  Алгоритм был разработан по результатам анализа 1122 образцов мирового генофонда вики посевной методом AFLP. Установлено, что 65 AFLP-фрагментов, полиморфных внутри вида, могут быть обнаружены практически во всех точках ареала вики посевной, но с разной частотой встречаемости. Одна и та же аллель могла быть распространенной  в одном регионе, встречаясь в 90% популяций, и очень редкой в другом районе видового ареала, встречаясь лишь в 10% популяций, однако, как правило, никогда не исчезая совсем (табл.1). Показано, что различия  в частотном соотношении AFLP-фрагментов между различными участками ареала пропорциональны их географической удаленности.

Если отдельные части ареала вида различаются частотным соотношением аллелей, то для каждого конкретного региона появляется возможность различать редкие и широко встречающиеся аллели. На основе частоты их встречаемости становится возможным проводить процедуру “взвешивания” аллелей, выявленных у образцов с помощью молекулярного маркирования по методу Смирнова (Смирнов, 1969). Чем больше в составе образца генотипов с редкими аллелями, маркируемыми AFLP, тем выше степень его оригинальности (специфичности) в системе популяций региона. В интерпретации генофонда это может означать, что в одном образце собраны генотипы наиболее характерные для данной местности, а в другом образце удалось «поймать» редкие генотипы, нехарактерные для местной среды обитания, но тем не менее сохраняемые популяцией в качестве резерва изменчивости. Как следствие, каждый образец

Таблица 1.

Частота встречаемости AFLP-фрагментов (E41-M57) в образцах V.sativa из 22 географических районов видового ареала

       

Кол-во

образцов

 

Размер AFLP-фрагментов (н.п.)

108.68

109.86

113

117.11

161

178

180

202

268.9

293

319

368

369

Прибалтика

98

0.938

0.255

1.000

0.684

0.061

0.765

0.877

0.071

0.633

0.020

0.786

0.020

0.245

Белоруссия

34

0.911

0.471

1.000

0.706

0.147

0.912

0.824

0.147

0.735

0.058

0.882

0

0.294

Центр.Украина

54

0.926

0.296

0.963

0.833

0.167

0.833

0.907

0.333

0.592

0.018

0.778

0

0.259

Запад.Украина

45

0.956

0.378

0.956

0.844

0.156

0.756

0.933

0.200

0.689

0.022

0.822

0.022

0.356

Кавказ

89

0.876

0.618

0.640

0.528

0.124

0.876

0.584

0.022

0.427

0.011

0.449

0.011

0.101

Россия-Север

37

0.889

0.278

0.944

0.861

0.167

0.944

0.833

0.028

0.694

0.056

0.972

0

0.209

Россия-Центр

105

0.962

0.429

0.895

0.829

0.152

0.886

0.867

0.105

0.610

0.028

0.857

0.038

0.209

Россия-Черноз

106

0.915

0.387

0.821

0.802

0.123

0.868

0.802

0.151

0.557

0.028

0.839

0

0.321

Россия-Поволжье

43

0.860

0.419

0.744

0.605

0.349

0.860

0.697

0.186

0.628

0

0.744

0.023

0.326

Россия-Урал

34

1.000

0.441

0.676

0.765

0.206

0.882

0.852

0.059

0.676

0.029

0.853

0

0.441

Росиия-Сибирь

30

0.933

0.200

0.933

0.700

0.133

0.867

0.867

0

0.733

0

0.867

0

0.267

Польша

23

0.782

0.130

0.652

0.522

0.130

0.696

0.783

0

0.261

0.435

0.565

0

0.478

Германия

21

0.900

0.150

0.700

0.450

0.150

0.800

0.950

0

0.500

0

0.700

0

0.300

Чехословакия

26

0.846

0.269

0.615

0.615

0.077

0.538

0.692

0

0.692

0.192

0.808

0

0.038

Греция

107

0.604

0.405

0.707

0.113

0.038

0.915

0.906

0

0.717

0.018

0.585

0.235

0.160

Испания

61

0.836

0.689

0.919

0.081

0.049

0.984

0.984

0

0.885

0

0.819

0.082

0.065

Италия

27

0.815

0.629

0.815

0.407

0.074

0.926

0.778

0

0.815

0.037

0.852

0.074

0

Болгария

26

0.880

0.200

0.600

0.280

0.280

1.000

0.440

0

0.760

0

0.200

0.120

0

Югославия

9

1.000

0

0.889

0.555

0

0.889

0.333

0

0.667

0.111

0.889

0.222

0.111

Венгрия

13

1.000

0.461

0.615

0.615

0.154

0.461

0.692

0

0.769

0.231

0.923

0

0.231

Турция

19

0.842

0.526

0.210

0.368

0.052

0.684

0.632

0

0.737

0

0.579

0

0.105

Иран

22

0.454

0.955

0.909

0.727

0.045

0.773

0.364

0

1.000

0

0.273

0.591

0

в пределах конкретного региона может быть охарактеризован с точки зрения пропорции редких и обычных аллелей в виде рассчитанного коэффициента генетической оригинальности (КГО) в системе местного генофонда. Разработана пятибалльная шкала, согласно которой каждому образцу, в соответствии с его КГО,  может быть присуждена градация от 1 до 5, отражающая долю редких для региона аллелей в конкретном образце. Алгоритм продемонстрирован на примере классификации 677 образцов посевной вики коллекции ВИР, собранных из 11 эколого-географических регионов России и проанализированных методом AFLP.

2. Стратегия идентификации генов, определяющих изменчивость хозяйственно-ценных признаков на основе транскриптомного анализа

Разработан метод, позволяющий соотнести изменчивость уровня экспрессии генов с изменчивостью хозяйственно-ценного признака на основе транскриптомного анализа. Метод продемонстрирован на примере идентификации генов-кандидатов, вовлеченных в формирование пивоваренного качества у ячменя. Для проведения транскриптомного анализа генотипов ячменя различного пивоваренного качества было необходимо сконструировать библиотеки кДНК из тканей прорастающего ячменного семени.

2.1. Создание библиотек кодирующих последовательностей ДНК  ячменя

Из иРНК, выделенной из тканей прорастающего ячменного семени на разных этапах прорастания, нами были созданы 4 библиотеки кДНК. Эти 4 библиотеки, вместе с другими 18 библиотеками кДНК из разных тканей и стадий развития ячменя, были использованы для создания обширной коллекции секвенированных фрагментов кодирующих последовательностей ДНК, насчитывающей 110981 EST и сохраняемой в настоящее время Институтом генетики культурных растений (IPK, Gatersleben). Созданная коллекция EST является базовым ресурсом геномных исследований у ячменя и составляет примерно одну треть от всего количества EST ячменя (~380000), опубликованных на сегодняшний день (Zhang et al., 2004). Всего из сконструированных нами библиотек прорастающего семени было секвенировано 27512 EST. Длина EST варьировала от 426 до 547 нуклеотидов, средняя длина составила 495. Примерно 50% EST показали достоверное сходство с аннотированными генами, кодирующими белки известных функций. 24% оказались сходными с генами, кодирующими белки с неизвестными функциями, 26% EST не имели достоверных аналогов в опубликованных базах данных. Нуклеотидные последовательности всех EST и их функциональные аннотации доступны для пользователей (http://pgrc.ipk-gatersleben.de/cr-est/index.php).

На основе полученных EST был создан кДНК-макрочип ячменя (1400 EST на нейлоновом фильтре). Получив возможность анализировать уровень экспрессии сотен генов в рамках одного эксперимента, мы использовали кДНК-макрочип для того, чтобы установить как меняется характер экспрессии генов в зависимости от стадии прорастания семени, и насколько уровень экспрессии специфичен для определенной ткани. Рис.1 в качестве примера иллюстрирует один из дифференциально-экспрессируемых генов карбоксипептидазу I (Cxp1, EST HY02B16), специфически транскрибируемый в щитке семени ячменя спустя 12-36 ч после намокания. Тканеспецифичная экспрессия этого гена может быть выявлена как с помощью кДНК-макрочипа, так и с помощью Нозерн-блоттинга. Преимущество кДНК микрочипа состоит в выявлении сразу несколько десятков дифференциально-экспрессируемых генов.

Среди 154 дифференциально-экспрессируемых генов 69 показали наивысший уровень активности в эндосперме, 58 преимущественно транскрибировались в зародыше и щитке, 11 только в зародыше и 16 только в щитке. 70% генов были аннотированы в соответствии с их предполагаемыми функциями. Гены, преимущественно экспрессируемые в зародыше и щитке, кодировали белки клеточного цикла, процессов трансляции, нуклеотидного метаболизма, углеводного обмена и транспортных функций. Гены, активные в алейроновом слое эндосперма, в основном определяли процессы гидролиза угеводов и метаболизма аминокислот. Было установлено, что результаты с использованием кДНК-макрочипа воспроизводимы и подтверждаются результатами альтернативных молекулярно-биологических методов (Нозерн-блоттинг). При условии соблюдения фиксированной экспериментальной ситуации можно проводить сравнение уровня транскрипции генов в прорастающем семени не только между тканями и возрастными стадиями одного и того же индивидуального организма, но и между различными генотипами.

2.2. Выявление корреляции между экспрессионными профилями EST и профилями варьирования признаков пивоваренного качества у ячменя

Для того чтобы идентифицировать гены, вовлеченные в детерминацию хозяйственно-ценного признака, невозможно сравнивать уровень транскрипции генов у двух генотипов, контрастных по определенным фенотипическим характеристикам (например, по принципу

Рис.1. I - Схематическое изображение органов семени ячменя, использованных для выделения РНК и последующего транскриптомного анализа; II - Тканеспецифичная экспрессия гена карбоксипептидазы (Cxp1) (HY02B16) в щитке зерновки ячменя, выявленная с помощью Нозерн-блоттинга (А) после 4, 12, 36 и 54 часов проращивания семени. Количество нанесенной РНК контролировалось параллельной гибридизацией с пробой рибосомальной ДНК (26S rDNA) (В); IIIIV Сравнение экспрессии 1440 генов в тканях семени с помощью кДНК-макрочипа (III - в щитке по сравнению с зародышем; IV -  в щитке по сравнению с эндоспермом). Логарифмированное значение интенсивности сигнала отображено на двухмерном графике разброса для двух сравниваемых тканей. Диагонали отражают границы разницы в уровне экспрессии генов в 3 раза. HY02B16 (карбоксипептидаза 1) показывает высокий уровень экспрессии в щитке, однако в зародыше и эндосперме ген не транскрибируется (сигнал неотличим от “экспериментального шума”).

“высокое - низкое пивоваренное качество”). В этом случае разница в экспрессии генов будет отражать общее генетическое несходство сортов, вызванное и другими факторами, например, происхождением сорта. Поэтому, предлагаемый функционально-ассоциативный подход предполагает анализ уровня экспрессии генов не у двух контрастных сортов, а у репрезентативной выборки сортов, среди которых наблюдается существенная вариация изучаемого признака. Далее, из всего множества дифференциально-экспрессируемых генов необходимо выбрать только те, варьирование уровня экспрессии которых между сортами коррелирует с изменчивостью изучаемого признака между теми же сортами.

Для десяти сортов ячменя, полученных от семенной компании Cebeco Seeds B.V. (Нидерланды), были проанализированы шесть параметров солодования. Для тех же 10 сортов с помощью кДНК-макрочипа был проанализирован уровень экспрессии 1440 генов в прорастающих семянах. Было выявлено 100 дифференциально-экспрессируемых генов, уровень экспрессии которых отличался более чем в 2 раза при сравнении хотя бы двух сортов. Далее, для 10 сортов были рассчитаны две матрицы попарных расстояний по Манхеттену (Average Manhattan distances). Первая матрица (табл.2а) была основана на показателях одного из параметров солодования, обозначенного в анализе как VZ 45°C, а вторая матрица (табл.2б) - на показателях уровня экспрессии 100 дифференциально-экспрессируемых генов. Достоверность корреляции между двумя матрицами устанавливалась с помощью Мантель-теста (Mantel, 1967). Первоначально, значение Мантель теста составило g=-0.8027, означая, что корреляция между матрицами не является достоверной, так как 5% уровень достоверности достигается при (g=1.645). Можно предположить, что не все 100 генов, по разному экспрессируемых у 10 сортов, имеют отношение к анализируемому признаку пивоваренного качества. Поэтому, из их числа необходимо элиминировать EST, негативно влияющие на корреляцию матриц. Для этого была применена следующая процедура: первый EST в списке 100 EST (EST 1) был удален, и на основании показателей экспрессии оставшихся 99 EST была составлена новая матрица расстояний, которая была сравнена с матрицей пивоваренного параметра (VZ 45°C). Показатель Мантель-теста составил g= -0.7499, что превышает начальный показатель (-0.7499 > -0.8027). Был сделан вывод, что EST 1 негативно влияет на корреляцию, так как при его отсутствии показатель Мантель-теста повышается. EST 1 был возвращен в список,  вместо него EST 2 был исключен, и процедура пересчета экспрессионной матрицы и ее сравнения с фенотипической

матрицей была повторена с результатом g= -0.8499. EST 2 положительно влияет на

корреляцию, так как его отсутствие понижает начальный показатель (-0.8499 < -0.8027). Действуя таким образом поэтапно со всеми 100 EST изначального списка, мы выявили 30 EST, позитивно влияющих на искомую корреляцию, показатели экспрессии которых формировали матрицу достоверно (p<0.05) коррелирующую с матрицей, рассчитанной на основе признака пивоваренного качества. С помощью той же процедуры кандидатные гены были идентифицированы и для остальных пяти параметров солодования.

Таблица 2.

Корреляция матриц попарных расстояний между 10 сортами ячменя, рассчитанных (a) на основе параметра солодовенного качества VZ 45° и (б) на основе экспрессионных профилей 100 генов. Значение Мантель-теста составило g = -0.8027, означая отсутствие достоверной корреляции между матрицами. Корреляция считается достоверной при g > 1.645 (p < 0.05).

а

Сорта

005

008

009

134

137

145

147

157

158

159

005

0

008

0.91

0

009

1.42

1.55

0

134

1.11

0.64

1.61

0

137

0.78

0.78

1.06

1.02

0

145

1.01

1.06

2.22

1.23

1.41

0

147

1.60

1.58

0.71

1.74

1.20

2.35

0

157

1.10

0.73

1.63

0.84

0.89

1.28

1.53

0

158

0.92

0.88

1.00

0.88

0.57

1.45

1.18

0.90

0

159

0.96

0.76

1.36

0.97

0.78

1.36

1.19

0.67

0.73

0

б

Сорта

005

008

009

134

137

145

147

157

158

159

005

0

008

1.79

0

009

1.14

0.65

0

134

0.28

1.51

0.86

0

137

0.30

1.49

0.84

0.02

0

145

1.74

0.05

0.60

1.46

1.44

0

147

2.50

0.71

1.36

2.22

2.20

0.76

0

157

2.93

1.14

1.79

2.65

2.63

1.19

0.43

0

158

2.20

0.41

1.06

1.92

1.90

0.46

0.30

0.73

0

159

1.69

0.10

0.55

1.41

1.39

0.05

0.81

1.24

0.51

0

Помимо генов, задействованных в процессах гидролиза крахмала и запасных белков, роль которых в процессе солодования у ячменя хорошо изучена, были выявлены дополнительные гены-кандидаты, чья возможная роль для солодования ранее не обсуждалась. Большинство из них кодирует ферменты, связанные с защитой клеток от дегидратации и теплового шока. Защитная функция этих ферментов действительно может иметь отношение к эффективности пивоваренного процесса на этапе сушки зеленого солода при высоких температурах. В случае, если термостабильность гидролитических ферментов могла бы быть повышена за счет более активного синтеза шаперонов (в том числе белков теплового шока), производственные потери при сушке зеленого солода были бы значительно сокращены. Полученные результаты свидетельствуют о том, что пивоваренные и белковые сорта ячменя могут различаться не только по своему гидролитическому потенциалу, но также и по активности генов, кодирующих белки-шапероны, защищающие гидролазы от денатурации при высоких температурах в процессе пивоварения.

Для дальнейшей проверки выявленные гены-кандидаты были локализованы на генетической карте. Для этого была использована картирующая популяция дигаплоидных линий от скрещивания двух сортов ячменя Steptoe (белковый сорт) и Morex (пивоваренный сорт) (Kleinhofs et al., 1993). Эта популяция широко используется для  картирования QTL пивоваренных качеств у ячменя (Hayes et al., 1993; Han et al., 1997). Изменчивость биохимических параметров солода среди дигаплоидных линий популяции детально документирована, и информация доступна через интернет (http://wheat.pw.usda.gov/ggpages/SxM/). Располагая информацией о позиции гена-кандидата на генетической карте Steptoe/Morex и данными о варьировании параметров солода среди дигаплоидных линий той же самой картирующей популяции, мы провели QTL анализ для параметров солода, чтобы оценить, совпадают ли позиции идентифицированных генов-кандидатов с позициями QTL для параметров пивоваренного качества на одной и той же генетической карте.

Для позиций 7 из 9 генов, картированных в популяции Steptoe/Morex, было зафиксировано совпадение с позициями QTL различных параметров пивоваренного качества. Это свидетельствовало о том, что хромосомные участки, где были локализованы гены-кандидаты, достоверно влияют на изменчивость солодовенного фенотипа. Такое совпадение объяснимо, если предположить наличие полиморфизма в промоторном участке гена-кандидата между Steptoe и Morex в результате цис-регуляторной мутации, которая может повышать или понижать экспрессию гена, и если ген действительно имеет отношение к формированию пивоваренных свойств, то как следствие, повышается или понижается значение соответствующего параметра солодования. В результате, в локусе, где был картирован ген-кандидат, QTL анализ фиксирует достоверную связь между полиморфизмом локуса и варьированием признака пивоваренного качества – выявляется достоверный пик QTL для параметров солодования. Чтобы проверить это предположение для одного из генов-кандидатов, взятого в качестве примера, были выявлены генетические факторы, определяющие уровень его экспрессии, путем картирования  eQTL (expressedQTL)  в популяции дигаплоидов от скрещивания Steptoe/Morex с использованием техники Real Time PCR (RT-PCR).

2.3. Идентификация геномных локусов, регулирующих экспрессию  генов-кандидатов, на примере гена Cxp1

Ген-кандидат, выбранный в качестве примера, кодирует протеолитический фермент карбоксипептидазу 1 (serine carboxypeptidase I, Cxp1), играющую важную роль в расщеплении запасных белков в прорастающем семени и, следовательно, в формировании солода (Winspear et al., 1984; Mikola, 1983). В наших экспериментах ген Cxp1 (EST HY02B16) был идентифицирован как ген-кандидат, так как изменчивость уровня его экспрессии между 10 сортами ячменя коррелировала с характером изменчивости пивоваренных параметров, такими как вязкость (VZ45°) и экстрактивность.

Относительный уровень экспрессии гена Cxp1 был измерен с использованием RT-PCR, как у родительских генотипов Steptoe и Morex, так и среди 134 рекомбинантных потомков этого скрещивания в двух повторностях (в прорастающих семянах 2000 и 2001 годов репродукции). Родительские генотипы Steptoe и Morex показали стабильное, воспроизводимое различие в экспрессии Cxp1. Экспрессия этого гена у пивоваренного сорта Morex достоверно превышала таковую у белкового сорта Steptoe, независимо от года репродукции семян, или повтора опыта проращивания. Уровень экспрессии Cxp1 в дигаплоидных линиях соответствовал нормальному распределению, и был подвергнут QTL анализу. Коэффициент наследуемости количественного признака “уровень экспрессии Cxp1”, определяющий долю генотипической изменчивости в наблюдаемых вариациях составил 21%. Единственный достоверный еQTL (expressed QTL) для гена Cxp1 был картирован на длинном плече хромосомы 3Н, в позиции непосредственно совпадающей с локусом, где ранее был картирован сам ген Cxp1 (рис.2).

Совпадение позиций гена Cxp1 и его еQTL на генетической карте свидетельствует о том, что различие в уровне экспрессии гена Cxp1 у Steptoe и Morex вероятнее всего определяется полиморфизмом в регуляторной части самого гена (цис-регуляторной мутацией). Иными словами, картированный еQTL представляет собой цис-еQTL.

Рис.2. Картирование eQTL для гена Cxp1 интервальным методом в популяции 134 дигаплоидных линий, полученных от скрещивания Steptoe и Morex. Кривые значений LOD показаны для двух повторов эксперимента (семена репродукции 2000 и 2001 гг.). Семь хромосом ячменя обозначены как 1Н-7Н. Числа под хромосомами обозначают наивысшее значение LOD, зафиксированное для данной хромосомы. Горизонтальная линия обозначает местоположение гена Cxp1 на генетической карте, где ген Cxp1 был картирован с помощью SNP-маркера, выявленного в структурной части гена.

Сравнительный анализ нуклеотидной последовательности гена Cxp1 среди 90 сортов ячменя позволил выявить шесть полиморфных локусов, в которых могут происходить нуклеотидные замены (SNP). В зависимости от аллелей SNP в этих шести полиморфных локусах, проанализированные 90 сортов ячменя формируют четыре гаплотипа (табл.3). 24 сорта относились к гаплотипу I (аллель Morex в локусе Te945) и 66 сортов показали гаплотип II (аллель Steptoe в локусе Te945), причем второй гаплотип может быть далее подразделен на IIа (27 сортов), IIв (14 сортов) и IIс (25 сортов), в зависимости от того, какой нуклеотид они несут в локусах Te931, Ui208 и Ui218.

Три SNP (Ti105, Te945 and Ui143) показали абсолютно неравновесное сцепление в наследовании (linkage disequilibrium, LD) с коэффициентом корреляции равным единице (табл.4) в произвольной выборке 90 генотипов ячменя. Один из них, Te945, ранее использованный нами как молекулярный маркер для картирования гена Cxp1, оказался ассоциированным с уровнем экспрессии гена. В зависимости от аллели в этом локусе, вся

Таблица 3.

Нуклеотидные замены  (SNP) и гаплотипы (комбинации SNP) выявленные в локусе  Cxp1 по результатам сравнительного секвенирования локуса у  90 сортов ячменя.

Сорта

Позиции нуклеотидных замен (SNP)

Гаплотип

Ti105(A/C)

Te931(G/T)

Te945(C/T)

Ui143(G/A)

Ui208(G/A)

Ui218(A/C)

Morex

…TCAAAACTGAAAGCTC…

…CGGACTGAACATTT

ATGACATCCTTG…

…TTTGGACAGA…

…CTATTTTTATAAATA

AGCTGCTTTTCTAA…

I (A.G.C.C.A.G)

Madonna

…TCAAAACTGAAAGCTC…

…CGGACTGAACATTT

ATGACATCCTTG…

…TTTGGACAGA…

…CTATTTTTATAAATA

AGCTGCTTTTCTAA…

Pasadena

…TCAAAACTGAAAGCTC…

…CGGACTGAACATTT

ATGACATCCTTG…

…TTTGGACAGA…

…CTATTTTTATAAATA

AGCTGCTTTTCTAA…

Krona

…TCAAAACTGCAAGCTC…

…CGGACTTAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTGTAAATA

AGCTACTTTTCTAA…

IIa (C.T.T.A.G.A)

Alexis

…TCAAAACTGCAAGCTC…

…CGGACTTAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTGTAAATA

AGCTACTTTTCTAA…

Steina

…TCAAAACTGCAAGCTC…

…CGGACTTAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTGTAAATA

AGCTACTTTTCTAA…

Henni

…TCAAAACTGCAAGCTC…

…CGGACTGAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTGTAAATA

AGCTACTTTTCTAA…

IIb (C.G.T.A.G.A)

Othira

…TCAAAACTGCAAGCTC…

…CGGACTGAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTGTAAATA

AGCTACTTTTCTAA…

Sally

…TCAAAACTGCAAGCTC…

…CGGACTGAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTGTAAATA

AGCTACTTTTCTAA…

Steptoe

…TCAAAACTGCAAGCTC…

…CGGACTGAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTATAAATA

AGCTGCTTTTCTAA…

IIc (C.G.T.A.A.G)

Extract

…TCAAAACTGCAAGCTC…

…CGGACTGAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTATAAATA

AGCTGCTTTTCTAA…

Angora

…TCAAAACTGCAAGCTC…

…CGGACTGAACATTT

ATGACATTCTTG…

…TTTAGACAGA…

…CTATTTTTATAAATA

AGCTGCTTTTCTAA…

Таблица 4.

Коэффициент корреляции в попарных сравнениях r2 аллелей в шести полиморфных локусах гена Cxp1. Достоверность корреляции

оценена по критерию Фишера (Fisher’s exact test) p<0.001.

Позиции SNP

Ti105(A/C)

Te931(G/T)

Te945(C/T)

Ui143(G/A)

Ui208(G/A)

Te931(G/T)

0.1196

Te945(C/T)

1

0.1160

Ui143(G/A)

1

0.1120

1

Ui208(G/A)

0.2264

0.4220

0.2289

0.2204

Ui218(A/C)

0.2529

0.3716

0.2553

0.2903

0.8300

картирующая популяция может быть подразделена на две подгруппы: дигаплоидные линии несущие аллель от Morex (С) и линии несущие аллель от Steptoe (Т). Подгруппа линий с аллелью Morex характеризуется значительно и достоверно (p<0.0001) более высоким уровнем экспрессии Cxp1, чем подгруппа Steptoe в двух повторах эксперимента.

Таким образом, стало возможным предположить, что аллели регуляторного локуса, определяющего экспрессию гена Cxp1, сцепленно наследуются  с тремя вышеупомянутыми SNP в структурной части гена. Если это предположение верно, тогда присутствие Morex-подобных аллелей (A/Ti105, C/Te945, G/Ui143) в структурной части гена Cxp1 должно быть ассоциировано с повышенным уровнем экспрессии гена Cxp1 по сравнению со Steptoe-подобными генотипами (все разновидности гаплотипа II) в случайной выборке сортов ячменя. Чтобы проверить эту гипотезу, уровень экспрессии гена Cxp1 был измерен среди уже упоминавшихся 90 сортов ячменя с помощью RT-PCR. Сравнение экспрессии гена Cxp1 в прорастающих семенах этих сортов показало достоверное (р=0,005) различие уровня экспрессии в зависимости от гаплотипа структурной части гена. Как и в популяции рекомбинантов от скрещивания Steptoe и Morex, сорта Morex-подобного гаплотипа I характеризовались более высоким уровнем экспрессии Cxp1 по сравнению с сортами Steptoe-подобного гаплотипа II.

В картирующей популяции Steptoe/Morex еQTL гена Cxp1 позиционно совпадает с QTL одного из параметров солодования «диастатическая энергия» (Diastatic Power, DP) (рис.3). Этот параметр характеризует общую ферментную активность в прорастающем семени и позволяет оценить эффективность энзимной атаки на крахмал и запасные белки семени при прорастании. По показаниям DP судят насколько быстро и эффективно запасные вещества семян деполимеризируются и становятся доступными для последующего дрожжевого брожения.

       Позиционное совпадение картированного еQTL гена Cxp1 и одного из QTL для диастатической энергии, свидетельствует о том, что уровень экспрессии гена-кандидата Cxp1 действительно может вносить определенный вклад в изменчивость этого селекционно-важного признака пивоваренного качества. Для успешного гидролиза крахмала необходима деполимеризация протеиного матрикса, в который заключены крахмальные зерна, так как матрикс препятствует доступу гидролаз (Bethke et al. 1999). Карбоксипептидазы, включая Cxp1, играют важную роль в этом процессе, расщепляя протеиновый матрикс. От их активности, в конечном итоге, может зависеть эффективность процесса гидролиза, которую и отражает диастатическая энергия.

Рис 3. Сравнение позиций еQTL гена Cxp1 (сплошная линия) и QTL для параметра солодования DP (эффективность гидролиза крахмала и запасных белков в прорастающем семени ячменя, пунктир). Верхняя часть рисунка: кривые LOD-оценок, пороговое значение достоверности для еQTL (LOD=2,9), для DP QTL (LOD=2,7). Нижняя часть рисунка: аддитивный эффект аллелей Steptoe, рассчитанный как пропорция от стандартного отклонения соответствующего признака. Позиция еQTL гена Cxp1 на хромосоме 3Н совпадает с позицией QTL для параметра солодования DP (обозначено стрелкой).

Проведенный анализ свидетельствует о том, что повышенная экспрессия Cxp1 коррелирует с более высокими показателями качества солодования у ячменя и ассоциирована с присутствием определенных аллелей в структурной части гена (гаплотип I). Однако такой признак как пивоваренное качество имеет сложную природу, и, помимо гена Cxp1, его формирование зависит от вклада множества других генетических факторов. Как следствие, не все пивоваренные сорта ячменя относятся к гаплотипу I по гену Cxp1 (например, немецкий сорт Barke). Кроме того, гаплотип I встречается у некоторых типичных высокобелковых непивоваренных сортов (Golf). Тем не менее, пивоваренный фенотип может быть усовершенствован в сортах, селектируемых для пивоваренных целей, путем  замещения в локусе Cxp1 аллелей гаплотипа II на гаплотип I.

Для этого в качестве маркера-диагноста и помощника селекции может быть применен выявленный нами SNP (Te945), который был конвертирован в более удобный для использования CAPS маркер. Использование CAPS маркера избавляет от необходимости трудоемкой процедуры секвенирования локуса Cxp1. Достаточно провести обычную полимеразно-цепную реакцию с последующей обработкой продукта амплификации рестрикционным ферментом Fok1. Рестриктаза подобрана так, чтобы участок цепи ДНК, который Fok1 „узнает“ в качестве мишени, совпадал с участком нуклеотидной замены. Аллель Morex  формирует рестрикционный сайт для данного фермента, в случае же аллели Steptoe рестриктаза не разрезает нуклеотидную цепь. Вследствие этого, генотипы ячменя с Steptoe-подобной и Morex-подобной аллелью Схр1 легко различить на агарозном геле (рис.4). Предложенный CAPS может быть непосредственно использован в селекции, так как маркирует  присутствие в генотипе растения Morex-подобной аллели гена Схр1, что означает высокую вероятность повышенной экспрессии этого гена, а следовательно, более интенсивный процесс протеолиза запасных белков семян и более эффективное солодование.

Рис.4. Дигаплоидные линии потомства от скрещивания сортов Steptoe и Morex, несущие разные аллели гена Схр1: S - аллель, унаследованная от Steptoe,  M – аллель, унаследованная от Morex. Полиморфизм визуализирован с помощью CAPS маркера.

3. Сопряженное картирование генов ячменя и регуляторов их транскрипции с помощью геночипа Affymetrix 22K Barley1 GeneChip

Современные технологии транскриптомного анализа позволяют сравнить уровень экспрессии десятков тысяч генов между двумя различными генотипами. Если дополнительно проанализировать уровень экспрессии генов среди потомства от их скрещивания, становиться возможным картировать полиморфные локусы (eQTL), определяющие варьирование уровня экспрессии генов между двумя генотипами в масштабе всего генома. Этот прием, получил название генетической геномики („genetical genomics“; Jansen, Nap, 2001). Мы применили подход генетической геномики для картирования регуляторов транскрипции генов ячменя в популяции дигаплоидных линий от скрещивания Steptoe и Morex с помощью олигонуклеотидного микрочипа Affymetrix 22K Barley1 GeneChip.

Микрочип Affymetrix представляет собой миниатюрную матрицу, на которую в определенном порядке нанесены 25-мерные олигонуклеотидные последовательности - пробы (probes). Пробы соответствуют определенным фрагментам кодирующих последовательностей ДНК (генов) того организма, для которого микрочип был создан. Для каждого гена предусмотрен набор из одиннадцати проб (probe-set), почти полностью покрывающий конкретную кодирующую последовательность ДНК. На геночипе ячменя (Affymetrix 22K Barley1 GeneChip) представлены 22840 таких пробо-сетов (probe-sets); каждая из одиннадцати проб, образующих пробо-сет, представляет собой короткую нуклеотидную последовательность, «списанную» с определенного участка кодирующей части гена. Нуклеотидные последовательности проб доступны из сети: http://www.plexdb.org/modules/ PD_probeset/ annotation.php?genechip=Barley1. Для гибридизации с микрочипом, иРНК, выделенная из анализируемого тканевого образца, конвертируется сначала в одноцепочечную, а затем в двуцепочечную кДНК. Последняя используется как матрица для транскрипции кРНК in vitro, в процессе которой 5' конец кРНК метится биотиновой меткой. Полученный пул синтезированных кРНК тестируемого организма, помеченных флюоресцентной меткой, гибридизуется с комплементарными олигонуклеотидными последовательностями микрочипа. Интенсивность сигнала гибридизации оценивается с помощью лазерного сканирования.

При вычислении сигнала, значения интенсивности пикселей для каждой пробы преобразуются в числовое значение. Эти значения суммируются в файле, имеющим стандартное расширение «CEL». С результатами гибридизаций, записанными в CEL файлах, можно работать на двух уровнях: а) анализируя уровень сигналов 11 отдельных проб для каждого гена (Probe-level analysis), и б) анализируя уровень обобщенного сигнала для каждого гена (Gene Abundance Estimates).

3.1. Принцип генотипирования сегрегантов картирующих популяций с помощью олигонуклеотидных микрочипов Affymetrix

Структура и дизайн олигонуклеотидных микрочипов Affymetrix позволяет не только проводить одновременное тестирование уровня транскрипции нескольких тысяч генов, но и параллельно выявлять полиморфные участки в последовательностях кРНК, синтезированных в процессе анализа in vitro с матричных кДНК. Так, если сравнивать результаты гибридизации на микрочип кРНК двух родительских генотипов Steptoe и Morex, можно выявить весьма значительную фракцию всех нуклеотидных замен, существующих между этими двумя генотипами ячменя. При этом два типа информации (уровень экспрессии тысяч генов и наличие в их нуклеотидной последовательности полиморфных локусов) могут быть получены одновременно, при обработке результатов одного и того же эксперимента. Уровень транскрипции каждого гена рассчитывается как взвешенная средняя сигналов всех 11 проб, представляющих на микрочипе данную кодирующую последовательность ДНК. Поиск полиморфизма между двумя генотипами, для которых проводится гибридизация на микрочип (генотипирование), имеет в виду анализ сигналов на уровне отдельных проб для каждого гена.

На примере гена Сontig5061_at, рис.5 демонстрирует числовые значения сигналов для трех повторностей гибридизаций Steptoe и Morex для всех 11 проб данного гена. Если нуклеотидная последовательность гена у обоих сортов полностью комплиментарна 25-мерному олигомеру (пробе), закрепленному на микрочипе, для обоих сортов данная проба покажет сигнал примерно одинаковой интенсивности (например, сигналы первой пробы Сontig5061_at_1 у повторностей Steptoe и Morex). Однако, любая нуклеотидная замена, вставка или делеция у одного из родительских генотипов в участке гена, “охваченным“ пробой Affymetrix, нарушат комплементарность, что отразится на кинетике гибридизации, и сигнал этой пробы для «некомплементарного» генотипа будет существенно ниже. При сравнении сигнала седьмой пробы Сontig5061_at_7 для двух генотипов можно заметить, что сигнал Steptoe на порядок ниже, чем сигнал Morex. Отсюда делается заключение, что в кодирующей последовательности Сontig5061_at в районе, комплементарном последовательности ATTCGTCCAGTCGTACTGCATATAC (седьмая проба Сontig5061_at_7), у генотипа Steptoe имеет место нуклеотидная замена, которой нет у генотипа Morex. После установления факта полиморфизма отдельного гена между родительскими сортами, становится возможным «вычислить» родительскую аллель  Steptoe или Morex унаследовала каждая дигаплоидная линия для гена Сontig5061_at (рис.5). Даже визуально можно установить, что линия DH116 унаследовала аллель Morex (сигнал пробы Сontig5061_at_7 равен 405.9), а  DH12 – аллель Steptoe (сигнал пробы Сontig5061_at_7 равен 26.1).

Описанный тип полиморфизма, определяемый на основании разницы сигнала одной пробы в пробо-сете, получил название SFP (Single Feature Polymorphism) (Rostoks et al., 2005). В дополнение к SFP, был предложен еще один класс маркеров, названный Gene Expression Markers (GEMs) (West et al., 2006). Этот класс маркеров основан на качественном различии в уровне экспрессии гена между двумя генотипами, причем уровень экспрессии рассчитывается как обобщенный сигнал всех 11 проб. GEMs продемонстрированы на нашем материале с генотипами ячменя Steptoe, Morex и дигаплоидными линиями от их скрещивания. Рис.5 показывает, что сигнал любой пробы гена Contig10883_at, а значит и общий суммарный уровень экспрессии гена, в гибридизациях Morex на порядок ниже, чем в гибридизациях Steptoe. Эта разница является воспроизводимой в картирующей популяции дигаплоидов: линия DH116 унаследовала аллель Morex,а  DH12 – аллель Steptoe (рис.5).

Рис.5. Транскрипционные маркеры TDMs как комбинация полиморфизма одиночной пробы (Single Feature Polymorphism, SFP, Contig5061_at7) и полиморфизма общего уровня экспрессии гена (Gene Expression Markers, GEMs, пробы Contig10883_at). Нормализованные значения для двух генов (Contigs5061_at и Contigs10883_at) отражают интенсивность сигнала каждой из одиннадцати проб. M1-M3 и S1-S3 обозначают три повторности гибридизации с родительскими генотипами Morex и Steptoe, за ними следуют дигаплоидные линии. Визуально различаемая аллель Morex выделена тенью.

3.2. Принцип выделения транскрипционных маркеров (Transcript Derived Markers, TDM) из экспрессионных профилей

В нашей работе предлагается новый способ эффективного извлечения генетических маркеров из экспрессионных профилей; такие маркеры получи ли название Transcript Derived Markers (TDMs). Под транскрипционным маркером (TDM) подразумевается одна из одиннадцати проб данного гена, демонстрирующая 1) неперекрывающуюся  разницу в уровне сигнала между двумя родительскими генотипами и 2) позволяющая разделить всю совокупность дигаплоидных линий данной расщепляющейся популяции на два класса, каждый из которых несет одну из родительских аллелей. Для практической идентификации TDM поочередно анализируется каждая из 250811 проб (22801 генов на микрочипе, каждый имеет по 11 проб,  22801 x 11  = 250811), и отбираются лишь те пробы, которые позволяют разделить все дигаплоидные линии популяции на два неперекрывающихся, обособленных кластера, как например, проба 7 в случае гена Contig5061_at или любая из проб гена Contig10883_at (рис.5). Очевидно, что в случае SFPs (Contig5061_at, проба 7) только одна или две-три пробы могут соответствовать этому критерию, в случае же GEMs (Contig10883_at) все пробы продемонстрируют явную разницу в сигнале между двумя кластерами. В случае, если несколько проб для одного гена удовлетворяют критериям TDM, из их числа выбирается одна, наиболее достоверная.

       Для выяснения вопроса, насколько достоверным является генотипирование на основе TDMs, нами были использованы данные сиквенса 203 генов ячменя для генотипов Steptoe и Morex и дигаплоидов от их скрещивания. После сравнения последовательностей Steptoe и Morex были выявлены нуклеотидные замены (SNP), и далее для каждого SNP в популяции дигаплоидов было установлено, SNP-аллель Steptoe или Morex унаследовала каждая дигаплоидная линия. Те же самые дигаплоидные линии были независимо генотипированы с помощью TDMs. Таким образом, мы имели возможность сравнить точность генотипирования TDMs с результатами генотипирования SNP для 30 дигаплоидных линий. Из 30 возможных случаев был подсчитан процент совпадений, при которых результаты секвенирования (SNP) и рассчитанные TDMs совпали в прогнозировании родительской аллели данного гена для конкретной дигаплоидной линии. Результаты верификации TDMs показали, что в 95% случаев все 30 линий были генотипированы правильно, или с ошибкой для одной-двух линий из тридцати. Вероятность ошибки при  генотипировании с помощью TDMs, когда из тридцати дигаплоидных линий родительская аллель была ошибочно предсказана для более чем двух линий, составила не более 5%. Описанный выше принцип был использован для идентификации TDM и картирования генов ячменя с помощью Affymetrix 22K Barley1 GeneChip по результатам гибридизации на микрочип препаратов РНК, выделенных из 30 дигаплоидных линий для ткани зародыша семени и листьев проростков. Для двух этих типов тканей было идентифицировано 2449 и 3858 TDMs соответственно. Две этих совокупности TDMs перекрывались между собой примерно на 40%. Идентифицированные TDMs были картированы в популяции рекомбинантов от скрещивания Steptoe и Morex, в результате чего 3029 транскрибируемых генов были локализованы на генетической карте ячменя.

3.3. Построение генетической карты скрещивания Steptoe и Morex на основе маркеров TDM и общегеномное картирование eQTL

При анализе гибридизаций на микрочип 139 дигаплоидных линий для тканей зародыша семени были выявлены 1596 TDM маркеров, которые были картированы на семи хромосомах ячменя. Общая длина карты составила 1017 сМ. Полученная генетическая карта включала 512 рекомбинационных бинов и была использована для картирования eQTL. Картирование eQTL проводилось только для генов, уровень транскрипции которых достоверно отличался от гибридизационного шума по крайней мере для двух из трех повторов гибридизаций одного из родителей (Steptoe или Morex). Таким образом, из 22801 генов ячменя, представленных на микрочипе Affymetrix, картирование регуляторов транскрипции осуществлялось для 15967 генов (70%). Для каждого из этих 15967 генов было проведено картирование eQTL методом CIM  (Compositive Interval Mapping; Zeng, 1993). Всего, при картировании регуляторов транскрипции 15967 генов ячменя было зафиксировано 23738 достоверных еQTL. Табл.5. обобщает полученную информацию: ни одного достоверного еQTL не было выявлено для 19% проанализированных генов, для остальных 81% (12987 генов) было зафиксировано до шести достоверных еQTL.

Таблица 5.

Число достоверных eQTLs (P0.05) обнаруженных для каждого из 15967 генов

Число достоверных (P0.05) eQTLs на один ген

Сколько генов выявлено

Процент генов от общего числа

0

2980

18.7%

1

5764

36.1%

2

4515

28.3%

3

1997

12.5%

4

616

3.8%

5

83

0.5%

6

12

0.1%

Всего генов

15967

3.4. Сгущения (hotspots) eQTL на генетической карте скрещивания Steptoe и Morex

Установлено, что распределение выявленных 23738 eQTL на генетической карте Steptoe/Morex не является равномерным. Для каждого из 512 бинов было расчитано относительное число картированных eQTL, приходящихся на один сантиморган. В результате были идентифицированы 14 бинов из начального числа 512, где число картированных eQTL достоверно превышало ожидаемое в случайном процессе. Идентифицированные участки генома со сгущениями eQTL представляют интерес в смысле выявления транс-регуляторных локусов, определяющих активность не одного, а сразу большого числа генов. С наибольшей вероятностью такие транс-регуляторы, влияющие на уровень транскрипции сразу нескольких генов, могут быть локализованы в сгущениях eQTL с более низким процентом объясненной фенотипической изменчивости (R2) (табл.6, выделено жирным шрифтом). При подобном анализе геномов у секвенированных организмов отмечалось, что транс-eQTL, как правило, ассоциированы с более низкими  R2 (Hughes et al., 2006; West et al., 2007). В таких сгущениях eQTL было также обнаружено преобладание одной из родительских аллелей с позитивным эффектом.

Таблица 6.

Сгущения eQTL, выявленные в картирующей популяции ячменя от скрещивания Steptoe и Morex. Хи-квадрат (χ2) оценивает достоверность преобладания позитивного эффекта от одного родителя по сравнению со вторым родителем для всех eQTL, картированных в данном сгущении. Сгущения eQTL, отличающиеся преобладанием eQTL с низким процентом объясненной фенотипической изменчивости (R2), подчеркнуты и выделены жирным шрифтом

Хромосома

Номер бина

Позиция на карте (cM)

Число картированных eQTLs

Длина интервала cM

%eQTL с позитивной аллелью от Mx

% eQTL с позитивной аллелью от St

Достоверность по Хи-квадрат

P value

У 95% картированных eQTLs R2 меньше чем

2H

12

33.9

134

2.3

40%

60%

0.0237

0.270

2H

26

52.9

136

0.8

72%

28%

0.0001

0.190

2H

32

61.9

191

0.7

50%

50%

0.9436

0.340

2H

37

65.5

197

0.7

41%

59%

0.0084

0.320

5H

1

0.0

236

2.9

17%

83%

0.0001

0.200

5H

5-6

5.1

453

6.6

9%

91%

0.0001

0.160

5H

41-42

58.1

105

1.5

62%

38%

0.0147

0.300

5H

44

62.5

384

2.2

50%

50%

0.8384

0.300

7H

26-29

35.1

685

5.8

4%

96%

0.0001

0.180

Рис.6. Ассоциация между фенотипическими рQTL для параметров солодования и сгущениями еQTL, картированных для уровня транскрипции генов. Непрерывные кривые, выделенные серым цветом, соответствуют значениям LOD-оценки в соответствующем локусе генетической карты для пивоваренных параметров: содержание белка (GP), активность альфа-амилазы (AA), диастатическая энергия (DP), и экстрактивность (ME). Ось ординат справа отражает шкалу LOD-оценки для рQTL пивоваренных признаков. Горизонтальные линии соответствуют пороговому уровню LOD, выше которого рQTL рассматриваются как достоверные (Р<0.05). Вертикальные черные линии соответствуют 14 сгущениям eQTL (табл.6). Высоты черных вертикальных линий оцениваются по шкале на оси ординат слева, которая отражает количество eQTL, зафиксированных в соответствующем сгущении. Стрелками обозначены позиции совпадений рQTL со сгущениями eQTL.

3.5. Сопоставление локусов сгущений eQTL с позициями QTL для важнейших параметров солодования у ячменя

       Выявленные сгущения регуляторных локусов, в которых нуклеотидный полиморфизм между Steptoe и Morex влияет на уровень транскрипции нескольких сотен генов, могут также иметь отношение к различиям по пивоваренному качеству между двумя этими сортами,  которое селектировалось в разных направлениях:  пищевой сорт Steptoe на высокое содержание белка, пивоваренный сорт Morex – на пониженное содержание белка. Используя опубликованные данные (Hayes et al., 1993) по изменчивости параметров солода для тех же самых 139 дигаплоидных линий, с помощью которых проводилось картирование eQTL, мы провели картирование QTL для четырех параметров солодования. Требовалось установить, совпадают ли локусы сгущений eQTL с позициями QTL для фенотипических признаков (phenotype QTL, pQTL). Результаты представлены на рис.6. Для всех четырех проанализированных параметров солодования был картирован хотя бы один достоверный pQTL, который совпал по позиции на генетической карте хотя бы с одним из локусов сгущений eQTL на хромосомах 2Н, 5Н или 7Н. Обнаружено, что локус сгущения eQTL на хромосоме 2Н влияет на изменчивость всех четырех проанализированных параметров солода.

3.6. Ограниченная плейотропия цис-регуляторных мутаций

Ограниченная плейотропия цис-регуляторных мутаций вперые была исследована нами в общегеномном масштабе на примере ячменя. Для этого было проведено сравнительное картирование 2081 цис-eQTL в двух типах ткани, соответствующим также двум разным последовательным стадиям развития растения – зародыша прорастающего семени и листьям 12-дневных проростков. Таким образом было проанализировано наследование 2081 цис-регуляторных мутаций дигаплоидными линиями от скрещивания Steptoe и Morex, и кроме того, мы сравнили эффект, оказываемый такими мутациями на уровень транскрипции генов в двух разных тканях. Было обнаружено, что для многих генов наследование определенной родительской аллели (Steptoe или Morex) может влиять на регуляцию транскрипции самым критическим образом. Однако обнаружить это влияние можно было только при определенных условиях. Так, для 30% проанализированных цис-регуляторных мутаций их эффект на уровень транскрипции гена проявлялся в одной ткани, но не обнаруживался в другой. Например, в случае Contig13784_at (рис.7А) ген активно транскрибировался как в зародыше семени, так и в листьях, однако эффект цис-регуляторной мутации проявлялся лишь в одной ткани, то есть обладал ограниченной плейотропией.

Мы также наблюдали примеры когда в одной ткани повышенная экспрессия гена определялась присутствием, например, аллели Morex, а в другой ткани – повышенная экспрессия фиксировалась у линий с аллелью Steptoe, то есть имел место обратный эффект родительской аллели, влияющий на уровень экспрессии гена в двух разных тканях. Так, в примере Contig4374_s_at (рис.7В) у дигаплоидных линий, унаследовавших аллель Steptoe, уровень транскрипции гена оставался неизменным в зародыше семени и в листьях. Однако, у линий, унаследовавших аллель Morex, уровень транскрипции гена повышался в тканях зародыша, но понижался в листьях. Наблюдаемые результаты можно объяснить, если предположить в случае Steptoe мутацию в участке энхансера, ответственного за тканеспецифичную регуляцию экспрессии гена. Мутации в участке энхансера могли иметь место еще для 34 генов, у которых в анализе был выявлен противоположный эффект родительской аллели на уровень транскрипции генов в разных тканях.

Рис.7. Ограниченная плейотропия цис-регуляторной мутации (А) и обратный эффект родительской аллели на уровень транскрипции гена в двух разных тканях (В). Уровень транскрипции, оцениваемый по логарифму интенсивности сигнала на микрочипе Affymetrix, соответствует шкале на оси ординат. Черным цветом обозначены уровень экспрессии гена в зародыше семени, серым – в листьях. Первые 6 столбиков на диаграммах для каждой ткани соответствуют 3 повторам Morex (M) и 3 повторам  Steptoe (S), за которыми следуют 30 дигаплоидов от их скрещивания

А - Contig13784_at, ген активно транскрибируется в обоих типах ткани, однако эффект цис-регуляторной мутации (аллель Steptoe повышает уровень транскрипции гена по сравнению с аллелью Morex) проявляется лишь в зародыше семени (ограниченный плейотропный эффект).

В - Contig4374_s_at, аллель Steptoe (S) определяет одинаковый уровень транскрипции гена в тканях зародыша семени и листьев, в то время как аллель Morex (M)  повышает уровень транскрипции в зародыше семени и понижает в листьях.

ВЫВОДЫ

1. По результатам анализа филогенетических взаимоотношений 29 видов Vicia subgenus Vicia методами RAPD, AFLP и рестрикционного анализа хлоропластных генов очерчен круг ближайших родственных таксонов для культивируемых видов вики, а также выдвинута гипотеза о возможной предковой форме культурного вида V.faba. 

2. По результатам анализа генофонда культурного вида V.sativa (1122 образцов из коллекций двух генбанков) методом AFLP предложен оригинальный метод классификации генетического разнообразия возделываемых видов на основе расчета коэффициентов генетической оригинальности образцов по Смирнову.

3. Создана коллекция 27512 EST, представляющая собой набор фрагментов кодирующих последовательностей ДНК, выделенных из тканей семени ячменя на разных стадиях прорастания. Нуклеотидные последовательности EST и их функциональные аннотации доступны для пользователей (http://pgrc.ipk-gatersleben.de/cr-est/index.php). На основе коллекций EST создан инструмент для транскриптомного анализа ячменя - кДНК-макрочип.

4. Впервые проанализирована динамика экспрессии генов в процессе прорастания семени ячменя с использованием кДНК-макрочипа. Установлено, что гены, преимущественно экспрессируемые в зародыше и щитке, кодируют белки клеточного цикла, процессов трансляции, нуклеотидного метаболизма, углеводного обмена и транспортных функций. Гены, активные в алейроновом слое эндосперма, в основном определяют процессы гидролиза углеводов и метаболизма аминокислот. На примере запасных белков и ингибитора трипсина было показано, что эндосперм прорастающего семени ячменя может содержать значительное количество деградирующих транскриптов, синтезированных на предыдущих этапах развития и созревания семени.

5. По результатам экспрессионного анализа с использованием кДНК-макрочипа десяти сортов ячменя, различающихся по параметрам солодования, разработан функционально-ассоциативный подход для выявления корреляции между изменчивостью экспрессионных профилей и изменчивостью признаков пивоваренного качества. В результате идентифицированы 19 генов-кандидатов, чья экспрессия, возможно, определяет пивоваренные качества у проанализированных сортов ячменя.

6. На примере одного из идентифицированных генов-кандидатов карбоксипептидазы 1 (Cxp1) продемонстрирована стратегия картирования генетического локуса, определяющего уровень экспрессии гена-кандидата, с последующим созданием молекулярного маркера-помощника селекции, позволяющего проводить отбор генотипов с желательной повышенной или пониженной экспрессией гена-кандидата.

7. Впервые проанализирован уровень транскрипции 22801 генов в прорастающих семенах двух генотипов ячменя Morex и Steptoe, а также у 139 дигаплоидных линий от их скрещивания с использованием микрочипа Affymetrix 22K Barley1 GeneChip. На основе полученных данных разработан новый тип молекулярных маркеров – транскрипционные маркеры (Transcript Derived Markers, TDM). С их помощью на генетической карте ячменя впервые установлено местоположение 3029 транскрибируемых генов. Создан каталог, содержащий информацию о линейной последовательности этих генов на хромосомах и генетических расстояниях между ними. В рамках того же эксперимента на карте скрещивания Steptoe/Morex локализованы генетические локусы (eQTL), от полиморфизма которых зависит уровень транскрипции 12987 генов.

8. Установлено, что картированные с помощью геночипа Affymetrix генетические локусы, достоверно влияющие на уровень транскрипции генов у ячменя (eQTL), неравномерно распределены на генетической карте. На хромосомах 2Н, 5Н и 7Н выявлены сгущения eQTL (eQTL hotspots), которые могут указывать на присутствие транс-регуляторных локусов, влияющих на транскрипцию не одного, а сразу большого числа генов. Позиции выявленных сгущений eQTL совпадают с позициями некоторых QTL для признаков пивоваренного качества.

9. Результаты транскриптомного анализа с использованием Affymetrix 22K Barley1 GeneChip показали, что нуклеотидный полиморфизм, существующий между двумя сортами ячменя, может достоверно влиять на уровень экспрессии более 80% транскрибируемых генов. Уровень транскрипции более половины из этих генов зависит от не одного, а нескольких полиморфных генетических локусов (eQTL).

10. Полиморфные генетические локусы, определяющие уровень транскрипции генов (eQTL), с самыми высокими показателями LOD, позиционно совпадают с положением самих генов на генетической карте. Это свидетельствует о том, что причиной наиболее существенных изменений в уровне экспрессии гена могут служить цис-регуляторные мутации, нарушающие взаимодействие регуляторных участков гена с РНК-полимеразой и транскрипционными факторами.

11. Ограниченная плейотропия цис-регуляторных мутаций вперые исследована в общегеномном масштабе на примере ячменя. Для этого было проведено сравнительное картирование 2081 цис-eQTL для генов в двух типах ткани, соответствующим также двум разным последовательным стадиям развития растения. Эффект 30% цис-регуляторных мутаций, выявленных при транскриптомном анализе популяции дигаплоидных линий от скрещивания двух генотипов (Steptoe и Morex), ограничивался конкретной тканью или возрастной стадией.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ

Статьи в изданиях, рекомендованных ВАК:

1. Potokina E. Gene expression quantitative trait locus analysis of 16,000 barley genes reveals a complex pattern of genome wide transcriptional regulation / E. Potokina, A. Druka, Z. Luo, R. Wise, R.Waugh, M. J. Kearsey // Plant Journal. - 2008. - V.53. – P. 90-101.

2. Потокина Е.К. Внутривидовое разнообразие Vicia faba L. и вопрос о происхождении возделываемых бобов по результатам молекулярного маркирования генома / Е. К. Потокина, С.В. Булынцев, Н. Томоока, Д. Воган // Сельскохозяйственная биология. – 2008. - №.3. – С. 47-58.

3. Potokina E. SFP genotyping from Affymetrix arrays is robust but largely detects cis-acting regulatory genes / Z.W. Luo, E. Potokina, A. Druka, R. Wise, R.Waugh, M.J. Kearsey // Genetics. - 2007. - V.176. – P. 789-800.

4. Потокина Е.К. Современные методы геномного анализа в исследованиях генетики количественных признаков у растений / Е.К. Потокина, Ю.В. Чесноков// Сельскохозяйственная биология. - 2006. - №.3. – С. 3-18.

5. Potokina E. Large-scale analysis of the barley transcriptome based on Expressed Sequence Tags / H.N. Zhang, N. Sreenivasulu, W. Weschke, N. Stein, S. Rudd, V. Radchuk, E. Potokina, U. Scholz, P. Schweizer, U. Zierold, P. Langridge, R.K. Varshney, U. Wobus, A. Graner // Plant Journal. - 2004. - V.40. – P. 276-290.

6. Potokina E. Functional association between malting quality trait components and cDNA array based expression patterns in barley (Hordeum vulgare L.) / E. Potokina, M. Caspers, M. Prasad, R. Kota, H. Zhang, N. Sreenivasulu, M. Wang, A. Graner // Molecular Breeding. - 2004. - V.14. – P. 153-170.

7. Potokina E. AFLP diversity in common vetch (Vicia sativa L.) on the world scale / E. Potokina, F.R. Blattner, T. Alexandrova, K. Bachmann // Theoretical and Applied Genetics. - 2002. - V.105. – P. 58-67.

8. Потокина Е.К. Перекрестник или самоопылитель? Электрофорез запасных белков семян как метод определения способа опыления видов бобовых / Э.Э. Егги, Е.К. Потокина // Ботанический журнал. - 1998. – Т.83.№12. – С. 77-83.

9. Потокина E.К. Особенности опыления однолетних видов рода Vicia (Fabaceae) / E.К. Потокина, Т. Г.  Александрова // Ботанический журнал. - 1996. – Т.81. – С. 74-79.

10. Потокина E.К. Коэффициенты генетической оригинальности образцов коллекции вики посевной (Vicia sativa L.) по результатам молекулярного маркирования / E.К. Потокина, Т. Г.  Александрова // Генетика. – 2008. - №.11.  (в печати).

Статьи в рецензируемых журналах:

11. Potokina E. Expression genetics and haplotype analysis reveal cis regulation of serine carboxypeptidase I (Cxp1), a candidate gene for malting quality in barley (Hordeum vulgare L.) / E. Potokina, M. Prasad, L. Malysheva, M.S. Roder, A.  Graner // Functional and Integrative Genomics. - 2006. - V.6.№1. – P.25-35.

12. Potokina E. cDNA array analysis of stress-induced gene expression in barley androgenesis / S.D.F. Maraschin, M. Caspers, E. Potokina, F. Wulfert, A. Graner, H.P. Spaink, M. Wang // Physiologia Plantarum. - 2006. - V.127. №4. – P. 535-550.

13. Potokina E. Der steinige molekulare Weg zu besserem Malz / M. Roder, E. Potokina, L. Malysheva-Otto, I. Matthies, A. Graner //Vortrge Pflanzenzchtung. - 2006. - V.69. – P. 83-85.

14. Potokina E. Molecular mapping in barley: shifting from the structural to the functional level / A. Graner, T. Thiel, H. Zhang, E. Potokina, M. Prasad, D. Perovich, R. Kota, R.K. Varshney, U. Scholz, I. Grosse, N. Stein //Czech Journal of Genetics and Plant Breeding. - 2005. - V.41.№3. – P. 81-88.

15. Potokina E. A simple hybridization-based strategy for the generation of non-redundant EST collections - a case study in barley (Hordeum vulgare L.) / R.K. Varshney, H.N. Zhang, E. Potokina, N. Stein, P. Langridge, A. Graner // Plant Science. - 2004. - V.167.№3. – P. 629-634.

16. Potokina E. Electrophoretic patterns of seed proteins in the East Asian Vicia species (Leguminosae) and their systematic utility / E. Potokina, Y. Endo, E. Eggi, H. Ohashi // The Journal of Japanese Botany. - 2003. - V.78.№1. – P.29-37.

17. Potokina E. Differential gene expression during seed germination in barley (Hordeum  vulgare L.) / E. Potokina, N. Sreenivasulu, L. Altschmied, W. Michalek, A. Graner // Functional and Integrative Genomics. - 2002. - V.2.№1-2. – P. 28-39.

18. Potokina E. Functional Genomics bei Gerste: Vom Erkenntnisgewinn zur zchterischen Nutzung / E. Potokina, M. Caspers, N. Sreenivasulu, M. Wang, L. Altschmied, A. Graner // Vortrge Pflanzenzchtung. - 2002. - V.173. – P.173-181.

19. Potokina E. Population diversity of the Vicia sativa agg. (Fabaceae) in the flora of the former USSR deduced from RAPD and seed protein analyses / E. Potokina, D. Vaughan, E. Eggi, N. Tomooka // Genetic Resources and Crop Evolution. - 2000. - V.47. – P.171-183.

20. Potokina E. Phylogeny of Vicia subgenus Vicia (Fabaceae) based on analyses of RAPDs and RFLP of PCR-amplified chloroplast genes / E. Potokina, N. Tomooka, D. A. Vaughan, T. Alexandrova, R.Q. Xu // Genetic Resources and Crop Evolution. - 1999. - V.46. – P.149-161.

21. Potokina E. Vicia sativa aggregate  (Fabaceae) in the flora of former USSR / E. Potokina // Genetic Resources and Crop Evolution. - 1997. - V.44. – P.199-209.

22. Потокина E.K. Электрофорез запасных белков семян в решении проблем систематики  Vicia sativa agg. / E. K. Потокина, Э. Э. Eгги // Труды по прикл. бот., ген. и селекц. - 1991. – Т.139. С.112-123.

Материалы всероссийских и международных конференций

23. Potokina E. Towards the functional basis of malting quality in barley: cis regulation of the Cxp1 gene / E. Potokina, M. Prasad, H. Zhang, D. Perovich, N. Stein, A. Graner // Proceedings of 9th International Symposium on Plant Seeds. – 2004. – P. 53.

24. Potokina E. Malting quality in barley cultivars using genomic approach  / M. Caspers, E. Potokina, A. Graner, M. Wang // European Society for Agronomy, VIII ESA Congress. – 2004. – P. 971.

25. Потокина Е.К. Функционально-ассоциативный подход для выявления связи генной экспрессии с изменчивостью фенотипического признака у ячменя (Hordeum vulgare L.). / Е.К. Потокина, М. Касперс, М. Ванг, М. Прасад, Р. Кота, Х. Цанг, А. Гранер //  Материалы III Съезда ВОГиС “Генетика в XXI веке: современное состояние и перспективы развития”. – Москва, 2004. - С. 253.

26. Потокина Е.К. Оптимизация коллекций генетических ресурсов растений с помощью методов ДНК-фингерпринтинга / Е.К. Потокина, Т.Г. Александрова // XII делегатский съезд русского ботанического общества. – 2003. – P. 53.

27. Potokina E. Study of androgenesis induced gene expression in barley by cDNA array approach / S.F. Maraschin, E. Potokina, M. Caspers, A. Graner, H.P. Spaink, M. Wang // Proceedings of XI International Conference of Plant Embryology. – 2003. – P. 41.

28. Potokina E. Malting quality of barley cultivars in terms of gene expression / E. Potokina, M. Caspers, N. Sreenivasulu, M. Wang, A. Sorensen, A. Graner // Proceedings of 6th Gatersleben Research Conference. – 2002. – P. 44.

29. Potokina E. Functional genomics of seed germination in barley / E. Potokina, M. Wolf, N. Sreenivasulu, W. Weschke, W. Michalek, L. Altschmied, A. Graner // Abstracts of the XVIth EUCARPIA Congress, Edinburg, Scotland, 2001. – http://www.eucarpia.org/03publications/ abstractsxvi/ XVI_006.html.

30. Potokina E. Vicia faba L. and related species: genetic diversity and evolution / E. Potokina, D.A. Vaughan, N. Tomooka, S. Bulyntzev // Proceedings of the 7th Ministry of Agriculture, Forestry and Fisheries (MAFF), Japan International Workshop on Genetic Resources. Part1. Wild Legumes. – 2000. – P. 125-143.

31. Potokina E. Exploration and collection of wild Vicia species in Nagano and Niigata Prefectures, Japan 17th-19th October 1999 / D. Vaughan, N. Tomooka, E. Potokina, N. Maxted, D. Jarvis, M.S. Yoon, A. Kaga, M. Akiba, Y. Tsubokura // Annual report of exploration and introduction of plant genetic resources. -  2000. – V.16. – P. 59-65.

32. Potokina E. Genetic diversity of landraces and local cultivars of common vetch (Vicia sativa L.) in the area of former USSR / E. Potokina, F.R. Blattner, T. Alexandrova, K. Bachmann  // Proceedings of 3rd International Crop Science Congress. – 2000. – P. 126.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.