WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

Казачинская Елена Ивановна

ПОЛУЧЕНИЕ И ПРИМЕНЕНИЕ МОНОКЛОНАЛЬНЫХ АНТИТЕЛ И РЕКОМБИНАНТНЫХ БЕЛКОВ ДЛЯ ИММУНОДИАГНОСТИКИ ОПАСНЫХ ИНФЕКЦИЙ ЧЕЛОВЕКА

03.01.06. - биотехнология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук

Кольцово – 2010

Работа выполнена в ФГУН Государственный научный центр вирусологии и биотехнологии “Вектор” Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека Министерства здравоохранения и социального развития РФ

Научный консультант:

доктор биологических наук, профессор Локтев Валерий Борисович

Официальные оппоненты:

доктор медицинских наук,

профессор Кожевников Владимир Сергеевич

доктор биологических наук Татьков Сергей Иванович

доктор медицинских наук,

профессор Бочаров Евгений Федорович

Ведущая организация:

НИИ молекулярной биологии и биофизики (НИИМББ) СО РАМН,

г. Новосибирск

Защита диссертационной работы состоится  «  24 » декабря  2010 г .

в  часов  на заседании диссертационного совета Д.208.020.01 при ФГУН Государственный научный центр вирусологии и биотехнологии “Вектор” Роспотребнадзора по адресу: 630559, Кольцово, Новосибирский район, Новосибирской области.

С диссертацией можно ознакомиться в библиотеке ФГУН ГНЦ ВБ “Вектор”

Автореферат разослан “ “  2010 г.

Ученый секретарь

диссертационного совета

доктор биологических наук  Трошкова Галина Павловна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность исследования

Проблема быстрой и точной диагностики инфекционных болезней имеет чрезвычайно важное значение для современного общества. Многие инфекционные заболевания представляют угрозу для жизни и здоровья не только для конкретного индивидуума, но для всего общества. Быстрое и не контролируемое распространение инфекционных заболеваний может привести к развитию эпидемии или даже пандемии в течение весьма короткого периода времени. В последние годы вспышки короновирусной инфекции, птичьего гриппа, пандемического вируса гриппа H1N1 подтверждают крайне высокую значимость борьбы с инфекционными заболеваниями в современном мире (X.Y. Che et al., 2004; Q. He et al., 2007; А.А. Кущ и др., 2008).

Важнейшей составляющей борьбы с инфекционными заболеваниями является своевременная их диагностика. В настоящее время развиваются два основных подхода в диагностике инфекционных заболеваний. Генетическая диагностика, основанная на выявлении нуклеиновой кислоты возбудителя, и иммунодиагностика, базирующаяся на выявление специфических антигенов и антител, являются взаимодополняющими методическими подходами. Следовательно, крайне важно развивать оба эти направления исследований. Сложность проблемы состоит в том, что в настоящее время известны тысячи опасных инфекционных заболеваний, которые могут поражать сельскохозяйственные растения, домашних животных и человека. Кроме того, постоянно возникают новые, неизвестные инфекционные заболевания. По данных Международного таксономического вирусологического комитета только в последние годы зарегистрировано несколько сотен вновь открытых вирусных агентов. Открытие каждого нового возбудителя требует разработки методов их диагностики, причем эпидемическая значимость некоторых  из них требует проведения этих исследований в самые кратчайшие сроки. Проблема усложняется тем, что постоянно возникают лекарственно устойчивые варианты возбудителей, многие вирусные агенты чрезвычайно быстро изменяются. Высокая патогенность многих вирусов также чрезвычайно усложняет экспериментальные работы по созданию новых методов диагностики. Вследствие этого, необходимо постоянное развитие и совершенствование биотехнологической базы для точной и своевременной диагностики инфекционных заболеваний.

Для совершенствования диагностики инфекций используют два основных подхода. Это технологии получения моноклональных антител (МКА) и рекомбинантных антигенов. Гибридомная технология позволяет создать уникальную биотехнологическую базу в виде препаратов МКА для исследования вирусных и бактериальных патогенов, опухолевых маркеров, гормонов, цитокинов, интерлейкинов, прионов, токсинов, аллергенов.

В настоящее время МКА все шире входят в повседневную практику научных лабораторий, активно используются для конструирования и производство высокоспецифичных тест-систем и все шире применяются в практической медицине. Использование рекомбинантных антигенов также позволяет совершенствовать иммунодиагностику, причем важно заметить, оба этих подхода позволяют фактически прекратить использование высокопатогенных инфекционных агентов при производстве тест систем. Другим важнейшим преимуществом данного подхода является возможность стандартизации качества новых иммунодиагностических систем и появление возможности обеспечивать производство иммунодиагностических тест систем необходимыми биологическими компонентами, антителами и антигенами, в течение неопределенно длительного времени.

Высокопатогенные филовирусы Марбург и Эбола чрезвычайно опасны для человека и общества, они могут использоваться с террористическими целями. Эпидемическая важность этих агентов основана на способности этих вирусов распространяться через прямой контакт с биологическими жидкостями и воздушно-капельным путем (О.В. Пьянков, 1993; М.Ю. Луб и др., 1995; E. Johson et al., 1995). В настоящее время в России нет коммерчески доступных ИФА тест-систем для быстрого выявления антител и антигенов филовирусов.

Характерной особенностью филовирусных инфекций является раннее появление вирусных антигенов в тканях, выделениях и сыворотке крови инфицированных животных и заболевших людей (Н.В. Кизимов и др., 1993; Н.В. Мерзликин и др., 1995; A.K. Rowe, 1999; Т.С. Чепурнова и др., 2000). Эта особенность развития заболевания делает высокоэффективными методы иммунологической диагностики, основанные на раннем выявлении вирусных антигенов в биологических жидкостях человека и животных. Препараты очищенных МКА могут служить основой ИФА тест-системы самостоятельно или как подтверждающий тест к ПЦР-диагностике (J.S. Towner et al., 2004). 

Вспышка 1999 г. в Волгоградской, Астраханской областях и Краснодарском крае лихорадки Западного Нила (ЛЗН), которая считалась эндемичной для тропических и субтропических стран, привлекла внимание к проблеме диагностики этой инфекции и потребовала быстрейшей ее разработки в нашей стране (Д.К. Львов и др., 2000). Тем более, что позднее появились сообщения о циркуляции вируса  Западного Нила (ВЗН) в птицах, комарах и клещах от Белоруссии до Приморского края, в Закавказье, бассейне Каспийского моря, республиках средней Азии, в Сибири (Д.К. Львов, 2000, В.А. Терновой и др., 2004; В.А. Терновой и др., 2006). ВЗН передается теплокровным (людям, лошадям, птицам) через укус комаров, клещей и москитов. В США зафиксированы случаи, когда ЛЗН развивалась у реципиентов после переливания крови (T. Harrington, 2003). ЛЗН особенно опасна для пожилых людей, у которых может развиться миокардит, менингит и менингоэнцефалит, что приводит к 10 %-ной летальности среди заболевших (E. Flatau et al., 1981). События 2010 г. на юге России, где снова возникла большая вспышка лихорадки Западного Нила, подтвердили значимость настоящего исследования и практическое использование разработанных тест систем обеспечило необходимые условия для борьбы с этой инфекцией в России.

Цитомегаловирусная инфекция (ЦМВИ), вызываемая вирусом герпеса человека 5 типа (ВГЧ-5) - широко распространенное заболевание повсеместно во всех географических зонах, странах и социально-экономических группах (C.A. Alford et al., 1981). Главной биологической особенностью ВГЧ-5 является его пожизненное персистирование в организме человека и реактивация при снижении иммунитета. Заражение происходит разными путями: воздушно – капельным и при тесном контакте (в том числе и половом) через биологические жидкости, трансплацентарно (от матери к плоду) и интранатально во время родов при прохождении плода через инфицированные родовые пути женщины, при кормлении ребенка грудным молоком (C.A. Alford et al., 1990). Подтверждены факты инфицирования людей при трансплантации органов (почек, печени и костного мозга) (S. Chou, 1986; E. Meijer et al., 2003; R.R. Razonable, 2008). ВГЧ-5 вызывает генерализованную инфекцию у больных СПИД, что является причиной их гибели (G. Nigro et al., 1996). Сложность диагностики связана с проблемами персистирования этого вируса в клетках организма и необходимостью выявления вирусных антигенов именно в инфицированных клетках. В настоящее время присутствие на мембранах периферических лейкоцитов матриксного фосфопротеина pp65 и секреторного р72 ВГЧ-5 принято считать одним из основных критериев острой ЦМВИ. Получение отечественной панели МКА, специфичных к белку рр65, помогло бы улучшить ситуацию с диагностированием острой ЦМВИ у инфицированных людей.

Цель работы: разработка биотехнологической базы для совершенствования иммунодиагностики инфекций, вызываемых вирусами Марбург, Эбола, Западного Нила и герпесом человека 5 типа (цитомегаловирусом).

Для достижения поставленной цели необходимо было решить следующие задачи:

  1. Получить представительные коллекции гибридом, продуцирующих моноклональные антитела (МКА), специфичные к белкам филовирусов Марбург и  Эбола, вируса Западного Нила (ВЗН) и вируса герпеса человека 5 типа (ВГЧ-5).
  2. Исследовать иммунохимические свойства МКА к структурным белкам вирусов Марбург, Эбола, ВЗН и ВГЧ-5 и оценить возможность их использования для конструирования иммунодиагностических тест систем на основе МКА.
  3. Сконструировать рекомбинантные плазмиды, кодирующие полноразмерные гены нуклеопротеина вируса Эбола и матриксных белков VP40 вирусов Марбург и Эбола и получить полноразмерные рекомбинантные белки.
  4. Исследовать антигенную структуру природных и рекомбинантных белков вирусов Марбург и Эбола с помощью панелей противовирусных поликлональных антител и гибридомных МКА с целью оценки возможности использования рекомбинантных антигенов для разработки иммунодиагностических тест систем.
  5. С использованием полученных МКА и рекомбинантных антигенов сконструировать новое поколение иммуноферментных систем для детекции антигенов вирусов Эбола и Марбург в биологических пробах.
  6. С использованием МКА, специфичных к белку Е вируса Западного Нила, сконструировать лабораторный вариант экспериментальной ИФА тест-системы для выявления вирусного антигена, оценить его специфичность и чувствительность. Организовать коммерческий выпуск новой тест системы на основе МКА для широкого апробирования на практике.
  7. Исследовать возможность использования МКА специфичных к белку рр65 ВГЧ-5 для диагностики острой и персистентной цитомегаловирусной инфекции на культурах клеток.

Научная новизна

Получены оригинальные и представительные коллекции гибридных клеток - продуцентов МКА и панели МКА  к антигенам вирусов Марбург, Эбола, ВЗН и ВГЧ-5.

Исследование иммунохимических свойств представительной панели гибридомных МКА показало, что полученные панели МКА к антигенам вирусов Марбург, Эбола, ВЗН и ВГЧ-5 могут быть использованы для научных исследований и для конструирования нового поколения иммунодиагностических тест систем на основе этих антител.

Получены оригинальные рекомбинантные белки гликопротеин (GP), нуклеопротеин (NP), VP40, VP35, VP24 вируса Марбург и белки NP, VP40, VP35 вируса Эбола. Исследование  антигенных свойств рекомбинантных белков показало их иммунохимическую полноценность, что позволяет их использовать при конструировании тест систем на эти инфекции.

       В результате проведенных исследований, с использованием оригинальных препаратов МКА, а также рекомбинантных антигенов филовирусов, сконструированы новые диагностические лабораторные тест системы для выявления антигенов вирусов Марбург и Эбола. Новизна и приоритет данной разработки подтверждена получением четырех патентов РФ (патенты № 2395575, № 2393220, № 2395576, № 2395577)

Исследование панели вируснейтрализующих МКА к белку Е вируса Западного Нила (LEIV-VLG99-27889-human) позволило обнаружить два вида МКА 9Е2 и 5Н6 пригодных для конструирования иммуноферментной тест системы для детекции антигена в биологических пробах.

Показана способность различных видов МКА, полученных к рекомбинантному белку рр65 ВГЧ-5, выявлять в иммуноблоттинге вирусный белок рр65. Иммуноцитохимическим методом показана способность МКА, специфичных к рекомбинантному белку рр65, выявлять вирусный белок рр65 в монослое клеток Vero, персистентно инфицированных цитомегаловирусом человека.

Практическая ценность работы

С использованием созданных панелей МКА к различным вирусным патогенам, в том числе высокопатогенным вирусам Марбург и Эбола, и набора рекомбинантных белков, созданы новые лабораторные образцы иммунодиагностических наборов. Это наборы для выявления белка VP40 вируса Марбург методом двухцентрового ИФА с использованием  двух типов  неконкурирующих МКА 7D8 и 7H10; наборы для выявления белка VP35 вируса Марбург при помощи иммуноферментного анализа на основе одного типа  МКА 3F9; наборы для выявления  нуклеопротеина вируса Эбола методом двухцентрового ИФА с использованием двух типов оригинальных МКА 1В2 (мышиного происхождения) и 7В11 (крысиного происхождения); наборы для выявления белка VP40 вируса Эбола на основе двухцентрового ИФА и двух типов оригинальных МКА 4А2 и 1С1. Каждая из четырех разработанных конструкций тест-системы защищена патентом РФ (№ 2393220, № 2395575, № 2395576, № 2395577).

       Сконструированы рекомбинантные плазмиды, кодирующие полноразмерные гены нуклеопротеина вируса Эбола и матриксные белки VP40 вирусов Марбург и Эбола, что позволяет нарабатывать соответствующие рекомбинантные белки филовирусов для практического использования, конструирования различных типов иммунобиологических препаратов. Данные белки могут также использоваться для конструирования вакцин и исследования иммунологии и патогенеза филовирусных инфекций. Важно отметить, что предложенный биотехнологический подход позволяет получать антигены филовирусов без использования лаборатории BSL-4 уровня и высокопатогенных вирусов Марбург и Эбола. 

Практическая ценность оригинальной коллекции из 24 мышиных гибридом, секретирующих МКА к вирусу Западного Нила (российский штамм LEIV-VLG99-27889-human) состоит в том, что МКА, секретируемые этими клетками - продуцентами, обладают вируснейтрализующей активностью в отношении различных штаммов ВЗН. Это позволяет использовать данные МКА для конструирования нового поколения иммунотерапевтических препаратов для лечения лихорадки Западного Нила. Это возможность была продемонстрирована в создании нового метода генной терапии лихорадки Западного Нила с использованием гена МКА 9Е2 (А.V. Pereboev et al., 2007). 

Разработанная лабораторная тест-система ИФА в формате “сэндвич” на основе пары МКА (9Е2 и 5Н6) позволила создать совместно с ЗАО “Вектор-Бест” экспериментальную тест-систему ИФА “ВектоНил–антиген” для выявления антигена вируса Западного Нила в полевых материалах и организовать ее производство. Данная система успешно производиться более четырех лет и используется в практическом здравоохранении. В настоящее время на основе этих же МКА 9Е2, используемых в качестве “подложки” для антигена, также выпускает тест-система ИФА для выявления специфических антител класса IgG против вируса Западного Нила (“ВектоНил-IgG”) и тест-система ИФА для определения индекса авидности антител класса IgG, специфичных к вирусу Западного Нила (“ВектоНил-IgG-авидность”).

Получены 11 оригинальных мышиных гибридных клеточных линий, продуцирующих МКА, специфичные к рекомбинантному белку рр65 ВГЧ-5. МКА, специфичные к рекомбинантному белку рр65 ВГЧ-5, были успешно использованы для выявления вирусного белка рр65 – маркера острой цитомегаловирусной инфекции. Штамм гибридных клеток животного Mus Musculus L. 5F10, используемый для получения высокоспецифичных МКА 5F10, защищен  патентом РФ № 2393219. Одноименные МКА могут стать основой для совершенствования  диагностики этой инфекции у человека, что чрезвычайно важно в практическом здравоохранении.

       Получение панелей МКА и набора рекомбинантных антигенов в рамках  настоящей работы позволяет говорить, что удалось создать биотехнологическую базу для совершенствования иммунодиагностики инфекций, вызываемых вирусами Марбург, Эбола, Западного Нила и герпесом человека 5 типа. Помимо использования этих иммунобиологических препаратов для разработки нового поколения иммунодиагностических тест систем возможно их использование для исследовательских целей. Важно подчеркнуть, что рекомбинантные антигены и МКА представляют собой стандартные препараты, которые могут храниться очень долго. Плазмиды и гибридные клетки могут обеспечивать наработку этих биореагентов в необходимых количествах на протяжение неограниченного времени без использования патогенных и высокопатогенных вирусных агентов.

В представляемой диссертационной работе на защиту выносятся следующие положения:

1. Панель МКА (мышиного происхождения), специфичных к внутренним структурным белкам вириона вируса Марбург (штамм Рорр) - к кофактору вирусной полимеразы (белку VP35) - 3 вида, к нуклеопротеину - 3 вида, к матриксному белку VP40 - 9 видов, для одного вида МКА линейные эпитопы не определяются.

2. Панель МКА (мышиного происхождения), специфичных к внутренним структурным белкам вириона вируса Эбола-Заир (штамм Mayinga) – к белку VP35 (2 вида), к нуклеопротеину (9 видов мышиного происхождения и 1 вид крысиного происхождения), остальные 9 видов МКА специфичны к матриксному белку VP40.

3. Рекомбинантные белки GP, VP24, NP, VP40 и VP35 филовирусов, полученные в экспрессионной системе E.coli, сохранили антигенную структуру, характерную для аналогичных вирусных белков, и в связи с этим, они могут быть успешно использованы для иммунодиагностики филовирусных инфекций.

4. Способ выявления белка VP40 вируса Марбург методом двухцентрового ИФА с использованием  двух типов  неконкурирующих МКА 7D8 и 7H10.

5. Способ выявления белка VP35 вируса Марбург при помощи иммуноферментного анализа на основе одного типа МКА 3F9, которые можно одновременно использовать как в качестве “захватывающих антиген”, так и в качестве “индикаторных” антител.

6. Способ выявления нуклеопротеина вируса Эбола методом двухцентрового ИФА с использованием двух типов оригинальных МКА 1В2 (мышиного происхождения) и 7В11 (крысиного происхождения).

7. Метод выявления белка VP40 вируса Эбола на основе двухцентрового ИФА и двух типов оригинальных МКА 4А2 и 1С1.

8. Панель из 15-ти МКА (мышиного происхождения), специфичных к российскому штамму вируса Западного Нила (штамм LEIV-VLG99-27889-human). Гибридную клеточную линию 9Е2 и одноименные высокоактивные вируснейтрализующие МКА широкой специфичности против семи штаммов ВЗН. Возможность использования МКА 9Е2 и 5Н6 в  тест системе “ВектоНил–антиген”, в тест системе “ВектоНил-IgG” и в тест-системе “ВектоНил-IgG-авидность”.

9. Коллекция из 11-ти оригинальных мышиных гибридных клеточных линий, продуцирующих МКА, специфичные к рекомбинантному белку рр65 вируса герпеса человека 5 типа.  МКА, специфичные к рекомбинантному белку рр65 вируса герпеса человека 5 типам способны высокоэффективно выявлять вирусный матриксный белок рр65 - маркер острой цитомегаловирусной инфекции человека в различных типах клеток (в чувствительной L68 и персистентно инфекцированных Vero и RH).

Конкретное участие автора в получении результатов

Экспериментальные данные, представленные в диссертации, получены лично диссертантом и в соавторстве с д.б.н. И.А. Разумовым, д.б.н. В.Б. Локтевым, к.б.н. А.В. Качко, н.с. А.В. Ивановой, к.б.н. Е.Л. Субботиной, к.б.н. А.В. Перебоевым, д.б.н. А.А. Чепурновым, к.б.н. Е.Ф. Белановым, к.б.н. В.А. Терновым, н.с. А.В. Сорокиным, д.б.н. С.В. Нетесовым, д.м.н. Суслопаровым М.А., зав. лаб. ЗАО “Вектор-Бест” В.В. Распопиным.

Апробация работы

Материалы диссертационной работы были представлены на следующих конференциях: Xth International Congress of Virology, Jerusalem 1996 г.; Russian-german colloquium on filoviruses: the modern state of problem. Koltsovo, Novosibirsk region, Russia. 1997 г.; 6th Biological Medical Defence Conference. Munchen 1999 г.; Inauguration of the Swedish Containment Laboratories. Stocgolm 2000 г.; IX Международная конференция: новые информационные технологии в медицине и экологии. Крым, Гурзуф 2001 г.; VI Международная конференция РФФИ. Результаты фундаментальных исследований для инвестиций. Московская обл., г. Пущино 2001 г.; Digest reports of the IV th ISTС scientific advisory committee seminar on “Basic science in ISTС activities”, Novosibirsk, 2001 г.; II Научная конференция с международным участием. Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера. Новосибирск, 2002 г.; Всероссийская научно-практическая конференция “Современная ситуация и перспективы борьбы с клещевыми инфекциями в XXI веке”, Томск, 2006 г.; XIV International Congress of Virology, 2008 г., Istanbul; Научная конференция “Медицинская геномика и протеомика”, 2009 г., Новосибирск; Международная научно-практическая конференция “Современные проблемы инфекционной патологии человека”, г. Минск, Республика Беларусь, 2009 г.

Связь выполненной работы с планом научных исследований

Работа выполнена в ГНЦ ВБ “Вектор” за период 1998-2010 гг. в рамках научных тем, выполняемых по Программе Центра по приоритетному направлению “Изучение структурно - функциональной организации и молекулярной эволюции геномов особо опасных вирусов человека и животных”. Исследования были поддержаны государственной программой “Новейшие методы биоинженерии”, “Исследования и разработки по приоритетным направлениям науки и техники, подраздел: Защита от патогенов”, контракт № 43.035.11.1529 (рук. д.б.н. А.А. Чепурнов); проектом по государственному контракту № 02.512.11.2004 “Биосенсоры на базе полимерных микрочастиц – жидких микрочипов для иммунодетекции инфекционных заболеваний, в том числе и особо опасных вирусных инфекций” (рук. зав. лаб. ИХКГ СО РАН д.ф.-м.н., профессор В. П. Мальцев); проектом Международного научно-технического центра (МНТЦ) ISNC № 2087 (рук. д.б.н., профессор В.Б. Локтев); проектами Российского фонда фундаментальных исследований (РФФИ) № 97-04-49697-а (рук. д.б.н. И.А. Разумов), № 98-04-49439-а (рук. д.б.н., профессор С.В. Нетесов), № 01-04-49877-а (рук. к.б.н. А.В. Качко), № 01-04-48972–а (рук. д.б.н. И.А. Разумов); №09-0400450 а (рук. д.б.н., профессор В.Б. Локтев); грантом Президента Российской Федерации для государственной поддержки ведущих научных школ “Научная школа НШ-387.2008.4” (рук. д.б.н., профессор С.В. Нетесов); контрактами, выполняемыми в 2009 г. по заказу ФГУЗ РосНИИПЧИ “Микроб” и ФГУН ГНЦ прикладной микробиологии и биотехнологии в рамках ФЦП “Национальная система химической и биологической безопасности Российской Федерации (2009-2013 гг.): № 6/ф/09 “Cоздание научно-технической основы для разработки новых методических и инструментальных подходов к индикации возбудителей особо опасных инфекций, с помощью высокочувствительных биосенсоров” (рук. к.б.н. А.П. Агафонов); № 127-Д/1 “Разработка методов получения антигенов и антител для использования в микроэррей технологии (рук. д.б.н., профессор В.Б. Локтев).

Публикации

По материалам диссертации опубликовано 13 статей, входящих в список ВАК, 20 тезисов, получено 7 патентов на изобретение.

Объем и структура работы

Диссертация состоит из введения, главы литературного обзора, главы материалы и методы, 3-х глав результатов собственных исследований и их обсуждения, заключения, выводов и приложений. Работа изложена на 336 cтр., включает 28 таблиц и 53 рисунка. Список литературы состоит из 753 источников, включая 132 отечественных работ.

Содержание диссертации

Материалы и методы исследований

В работе использовали вирус Марбург (ВМ) штамм Popp, концентрированный и очищенный методом ультрацентрифугирования плазмы крови инфицированных морских свинок (А.А. Букреев, и др., 1995) и инактивированный в течение 24 ч при 8-10 0С добавлением 0,17 % димера этиленимина (ДЭИ) с дальнейшим прогреванием при 60 0С в течение 1 часа (S. Mitchel et al., 1984). Вирус Эбола-Заир (ВЭ) штамм Mayinga, был сконцентрирован и очищен из суспензии инфицированной культуры клеток Vero, инактивировали кипячением в течение 2 мин в растворе, содержащем 5 % β-меркаптоэтанола и 1 % додецилсульфата натрия (SDS) с дальнейшим прогреванием при 60 0С в течение 1 часа (А.А. Чепурнов, и др., 1994). Получение рекомбинантных (рек.) белков ВМ в результате экспрессии в прокариотической системе E. coli полноразмерных генов VP35, VP24, GP, NP описано (А.В. Сорокин и др., 1999; А.В. Качко и др., 2001) и препараты предоставлены авторами.

Семь штаммов вируса Западного Нила (ВЗН): LEIV-VLG99-27889-human; LEIV-VLG00-27924-human; LEIV-Tur73-2914-ticks; LEIV-Az70-72-ticks; LEIV-Az67-1640-nuthatch; Ast63-94-ticks; Eg101, полученные из коллекции вирусных препаратов Института вирусологии им. Д.И. Ивановского, были пассированы на культуре клеток Vero и на новорожденных белых мышах заражением в мозг.

Сыворотка крови морских свинок, инфицированных ВЭ (референс-антисыворотка), получена из Белорусского НИИ ЭМ. Коммерческие препараты лошадиных IgG против инфекционных ВЭ и ВМ, очищенные спиртовым фракционированием по Кону (И.В. Борисевич и др., 1996), получены из ВЦ НИИМ МО РФ (г. Сергиев Посад). Получение сывороток против ВЭ и ВМ проводили иммунизацией мышей BALB/c (массой 18-20 г), крыс Lou (массой 180-200 г) инактивированными вирусными препаратами. Сыворотка крови кроликов, специфичная к ВМ, получена при иммунизации животных инактивированным вирусным препаратом. В качестве референс-антисывороток против ВМ использовали полученную из Белорусского НИИ ЭМ сыворотку крови инфицированных морских свинок и сыворотку крови сотрудника ГНЦ ВБ “Вектор”, переболевшего ГЛМ в результате случайного лабораторного заражения (В.В. Никифоров и др., 1994). Моносыворотки к отдельным рек. белкам филовирусов получали в результате 4-кратной (в течение месяца) иммунизации неинбредных мышей ICR в суммарной дозе - 100 мкг/мышь. Поликлональные сыворотки к ВЗН получали иммунизацией неинбредных мышей ICR и мышей BALB/c инфекционным вирусом и инактивированным вирусным препаратом. Все манипуляции с животными проводили с применением анестезии, в соответствии с ветеринарным законодательством.

Использовали культуры клеток: мышиную P3.NS.1/1-Ag4.1 (NS/1) и крысиную 210RC.Y3-Ag1.2.3 миеломы (полученные из Онкологического центра РАМН) культивировали на среде DMEM(M) (производство ГНЦ ВБ “Вектор”) с добавлением 10 % - 15 % фетальной бычьей сыворотки (ФБС) (Flow Laboratories, Англия), 150 мг L – глутамина (ГНЦ ВБ “Вектор”) и 80 мг сульфата гентамицина (КРКА, Словения) на 500 мл среды; Vero (клетки почки африканской зеленой мартышки), L-68 (диплоидные клетки легкого эмбриона человека), RH (клетки почки эмбриона человека) и 293 (клетки почки эмбриона человека) культивировали в среде DMEM(M) с 5 – 10 % ФБС. Иммунизацию мышей BALB/c - доноров иммунных спленоцитов проводили в течение двух недель по внутрилабораторной схеме (в общей дозе для ВМ - 98 мкг/мышь, ВЭ - 120 мкг/мышь; рек. белка рр65 - 220 мкг/мышь). Иммунизацию мышей ВЗН проводили по разным схемам, с использованием, как инактивированного препарата, так и инфекционного вируса (I.A. Razumov et al., 2005). Слияние клеток (гибридизацию) проводили с помощью полиэтиленгликоля (м.м. 1300-1600) по методу, предложенному M.L. Gefter с соавт. (1977). Использовали соотношение миеломных клеток NS/1 к иммунным спленоцитам 1/3. Гибридные клетки выращивали при 37 0C в атмосфере 7 %-го CO2 и проводили селекцию в среде ГAT с 10-5 М аминоптерина (чтобы подавить рост клеток NS/1), гипоксантина и тимидина, с добавлением 10 % оптимизированной для гибридом фетальной сыворотки (HyСlone, США). Тестирование культуральной среды от гибридных клеток проводили методом твердофазного ИФА (ТИФА), используя полистирольные планшеты (производства ВНИИ Медполимер (Москва) или Costar (США), проявление проводили с использованием субстрата ОФД (1 мг/мл о-фенилендиамина в цитратно-фосфатном буферном растворе (0,2 М лимонной кислоты, 0,5 М Na2HPO3, рН 5,0) с 0,03 % Н2О2). Иммуно-химическую реакцию останавливали добавлением 1 N соляной кислоты, оптическую плотность субстратно-индикаторной смеси в лунках измеряли на спектрофотометре “Uniscan” (Финляндия) при длине волны 492 нм. Клоны подвергали криоконсервации в среде DMEM(M) с добавлением 40 % ФБС и 10 % диметилсульфоксида. Наработку препаративных количеств МКА проводили in vivo.

Очистку МКА из асцитических жидкостей проводили осаждением балластных белков каприловой кислотой (H. Bazin et al., 1990) с последующей преципитацией IgG в 50 %-м растворе сульфата аммония на 0,05 М фосфатно-солевом буферном растворе. Определение концентрации белка в полученных препаратах выполняли с использованием набора “Protein Assay Kit” (Bio-Rad, США) на спектрофотометре СФ-26 при длине волны 495 нм. Класс и подкласс МКА определяли методом иммунодиффузии по Уохтерлони с помощью набора мышиных моноспецифических антител (IСN, США) и методом ТИФА с использованием моноспецифических мышиных антител (АТ) (Sigma, США). Определение константы аффинности МКА проводили, используя метод параллельного титрования АТ известной начальной концентрации на сорбированном антигене в ТИФА (Д. Берзовски и др., 1989; А.М. Егоров и др., 1991). Биотинилирование очищенных МКА проводили по методу E.A. Bayer с соавт. (1980), используя Biotin N-hydroxysuccinimide ester FW 341,4 (Sigma, США). Для проведения двухцентрового ИФА в формате “сэндвич” использовали высокосорбционные полистирольные планшеты (Testiks(США) или Nunc (Дания). В промежуточных этапах иммунохимической реакции лунки планшетов промывали трис-солевым буферным раствором с твином (ТСБ-Т, pH 7,4), содержащим 0,15 М NaCl, 0,02 M трис-HCl, 0,05 % твин-20. Проявление проводили с использованием жидкого субстрата ТМБ (3,3’,5,5’–Tetramethylbenzidine), останавливали реакцию добавлением 1 N соляной кислоты, оптическую плотность субстратно-индикаторной смеси в лунках измеряли на спектрофотометре “Uniscan” при длине волны 450 нм.

Фрагменты генома ВЭ, кодирующие белки NP и VP40 получены в ОТ-ПЦР реакции с использованием следующих праймеров:

Для гена VP40:

5’ – AAAAGGATCCATGAGGCGGGTTATATTGCCTAC – 3’

5’ – AAAAAAGCTTTTACTTCTCAATCACAGCTGGAA – 3’

Для гена NP:

5’ – AAAAGGATCCATGGATTCTCGTCCTCAGAAAATCTGG – 3’

5’ – AAAAAAGCTTTCACTGATGATGTTGCAGGATTG-3’

Полноразмерные копии генов VP40 и NP ВЭ после гидролиза эндонуклеазами BamHI и HindIII клонированы в плазмиду pQE-30 (QIAGEN). Для сборки полноразмерной ДНК-копии гена белка VP40 ВМ использовали библиотеку клонов Е. coli (штамм JC5183), несущих рекомбинантные плазмиды pQE31 со вставками ДНК-копий фрагментов геномной РНК ВМ (A. Bukreyev et al., 1995).

Очистку рек. белков из лизата Е. coli проводили аффинной хроматографией на Ni-хелатной смоле (что обеспечивалось наличием в их составе полигистидинового белка 6хHis-tag), согласно протоколу фирмы-производителя (QIAGEN, Германия). Концентрацию белков измеряли при помощи набора “Bio-Rad Protein Assay Kit” в соответствии с рекомендациями производителя, используя в качестве стандарта овальбумин в 4 М мочевине. Электрофорез (ЭФ) вирусных препаратов, рек. белков и МКА проводили по методу, предложенному А.А. Остерманом (1981) в прерывистой буферной системе, с использованием 12-15 %-го полиакриламидного геля (ПААГ) с 0,1 % SDS в трис-глициновом буферном растворе в режиме 10 В/см. Окраску гелей проводили при помощи Кумасси G-250.

Иммуноблоттинг (ИБ) проводили после переноса белков на нитроцеллюлозную мембрану (Millipore, США) по методу H. Towbin и соавт. (1979) на аппарате Transphor (“LKB”, Швеция) в течение 1,5 часов при напряжении 80 В в 0,025 М трис-HCl буферном растворе, содержащем 0,192 М глицина (рН 8,3) и 20 % этанола.

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

Применение МКА и рекомбинантных антигенов для разработки иммунодиагностики геморрагических лихорадок Марбург и Эбола

Описанные в литературе МКА, полученные к инактивированному разными способами ВМ (штамм Musoke), имеют разный состав и разную специфику. Семнадцать видов МКА к GP, 4 к NP, 2 к VP30 и один вид МКА к белку VP40 ВМ, инактивированного -облучением описано в работе (M. Hevey et al., 1997). Две гибридомы продуцирующие МКА к структурному GP ВМ (штамм Рорр), инактивированному 0,05 % формалином, содержит коллекция (C.В. Ручко и др., 2001). МКА, специфичные к определенным эпитопам рек. NP ВМ (штамм Musoke), были использованы при конструировании ИФА тест-системы для установления быстрого диагноза ГЛМ (M. Saijo et al., 2005). Специфичные к ВЭ МКА получены, в основном, к рек. белкам GP и NP (J.A. Wilson et al., 2000; M. Niikura et al., 2001; A. Takada et al., 2001; J.S. Yu et al., 2006; S. Shahhosseini еt al., 2007).

Получение гибридом, продуцирующих МКА к вирусам Марбург (ВМ) и Эбола (ВЭ)

В результате 11-ти гибридизаций было получено более 2500 гибридных клеточных линии, растущих на селективной среде ГАТ. Выявление растущих гибридом осуществляли визуально, методом световой микроскопии. По результатам ТИФА ростовой среды от гибридом отбирали клеточные линии, продуцирующие специфичные МКА. С целью стабилизации культуральных свойств гибридом и секреции ими специфических IgG было проведено клонирование гибридных клеток методом предельных разведений. В результате отбора, после трех-кратного тестирования были получены коллекции, состоящие из 20-ти гибридомных клеточных линий, стабильно секретирующих МКА к ВМ (Е.И. Казачинская, 2002) и 39-ти гибридомных клеточных линий, стабильно секретирующих МКА к ВЭ. Клеточные линии были размножены, наработаны в культуральных сосудах и заморожены в жидком азоте (при минус 196 0С).

Препараты очищенных МКА получали из культуральной среды гибридом и асцитических жидкостей мышей BALB/c и крыс Lou. Для характеризации МКА были определены: субклассы моноклональных IgG; белки вирусов, с которыми они взаимодействуют; титры специфического взаимодействия АТ с вирусным препаратам; количественный уровень синтеза гибридомных IgG в организме животных; константы аффинности.

Данные по иммуно-химическим свойствам МКА, специфичных к ВЭ представлены в табл. 1 (первая коллекция) и табл. 2 (вторая коллекция). Все гибридомные IgG по результатам типирования были отнесены к классу IgG разных подклассов. Уровень синтеза моноклональных IgG в организме мышей и крыс оценивали по концентрации белка в очищенных препаратах, которая составила от 0,5 до 14,5 мг/мл. Аффинность каждого МКА определяли методом ТИФА при параллельном титровании АТ (в одинаковой начальной концентрации 1 мг/мл) на инактивированном АГ ВЭ. Константы аффинности для каждого МКА находятся в диапазоне от 0,7 до 3,1х108 М-1, а самое высокое сродство к вирусному антигену было определено для МКА 4В9 9,0х108М-1 (см. табл. 1), специфичных к NP. Методом ТИФА было проведено определение специфичности взаимодействия вирусного FU с МКА, в виде культуральной и асцитической жидкости, а так же очищенных препаратов. Титры гибридомных АТ в асцитической жидкости находились в диапазоне разведений от 1/2700 до 1/6561000. В результате исследований методом ИБ было показано, что из 14 видов МКА первой коллекции - двенадцать специфичны к NP и два вида МКА к белку VP35 ВЭ (см. табл. 1). МКА, продуцируемые гибридомами второй коллекции, в основном специфичны к матриксному белку VP40 и 2 МКА специфичны к NP (см. табл. 2). Аффинность МКА второй коллекции не определяли в виду отсутствия достаточного количества инактивированного вирусного АГ.

Результаты по преобладанию в нашей коллекции МКА, специфичных к матриксному VP40 филовирусов, совпадают с данными авторов (A. Lucht et al., 2000), описавших коллекцию из 12 гибридных клеточных линий, девять из которых синтезируют МКА к VP40 инактивированного ВЭ-Заир.

Исследование специфичности полученных МКА указывают на возможность их использования как для анализа антигенной структуры филовирусных белков, так и для конструирования диагностических тест – систем для выявления антигенов ВМ и ВЭ. 

Таблица 1

Свойства МКА (первая коллекция), специфичных к вирусу Эбола

№ п/п

Назва-ние гибри-домы и МКА

Класс IgG

Белок-ми-шень

в ИБ

Титры МКА против ВЭ в ТИФА (обр. величины)

Концент-рация очищен-ных IgG (мг/мл)

Константа аффин-

ности

Ка, М-1

Культу-ральная среда

Асцити-ческая жидкость

Очищенный препарат

МКА

1

10A8

IgG2b

NP

900

218700

218700

7,2

1,4 x108

2

1E5

IgG2b

NP

2700

218700

218700

6,3

2,5 x108

3

4A8

IgG2b

NP

8100

2187000

2187000

8,0

2,8 x108

4

10B4

IgG2a

NP

8100

2187000

2187000

9,0

2,5 x108

5

7E1

IgG2a

NP

300

24300

24300

3,1

2,5 x108

6

6G8

IgG2a

NP

300

8100

24300

6,8

0,7 x108

7

4B9

IgG2b

NP

8100

656100

656100

7,4

9,0 x108

8

2H9

IgG1

NP

900

72900

72900

6,0

2,5 x108

9

6A8

н.о.

NP

900

27000

72900

4,3

2,9 x108

10

9G11

IgG2a

NP

8100

2187000

2187000

6,0

2,5 x108

11

9A7

IgG2b

NP

900

24300

24300

4,3

1,7 x108

12

1C7

IgG2a

VP35

8100

729000

2187000

7,8

3,1 x108

13

6F7

IgG2a

VP35

8100

656100

729000

8,3

2,8 x108

14

7B11*

н.о.

NP

н.о.

512000

512000

7,2

н.о.

Примечания: МКА 7B11* - продукт секреции гибридомы крысиного происхождения

(автор А.В. Перебоев). 

Выявление иммунодоминатных белков вирусов Марбург и Эбола

Полученные гибридные клеточные линии продуцируют МКА, для которых белки-мишени определены: к белку VP35 - 7 линий, к VP40 - 20 линий и к NP - 16 линий (см. табл. 1, 2). Эти результаты показывают наличие антигенной структуры на внутренних белках VP35, VP40 и NP инактивированных вирионов ВМ и ВЭ. Вклад каждого белка в иммуногенность вирусного препарата по количеству полученных видов МКА оценить сложно, так как отбор положительных гибридом (продуцирующих МКА) проводили эмпирически, отбирая их в ТИФА по  результатам сигнала ОП (>1,0) субстратно-индикаторной смеси в лунках с тестируемой культуральной средой от растущих гибридных клонов. Белок-мишень для полученных МКА можно определить, имея не менее 1 мл культуральной среды и достаточно АГ для переноса на нитроцеллюлозную мембрану, чтобы протестировать большое количество гибридных клонов, но это рутиная и затратная процедура.

  Таблица 2

Свойства МКА (вторая коллекция), специфичных к вирусу Эбола

№ п/п

Название гибридомы

и МКА

Cпеци-фичность к АГ

Класс IgG

Белок-мишень

в ИБ

Титры МКА против ВЭ в ТИФА (обр.величины)

Концент-

рация

очищен-

ных IgG (мг/мл)

Куль-туральная среда

Асцити-ческая жидкость

Очищен-ный препарат МКА

1

4A2

ВЭ-IS

IgG1

VP40

24300

6561000

6561000

7,7

2

5C10/H5

ВЭ-IS

IgG1

VP40

8100

72900

24300

6,3

3

3F6/E9/H8

ВЭ-IS

н.о.

VP40

900

24300

24300

4,3

4

2E12

ВЭ-IS

IgG2a

VP40

300

8100

8100

4,1

5

2G9/E12

ВЭ-IS

н.о.

VP40

900

24300

24300

2,5

6

2A3/C6

ВЭ-IS

н.о.

VP40

100

8100

н.о.

1,2

7

3E3/D8

ВЭ-IS

н.о.

VP40

100

2700

н.о.

0,5

8

4C4/E11/G12

ВЭ-IS

н.о.

VP40

900

24300

8100

2,8

9

3C7/D9

ВЭ-IS

IgG1

VP40

300

24300

24300

6,5

10

1B2

ВЭ-IS

IgG1

NP

8100

6561000

2187000

8,9

11

1B1

ВЭ-IS

н.о.

NP

100

8100

н.о.

н.о.

12

3B12

ВЭ-IS

н.о.

VP40

100

8100

н.о.

н.о.

13

4G8

ВЭ-IS

н.о.

VP40

300

8100

н.о.

н.о.

14

2H5

ВЭ-IS

н.о.

VP40

100

8100

н.о.

н.о.

15

1C1

ВЭ-8МС

IgG1

VP40

8100

6561000

6561000

14,5

16

1E6/A3

ВЭ-8МС

IgG1

VP40

8100

729000

729000

1,5

17

1B5

ВЭ-8МС

IgG2a

VP40

8100

218700

72900

5,7

18

3D9/C2

ВЭ-8МС

IgM

VP40

8100

729000

729000

7,0

19

3C12/G2

ВЭ-8МС

IgG2a

VP40

900

72900

72900

3,5

20

1G4

ВЭ-8МС

н.о.

VP40

300

н.о.

н.о.

н.о.

21

2H4

ВЭ-8МС

н.о.

VP40

100

н.о.

н.о.

н.о.

22

3F8

ВЭ-8МС

н.о.

н.о.

100

н.о.

н.о.

н.о.

23

3F6

ВЭ-8МС

н.о.

VP40

100

н.о.

н.о.

н.о.

24

7D12

ВЭ-8МС

н.о.

н.о.

100

н.о.

н.о.

н.о.

25

6A12

ВЭ-8МС

н.о.

н.о.

100

н.о.

н.о.

н.о.

Примечания: н.о. – не определяли; ВЭ-IS – исходный штамм ВЭ-Заир; 8МС – штамм ВЭ-Заир, адаптированный к морским свинкам, на 8 пассаже вызвал гибель животных (V.E. Volchkov et al., 2000).

Кроме того, для иммунизации мышей - доноров иммунных спленоцитов были использованы инактивированные вирусные АГ, что могло повлиять на антигенную структуру вирусных белков.

Исследование антигенного состава любого патогена необходимо для совершенствования дифференцирующей диагностики на специфические маркеры, а также для разработки эффективных вакцин и противовирусных препаратов. По литературны данным, основными белками филовирусов, вызывающими иммунный ответ организма, являются NP, VP40 и белок VP35. Это было выявлено методом ИБ при исследовании сывороток крови обезьян различных пород из возможного ареала распространения филовирусов и cывороток крови реконвалесцентов (S. Becker et al., 1992).

Исследование спектра АТ, продуцируемых организмом в ответ на иммунизацию или инфицирование животных ВМ и ВЭ проводили методом ИБ. В инактивированных вирусных препаратах  были выявлены вирусные белки-иммуногены, взаимодействующие с АТ сывороток крови от иммунизированных и инфицированных животных (табл. 3). Это белки - GP, NP, VP40, VP35, VP30 и VP24, формирующие антигенную структуру филовирусного вириона и распознаваемые иммунной системой макроорганизма при инфицировании или иммунизации. Белки NP, VP40, VP35 ВМ выявлялись АТ исследуемых сывороток в виде мажорных полос. Эти результаты свидетельствуют, что белки инактивированных вирусных АГ не теряют своих иммуногенных свойств, то есть сохраняются антигенные детерминанты. Особый интерес для данного исследования представляют результаты взаимодействия белков инактивированных вирусов с АТ инфицированных морских свинок, с IgG лошадей и АТ сыворотки реконвалесцента (В.В. Никифоров и др., 1994).

У морских свинок, переболевших экспериментальной ГЛМ, несмотря на одинаковую дозу заражения и одинаковое количество прошедших суток на день взятия крови, варьировал титр АТ и диапазон специфичности к вирусным белкам. Тем не менее, доминирующие полосы при ИБ соответствовали белкам - NP, VP40 и VP35 (см. табл. 3). В ТИФА был обнаружен титр 1/218700 для препарата IgG лошадей. Особенность получения данных препаратов состоит в том, что лошади не восприимчивы к филовирусным инфекциям, но вырабатывают нейтрализующие АТ в титре 1/2048. По данным И.В. Борисевич и соавт. (2008) введение морским свинкам, полученного таким образом препарата, через 1 - 2 часов после заражения ВМ в дозе 20-50 ЛД50, защищало от гибели 88-100 % животных.

Противовирусные АТ сыворотки крови реконвалесцента выявляют эти белки в вирусном препарате методом ИБ так же в виде мажорных полос  (см. табл. 3, рис. 1), что говорит о том, что внутренние структурные белки ВМ, так же как и наружные, презентируются иммунной системе организма индивидуально, обладают высокой иммуногенностью как в нативном, так и в инактивированном состоянии. Титр антивирусных АТ в сыворотке крови реконвалесцента составлял 1/24300. Такой же уровень антител наблюдался в сыворотке крови мышей (№ 2), иммунизированных инактивированным ВМ.

Так же в табл. 3 представлены результаты специфического взаимодействия в ТИФА белков ВЭ с противовирусными АТ. Наиболее высокий титр АТ (1/2187000 и 1/729000) был выявлен в сыворотках крови мышей (от гибридизаций № 5 и № 4), иммунизированных инактивированным АГ ВЭ.

Несмотря на то что, ВМ и ВЭ являются представителями одного семейства, по антигенной характеристике они имеют заметные отличия. На это обратили внимание K.M. Johnson соавт. (1977), пытаясь сравнить впервые выделенный ВЭ с уже известным ВМ. Дальнейшие исследования филовирусов подтвердили их антигенные различия (M.P. Kiley, 1988; E.D. Johnson et al., 1996). Но в работе S. Becker cоавт. (1992) отмечается, что при исследовании сывороток крови от людей, переболевших ГЛМ в 1967 г., регулярно наблюдалась кросс-реактивность с АГ ВЭ в реакции иммунофлюоресценции. Аминокислотная последовательность, определенная для NP ВМ и ВЭ, показывает высокую степень их гомологии 400 N-концевых а.о. (A. Sanchez et al., 1993), что позволяет предположить наличие антигенного перекреста. При сравнении аминокислотной последовательности белков VP35 ВЭ и ВМ также были обнаружены у них гомологичные участки (A. Bukreyev et al., 1993).

В исследовании было обнаружено, что в сыворотках крови животных ПАТ имеют перекрестную активность с гетерологичными антигенами в ТИФА (см. табл. 3). Методом ИБ ранее были показаны белки для перекрестных взаимодействий ПАТ мышей, иммунизированных ВЭ – это NP и VP35 ВМ (Е.И. Казачинская, 2002). Возможно, что при инактивации вирионов открылись гомологичные а.о. последовательности филовирусных белков.

Для исключения не специфического взаимодействия противовирусных АТ с гетерологичными вирусными белками использовали для исследования аффинно-очищенные рек. белки, полученные в результате экспрессии полноразмерных филовирусных генов в клетках E.coli.

Получение рекомбинантных белков филовирусов в экспрессионной системе E.coli и исследование их свойств с помощью противовирусных антител

Для наработки и очистки филовирусов необходим 4 уровень биозащиты, персонал со специальной подготовкой и надежная инактивация вирусных препаратов. Есть данные, что рек. NP ВЭ и ВМ, экспрессированные в виде полноразмерных копий в бакуловирусной системе и в виде С-концевых фрагментов в E.coli, обладали антигенностью и были использованы в ИФА в качестве АГ для обнаружения IgG в сыворотках реконвалесцентов. Специфичность определения IgG была 100 %-ной, без ложноположительных результатов. Кроме того, было обнаружено, что рек. NP ВЭ, полученный на основе гена NP ВЭ-Заир, можно использовать для выявления IgG к другим штаммам ВЭ - Судан, Рестон и Берег Слоновой Кости (M. Saijo et al., 2001). Рек. VP40 ВЭ использовали в качестве положительного контроля на АГ в лабораторной тест-системе (G. Kallstrom et al., 2005). Так же рек. VP40 ВЭ был использован в ИБ для точного определения специфичности МКА, полученных к инактивированному ВЭ-Заир (штамм Mayinga) (A. Luch et al., 2003).

  Таблица 3

Исследование спектра филовирусных белков-иммуногенов и перекрестного взаимодействия поликлональных антител с филовирусными антигенами в ТИФА

Источник

антител

Сутки взятия крови от начала иммуниза-ции

Иммуноген

Титры антител в ИФА

(обратные величины)

Белки-иммуногены, выявляемые

в ИБ на гомологичном инактивированном антигене

Антигены

инакт.

ВМ

инакт. ВЭ

мышь № 1

14

инакт. ВМ

8100

<100

NP, VP35, VP40

мышь № 2

21

инакт. ВМ

24300

300

GP, NP, VP35, VP40,VP30,VP24

кролик

нет данных

инакт. ВМ

24300

<100

NP, VP40, VP35, VP30,VP24

IgG лошади

нет данных

инф. ВМ

218700

<100

GP, NP, VP35, VP40,VP30

ЧС

нет данных

инф. ВМ

24300

900

GP, NP, VP35, VP40,VP30,VP24

морская свинка

нет данных

инакт. ВМ

900

<100

NP, VP40, VP35

морская свинка* (6.4; 7.2)

14

инф. ВМ

200; 200

NP

морская свинка* (2.2; 4.2;6,3)

14

инф. ВМ

6400; 6400; 12800

GP, NP, VP40, VP35

морская свинка* (2.1;4.1;5.1; 6.1; 6.2)

14

инф. ВМ

1600; 800; 800; 400; 6400

<100

NP, VP40, VP35

морская свинка* (1.2;5.2)

14

инф. ВМ

400; 400

<100

NP, VP35

морская свинка* (1.3; 1.4)

14

инф. ВМ

400; 400

<100

NP, VP40

морская свинка* (3.1)

14

инф. ВМ

200

<100

VP40

мышь № 1

14

инакт. ВЭ-IS

2700

72900

NP, VP40, VP35,VP30, VP24

мышь № 2

14

инакт. ВЭ-IS

900

72900

NP, VP40, VP35,VP30, VP24

мышь № 3

14

инакт. ВЭ-IS

300

81000

L,GP, NP, P40,VP35,VP30,VP24

мышь № 4

21

инакт. ВЭ-IS

300

729000

L,GP,NP,VP40,VP35,VP30,VP24

мышь № 5

14

инакт. ВЭ-IS

300

2187000

L,GP,NP,VP40,VP35,VP30,VP24

мышь № 6

14

инакт. ВЭ-8МС

<100

9000

L,GP,NP,VP40,VP35,VP30,VP24

мышь № 7

14

инакт. ВЭ-8МС

300

243000

L,GP,NP,VP40,VP35,VP30,VP24

мышь № 8

14

инакт. ВЭ-8МС

300

72900

L,GP,NP,VP40,VP35,VP30,VP24

мышь № 9

14

инакт. ВЭ-8МС

300

72900

L,GP,NP,VP40,VP35,VP30,VP24

кролик

нет данных

инакт. ВЭ-IS

2700

72900

NP, VP40, VP35,VP30, VP24

крыса

14

инакт. ВЭ-IS

8100

72900

NP

IgG лошади

26-42

инф. ВЭ

24300

218700

NP, VP40, VP35

морская свинка

нет данных

инакт. ВЭ-IS

<100

900

NP

морская свинка

нет данных

инф.ВЭ

<100

900

GP, NP

контроли

без антигена

<100

<100

-

Примечание к табл. 3: инакт. – инактивированный вирусный препарат; инф. – инфекционный вирус; *- сыворотки от выживших морских свинок, инфицированных ВМ (условное обозначение каждого животного); ЧС - сыворотка реконвалесцента (человек переболел ГЛМ) (Никифоров В.В. и др., 1994); нормальные сыворотки - мыши, кролика, крысы, лошади, морской свинки и человека использовались в качестве отрицательного контроля; № 1 - 9 – сыворотки мышей, представляющие собой каждая пул сывороток от 3 мышей – доноров иммунных спленоцитов, используемых для гибридизаций; NP, VP40, VP35 жирным шрифтом выделены белки, образующие доминирующие полосы при ИБ.

Рис. 1. Иммуноблоттинг. Выявление белков вируса Марбург антителами сыворотки реконвалесцента

1 – нормальная сыворотка человека в разведении 1/1000;

2 – сыворотка человека, переболевшего ГЛМ (Никифоров В.В. и др., 1994),

в разведении 1/1000;

Стрелками обозначено местоположение белков ВМ на нитроцеллюлозной мембране.

Оценку степени чистоты рек. белков, полученных в настоящем исследовании оценивали по результатам ПААГ-ЭФ с SDS (рис. 2, 3, 4). Были исследованы свойства рек. белков ВМ и ВЭ: антигенные - по выявлению специфических антивирусных АТ реконвалесцента и АТ иммунизированных животных; и иммуногенные – по взаимодействию АТ, полученных к рек. белкам, с вирусными АГ методами ТИФА и ИБ. Серопозитивная сыворотка крови рековалесцента оказалась ценным препаратом для исследования рек. белков, так как содержит противовирусные АТ, которые наглядно отражают распознавание антигенных детерминант ВМ иммунной системой человека в течение естественной инфекции. Результаты тестирования, представленные в табл. 4 и табл. 5 демонстрируют, что рек. аналоги вирусных белков GP, NP, VP35, VP40,VP24 ВМ и VP35, NP, VP40 ВЭ обладают иммуногенностью - вызывают синтез антител в организме иммунизированных беспородных мышей и выявляют в ТИФА антивирусные антитела, то есть обладают антигенными свойствами.

Рис. 2. Электрофореграмма. Анализ

белков, синтезирующихся под контролем

рекомбинантной плазмиды pQE-VP35

вируса Эбола в клетках

E.coli

1 – лизат E.coli – pQE;

2,3 – лизат E.coli – pQE-VP35 ВЭ;

4 – препарат очищенного рек. белка VP35 ВЭ;

5 – препарат инактивированного ВЭ

(стрелкой показан вирусный белок VP35);

обозначено местоположение маркеров

молекулярной массы – 18, 29, 36, 43, 68,

97 и 116, соответственно.

Рис. 3. Электрофореграмма вирусов Марбург и Эбола и очищенных рекомбинантных белков VP40

  1. Рек. белок VP40 ВМ (5 мкл);
  2. препарат инактивированного ВМ (10 мкл);
  3. препарат инактивированного ВЭ (10 мкл);
  4. рекомбинантный белок VP40 ВЭ (5 мкл);
  5. местоположение белковых маркеров молекулярной массы (Bio-Rad).

Рис. 4. Электрофореграмма

вируса Эбола и очищенного

рекомбинантного нуклеопротеина

  1. рекомбинантный белок

NP ВЭ (5 мкл);

  1. препарат инактивированного

  ВЭ (10 мкл).

Таблица 4

Исследование антигенных и иммуногенных свойств рекомбинантных белков вируса Марбург

№ п/п

ПАТ

Взаимодействие ПАТ с ВМ и рекомбинантными белками в ИБ

Титры рекомбинантных белков при

специфическом взаимодействии с ПАТ

(обратные величины) в ТИФА

ВМ

рек. GP

рек. NP

рек. VP40

рек.

VP35

рек.

VP24

рек. GP

рек. NP

рек. VP40

рек.

VP35

рек.

VP24

1

ЧС

(1/500)

+

-

+

+

+

+

800

12800

8100

8100

6400

2

IgG

лошади

(1/1500)

+

-

+

+

+

+

1600

72900

40500

13500

1600

3

МАС-ВМ

№ 2

(1/1000)

+

+

+

+

+

+

900

24300

8100

8100

1600

4

МАС-рек. GP

(1/1000)

+

+

-

-

-

-

72900

<100

<100

<100

<100

5

МАС-рек. NP

(1/5000)

+

-

+

-

-

-

<100

218700

<100

<100

<100

6

МАС-рек. VP35

(1/5000)

+

-

-

-

+

-

<100

<100

656100

<100

<100

7

МАС-рек. VP40

(1/10000)

+

-

-

+

-

-

<100

<100

<100

1087500

<100

8

МАС-рек. VP24

(1/5000)

+

-

-

-

-

+

<100

<100

<100

<100

202400

Примечания: ПАТ – поликлональные антитела иммунных сывороток; r – рек. белок;

ЧС - сыворотка человека, переболевшего ГЛМ (разведение); МАС-ВМ № 2 - пул сывороток от 3 мышей, иммунизированных АГ ВМ и используемых для гибридизации на 21-е сутки от начала иммунизации в разведении ; МАС-рек. - сыворотки мышей, иммунизированных рек. белками GP, NP, VP40, VP35, VP24 ВМ. 

  Таблица 5

Исследование антигенных и иммуногенных свойств рекомбинантных белков вируса Эбола

Источник антител

Титры специфических антител (обратные величины) и взаимодействие

в ИБ

Антигены (концентрация для ТИФА 1 мкг/мл )

Инактивирован-ный ВЭ

рек.VP35

рек.VP40

  рек.NP

рQE

ИФА

ИБ

ИФА

ИБ

ИФА

ИБ

ИФА

ИБ

ИФА

ИБ

IgG  лошади - ВЭ

656100

+

121500

+

656100

+

656100

+

<100

-

МАС - ВЭ

218700

+

218700

+

218700

+

656100

+

<100

-

АС крысы - ВЭ

218700

+

24300

+

218700

+

218700

+

<100

-

АС кролика - ВЭ

218700

+

218700

+

218700

+

656100

+

<100

-

МАС – рек. VP35

729000

+

729000

+

<100

-

<100

-

<100

-

МАС – рек. VP40

656100

+

<100

-

1968300

+

<100

-

<100

-

МАС – рек. NP – ВЭ

656100

+

<100

-

<100

-

1968300

+

<100

-

отрицательные контроли**

<100

-

<100

-

<100

-

<100

-

<100

-

Примечание: МАС – мышиные антисыворотки; рQE – лизат E.coli (отрицательный контроль для рек. белков); * – проводили обработку (истощение) исследуемых моноспецифических МАС в присутствии 1 %-го раствора лизата E.coli клеток 20 мин при 37 0С; ** – в качестве отрицательного контроля использовали нормальные сыворотки лошади, мыши, крысы и кролика.

Изучение возможности использования инактивированного вируса Марбург и рекомбинантных белков для выявления специфических иммуноглобулинов класса IgG в сыворотках крови животных и человека

Описанные выше исследования рек. белков - GP, NP, VP35, VP40 и VP24 ВМ показали сходство их антигенных свойств с природными вирусными белками, что указывает на возможность использования данных препаратов в тест-системах для выявления специфических АТ.

Для анализа уровня АТ к каждому вирусному белку использовали в качестве АГ отдельные рек. белки. Это позволило определить уровень и спектр АТ к отдельным белкам ВМ (табл. 6). Наиболее высокая концентрация специфических АТ в сыворотке крови реконвалесцента была зарегистрирована к NP (1/24300) и, по убывающей, к VP40 (1/8100) и к VP35 (1/2700). Уровень специфических АТ к GP был ниже, чем к другим белкам и вообще не определялся в сыворотке, взятой у пациента через шесть лет после болезни. Такая же тенденция, по уровню АТ к индивидуальным белкам, была обнаружена и для АТ в сыворотках крови иммунизированных животных.

В случае применения в качестве АГ комбинации четырех рек. белков ВМ - GP, NP, VP35 и VP40, повышался уровень титров выявления специфических АТ исследуемых сывороток по сравнению с использованием инактивированного АГ ВМ.

Таблица 6

Использование рекомбинантных белков в качестве антигена в ТИФА для выявления IgG, специфичных к вирусу Марбург

Источник

антител

  Титры специфических IgG (обратные величины)

Антигены (концентрация нг/лунку)

вирус

Марбург

(200)

рек.GP

(200)

рек.NP

(200)

рек.VP40

(200)

рек.VP35

(200)

рек. белки

(400)***

рQE

(400)

ЧС (1990 г.)

24300

900

24300

8100

2700

24300

<100

ЧС (1996 г.)

200

<100

400

400

<100

800

<100

IgG лошади

218700

13500

121500

40500

13500

364500

<100

МАС–ВМ № 1

8100

<100

2700

2700

<100

8100

<100

МАС-ВМ № 2

24300

900

24300

24300

8100

72900

<100

МАС–рек.GP*

8100

656100

<100

<100

<100

72900

<100

МАС–рек.NP*

72900

<100

72900

<100

<100

24300

<100

МАС–рек.VP35*

24300

<100

<100

<100

656100

218700

<100

МАС–рек.VP40*

72900

<100

<100

1968300

<100

218700

<100

отрицательные

контроли**

<100

<100

<100

<100

<100

<100

<100

Примечание: ЧС – сыворотка человека, переболевшего ГЛМ (в скобках указана дата забора крови); МАС – мышиные антисыворотки; рQE – лизат E.coli (отрицательный контроль для рек. белков);

* – проводили обработку (истощение) исследуемых моноспецифических МАС в присутствии 1 %-го раствора лизата E.coli клеток 20 мин при 37 0С; ** – в качестве отрицательного контроля использовали нормальные сыворотки человека (5 сывороток), лошади (1 сыворотка), мыши (5 сывороток); *** – смесь рек. белков GP, NP, VP35, VP40 по 100 нг/лунку каждого.

Изучение антигенных свойств рекомбинантных белков вируса Марбург с помощью панели МКА

По исследованию рек. белков ВМ имеется два сообщения - об использовании рек. NP, экспрессированного в виде полноразмерных копий в бакуловирусной системе и в виде С-концевых фрагментов в E.coli, для выявления противовирусных АТ в сыворотках крови реконвалесцентов людей (M. Saijo et al., 2001) и о получении МКА, специфичных к этому рек. белку и выявляющих вирусный АГ в реакции иммунофлюоресценции (M. Saijo et al., 2005).

Для изучения рек. белков NP, VP35, VP40 ВМ, получили панель гибридомных МКА, специфичных к гомологичным вирусным белкам. Панель содержит - 3 вида МКА к NP, 3 вида МКА к белку VP35 и 9 видов МКА к  VP40 (табл. 7). Для одного вида МКА 3А5 белок-мишень в ИБ не определялся, хотя он имел высокий титр в ТИФА, видимо эпитопы для этого вида МКА имеют конформационную структуру.

Специфическое взаимодействие МКА с рек. белками ВМ оценивали в ТИФА и ИБ. Как видно из представленных данных (см. табл. 7), большинство МКА активно взаимодействовали с рек. белками – аналогами вирусных белков в ТИФА. Специфическое взаимодействие рек. белков с МКА в ИБ для примера представлено на рис. 5-7. Так же было показано, что МКА, специфичные к ВМ, не имеют перекрестного взаимодействия с рек. белками гетерологичного ВЭ в ИБ и ТИФА, в отличие от данных по перекрестному взаимодействию противовирусных ПАТ с гетерологичными вирусными белками, как это было показано ранее (см. табл. 3).

Рис. 5. Иммуноблоттинг рекомбинантных белков NP вируса Марбург с МКА, специфичными к вирусному нуклеопротеину

Цельная мембрана, содержащая:

1 – лизат клеток 293 (отрицательный контроль);

2 - лизат клеток 293, инфицированных vTF7-3 (отрицательный контроль);

3 – инактивированный ВМ;

4 – рек. NP, экспрессированный в эукариотических клетках 293;

5 – рек. NP, экспрессированный в прокариотических клетках E.coli;

6 – лизат клеток E.coli (отрицательный контроль);

обработана смесью МКА 5F1, 5H7 и 9С7 в разведении 1/1000 каждого.

Рис. 6. Иммуноблоттинг рекомбинантного белка VP40 с МКА, специфичными к матриксному вируса Марбург, обработан МКА 7Н10 (положительный контроль);

2 - препарат ВМ, обработан МКА 7D8 (положительный контроль);

3 – рек. белок VP40, обработан МКА 7Н10;

4 – рек. белок VP40, обработан МКА 7D8;

5 - препарат ВЭ, обработан МКА 7Н10 (отрицательный контроль);

6 - препарат ВЭ, обработан МКА 7D8 (отрицательный контроль);

7 - лизат E.coli, обработан МКА 7Н10 (отрицательный контроль);

8 - лизат E.coli, обработан МКА 7D8 (отрицательный контроль); МКА использовали в разведении (1/500).

 

  Таблица 7

Анализ специфичности рекомбинантных белков вируса Марбург

п/п

Назва-

ние

МКА

Иммуно-ген

Вирусный белок-

мишень

в ИБ

Взаимо-

действие

с рек.

белком-

аналогом

в ИБ

Титры антител в ТИФА с вирусными антигенами

и рекомбинантными аналогами

вирус 

Марбург

рек.NP –

ВМ

рек.VP40-

ВМ

рек.VP35-

ВМ

1

3F9

ВМ

VP35

+

656100

-

-

729000

2

9D8

ВМ

VP35

+

729000

-

-

656100

3

8G3

ВМ

VP35

-

218700

-

-

72900

4

5G9

ВМ

VP40

+

729000

-

72900

-

5

7H10

ВМ

VP40

+

729000

-

729000

-

6

9G6

ВМ

VP40

+

218700

-

218700

-

7

6B7

ВМ

VP40

+

656100

-

656100

-

8

1C12

ВМ

VP40

+

24300

-

24300

-

9

10E11

ВМ

VP40

+

24300

-

24300

-

10

7D8

ВМ

VP40

+

2187000

-

243000

-

11

5G8

ВМ

VP40

+

656100

-

656100

-

12

7С4

ВМ

VP40

+

2187000

-

729000

-

13

5F11

ВМ

NP

+

2187000

24300

-

-

14

9C7

ВМ

NP

+

6561000

6561000

-

-

15

5H7

ВМ

NP

+

2187000

2187000

-

-

16

3A5

ВМ

NP (?)

-

218700

-

-

-

Примечания: для иммунизации мышей-доноров иммунных спленоцитов был использован инактивированный ВМ; NP (?) – белок – мишень не определяется этим видом МКА в ИБ и не взаимодействует с рек. белком, но по результатам КИФА имеет сродство к NP ВМ (Е.И. Казачинская, 2002); + есть реакция в данном методе; -  нет реакции в данном методе; 100 нг/лунка – концентрация антигенов.

Рис. 7. Иммуноблоттинг с вирусных и рекомбинантных белков VP35 вируса Марбург с моноклональными антителами

1 – препарат ВМ (10 мкл), стрелкой обозначен вирусный белок VP35;

2 - препарат ВЭ (отрицательный контроль на антиген);

3 – лизат E.coli. (отрицательный котроль для рек. белка);

4 – очищенный рек. белок VP35 ВМ (10 мкл) обозначен стрелкой;

все полоски мебраны обработаны препаратом очищенных МКА 3F9 в разведении 1/500;

5 – значения молекулярной массы белковых маркеров.

Изучение антигенных свойств рекомбинантных белков вируса Эбола с помощью МКА

Рек. белки VP35, NP и VP40 ВЭбыли исследованы с помощью панели гибридомных МКА, специфичных к гомологичным вирусным белкам. Специфическое взаимодействие МКА с рек. белками VP35, NP и VP40 ВЭ оценивали в ТИФА и ИБ (табл. 8). Специфическое взаимодействие рек. белков NP и VP40 ВЭ с МКА в ИБ для примера представлено на рис. 8, 9.

Было выявлено, что МКА, специфичные к ВЭ, не имели перекрестного взаимодействия с рек. белками ВМ в ИБ и ТИФА, в отличие от перекрестного взаимодействия ПАТ с вирусными белками, как это было показано ранее (см. табл. 3).

Так как вирусные белки, с которыми взаимодействовали АТ, выявляли методом ИБ, это позволо предположить, что данные эпитопы являются конформационно стабильными и, видимо, представлены “линейной” структурой как на вирусных белках, так и на их рек. аналогах. Для того чтобы выяснить, существуют ли подобные антигенные структуры на белках вириона исследовали взаимодействие МКА с инфекционным вирусным препаратом в ТИФА в условиях 4 уровня биозащиты (табл. 9). Результаты проведенного анализа демонстрируют наличие исследуемых эпитопов на белках VP35 и NP очищенных вирионов ВЭ и сохранность этих эпитопов после инактивации. Высокая специфичность взаимодействия АТ иммунной сыворотки против рек.VP35 ВЭ с очищенными инфекционными вирионами, подчеркивает подобие эпитопов рек. белка и природного VP35 ВЭ.

До начала исследований всей панели МКА методом двухцентрового ИФА в формате “сэндвич” для выявления не конкурирующих за антигенные эпитопы МКА, пригодных для конструирования тест-ситемы по выявлению филовирусных АГ, пара МКА (4А8 и 6F7 из первой коллекции), были использованы при разработке метода экспресс-выявления антигена ВЭ (А.А. Чепурнов и др., 2007). Основой тест-системы служит нитроцеллюлозная мембрана с нанесенными на нее МКА 4А8 (в концентрации 0,1 мг/мл) для захвата антигена. МКА 6F7, сорбционно связанные с коллоидным золотом, служили детектирующими. Было показано выявление АГ ВЭ на вторые сутки после инфицирования в сыворотке крови сотрудника, фатально заболевшего при лабораторной аварии. Чувствительность выявления вирусного АГ составила 3 нг/мл, при титре вирусемии в сыворотке крови 105 БОЕ/мл. Эти данные служат достаточным основанием использования МКА, которые строго специфичны к внутренним вирусным белкам NP, VP40 и VP35 ВЭ и не имеют перекрестной активности c гетерологичным АГ, для разработки ИФА тест-систем для выявления АГ ВЭ.

  Таблица 8

Анализ специфичности рекомбинантных белков вируса Эбола

п/п

Назва-

ние

МКА

Специ-

фич-

ность

(вирус)

Белок-

мишень

Взаимо-

действиес рек.

белком-

аналогом

в ИБ

Титры антител в ТИФА с вирусными антигенами и

рекомбинатными аналогами

 

вирус

Эбола

рек.VP35-ВЭ

рек.NP - ВЭ

рек.VP40-ВЭ

1

1C7

ВЭ-IS

VP35

+

2187000

729000

<100

<100

2

6F7

ВЭ -IS

VP35

+

729000

218700

<100

<100

3

1B2

ВЭ-IS

NP

+

2187000

<100

2187000

<100

4

7B11*

ВЭ-IS

NP

+

512000

<100

656100

<100

5

1E5

ВЭ-IS

NP

+

218700

<100

243000

<100

6

4B9

ВЭ-IS

NP

+

656100

<100

2187000

<100

7

9A7

ВЭ-IS

NP

+

24300

<100

72900

<100

8

4А8

ВЭ-IS

NP

+

2187000

<100

121500

<100

9

10В4

ВЭ-IS

NP

+

2187000

<100

729000

<100

10

6G8

ВЭ-IS

NP

+

24300

<100

243000

<100

11

6A8

ВЭ-IS

NP

+

72900

<100

40500

<100

12

10A8

ВЭ-IS

NP

+

218700

<100

218700

<100

13

1C1

ВЭ-8МС

VP40

+

6561000

<100

<100

6561000

14

4A2

ВЭ-IS

VP40

+

6561000

<100

<100

6561000

15

1E6

ВЭ-8МС

VP40

+

72900

<100

<100

656100

16

3D9

ВЭ-8МС

VP40

+

729000

<100

<100

218700

17

1B5

ВЭ-8МС

VP40

+

72900

<100

<100

656100

18

5С10

ВЭ-IS

VP40

+

24300

<100

<100

13500

19

2E12

ВЭ-IS

VP40

+

24300

<100

<100

24300

Примечания: ВЭ-IS – исходный штамм ВЭ-Заир; 8МС – штамм ВЭ-Заир, адаптированный к морским свинкам, на 8 пассаже вызвал гибель животных (V.E. Volchkov et al., 2000) МКА 7B11* - продукт секреции гибридомы крысиного происхождения (автор гибридомы А.В.Перебоев); + есть реакции в данном методе; 100 нг/лунка – концентрация антигенов.

Рис. 8. Иммуноблоттинг. Выявление вирусного белка VP35 в составе вирусного препарата ПАТ мышиной моносыворотки, специфичной к рек. белку VP35 ВЭ

1 - очищенный препарат ВЭ обработан моносывороткой к рек.VP35;

2 – рек. белок VP35 обработан нормальной АС мыши (отрицательный контроль);

3 – рек. белок VP35 обработан моносывороткой к рек.VP35 (положительный контроль);

антитела использовали в разведении (1/3000).



Рис. 9. Иммуноблоттинг. Взаимодействие МКА, специфичных к вирусному белку VP40 с рекомбинантным белком-аналогом вируса Эбола

1 - препарат ВЭ, обработан МКА 4А2;

2 - препарат ВЭ, обработан МКА 1С1;

3 – рек. белок VP40, обработан МКА 4А2;

4 – рек. белок VP40, обработан МКА 1С1;

5 - препарат ВМ, обработан МКА 4А2 (отриц. контроль);

6 - препарат ВМ, обработан МКА 1С1 (отриц. контроль);

7 - лизат E.coli., обработан МКА 4А2 (отриц. контроль);

8 - лизат E.coli., обработан МКА 1С1 (отриц. контроль);

МКА использовали в разведении (1/10000).


Рис. 10. Иммуноблоттинг. Взаимодействие МКА, специфичных

к вирусному нуклеопротеину вируса Эбола с рекомбинантным белком: 1 - препарат ВЭ, обработан МКА 1В2;

2 - препарат ВЭ, обработан МКА 7В11;

3 – рек. NP, обработан МКА 1В2;

4 – рек. NP, обработан МКА 7В11;

5 - препарат ВМ, обработан МКА 1В2

(отриц. контроль);

6 - препарат ВМ, обработан МКА 7В11

(отриц. контроль);

7 - лизат E.coli, обработан МКА 1В2 в разведении 1/500

(отриц. контроль);

8 - лизат E.coli, обработан МКА7В11 в разведении

(отриц. контроль); МКА использовали в разведении (1/500).

Таблица 9

Взаимодействие МКА, специфичных к инактивированному вирусу Эбола с нативными вирионными белками

Источник антител

Титр антител

Очищенный ВЭ*

(до инактивации)

Инактивированный ВЭ**

МКА 1С7 – VP35

н.о.

2187000

МКА 6F7 – VP35

н.о.

729000

Cмесь МКА к VP35 (1С7+6F7)

1562500

312500

МАС – рек.VP35

3125000

729000

Cмесь МКА к NP (10А8 + 4B9+10В4+1Е5+6А8)

3125000

3125000

МКА 10А8

н.о.

218700

  4В9

н.о.

656100

  10В4

н.о.

2187000

  1Е5

н.о.

218700

  6А8

н.о.

72900

Примечания: Данный эксперимент провел доктор А.А. Чепурнов в условиях 4 уровня биозащиты; МАС - рек.VP35 – сыворотка мыши, иммунизированной рек. белком VP35 ВЭ; ВЭ* - инфекционный вирусный препарат; ВЭ** - вирусный АГ инактивирован 1 %-ным раствором SDS; сорбция антигенов в концентрации 100 нг/лунку; н.о – не определяли.

Отбор парных МКА не конкурирующих за антигенные эпитопы вирусных и рекомбинантных белков вируса Марбург и Эбола

Метод ИФА в формате “сэндвич” с ПАТ применяли при разработке лабораторных ИФА тест-систем для выявления ВМ в работах (А.С. Владыко и др., 1991; Н.В. Кизимов, 1993). В одной работе описаны МКА, специфичные к GP, которые были использованы в качестве “индикаторных” для выявления вирусного АГ (С.В. Ручко и др., 2001), а в другой (M. Saijo et al., 2005) для “захвата” АГ использовали МКА, специфичные к определенным перекрывающимся эпитопам (634-647 а.о. и 643-695 а.о.) рек. NP ВМ.

При разработке первых лабораторных ИФА тест-систем для выявления АГ ВЭ применяли метод ИФА в формате “сэндвич” в основном с ПАТ разных видов животных (Н.В. Мерзликин и др., 1995; T.G. Кsiazek et al., 1992) или сочетано с МКА, специфичными к вирусному белку VP40 (G. Kallstrom et al., 2005) или рек. NP (M. Niikura et al., 2001). В недавней работе зарубежных исследователей показано практическое применение двух видов МКА, специфичных к матриксному белку VP40, при исследовании проб сывороток крови, мочи, слюны и пота людей, собранных при вспышке ГЛЭ в Республике Конго в 2003 г. (A. Lucht et al., 2007). Принцип метода иммунофильтрации состоит в “сэндвиче” из МКА, один вид которых нанесен на матрицу колонки с открытым сужающимся дном, что обеспечивает хорошую промывку. Второй вид МКА, меченных биотином, реагирует с конъюгатом стрептовидина и пероксидазы. Иммунохимическую реакцию АТ с АГ проявляли раствором ТМБ. Для учета ОП реакции используют портативный фотометр или учитывают результат визуально. Данный метод для выявления вирусного АГ пригоден для полевых испытаний без использования электричества и дорогого оборудования. Время проведения анализа составляет 30 минут. Чувствительность выявления нативного вирусного АГ составила 105 БОЕ/мл. Инактивация исследуемых проб с 1 % SDS, повышашало чувствительность системы до 104 БОЕ/мл.

Создание представительной панели МКА, специфичных к трем филовирусным белкам – NP, VP40 и VP35, позволило использовать метод двухцентрового ИФА в формате “сэндвич” для выявления МКА, не конкурирующих за антигенные эпитопы, то есть способных эффективно “захватывать” вирусный или рек. АГ из исследуемой пробы.

МКА, имеющие высокий титр в ТИФА в виде культуральной жидкости от гибридных культур клеток, наработали in vivo. Асцитические жидкости очищали каприловой кислотой (H. Bazin et al., 1990) с последующим высаливанием 50 %-ным раствором сульфата аммония и оценивали степень чистоты полученных препаратов МКА в ЭФ. На рисунке 11, для примера, представлены несколько из использованных в исследовании очищенных МКА. Данный метод позволяет получать очищенные МКА с четко выраженными на электрофореграмме тяжелыми  (на уровне 50-55 кДа) и легкими (20-25 кДа) цепями IgG. Хорошая очистка МКА важна для исключения неспецифического фона при иммунохимических взаимодействиях, для сорбции на полистироловую поверхность планшетов большего количества IgG, несущих специфические паратопы для АГ и приготовления универсальных конъюгатов с ферментами.

Рис. 11 Электрофореграмма МКА,

очищенных каприловой кислотой

1 - белковые маркеры молекулярной массы

(10 мкл), (Bio-Rad);

2,3.4 - препараты очищенных мышиных

МКА 3F9, 7D8, 7H10,

специфичные к ВМ (по 1 мкл);

5,6,7 – препараты очищенных мышиных

МКА 1C1, 4A2, 1В2,

специфичные к ВЭ (по 1 мкл);

стрелками обозначены цепи IgG.

Методом двухцентрового ИФА в формате “сэндвич” было исследовано 16 видов МКА, специфичных к белкам. На их основе было сформировано 224 сочетания пар МКА. Из 74 пар МКА, выявляющих инактивированный АГ ВМ (при ОП субстратно-индикаторной смеси в тестируемых лунках >1,0) - 15 пар МКА выявляли рек. белки: 11 пар выявляли рек. VP40 и 4 пары – рек.VP35 (табл. 10).

Так же был исследован 21 вид МКА, специфичных к белкам ВЭ – два к VP35; девять к VP40; десять к нуклеопротеину. Из них было сформировано 399 различных сочетаний пар МКА. Инактивированный антиген ВЭ удовлетворительно выявляли 115 пар МКА (при ОП субстратно-индикаторной смеси в тестируемых лунках >1,0), из них 29 пар МКА выявляли рек. белки: 17 пар выявляли рек.VP40 и 14 пар – рек.NP (см. табл. 10).

Интересен был факт выявления инактивированных АГ парами МКА, специфичных к разным вирусным белкам. Эти данные предполагают высокое белок - белковое взаимодействие вирусных протеинов в вирионе, несмотря на жесткую инактивацию. По литературным данным, при исследовании структуры филовирусов методом электронной микроскопии было зафиксировано, что NP и VP40 ВЭ-Заир тесно связаны в течение вирусного морфогенеза, что является важной деталью при постановке диагноза филовирусных заболеваний (T.W. Geibert et al., 1995). При исследовании вклада филовирусных белков в формирование вирусоподобных частиц (VLPs) было показано, что NP ВЭ самостоятельно, без помощи VP40, не выходит из клеток и поэтому была предположена важная связь между этими белками (J. Licata et al., 2004).

Использование рек. белков позволяет более точно определять чувствительность выявления индивидуальных АГ. Так, по литературным данным, очищенный  АГ ВЭ выявляли парой МКА, специфичных к белку VP40, до концентрации 1-2 нг/мл, что соответствовало инфекционному титру 103-104 БОЕ/мл (A. Luch et al., 2003). При использовании МКА для “захвата” АГ была показана чувствительность выявления рек. VP40 ВЭ в концентрации 2 нг/100 мкл (G. Kalstrom et al., 2005) и рек. NP в концентрации 30 нг/100 мкл (M. Niikura et al., 2001).

В данном исследовании чувствительность выявления рек. АГ разными парами МКА находилась в диапазоне концентраций от 150 до 1 нг/мл). Были выбраны четыре пары МКА, которые наиболее эффективно выявляли как очищенные вирусные АГ, так и рек. белки с чувствительностью 1 нг/мл. Это пара МКА 1В2 и 7В11, специфичные к NP ВЭ (рис. 12) и пара МКА 4А2 и 1С1, специфичные к белку VP40 ВЭ (рис. 13). Для белка VP40 ВМ это пара МКА очищенных 7D8 и меченных биотином 7H10 (рис. 14).

МКА 3F9, специфичные белку к VP35, можно одновременно эффективно использовать как в качестве “захватывающих” АГ, так и в качестве меченных биотином МКА для выявления АГ VP35 ВМ (рис. 15). В двух известных коллекциях мышиных гибридом, продуцирующих МКА к ВМ, штамм Musoke (M. Hevey et al., 1997) и штамм Рорр (С.В. Ручко и др., 2001), отсутствуют гибридомы, продуцирующие МКА к белку VP35. Это делает МКА 3F9, специфичные к VP35 ВМ особенно перспективными для дальнейшего практического использования.

Выбранные пары МКА строго специфичны к внутренним структурным вирусным белкам NP, VP40 и VP35 филовирусов, не имеют перекрестной реактивности с гетерологичными вирусными и рек. АГ. Кроме того, по результатам двухцентрового ИФА все эти 7 видов МКА, специфичные к структурным внутренним филовирусным белкам NP, VP40 и VP35, конкурируют с IgG лошадей, иммунизированных инфекциоными вирусами, за антигенные эпитопы вирусных и рек. белков. В связи с этим, показана ценность препаратов МКА при использовании их в качестве  диагностических реагентов для выявления маркеров филовирусов.

Исследование иммунохимических свойств рек. белков NP, VP40 и VP35, полученных в результате экспрессии полноразмерных генов NP, VP35 и VP40 в клетках E.coli методами ИФА и ИБ, показало, что они антигенно схожи с нативными вирусными АГ и могут быть успешно применены для конструирования иммунодиагностических тест-систем в качестве положительного контроля на антиген.

  Таблица 10

Данные по количеству пар МКА, исследованных в двухцентровом ИФА формата “сэндвич” для выявления антигенов вирусов Марбург и Эбола

Общее количество исследован-ных видов МКА

Коли-чество исследо-ванных

сочета-ний

пар

Количество пар МКА, выявляю-щих инактиви-рованный АГ

Количество пар МКА, выявляю-щих рекомбинант-ный VP40 ВМ (совпадающих

по выявлению

АГ ВМ)

Количество пар МКА, выявляющих рекомби-нантный VP35 ВМ (совпадаю-щих по выявлению АГ ВМ)

Количество пар МКА, выявляю-щих рекомби-нантный VP40 ВЭ (совпадаю-щих по выявлению АГ ВЭ)

Количество пар МКА, выявляю-

щих рекомби-нантный NP ВЭ

(совпадаю-щих по выявлению АГ ВЭ)

Из 16 видов МКА, специфич-ных к вирусу Марбург:

3 – к белку VP35;

9 - к белку VP40;

3 – к  NP;

1 –  NP (?)

224

74 

33 (11)

5  (4)

-

-

Из 21 вид МКА, специфич-ных к вирусу Эбола:

2 – к белку VP35;

9 - к белку VP40;

10 – к  NP

399

115

-

-

51  (17)

42  (14)

Рис. 12. Титрование антигена вируса Эбола и рекомбинантного нуклеопротеина парой МКА 1B2 и 7B11*

Примечания: исходная концентрация препаратов антигенов по СФ 1 мг/мл, первая точка титрования в разведении 1/400 соответствует концентрации 2500 нг/мл; 7B11* - индикаторные МКА меченные биотином; в качестве отрицательного контроля использовали пару МКА 9С7 и 5F11*, специфичных к NP ВМ; концентрация МКА для “захвата” антигенов – 10 мкг/мл; концентрация индикаторных МКА, меченных биотином – 1 мкг/мл.

Рис. 13. Титрование антигена вируса Эбола и рекомбинантного белка VP40

парой МКА 4А2 и 1С1*

Примечания: Исходная концентрация препаратов антигенов по СФ 1 мг/мл, первая точка титрования в разведении 1/400 соответствует концентрации 2500 нг/мл; 1C1* - индикаторные МКА меченные биотином; в качестве отрицательного контроля использовали пару МКА 7D8 и 7Н10*, специфичные к белку VP40 ВМ; концентрация МКА для “захвата” антигенов – 10 мкг/мл; концентрация индикаторныхМКА, меченных биотином – 1 мкг/мл.

Рис. 14. Титрование антигена вируса Марбург и рекомбинантного белка VP40 парой МКА 7D8 и 7H10*

Примечания: Исходная концентрация препаратов антигенов по СФ 1мг/мл, первая точка титрования в разведении 1/400 соответствует концентрации 2500 нг/мл; 7H10* - индикаторные МКА меченные биотином; в качестве отрицательного контроля использовали пару МКА 4A2 и 1C1*, специфичные к белку VP40 ВЭа; концентрация МКА для “захвата” антигенов – 10 мкг/мл; концентрация индикаторных МКА, меченных биотином – 1 мкг/мл.

Рис. 15. Титрование антигена вируса Марбург и рекомбинантного белка VP35 парой МКА 3F9 и 3F9*

Примечания: Исходная концентрация препаратов антигенов по СФ 1мг/мл, первая точка титрования в разведении 1/400 соответствует концентрации 2500 нг/мл; 3F9* - индикаторные МКА меченные биотином; в качестве отрицательного контроля использовали захватывающие антиген МКА 1С7, специфичные к белку VP35 ВЭ; концентрация МКА для “захвата” антигенов – 10 мкг/мл; концентрация индикаторных МКА, меченных биотином - 1мкг/мл.

Применение МКА и антигенов в иммунодиагностике лихорадки Западного Нила

В серодиагностике ЛЗН используют метод ИФА для выявления специфических АТ (В.В. Распопин и др., 2007; S. Feinstein et al., 1985; W.R. Hogrefe et al., 2004). Но выраженные перекрестные реакции между ВЗН и ВКЭ, ареалы которых в России перекрываются (Д.К. Львов и др., 2000; В.А. Терновой и др., 2004; В.А. Терновой и др., 2006), затрудняют его иммунохимическую диагностику (В.В. Распопин и др., 2007). Методы выявления вируса на культуре клеток москитов или Vero (I. Samina et al., 1986; K.A. Bernard et al., 2001; R.S Nasci. et al., 1999) или внутримозговым заражением новорожденных мышей (Д.К. Львов, 2000; I. Samina et al., 1986), а так же ПЦР для выявления вирусной РНК (Д.К. Львов, 2000; В.А. Терновой и др., 2004; В.А. Терновой и др., 2006; R.S. Lanciotti et al., 2000; G.L. Surtherland et al., 2007) требуют много времени и/или дороги.

Для наблюдения вирусной активности в естественных циклах передачи и предотвращения инфекции у людей Hunt A.R. и соавт. (2002) предлагают проводить выявление вирусного АГ методом ИФА в лабораториях, не имеющих оборудования для выполнения ПЦР. Для захвата антигена в этой системе использованы МКА, специфичные к южно-африканскому штамму ВЗН, полученные T.G. Besselaar и соавт. (1988), а для детекции - группоспецифические к флавивирусам МКА, конъюгированные с пероксидазой. Чувствительность выявления очищенного АГ ВЗН (штамм NY99) в этой системе составила 320 пг/мл, а в пуле лабораторно инфицированных москитов и мозговой суспензии мышей-сосунков 103-104 PFU/мл.

В России в настоящее время выпускается только одна коммерческая тест-система ИФА на основе ПАТ для выявления АГ ВЗН (ЗАО ЭКОлаб, Московская область, г. Электрогорск).

Получение и характеризация МКА, специфичных к российскому штамму вируса Западного Нила (LEIVVL99-27889-human)

Для получения гибридом, продуцирующих МКА специфичные к структурным белкам ВЗН, было проведено 3 гибридизации и в результате наблюдения в световой микроскоп было выявлено 853 лунки с гибридами, размножающимися на селективной среде ГАТ. Из них 771 гибридная популяция была оценена в ТИФА и после 2-кратного тестирования было выявлено 119 позитивных популяций гибридом, растущих в лунках. Методом предельных разведений было проведено клонирование 75 гибридом. Заморожена позитивная популяция 32 гибридом. Выход позитивных клонов гибридом, после клонирования, составил 24 гибридомы. Позитивные клеточные линии, по данным ИФА,  были размножены (1-3 клона) и заложены в жидкий азот на хранение.

Препаративные количества очищенных 15-ти видов МКА, полученные из асцитических жидкостей мышей с привитыми гибридомными клетками, тестировали методом ТИФА с использованием в качестве АГ очищенного ВЗН (штамм Vlg99-27889). Результаты анализа представлены в табл. 11. Все исследованные препараты содержали высокий уровень специфических МКА. Методом ИБ показана специфичность полученых МКА (рис. 16).

Проведенные ранее исследования показали, что эти МКА позволяют нейтрализовать семь штаммов ВЗН (LEIV-VLG99-27889-human; LEIV-VLG00-27924-human; LEIV-Tur73-2914-ticks; LEIV-Az70-72-ticks; LEIV- Az67-1640-nuthatch;  Ast63-94-ticks; Eg101) на культуре клеток Vero (Razumov I.A., Каzachinskaia E.I. et al., 2005). Использование РНК из мышиных гибридом, продуцирующих самые активные МКА 9Е2, позволило создать нашим коллегам в США химерную конструкцию МКА мышь/IgG1 человека, способную к протективному действию у мышей, зараженных американским штаммом NY-99 (A. Pereboev et al., 2008).

  Таблица 11

  Свойства МКА, специфичных к вирусу Западного Нила

№ п/п

МКА

Белок-мишень

в ИБ

Субтип IgG

Титр МКА в ТИФА

Концентрация очищенных МКА (мг/мл)

В асцитных жидкостях

В очищенных препаратах

1

9Е2

Е (53 кДа)

IgG1

>27000000

21870000

14,3

2

5Н6

н.о.

IgG1

729000

656100

6,0

3

4D10

н.о.

IgG1

243000

72900

7,0

4

7E6

Е (53 кДа)

IgG3

243000

243000

8,3

5

5F11

67 кДа

IgG3

243000

243000

8,9

6

11G3

Е (53 кДа)

IgG3

729000

810000

5,0

7

7B9

Е (53 кДа)

IgG2b

729000

729000

6,3

8

3A9

Е (53 кДа)

IgG1

72900

72900

4,5

9

5F7

н.о.

IgG1

72900

24300

1,7

10

4F11

Е (53 кДа)

IgG3

243000

243000

5,7

11

3F4

Е (53 кДа)

IgG2b

656100

656100

6,5

12

1B7

Е (53 кДа)

IgG3

656100

243000

4,5

13

2G12

Е (53 кДа)

IgG3

24300

24300

2,5

14

7G9

Е (53 кДа)

IgG3

>27000000

2430000

13,5

15

7B2

Е (53 кДа)

IgG1

24300

24300

2,5

16

АС мыши*

Е (53 кДа); 67 кДа

все

729000

2430000

н.о.

17

АС здоровой мыши

<100

<100

н.о.

Примечания: в качестве АГ в ТИФА использован очищенный препарат ВЗН (штамм Vlg99-27889); * сыворотка мышей, клетки селезенки которых были взяты для гибридизации; н.о. – не определяется.

Рис. 16. Иммуноблоттинг.

Исследования белков

очищенного вируса Западного Нила (штамм Vlg99-27889) с применением:

1 - сыворотки мышей, иммунизированных инфекционным вирусом;

2, 3, 4 – сывороток мышей, иммуннизированных

инактивированным вирусным препаратом,

селезенки которых были взяты в гибридизацию;

5 – 10 – очищенных препарататов МКА 9Е2,7G9, 11G3,

7F9 и 7B9, соответственно;

11, 12 - очищенных препаратов МКА 5H6 и 4D10.

Справа приведены обозначения молекулярной массы

по маркерам (Life technology).

Все антитела использовали в разведении (1/1000); cтрелками показаны белки вирусного препарата.

Изучение антигенных свойств препаратов ВЗН с применением МКА

МКА были получены при иммунизации мышей-доноров иммунных спленоцитов очищенным вирусным препаратом из мозговой ткани инфицированных ВЗН мышей-сосунков.

Приготовление очищенного АГ трудоемкий и затратный процесс, так на приготовление 1 мг АГ было использовано 40 животных. Чтобы исключить наработку вирусного препарата на инфицированных животных, для дальнейших исследований использовали концентрированный АГ из инфицированных клеток Vero. С монослоя инфицированных клеток Vero (до появления явного ЦПД вируса в виде лизиса инфицированных клеток) удаляли поддерживающую среду, а клеточный дебрис в небольшом объеме среды без сыворотки осаждали низкоскоростным центрифугированием при 1000 об/мин. Осадок клеток в объеме 1 мл среды без сыворотки обрабатывали ультразвуком при 50 Вт в течение 30 секунд на тающем льду. Лизат клеток освобождали от осадка клеточных мембран центрифугированием при 1000 об/мин в течение 10 минут. К аликвотам полученного лизата клеток или очищенного вирусного препарата добавляли 50 % глицерина и 1 % Nonidet P40. Супернатанты для учета инфекционного титра вируса на культуре клеток Vero получали центрифугированием (при 10000 об/мин, 4 0С) трехкратно замороженной и размороженной среды вместе с клетками, после наблюдаемого не менее 80 % ЦПД вируса на монослой зараженных клеток. Работа с инфекционным ВЗН проводилась в изолирующем боксе, так как он относится к агентам II группы патогенности по биобезопасности.

Оценку эффективности взаимодействия МКА с белками очищенного и неочищенного АГ проводили методами ТИФА и ИБ. Результаты титрования очищенного вируса и лизата инфицированных клеток Vero в ТИФА с МКА 9Е2 приведены на рис. 17. В лизате инфицированных клеток белок Е выявляется методом ИБ с МКА без фоновых полос, так же как и в очищенном вирусном препарате (рис. 18). МКА, специфичные к ВЗН не выявляли этот белок в препаратах ВКЭ и ВЯЭ.

Данные ИБ и данные титрования очищенного вируса и лизата инфицированных клеток в ТИФА свидетельствуют о высокой специфичности МКА к белку Е и возможности использования неочищенного вирусного препарата в качестве положительного контроля на АГ. Высокий уровень урожая вируса при наработке на культуре клеток Vero позволяет не использовать животных.

Рис. 17. Титрование вирусных препаратов в ТИФА с МКА 9Е2

Примечания: ВЗН – вирус Западного Нила;ВКЭ – вирус клещевого энцефалита; ВЯЭ – вирус японского энцефалита.

Рис. 18. Иммуноблоттинг препаратов

вируса Западного Нила с МКА 9Е2

  1. очищенный, концентрированный вирусный

препарат в градиентах 30 % глицерина – 40 %

тартрата калия - натрия, приготовленный из гомогената мозга мышей,

  1. инфицированных ВЗН (штамм LEIV-VLG99-27889-human); лизат клеток Vero, инфицированных ВЗН

(штамм Eg101);

  1. лизат не инфицированных клеток Vero;
  2. очищенный, концентрированный препарат ВКЭ;
  3. очищенный, концентрированный препарат ВКЭ.

Все полоски мембраны обработаны очищенными МКА 9Е2 в разведении (1/500).

Выбор пар МКА для эффективного выявления антигена ВЗН

Оценку конкуренции МКА за эпитопы белка Е проводили в двухцентровом ИФА формата “сэндвич”. На очищенные для “захвата” АГ МКА, сорбированные на полистироловую поверхность микропланшета наносили вирусный препарат и затем вторые МКА меченные биотином (индикаторные). После отмывки выявляли связанную биотиновую метку конъюгатом стрептавидина с пероксидазой. Результаты представлены в табл. 12. Выявлено несколько пар МКА специфичных к удаленным друг от друга эпитопам и не конкурирующих между собой за места связывания с АГ: 9Е2+5Н6*; 9Е2+7G9*; 5H6+7G9*; 5H6+7E6*; 7E6+5H6*; 7E6+7G9* (звездочками обозначены индикаторные антитела). По результатам титрования АГ разными парами МКА, наиболее перспективной для использования в иммунохимических тестах представлялась пара МКА 9Е2+5Н6*, которая и была использована в дальнейших экспериментах.

Иммунохимическое выявление вируса Западного Нила в биопробах

С использованием пары МКА (9Е2 для захвата АГ и 5Н6, связанных с биотином для детекции и конъюгата стрептавидина с пероксидазой) исследован ряд вируссодержащих субстанций с целью оценки эффективности данных АТ для выявления АГ ВЗН. На рис. 19 представлены результаты выявления очищенного антигена и лизата инфицированных клеток. Очищенный АГ ВЗН (с концентрацией по белку 1 мг/мл) эта система достоверно определяет в разведении 1/51200. Таким образом, лимит выявления АГ составляет 1 - 2 нг/мл. Выбранная пара МКА позволяет выявлять в ростовой среде инфицированных клеток Vero вирусный АГ семи исследованных штаммов ВЗН, выделенных от разных хозяев – людей, птиц и нескольких видов клещей в разное время (рис. 20).

Для оценки эффективности обнаружения АГ ВЗН в биопробах от животных  была моделирована ЛЗН (штамм Египет-101) на белых беспородных мышах при внурибрюшинном заражении, как описано Писаревым В.Б. и соавт. (2007). Биологический материал забирали в разгар заболевания (активность резко снижена, шерсть взъерошена, живот асцитный, паралич задних конечностей). Животным под эфирным наркозом проводили декапитацию и забор биологического материала проводили с соблюдением требований инструкций, разработанных для работы с вирусами II группы патогенности и правилами проведения работ с использованием экспериментальных животных. Из крови получали сыворотку, а из органов готовили 10 %-е гомогенаты мозга, печени, селезенки, почек, легкого и сердца. В качестве положительного контроля на АГ использовали ростовую среду от инфицированных клеток Vero. Результаты представлены на рис. 21. По данным титрования было выявлено, что в цельной крови АГ практически не обнаруживается, а наибольшее его количество сконцентрировано в мозговой ткани и клетках печени. В клетках сердца, селезенки, почек и легкого мышей ВЗН так же продуктивно реплицируется, что говорит широком диапазоне его тропности.

На основании этих данных совместно с ЗАО “Вектор-Бест” была разработана экспериментальная тест-система “ВектоНил-антиген”. Для “захвата” АГ использовались иммобилизованные высокоспецифичные МКА 9Е2, а в качестве конъюгата применялись меченые пероксидазой хрена МКА 5Н6. Сотрудниками лаборатории ООИ ФГУЗ «ЦГиЭ в Волгоградской области» были проведены полевые испытания этой тест-системы. Результаты представлены в табл. 13. Было исследовано 264 пробы из внешней среды на наличие антигена АГ ВЗН, в том числе суспензии из органов 62-х птиц (видовой состав – грачи, вороны, дрозды), 114 комаров (рода Aedes, Culex, Anopheles); 36 клещей (виды H. Morginatum и D. Reticulatum), органов 52–х мелких мышевидных грызунов. Положительный результат на АГ был получен в 15 пробах (5,6 %): комаров – 14 (12,2 %) и клещей – 1 (2,7 %). Комары рода Aedes и Culex пойманы в Камышинском районе Волгоградской области и г. Волгограде. Клещ H. morginatum был снят с грача (Октябрьский район Волгоградской области).

Таким образом, разработанная на основе двух видов МКА, тест-система “ВектоНил-антиген”, может применяться при проведении эпидемиологических исследований на присутствие АГ ВЗН в биологических образцах, собранных в природе.

Таблица 12

Результаты оценки МКА, специфичных к разным эпитопам белка Е вируса Западного Нила методом двухцентрового ИФА в формате “сэндвич”

МКА захвата

Индикаторные  МКА, меченные биотином

9Е2

5Н6

4D10

7E6

5F11

11G3

4F11

3F4

7G9

1

9Е2

0,23

3,83

0,56

0,84

0,66

0,06

0,78

0,60

2,51

2

5Н6

0,55

0,80

2,53

2,72

3,17

0,99

0,94

0,89

3,09

3

4D10

0,04

0,48

0,62

0,03

1.03

0,06

0,66

0,61

0,54

4

7E6

0,01

3,57

0,65

0,19

0,86

0,04

0,79

0,67

3,20

5

5F11

0,05

0,43

0,70

0,01

0,97

0,03

0,51

0,64

0,45

6

11G3

0,01

0,43

0,84

0,05

1,45

0,04

0,62

0,52

0,38

7

7B9

0,01

0,29

0,94

0,01

1,64

0,02

0,44

0,51

0,27

8

3A9

0,01

0,41

1,64

0,09

3,30

0,05

0,79

0,49

0,33

9

5F7

0,09

0,24

1,19

0,06

2,60

0,03

0,42

0,70

0,47

10

4F11

0,08

0,19

1,53

0,09

2,80

0,07

0,38

0,53

0,31

11

3F4

0,09

0,27

1,33

0,09

2,63

0,07

0,43

0,53

0,33

12

1B7

0,10

0,09

0,43

0,09

0,62

0,05

0,39

0,54

0,21

13

2G12

0,08

0,08

0,52

0,09

0,62

0,05

0,39

0,54

0,21

14

7G9

0,06

0,99

1,04

0,24

1,62

0,02

0,52

0,57

0,81

15

7B2

0,07

0,11

0,71

0,05

1,19

0,05

0,48

0,52

0,29

16

АС мыши*

0,16

1,49

1,50

0,79

2,71

0,21

0,67

0,62

1,88

17

контроли

<0,1

<0,1

<0,1

<0,1

<0,1

<0,1

<0,1

<0,1

<0,1

Примечание: В качестве антигена использован лизат клеток Vero инфицированных ВЗН (штамм Eгипет-101); МКА для сорбции в ячейках планшета использовали в концентрации 10 мкг/мл; ндикаторные МКА использовали в концентрации 1 мкг/мл; жирным шрифтом выделены результаты для неконкурирующих МКА, т.е. активно “захватывающих” АГ; АС мыши* - сыворотка мыши, иммунизированной инфекционным вирусом. В качестве отрицательных контролей использовали лизат не инфицированных клеток Vero и очищенные препараты вирусов клещевого и японского энцефалитов.

Рис. 19. Результаты исследования серий двукратных разведений вирусных препаратов в двухцентровом ИФА с использованием пары МКА 9Е2 для захвата и 5Н6 для детекции

Рис. 20. Титрование антигена в вируссодержащей ростовой среде от инфицированных клеток Vero в  двухцентровом ИФА парой МКА 9Е2 и 5Н6*

Примечания: стрелками обозначен диапазон чувствительности ИФА при сравнении инфекционного титра вируса в супернатантах при параллельном их титровании на культуре клеток Vero. Разведение супернтанта (-3) соответствует в данном эксперименте 100 ТЦД50/100 мкл; Eg -101 – штамм Египет 101, выделен в 1951г. в Египте из сыворотки больного ребенка; Hp-94 – штамм Ast63-94-ticks, выделен в 1963 г. из клещей Hyalomma marginatum в дельте Волги (Астраханская область); Vlg-27924 – штамм LEIV-VLG00-27924-human, выделен в 2000 г. в г. Волгограде из мозга человека 74 лет, погибшего от ЛЗН; А-72 – штамм LEIV-Az70-72-ticks, выделен в 1970 г. из клещей Ornithodoros capensis в Азербайджане; Vlg-27889 – штамм LEIV-VLG99-27889-human, выделен в 1999 г. в г. Волгограде из мозга человека 15 лет, погибшего от ЛЗН; А-1640 – штамм LEIV-Az67-1640-nuthatch, выделен в 1967 г. из мозга птицы Sitta europaea в Азербайджане; Tur-2914- штамм LEIV-Tur73-2914-ticks, выделен в 1973 г. из клещей Hyalomma detritum в Туркмении.

Рис. 21. Выявление вирусного антигена в биологических пробах от инфицированных мышей методом двухцентрового ИФА парой МКА 9Е2 и 5Н6*

1 - супернатант от инфицированных клеток Vero (положительный контроль); 2 – 10 %-й гомогенат мозговой ткани; 3 – 10 %-й гомогенат печени; 4 – 10 %-й гомогенат легкого; 5 – 10 %-й гомогенат селезенки; 6 – 10 %-й гомогенат cердца; 7 – 10 %-й гомогенат почек; 8 - цельная сыворотка крови; 9 - ростовая среда от клеток Vero (отрицательный контроль).

  Таблица 13

Результаты полевого испытания ИФА тест-системы “ВектоНил-антиген”

Пробы

Количество исследованных проб

Результаты, полученные при использовании тест-системы “ВекторНил-антиген”

Положительных

Отрицательных

Суспензии из органов птиц (грачи, вороны, дрозды)

62

0

62

Суспензии из комаров родов Aedes, Culex, Anopheles

114

14

100

Cуспензии из органов мелких мышевидных грызунов

52

0

52

Суспензии из клещей H.morginatum, D.reticulatum

36

1

35

Всего

264

15

249

Примечания: для конструирования диагностической ИФА тест-системы”ВектоНил-антиген” для “захвата” антигена использовали очищенные МКА 9Е2; в качестве конъюгата применялись меченые пероксидазой хрена МКА 5Н6. Биологические образцы были собраны в очагах инфекции ЛЗН в Волгоградской области сотрудниками ООО ФГУЗ “ЦГ и Э в Волгоградской области”.

Применение моноклональных антител в диагностике цитомегаловирусной инфекции

Получение коллекции мышиных гибридом, продуцирующих МКА к рекомбинантному белку рр65 вируса герпеса человека 5 типа (ВГЧ-5, ЦМВ)

Очищенные частицы ЦМВ содержат от 30 до 40 полипептидов с молекулярной массой в диапазоне 20 - 300 кДа (S. Landolfo et al., 2003). В матриксном (тегументном) слое вириона расположены, предположительно, 25 белков (W. Gibson, 1996). В связи сэтим, провести отбор гибридом, продуцирующих МКА к белку рр65, при иммунизации животных нативным АГ, достаточно проблематично.

Для иммунизации мышей - доноров иммунных спленоцитов целенаправленно был использован рек. белок рр65, полученный в результате биосинтеза в клетках E.coli (И.М. Суслопаров и др., 2005). Исследование антигенных и иммуногенных свойств рек. белка рр65 не проводили, в связи с очевидностью этих характеристик. Ранее было описано применение кроличьих ПАТ, полученных к рек. белку рр65 для выявления продуктивной ЦМВИ в тканях сердца пациентов, после операции аортокоронарного шунтирования (М.А. Суслопаров и др., 2005). Кроме того, для формирования отечественной стандартной панели сывороток, содержащих и не содержащих АТ к ЦМВ человека, были использованы рек. белки - рр150, р52 и белок рр65 (С.Н. Ивченко, 2008).

В результате слияния и клонирования получены, тестированы и заложены на хранение в Банк гибридом ГНЦ ВБ “Вектор” (в жидком азоте) 11 гибридных клеточных линий, стабильно продуцирующих МКА, специфичных к рек. белку рр65.

Характеризация МКА, специфичных к рекомбинантному белку рр65 ЦМВ

Характеризацию АТ проводили методом ТИФА с использованием рек. белка и нативного вирусного АГ, полученного в виде лизата инфицированных клеток Vero. Определяли класс IgG, концентрацию АТ в очищенных препаратах и титры специфического взаимодействия с АГ. Результаты представлены в табл. 14. Все гибридные клетки продуцировали МКА класса IgG1,. взаимодействовали в ТИФА с рек. белком в диапазоне разведений от 1/24300 до 1/1968000, а с нативным вирусным белком в диапазоне от 1/1600 до 1/25600 и выявляли оба белка в ИБ. Наибольшую активность при взаимодействовии с вирусным белком рр65 в ТИФА проявляли МКА 5F10.

Таблица 14

Характеристика МКА, специфичных к рекомбинантному белку рр65 ЦМВ

п/п

Название

гибридомы

и МКА

Класс IgG

Титры МКА в ТИФА
(обратные величины)

к антигенам*

Концентрация очищенных МКА (мг/мл)

Иммуноблоттинг
с использованием
антигенов**

Рекомби-нантному

Нативному

Рекомби-нантного

Нативного

1

5F10

IgG1

1968000

25600

10,3

+

+

2

1F9/H11

IgG1

1968000

12800

8,7

+

+

3

1F9/E8

IgG1

1968000

12800

7,25

+

+

4

I/A

IgG1

218700

12800

7,0

+

+

5

I/G

IgG1

24300

3200

5,3

+

+

6

I/C5

IgG1

24300

1600

4,0

+

+

7

I/H

IgG1

24300

3200

4,7

+

+

8

I/В10

IgG1

24300

3200

6,0

+

+

9

I/D4

IgG1

24300

3200

4,5

+

+

10

II/H10

IgG1

1968000

12800

7,6

+

+

11

II/C12

IgG1

1968000

12800

8,1

+

+

Примечание: * В ТИФА для сенсибилизации планшетов использовали рек. рр65 с концентрацией 1 мкг/мл, а нативный АГ (лизат инфицированных клеток Vero) в разведении 1/20. ** В ИБ рекомбинантный и нативный белки использовали в объемах по 10 и  20 мкл на дорожку, соответственно.

Выявление вирусного белка рр65 в клетках, инфицированных цитомегаловирусом человека

Для исследований ЦМВ человека используют, главным образом, диплоидные фибробласты легкого эмбриона человека, так они переживают продуктивную инфекцию с характерным для этого вируса цитопатическим эффектом – округление, увеличение размеров, многоядерность (Н.Е. Федорова и др., 2005; Л.К. Эмралидзе и др., 2005). Было показано, что ЦМВ человека стимулирует клетки Vero к вступлению в фазу митоза. Инфицированные клетки Vero могут нормально завершать цикл деления, так как прирост числа клеток в этой популяции обычно не ниже уровня контрольных незараженных клеток. С помощью МКА показана экспрессия сверхраннего белка р72 ЦМВ в инфицированных клетках этого вида (Н.Е. Макарова, 1995).

Для оценки продуктивной ЦМВИ исследовали уровень синтеза белка рр65 в нескольких культурах клеток - L-68, Vero, RH и 293. Характерное ЦПД вируса (набухание и лизис) наблюдалось только на чувствительной культуре клеток L-68, остальные инфицированные культуры не отличались визуально от контрольных незараженных клеток. На рис. 22 приведены результаты ПААГ-ЭФ лизатов инфицированных клеток перечисленных выше культур.

Визуально белок рр65 в большом количестве присутствует во всех вирусных препаратах. Однако этот белок сложно отличить от сходного с ним по  молекулярной массе бычьего сывороточного альбумина (БСА, 66 кДа), содержащегося в ростовой среде от инфицированных клеток. Отмывание клеточного монослоя при получении лизатов не обеспечивает полного избавления от этого белка. В связи с этим, далее наличие специфического АГ в лизатах оценивали методом ИБ. На рисунке 23 видно, что очищенные МКА 5F10 активно выявляют нативный вирусный белок рр65 в препаратах, полученных при инфицировании ЦМВ разных культур клеток – Vero, RH и L-68.

Растворы меркаптоэтанола и SDS, использующиеся при выполнении процедуры ЭФ могут вызывать нарушение структуры вирусных белков. Для оценки эффективности взаимодействия полученных МКА с нативными вирусными белками, выращивали инфицированную культуру клеток Vero в лунках 96-луночного культурального планшета и спустя 7 суток клетки фиксировали на поверхности планшета этанолом. Инфицированные клетки обрабатывали очищенными МКА и антивидовыми антителами, меченными пероксидазой. Окрашивание проводили с использованием субстрата на основе 3-amino-9-ethylcarbazole. Результаты иммуноцитохимического анализа приведены на рис. 24. Видно, что МКА 5F10, специфичные к рек. белку рр65, интенсивно окрашивают нативный вирусный белок рр65 в виде мелких и крупных конгламератов в персистентно инфицированных клетках Vero.

Результаты исследования в ТИФА серий двукратных разведений герпесвирусных АГ показали, что применение МКА 5F10 позволяет определять рек. белок рр65 в концентрации 2,5 нг/мл  (на рис. 25). Вирусный АГ, приготовленный из лизата инфицированных клеток Vero, выявляется на порядок хуже, что пропорционально относительно небольшой доле целевого белка в общем массиве лизатных протеинов. В качестве отрицательных контролей в этих экспериментах использовали нативный ВПГ-2 (М.А. Суслопаров и др., 2004), так же приготовленный из лизата инфицированных клеток Vero, и рек. белок gG вируса ВПГ-2 (М.А. Суслопаров, 2009), который является типоспецифическим маркером для этого вируса. Исследованные МКА не вступали в перекрестные реакции ни с тем, ни с другим контрольным образцом, что свидетельствует об их типовой специфичности.

Проведенные эксперименты показали, что полученные МКА обладают высокой специфичностью и активностью, позволяющей эффективно применять их для ранней диагностики ЦМВИ.

К сожалению, отсутствие животной модели для ВГЧ–5 (ЦМВ) не позволяют исследовать протективное или лечебное действие полученных МКА. Но получение МКА может иметь потенциальное терапевтическое значение. Так как в настоящее время нет препаратов широкого антивирусного действия, идет активное исследование препаратов и подходов к лечению ЦМВИ. На том факте, что основной белок тегумента рр65 может самостоятельно доставляться из инфицированных клеток в ядра соседних клеток (S. Schmolke et al., 1995; С.С. Ряскина и др., 2006), может быть сконцентрирован подход антивирусной терапии против ЦМВИ. Есть данные о том, что рр65 оказывает негативное влияние на развитие интерферонового сигнала на начальных стадиях инфицирования после проникновения вируса в клетку, до начала синтеза остальных вирусных белков (E. Browne et al., 2003). Показан вакцинный потенциал белков ВГЧ-5, синтезированных альфавирусными репликонами, несущими гены белков IE1, gB и рр65 (E.A. Reap et al., 2007; M.R. Schleiss, 2008).

Рис. 22. Результаты электрофоретического

анализа белковых препаратов

1 – очищенный рек. белок рр65 (10 мкл);

2-5 - лизаты клеток Vero, RH, L68 и 293,

инфицированных ЦМВ (по 20 мкл на дорожку);

6 – препарат очищенных МКА 5F10 (1 мкл),

7 - белковые маркеры молекулярной массы (Bio-Rad).

Рис. 23 Результаты иммуноблоттинга белков ЦМВ в лизатах инфицированных клеток с применением

МКА 5F10, специфичных к рекомбинантному белку рр65

1,2,3 – Лизаты инфицированных ЦМВ клеток Vero, RH и L68,

соответственно (по 20 мкл на дорожку).

4 – Очищенный рек. белок рр65 (10 мкл)

(положительный контроль).

5 – Лизат клеток Vero, инфицированных вирусом простого герпеса 2 типа (отрицательный контроль).

6 - Значения молекулярной массы белковых маркеров.

МКА 5F10 использованы в разведении 1/500.

Рис. 24. Выявление белка рр65 в инфицированных клетках Vero иммуноцитохимическим окрашиванием с использованием МКА 5F10

  1. Не инфицированная культура клеток Vero (отрицательный контроль).
  2. Не инфицированная культура клеток Vero, обработанная МКА 5F10 (отрицательный контроль).
  3. Инфицированная ЦМВ культура клеток Vero, последовательно обработанная МКА 5F10 и конъюгатом антивидовых антител с пероксидазой.

Рис. 25. Результаты ТИФА серии двукратных разведений антигенов герпесвирусов

Примечания: ВПГ-2 - вирус простого герпеса 2 типа (М.А. Суслопаров и др., 2004);

рек.gG – рек. белок gG ВПГ-2 (М.А. Суслопаров, 2009);

МКА 5F10 использованы  в концентрации 2 мкг/мл.

ВЫВОДЫ

    1. Создана оригинальная панель моноклональных антител (МКА), специфичных к вирусу Марбург (штамм Рорр). Получены очищенные препараты, специфичные к внутренним структурным белкам вириона - к кофактору вирусной полимеразы (белку VP35) - 3 вида, к нуклеопротеину - 3 вида, к матриксному белку VP40 - 9 видов, для одного вида МКА линейные эпитопы не определяются.
    2. Создана оригинальная панель МКА, специфичных к вирусу Эбола-Заир (штамм Mayinga). Получены очищенные препараты, специфичные к белку VP35 (2 вида), к нуклеопротеину (10 видов), к матриксному белку VP40 – 9 видов.
    3. Показано, что рекомбинантные белки GP, VP24, NP, VP40 и VP35 филовирусов сохранили антигенную структуру, характерную для аналогичных вирусных белков, и в связи с этим, они могут быть успешно использованы для иммунодиагностики филовирусных инфекций. 
    4. Установлено, что использование комбинации рекомбинантных белков GP, NP, VP35 и VP40 в качестве антигена повышает чувствительность твердофазного иммуноферментного анализа по сравнению с применением в качестве антигена инактивированного очищенного вируса Марбург.
    5. Показано, что полученные МКА и рекомбинантные белки NP, VP40 и VP35 могут быть успешно использованы для совершенствования иммунодиагностики заболеваний, вызываемых вирусами Марбург и Эбола.

Это позволило: 

- предложить новый способ выявления белка VP40 вируса Марбург методом двухцентрового ИФА с использованием двух типов неконкурирующих МКА 7D8 и 7H10.

– разработать новый способ выявления белка VP35 вируса Марбург при помощи иммуноферментного анализа на основе одного типа МКА 3F9, которые можно одновременно использовать как в качестве “захватывающих антиген”, так и в качестве “индикаторных” антител.

- создать оригинальный способ выявления нуклеопротеина вируса Эбола методом двухцентрового ИФА с использованием двух типов МКА 1В2 (мышиного происхождения) и 7В11 (крысиного происхождения).

– разработать метод выявления белка VP40 вируса Эбола на основе двухцентрового ИФА и двух типов оригинальных МКА 4А2 и 1С1.

7. Создана оригинальная панель из 15-ти очищенных препаратов МКА, специфичных к российскому штамму вируса Западного Нила (штамм LEIV-VLG99-27889-human). Сконструирована лабораторная тест-система ИФА на основе двух типов МКА 9Е2 и 5Н6, для выявления антигена вируса Западного Нила. Гибридная клеточная линия 9Е2, продуцирующая одноименные высокоактивные вируснейтрализующие МКА широкой специфичности (против всех штаммов ВЗН), защищена патентом РФ № 2265658. 

8. На основе лабораторной тест-система ИФА совместно ЗАО “Вектор-Бест” разработана и начато производство экспериментальной тест-системы “ВектоНил-антиген”. Показано ее высокая эффективность для эпидемиологического исследования циркуляции вируса Западного Нила в природных очагах этой инфекции.

9. Создана оригинальная коллекция из 11 мышиных гибридных клеточных линий, продуцирующих МКА, специфичные к рекомбинантному белку рр65 вируса герпеса человека 5 типа (цитомегаловируса человека). Показана способность МКА, специфичных к рекомбинантному белку рр65, высокоэффективно выявлять вирусный матриксный белок рр65 - маркер острой цитомегаловирусной инфекции человека в различных типах клеток.

Список работ, опубликованных по теме диссертационной работы

1. Разумов И.А., Беланов Е.Ф., Букреев А.А., Казачинская Е.И. Моноклональные антитела к белкам вируса Марбург и их иммунохимическая характеризация. // Вопросы вирусологии. - 1998. - № 6. - С. 274-279. (Список ВАК).

2. Сорокин А.В., Казачинская Е.И., Качко А.В., Иванова А.В., Букреев А.А., Разумов И.А.. Сравнительное исследование антигенных и иммуногенных свойств природного и рекомбинантного белков VP35 вируса Марбург. // Вопросы вирусологии. - 1999. - № 5. - С. 206-213. (Список ВАК).

3. Казачинская Е.И., Перебоев А.В., Чепурнов А.А., Беланов Е.Ф., Разумов И.А. Моноклональные антитела к вирусу Эбола: получение, характеризация и изучение перекрестной реактивности с вирусом Марбург. // Вопросы вирусологии. - 2000. - № 3. - С. 40-44. (Список ВАК).

4. Разумов И.А., Беланов Е.Ф., Бормотов Н.И., Казачинская Е.И. Выявление противовирусной активности моноклональных антител, специфичных к белкам вируса Марбург. // Вопросы вирусологии. - 2001. - № 1. - С. 33-37. (Список ВАК).

5. Казачинская Е.И., Терновой В.А., Рудзевич Т.Н., Нетесов С.В., Чепурнов А.А., Разумов И.А. Исследование антигенной структуры белка VP35 вируса Эбола. // Вопросы вирусологии. - 2001. - № 5. - С. 25-31. (Список ВАК).

6. Качко А.В., Чеусова Т.Б., Сорокин А.В., Казачинская Е.И., Чешенко И.О., Беланов Е.Ф., Букреев А.А., Иванова А.В., Разумов И.А, Рябчикова Е.И., Нетесов С.В. Сравнительное изучение морфологии и антигенных свойств рекомбинантных аналогов нуклеопротеина вируса Марбург. // Молекулярная биология. - 2001. - № 3. - С. 1-8. (Список ВАК).

7. Sorokin A.V., Kazachinskaya E.I., Ivanova A.V., Kachko A.V., Netesov S.V., Bukreev A.A., Loktev V.B., and Razumov I.A. *. Mapping of two dominant sites of VP35 Marburg virus. // Viral Immunology. – 2002. - Vol.15. - № 3. – Р. 481-92. (Список ВАК).

8. Cheusova T., Kachko A., Kazachinskaya E., Chechenko I., Razumov I., Netesov S., Ryabchikova E. Studies of the expression of Marburg virus recombinant nucleoprotein. / Ultrastructual Microskopy. – 2002. - № 4. - С. 26-27. (Список ВАК).

9. Рудзевич Т.Н., Терновой В.А., Казачинская Е.И., Разумов И.А., Чепурнов А.А., Локтев В.Б., Нетесов С.В. Выявление антигенных детерминант на N – конце белка VP35 вируса Эбола с помощью коротких рекомбинатных фрагментов этого белка. // Молекулярная генетика, микробиология и вирусология. – 2003. - № 2. - С.38-41. (Список ВАК).

10. Razumov IA, Kazachinskaia EI, Ternovoi VA, Protopopova EV, Galkina IV, Gromashevskii VL, Prilipov AG, Kachko AV, Ivanova AV, L”vov DK, Loktev VB. / Neutralizing monoclonal antibodies against Russian strain of the west nile virus. // Viral Immunol. – 2005. - Vol. 18. - № 3. – P. 558-68. (Список ВАК).

11. Распопин В.В., Разумов И.А., Казачинская Е.И., Протопопова Е.В., Локтев В.Б., Топычканова Н.Г., Жуков В.А., Жукова Н.Г., Павленко Е.В., Леонова Г.Н., Смердова М.А., Гришаев М.П.. Индекс авидности специфических IgG в диагностике заболеваний, вызванных вирусами Западного Нила и клещевого энцефалита. // Клиническая лабораторная диагностика. - 2007. - № 4 - C. 29-32. (Список ВАК).

12. Alexander Pereboev, Viktoriya Borisevich, George Tsuladzea, Mikhail Shakhmatov, Debora Hudman, Elena Kazachinskaia, Ivan Razumov, Viktor Svyatchenko, Valery Loktev and Vladimir Yamshchikov. Genetically delivered antibody protects against West Nile virus. // Antivirol Research. – 2008. – Vol. 77. - № 1. – Р. 6-13. (Список ВАК).

13. Казачинская Е.И., Иванова А.В., Сорокин А.В., Качко А.А., Субботина Е.Л., Разумов И.А., Локтев В.Б. Моноклональные антитела и рекомбинантные белки филовирусов. Иммунохимические свойства и оценка возможности их использования для иммунодиагностики. // Медицинская иммунология. - 2010.-  № 3. - Том 12. - С. 177-190. (Список ВАК).

Публикации в материалах конференций

  1. I.A.Razumov, E.F. Belanov, A.A. Bukreev, E.I. Kazachinskaia & N.I. Bormotov. Properties and protective capacity of monoclonal antibodies to Marburg virus. // Xth international congress of virology, Jerusalem, Israel. - 1996. - Abstract Book. - PW60-45. - P. 260.
  2. I.A. Razumov, E.I Kazachinskaia, E.F. Belanov, A.A. Chepurnov. Mabs to filoviruses: properties, antigenic specificity, and their utility in detecting filoviral antigens. // Russian - German colloquium on filoviruses: the modern state of problem. Koltsovo, Novosibirsk region, Russia. - 1997. - Abstract Book. - P. 13.
  3. I.A. Razumov, E.I Kazachinskaia, E.F. Belanov, A.V. Kachko, A.V. Sorokin. Monoclonal antibodies against Filoviruses. // 6th Biological Medical Defence Conference, Munchen. - 1999.
  4. I.A. Razumov, E.I Kazachinskaia, E.F. Belanov, A.V. Kachko, A.V. Sorokin. Monoclonal antibodies against Filoviruses: Characterization of viral and recombinant proteins. // Inauguration of the Swedish Containment Laboratories, Stocgolm. - 2000.
  5. Разумов И.А., Казачинская Е.И., Беланов Е.Ф., Качко А.В., Сорокин А.В. Использование моноклональных антител и рекомбинантных белков для создания новых систем для выявления вируса Марбург. // Крым, Гурзуф. - 2001. - Cборник тезисов. - С. 130.
  6. Казачинская Е.И., Терновой В.А., Перебоев А.В., Разумов И.А. Моноклональные антитела к вирусу Эбола: свойства и использование для выявления вирусных антигенов. /. Крым, Гурзуф. - 2001. Cборник тезисов. – С.  133.
  7. И.А. Разумов, Е.И. Казачинская, Е.Ф. Беланов, А.В. Качко. Использование моноклональных антител и рекомбинантных белков для выявления вируса Марбург. // г. Пущино 2001. - Тезисы докладов. - С. 142.
  8. А.В. Качко, А.В. Сорокин, Е.И. Казачинская, А.В. Иванова, Е.Ф. Беланов, И.А. Разумов, А.А. Букреев, P. Collins, Нетесов С.В. // г. Пущино 2001. - Тезисы докладов. - С. 140.
  9. I.A. Razumov, A.V. Sorokin, E.I. Kazachinskaia, A.V. Ivanova, A.V. Kachko, S.V. Netesov,  A.A. Bukreyev, V.B. Loktev, Mapping of Two Dominant Sites of VP35 of Marburg Virus. // In “The world of microbes. XIIth International Congress of Virology, 27 July – 01 August, Paris. – 2002. - Abstract Book. - P. 460
  10. I.A. Razumov, E.I. Kazachinskaia, E.V.Protopopova, I.V. Galkina*, V.L. Gromashevskii*, A.G. Prilipov*, D.K. L'vov*, and V.B. Loktev Neutralizing Monoclonal Antibodies Against European Strain of the West Nile Virus. // In Seventh International Symposium on Positive Strand RNA viruses, May 27 – June 01, 2004. - San Francisco. - Abstract Book. - P. 102
  11. I.A. Razumov, E.I. Kazachinskaia, E.V.Protopopova, I.V. Galkina, V.L. Gromashevskii, A.G. Prilipov, D.K. L'vov, and V.B. Loktev, Neutralizing Monoclonal Antibodies Against European Strain of the West Nile Virus. Health Canada Science Forum, October 18-19, 2004. Ottawa, Ontario. 
  12. Распопин В.В. Разумов И.А., Казачинская Е.И., Протопопова Е.В., Локтев В.Б., Жуков В.А., Смердова М.А., Гришаев М.П. Изменение авидности вирусспецифических IgG человека при лихорадке Западного Нила. Оценка возможности использования индекса авидности IgG для диагностики. // Всероссийская научно-практическая конференция “Современная ситуация и перспективы борьбы с клещевыми инфекциями в XXI веке”, г. Томск, 14-15 февраля 2006 г. - Тезисы докладов. - С. 114-115. 
  13. Распопин В.В. Разумов И.А., Казачинская Е.И., Протопопова Е.В., Локтев В.Б., Жуков В.А., Смердова  М.А., Гришаев М.П. Использование теста на авидность IgG для дифференцировки заболеваний, вызванных вирусами Западного Нила и  клещевого энцефалита. // Всероссийская научно-практическая конференция “Современная ситуация и перспективы борьбы с клещевыми инфекциями в XXI веке”, Томск, 14-15 февраля 2006 г. - Тезисы докладов. - C. 112-113 
  14. Распопин В.В. Смердова М.А., Гришаев М.П. Топычканова Н.Г., Разумов И.А., Казачинская Е.И., Протопопова Е.В., Локтев В.Б., Жукова Н.Г., Леонова Г.Н. Индекс авидности специфических IgG в дифференциальной диагностике заболеваний, вызванных вирусами Западного Нила и клещевого энцефалита. // III Российская научная конференция с международным участием “Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера”, г. Новосибирск  27-29 сентября, 2006 г. - Тезисы докладов. – С. 210-211.
  15. Распопин В.В. Шварева О.А., Шумакевич Г.В., Казачинская Е.И., Протопопова Е.В., Разумов И.А., Локтев В.Б., Гришаев М.П. Мониторинг вируса Западного Нила в Волгоградской области в 2006 г. // Дальневосточный Журнал Инфекционной Патологии (ДЖИП) 2007. - № 11. - С. 145.
  16. A. Pereboev, V. Borisevich, G. Tsuladze, M. Shakhmatov, D. Hudman, E. Kazachinskaia, I. Razumov, V. Svyatchenko, V. Yamshchikov, V. Loktev. Genetically delivered antibody protects against West Nile virus, XIV International Congress of Virology, 10-15 August 2008, Istanbul. - Abstract Book. – Р. 24-25.
  17. Казачинская Е.И. Разумов И.А. Локтев В.Б. Использование моноклональных антител для выявления вируса Западного Нила в DAS-ELISA. // Всероссийская конференция “Диагностика, лечение и профилактика опасных и особо опасных инфекционных заболеваний. Биотехнология” посвященная 80-летию 48 Центрального научно-исследовательского института Министерства обороны РФ 20 – 21 ноября 2008 г.
  18. Перебоев А.В., Borisevich V., Tsuladze G., Shakhmatov M.,  Hudman D., Казачинская Е.И., Разумов И.А., Святченко В.А., Ямщиков В.А., Локтев В.Б.  Генная терапия флавивирусных инфекций на примере лихорадки Западного Нила. // Научная конференция “Медицинская геномика и протеомика”, Новосибирск, ИХБФМ СО РАН, 9-13 сентября 2009, г. Новосибирск. - Тезисы докладов. - С. 30
  19. Казачинская Е.И., Иванова А.В., Сорокин А.В., Качко А.А., Субботина Е.Л., Разумов И.А., Локтев В.Б. Моноклональные антитела и рекомбинантные белки филовирусов. Иммунохимические свойства и оценка возможности их использования для иммунодиагностики. // Международная научно-практическая конференция “Современные проблемы инфекционной патологии человека”. г. Минск, 2009. - Cборник научных трудов. – С. 277-280.
  20. Казачинская Е.И., Суслопаров М.А. Локтев В.Б. Получение моноклональных антител, специфичных к иммунодоминатному району рекомбинантного белка рр65 цитомегаловируса человека. // Международная научно-практическая конференция “Современные проблемы инфекционной патологии человека”. г. Минск, 2009. - Cборник научных трудов. – С. 275-277.

Патенты

1. Сорокин А.В., Разумов И.А., Казачинская Е.И., Качко А.В., Иванова А.В., Мишин В.П., Букреев А.А., Локтев В.Б., Нетесов С.В. Рекомбинантная плазмидная ДНК pQ_f35M, кодирующая гибридный полипептид f35M, обладающий антигенными и иммуногенными свойсвами белка VP35 вируса Марбург, способ ее получения, и штамм бактерий Esherichia coli сверхпродуцент рекомбинантного полипептида f35М. // Патент РФ № 21445665, приоритет изобретения от 12.11.1998. Опубликован 20.01.2000 в БИ № 2.

  1. Казачинская Е.И. Алексеенко Т.П. Разумов И.А. Протопопова Е.В. Локтев В.Б. Штамм гибридных клеток животного Mus musculus L. НИИМБ-280 (9Е2) – продуцент моноклональных антител к белку Е вируса Западного Нила. // Патент РФ № 2265658, приоритет изобретения от 09.01.2004. Опубликован 10.12.2005 в БИ № 34.
  2. Казачинская Е.И., Сорокин А.В., Иванова А.В., Качко А.В., Беланов Е.Ф., Разумов И.А., Локтев В.Б. Штамм гибридных клеток животного Mus musculus L. 3F9 – продуцент моноклональных антител, пригодных для использования в иммуноферментной системе формата “сэндвич” для выявления белка  VP35 вируса Марбург и моноклональные антитела 3F9, продуцируемые указанным штаммом гибридных клеток. // Патент РФ № 2393220, приоритет изобретения от 15.12.08. Опубликован 27.06.2010 в БИ № 18.
  3. Казачинская Е.И., Сорокин А.В., Иванова А.В., Качко А.А., Беланов Е.Ф., Разумов И.А., Локтев В.Б. Штамм гибридных клеток животного Mus musculus L. – продуцент моноклональных антител для выявления белка VP40 вируса Марбург (штамм Рорр) (варианты), моноклональное антитело, продуцируемое штаммом (варианты), набор для иммуноферментной системы формата “сэндвич” для выявления матриксного белка VP40 вируса Марбург (штамм Рорр). // Патент РФ № 2395575, приоритет изобретения от от 15.12.08. Опубликован 27.07.2010 в БИ № 21.
  4. Казачинская Е.И., Перебоев А.В., Иванова А.В., Качко А.А., Субботина Е.Л., Чепурнов А.А., Разумов И.А., Локтев В.Б. / Штамм гибридных клеток животного Mus musculus L. 1В2 - продуцент моноклональных антител для выявления нуклеопротеина вируса Эбола, субтип Заир (штамм Mainga) (варианты), моноклональное антитело, продуцируемое штаммом (варианты), набор для иммуноферментной системы формата “сэндвич” для выявления нуклеопротеина вируса Эбола, субтип Заир (штамм Mainga). // Патент РФ № 2395576, приоритет изобретения от от 16.12.08. Опубликован 27.07.2010 в БИ № 21.
  5. Казачинская Е.И., Иванова А.В., Качко А.А., Субботина Е.Л., Чепурнов А.А., Разумов И.А., Локтев В.Б. Штамм гибридных клеток животного Mus musculus L. – продуцент моноклональных антител для выявления белка VP40 вируса Эбола, субтип Заир (штамм Mainga) (варианты), моноклональное антитело, продуцируемое штаммом (варианты) и набор для иммуноферментной системы формата “сэндвич” для выявления белка VP40 вируса Эбола, субтип Заир (штамм Mainga). // Патент РФ № 2395577, приоритет изобретения от от 18.12.08. Опубликован 27.07.2010 в БИ № 21.
  6. Казачинская Е.И.,  Cуслопаров М.А.,  Локтев В.Б. Штамм гибридных клеток животного Mus musculus L. 5F10 – продуцент моноклональных антител, используемых для выявления белка рр65 цитомегаловируса человека”. // Патент РФ № 2393219, приоритет изобретения от от 15.12.08. Опубликован 27.06.2010 в БИ № 18.

Список использованных сокращений

АГ - антиген

АТ – антитела

а.о. – аминокислотное основание

АС – антисыворотка

БОЕ – бляшкообразующие единицы

ВЭ - вирус Эбола

ВМ - вирус Марбург

ВЗН – вирус Западного Нила

ВГЧ-5 - вирус герпеса человека 5 типа (цитомегаловирус человека)

ВПГ-2 - вирус простого герпеса 2 типа

ВКЭ – вирус клещевого энцефалита

ВЦ НИИМ МО РФ – Вирусологический Центр НИИ микробиологии Министерства Обороны РФ (г. Сергиев Посад)

ГЛЭ – геморрагическая лихорадка Эбола

ГЛМ - геморрагическая лихорадка Марбург

ИФА - иммуноферментный анализ

ИБ – иммуноблоттинг

ИХКГ СО РАН – Институт Химической Кинетики и Горения Сибирского отделения Российской Академии Наук

КИФА – конкурентный ИФА

ЛЗН – лихорадка Заадного Нила

МКА - моноклональные антитела

OП – оптическая плотность

ОФД - орто-фенилендиамин

ПАТ - поликлональные антитела

ПААГ - полиакриламидный гель

ПААГ-ЭФ – электрофорез в ПААГ

рук. – руководитель

НИИ ЭМ – НИИ эпидемиологии и микробиологии (Беларусь, г. Минск);

рек. белок - рекомбинантный белок

ТИФА – твердофазный ИФА

ТСБ – трис-солевой буферный раствор

ТСБ-Т - трис-солевой буферный раствор с твином

ТМБ – тетраметилбензидин

ФГУЗ РосНИИПЧИ “Микроб” – Федеральное  государственное учреждение здравоохранения Российский научно-исследовательский противочумный институт “Микроб”

ФСБ - фосфатно-солевой буферный раствор

ФБС - фетальная бычья сыворотка

ЦМВ – цитомегаловирус

ЦМВИ – цитомегаловирусная инфекция

ЦПД – цитопатическое действие

IgG – иммуноглобулин класса G

IgM- иммуноглобулин класса М

GP – гликопротеин (основой структурный белок оболочки филовируса

NP – нуклеопротеин (основой структурный белок нуклеокапсида филовируса)

SDS – додецилсульфат натрия

RH – клетки почки эмбриона человека

L-68 – диплоидные клетки легкого эмбриона человека

Vero – клетки почки африканской зеленой мартышки

VP40 – матриксный белок филовируса

VP35 – структурный белок филовируса (кофактор вирусной полимеразы)

VP24 – белок оболочки филовируса

Благодарности

Автор выражает благодарность всем коллегам за поддержку данной работы и за сотрудничество: научному консультанту д.б.н., профессору Локтеву В.Б., д.б.н. Разумову И.А., к.б.н. Качко А.В., н.с. Ивановой А.В., к.б.н. Субботиной Е.Л., д.б.н., профессору Нетесову С.В., к.б.н. Перебоеву А.В., н.с. Сорокину А.В., зав. лаб. ЗАО “Вектор-Бест” Распопину В.В., ст. лаборанту ЗАО “Вектор-Бест” Алексеенко Т.П. За предоставленные для исследования препараты: д.б.н. Чепурнову А.А. за инактивированный вирус Эбола и сыворотку крови иммунизированного кролика, к.б.н. Беланову Е.Ф. за инактивированный вирус Марбург, к.б.н. Терновому В.А. за рекомбинантный белок VP35 вируса Эбола, к.б.н. Протопоповой Е.В. за инактивированные препараты вирусов клещевого и японского энцефалитов, д.м.н. Суслопарову М.А. за нативные герпесвирусы (5 и 2 типов) и рекомбинантный белок рр65 ВГЧ-5, зав. лаб. вирусологии флавивирусов к.б.н. Святченко В.А. и с.н.с. Киселеву Н.Н. за ценную консультативную помощь при работе с инфекционными вирусами, ведущего инженера Соколову Н.А. за помощь при очистке вируса Западного Нила, ст. лаборанта Черникову Л.А. за техническую помощь, ст. лаборанта Чичакову Г.Н. за работу с животными.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.