WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

Агафонов Александр Петрович

Получение антигенов и использование их для разработки средств диагностики и профилактики вирусных инфекций

03.01.06 – биотехнология

03.02.02 - вирусология

Автореферат диссертации

на соискание ученой степени доктора биологических наук

Новосибирск, 2010

Работа выполнена в Федеральном государственном учреждении науки Государственный научный центр вирусологии и биотехнологии «Вектор» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека Минздравсоцразвития России

Научный  консультант

доктор медицинских наук,

профессор Дроздов Илья Геннадиевич

Официальные оппоненты:

доктор биологических наук Аликин Юрий Серафимович

доктор медицинских наук,

профессор  Носик Дмитрий Николаевич

доктор медицинских наук,

профессор Трунов Александр Николаевич

Ведущая организация

Филиал Федерального Государственного Учреждения
«48 Центрального Научно-Исследовательского Института Министерства Обороны Российской Федерации» – «Вирусологический Центр», Московская область, г. Сергиев Посад-6

Защита состоится «  24 » декабря  2010 г. в______часов на заседании диссертационного совета Д.208.020.01 при ФГУН Государственный научный центр вирусологии и биотехнологии «Вектор» по адресу: ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора, Кольцово Новосибирской области, 630559, тел. (383)336-74-28.

С диссертацией можно ознакомиться в библиотеке ФГУН ГНЦ ВБ «Вектор»

Автореферат разослан «____»______________2010 г.

Ученый секретарь диссертационного совета д.б.н. Г.П. Трошкова

ОБЩАЯ ХАРАКТЕРИСТИКА ИССЛЕДОВАНИЯ

Актуальность проблемы. Борьба с инфекционными заболеваниями – одна из наиболее актуальных и приоритетных задач современного здравоохранения. Болезни, вызываемые инфекционными агентами, во многих странах являются главной причиной преждевременной смерти. Смертность от инфекционных заболеваний характерна, главным образом, для населения развивающихся стран, однако и в странах с высоким уровнем здравоохранения мероприятия по снижению уровня инфекционных заболеваний входят во все национальные программы социальной и медицинской направленности (WHO, 2008; WHO, 2009).

Реализация программы искоренения натуральной оспы, успехи в борьбе с полиомиелитом и корью доказывают возможность эффективной борьбы и даже полной элиминации инфекционного заболевания. Проверенный практикой комплексный подход, включающий в себя сочетание профилактики и эпидемиологического контроля, становится условием борьбы с инфекционным заболеванием и залогом успеха. При этом крайне важно на первых этапах исследования получить сам этиологический агент и его антигенные компоненты и изучить их структурно функциональные и иммунобиологические свойства.

На сегодняшний день корь, наряду с малярией, туберкулезом, ВИЧ/СПИД, холерой, эпидемическим паротитом, краснухой, остается наиболее распространенным инфекционным заболеванием в мире (WHO, 2008; WHO, 2009). Программой ВОЗ определена задача усиления надзора над заболеванием и ликвидации кори.

Приказами МЗ РФ от 19.08.2002 № 270 «Об утверждении программы ликвидации кори на территории Российской Федерации к 2010 году» 21.03.2003 № 117 «О реализации "Программы ликвидации кори в Российской Федерации к 2010 году"» в рамках программы ВОЗ усиления надзора над заболеванием и ликвидации кори была принята национальная программа элиминации кори. Для ее успешной реализации организованы работы по молекулярно-эпидемиологическому мониторингу за инфекцией и разрабатываются эффективные тест-системы для подтверждения случаев заболевания и серомониторинга кори в России. В 2009 заболеваемость корью в РФ снизилась до уровня менее 1 случая на 1 млн. населения, что позволило 2010 году завершить национальную Программу ликвидации кори, и начать процедуру подготовки сертификации территорий для документального подтверждения статуса субъектов РФ как территорий, свободных от эндемичной кори (Гос. доклад «О санитарно-эпидемиологической обстановке в РФ в 2009 году», 2010; Приказ Роспотребнадзора №308, 2010).

С одной стороны это подтверждает эффективность мероприятий вакцинопрофилактики в борьбе с инфекциями, с другой – указывает на незащищенность населения от других вирусных инфекций, средства профилактики для которых еще не разработаны. Неконтролируемые инфекции представляют биологическую опасность для России и с точки зрения возможного завоза на территорию эндемичных вирусов при расширяющихся экономических и туристических связях в мире, и с точки зрения умышленного использования инфекционного агента. Особую опасность для человека из-за своей высокой контагиозности и патогенности представляют возбудители вирусных геморрагических лихорадок. Вирусы, вызывающие заболевания с геморрагическим синдромом, относятся главным образом к четырем семействам: Filoviridae, Arenaviridae, Bunyaviridae и Flaviviridae. К наиболее опасным, с точки зрения последствий для не эндемичных территорий, можно отнести представителей семейства Filoviridae – вирусы Марбург и Эбола, летальность от которых составляет 80-90 %. Если учесть увеличение скорости передвижение людей, использующих современные виды транспорта, расширяющиеся связи между государствами, а также высокую контагиозность вирусов, вызывающих геморрагические лихорадки, то опасность заноса инфекции на не эндемичные территории и возникновение там вспышек с серьезными последствиями становится вполне реальной. Следует учитывать, что для многих возбудителей геморрагических лихорадок четко не определены ни ареалы распространения, ни резервуары инфекции, ни переносчики и способ передачи. В настоящее время для борьбы с этими инфекциями не разработаны эффективные средства профилактики и лечения.

Цель работы - получение вирусных антигенов и изучение их иммунобиологических свойств для разработки средств диагностики и профилактики вирусных инфекций: геморрагической лихорадки Марбург, кори и эпидемического паротита.

Задачи исследования:

  1. Разработка технологии получения очищенных вирусов из культуральной вируссодержащей жидкости с целью получения антигенов для изучения иммуногенных свойств или разработки современных ИФА-тест-систем в соответствии с принципами обеспечения биологической безопасности в вирусологических лабораториях.
  2. Получение антигенов вируса Марбург, изучение их иммуногенных и протективных свойств и определения антигенов, перспективных для создания вакцины против геморрагической лихорадки Марбург.
  3. Оценка перспективности современных подходов к созданию профилактических препаратов против кори – изучение иммуногенности экспериментального препарата на основе живого вируса кори при пероральном его применении и ДНК-вакцины.
  4. Выделение и изучение циркулирующих на территории России вирусов кори и паротита с целью слежения за их антигенной и генетической изменчивостью и создания на их основе диагностических ИФА-тест-систем.

Научная новизна и практическая значимость работы

Разработана и запатентована технология получения вирусных антигенов для создания профилактических и диагностических препаратов (патенты RU2029561C1, RU2230785C2, RU2348691C1). Получены и охарактеризованы по иммуногенным и протективным свойствам структурные белки вируса Марбург, которые могут быть использованы при разработке диагностических и профилактических препаратов против геморрагической лихорадки Марбург. Показана принципиальная возможность создания удобного в применении и более простого с точки зрения организации профилактических мероприятий варианта коревой вакцины – препарата для перорального применения. В рамках реализации программы глобальной ликвидации кори разработаны эффективные ИФА-тест-системы для диагностики кори и проведения мероприятий по серомониторингу заболевания, а также изучены антигенные свойства циркулирующих на территории Западной Сибири генотипов вируса. Впервые в РФ разработана и внедрена в практику здравоохранения тест-система иммуноферментная для определения антител класса G к вирусу кори, позволяющая оценить содержание антител класса G в международных единицах. Впервые в РФ разработана тест-система иммуноферментная для определения антител класса М к вирусу кори. Исследования по серомониторингу заболевания позволили выявить возрастные группы населения, наиболее подверженные опасности заболевания корью. Подтверждено генетическое и антигенное родство новых генотипов вируса кори и вируса паротита с вакцинными штаммами, используемыми для программы вакцинопрофилактики этих заболеваний. Впервые показана циркуляция генотипа D6 вируса кори и генотипов C и H вируса паротита на территории РФ.

Штамм Popp вируса Марбург депонирован в Государственной коллекции вирусов (Институт вирусологии им. Д.И. Ивановского РАМН) под номером ГКВ N 946 от 20 января 1993 г. Штамм рекомендован для производства диагностических и вакцинных препаратов. Штаммы вирусов кори и паротита депонированы в коллекции микроорганизмов ГНЦ ВБ Вектор (штамм «НовО/96» вируса кори – VB-04, штамм «Драгун» вируса паротита – VB-05, штамм «ПетроНов» вируса паротита – V-330) и использованы для получения антигена – основного компонента ИФА-тест-системы.

Апробация работы

Результаты исследований были доложены: на международной конференции "Медицина, биотехнология, иммунизация и СПИД" (Ленинград, 1991), международном симпозиуме "100 лет вирусологии" (Москва, 1992), международной конференции 100-летие вирусологии (Санкт-Петербург, Россия, 1992), IX (Глазго, 1993), X (Иерусалим, 1996), XII (Париж, 2002) международных вирусологических конгрессах, 2-й, 3-й и 4-й международных конференциях «Новые направления в развитии вакцин» (Вена, Австрия, 1995, 1997, 1999 гг.), международной конференции «Вирусы Марбург и Эбола» (Марбург, Германия, 2000), 11-м международном конгрессе по инфекционным заболеваниям (Канкун, Мексика, 2004), IX международной конференции «Новые технологии в медицине и экологии» (Гурзуф-Ялта, 2001), международном конгрессе «Ликвидация и элиминация инфекционных болезней – прогресс и проблемы» (Санкт-Петербург, 2003), международной конференции по медико-биологическим исследованиям (Мюнхен, 2004), Азиатском конгрессе по аэрозолям (Гонконг, 2004), VI межгосударственной научно-практической конференции «Санитарная охрана территорий государств – участников Содружества Независимых Государств: проблемы биобезопасности и противодействия биотерроризму в современных условиях» (Волгоград, 2005), IX Съезде Всероссийского научно-практического общества эпидемиологов, микробиологов и паразитологов (Москва, 2006), II и III Российских научных конференциях с международным участием «Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера» (Новосибирск, 2002 и 2006), международной научно-практической конференции «Биотехнология в Казахстане: проблемы и перспективы инновационного развития» (Алматы, Республика Казахстан, 2008).

Работа выполнена в 1990–2009 годах в ГНЦ ВБ "Вектор" в рамках научных тем организации и по грантам МНТЦ (1035В, 2168). Работы по оценке иммуногенности живой коревой вакцины при пероральной аппликации были проведены в лаборатории профессора A.D.M.E. Osterhaus (Университет им. Э. Роттердамского, Роттердам, Нидерланды). Изучение штамма НовО/96 вируса кори было проведено в лаборатории кори и краснухи д-ра E. Gerike (Институт им. Р. Коха, Берлин, Германия). Основные положения, выводы и практические предложения диссертации были обсуждены и одобрены на заседании проблемно-тематической комиссии «Эпидемиология, вирусология и диагностика особо опасных вирусных инфекций» ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора (2010).

Основные положения, выносимые на защиту

  1. Белок NP вируса Марбург обладает выраженными иммуногенными свойствами и вызывает образование вирусспецифических антител и развитие клеточного иммунитета, формируя протективный иммунный ответ при введении лабораторным животным.
  2. Вакцинный штамм вируса кори способен вызывать формирование специфического гуморального и клеточного иммунного ответа у лабораторных животных при пероральном применении.
  3. Введение лабораторным животным ДНК-вакцины на основе гемагглютинина вируса кори приводит к формированию специфического гуморального и клеточного иммунного ответа.
  4. Наибольший процент лиц, не имеющих протективных антител к вирусу кори, входит в возрастную категорию населения РФ от 16 до 25 лет.
  5. Циркулирующие на территории РФ в период с 1993 по 2001 гг. вирусы кори и паротита находятся в близком антигеном родстве с вакцинными штаммами, используемыми для программы вакцинопрофилактики.

Публикации результатов исследований

По теме диссертации опубликовано 31 научная статья, в том числе 23 статьи в ведущих научных журналах, рекомендованных ВАК Минобразования и науки Российской Федерации, 3 монографии, 1 методические указания. Получено 4 патента Российской Федерации.

Внедрение результатов исследований

Предложены и апробированы методы получения вирусных антигенов, послужившие основой для разработки средств диагностики в рамках выполнения Федеральной целевой программы «Национальная система химической и биологической безопасности Российской Федерации (2009-2013 годы)».

Внедрена в практику здравоохранения тест-система иммуноферментная для определения антител класса G к вирусу кори с представлением содержания антител в международных единицах. Совместно с ЗАО «Медико-биологический союз» выпущено и поставлено потребителям 8 серий тест-системы «Корь-IgG-ДС», достаточных для проведения более 80 000 анализов.

Материалы диссертации используются, в том числе и в учебно-образовательном процессе при проведении курсов повышения квалификации специалистов микробиологических лабораторий Министерства здравоохранения и социального развития РФ и Министерства сельского хозяйства РФ на базе в ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора.

Структура и объем работы

Диссертация изложена на 334 страницах машинописного текста, включает 46 таблиц и 57 рисунков и содержит следующие разделы: введение, обзор литературы, материалы и методы, результаты и обсуждение, заключение, выводы и список литературы, содержащий 380 работ отечественных и зарубежных авторов.

Материалы и методы исследований

В работе использовали вирус Марбург (штамм Рорр), полученный из БелНИИЭМ (Минск, Беларусь). В качестве референс-штаммов при работе с вирусом кори был использован штамм Эдмонстон (получен из АТСС, VR-24), при работе с вирусом паротита – штамм Эндерс (получен из АТСС, VR-106). При оценке антигенных свойств выделенных изолятов вирусов кори и паротита использовали вакцинные штаммы Л-16 и Л-3, полученные из Государственной коллекции вирусов Института вирусологии им. Д.И. Ивановского (Москва). В качестве тест-вируса для титрования интерферона использовали вирус энцефаломиокардита мышей (ЕМС), полученный из коллекции штаммов вирусов НИИЭМ им. Н.Ф. Гамалеи (Москва).

Использовали клетки Л-68, ДК-58 (диплоидные фибробласты эмбриона человека), К-562 (клетки миелолейкоза человека), СV-1, Vero, GMK (клетки почки обезьяны), клетки комара Aedes aegipty и L-929 (клетки мыши) получены из коллекции культур клеток ГНЦ ВБ «Вектор». В работе использовались питательные среды RPMI-1640, ПС-4, Игла МЕМ с двойным набором аминокислот и витаминов производства ГНЦ ВБ «Вектор».

В исследованиях использовали аутбредных морских свинок (вес 250-300 г), кроликов (вес 1,5-2,5 кг), мышей линии BALB/c (вес 14-18 г), обезьян Macaca mulatta (самцы 5,2-6,6 кг) и Papio hamadrias (самцы 4,8-5,2 кг), полученных из питомника ГНЦ ВБ «Вектор». Животные содержались на стандартном рационе с достаточным количеством воды. Все манипуляции с животными при поведении эксперимента проводили с применением седативных средств в соответствии с ветеринарным законодательством.

Для идентификации вируса Марбург использовали референс-сыворотку (сыворотка реконвалесцента N 700808), которая была получена из CDC (Атланта, США). Анализы по определению уровня специфических антител к вирусу кори стандартизовались относительно международного образца «1st International Standard, 1990, Anti-Measles antibody 66/202, 5 International Units per ampoule». Разработанные тест-системы были сравнены с коммерческими тест-системами, производства ЗАО “Биосервис” (Москва), Wampole (США), Boehringer Mannheim (Германия), Human (Германия). Образцы с известным титром ревматоидного фактора (по латекс-тесту) для панели содержащей и не содержащей антитела класса М к вирусу кори были любезно предоставлены к.б.н. Т.Н. Юнасовой (лаборатория кори, паротита, краснухи и интерферонов, рук. проф. В.Ф. Попов, ГИСК имени Л.А. Тарасевича).

Препараты очищенных вирусов Марбург, кори, паротита анализировали с помощью электронной микроскопии, электрофореза в ПААГ по Лаемли (Laemly W.K, 1970), вестерн-блот анализа (Towbin H. et al., 1976), а концентрацию общего белка в препаратах определяли традиционным методом Лоури (Lowry O. H. et al., 1951).

Оценку показателей гуморального иммунитета проводили: для вируса Марбург методом ИФА по ранее описанной методике (Becker S. et al., 1992), для вируса кори и паротита – методом РТГА, используя эритроциты обезьяны (Попов В.Ф. и др., 1985), методом ИФА, используя коммерческие тест-системы, и в реакции нейтрализации (CDC, 1996). Оценку клеточного звена иммунитета проводили с использованием реакции бласттрансформации лимфоцитов (РБТЛ), которую проводили по общепринятой методике (Ignatyev G.M. et al., 1995), методом ELISpot с использованием набора «ELISpot mouse INF-» (R&D Systems Inc, США) и исследуя активность CD3, CD4, CD69 и CD8 клеток (Stittelaar K. et al., 2000). Протективные свойства препарата оценивали по индексу резистентности, который вычисляли как разницу логарифмов ЛД50 в опыте и контроле. Статистическую обработку данных проводили с использованием непараметрических методов оценки: сравнение по 2 критерию, сравнение по U критерию Манна-Уитни (Закс Л., 1976). Значение ЛД50 находили по формуле Кербера в модификации И.П. Ашмарина и А.А. Воробьева (Ашмарин И.П., Воробьев А.А., 1962).

Для разработки ИФА-тест-систем использовали выделенные от больных штамм NovO/96 вируса кори (патент RU № 2230785 C2) и штамм Драгун вируса паротита (патент RU 2348691 С1).

Исследования с участием людей проводили с соблюдением принципов добровольности и конфиденциальности в соответствии с «Основами законодательства РФ об охране здоровья граждан» (Указ Президента РФ от 24.12.1993 Т2288, Федеральные законы №30-ФЗ от 02.03.1998, № 214-ФЗ от 20.12.1999). Порядок проведения исследования одобрен этическим комитетом IRB00001360.

Результаты исследований И ИХ ОБСУЖДЕНИЕ

Получение препаратов антигенов вируса Марбург и изучение их иммуногенных и протективных свойств. На первом этапе исследования была проведена идентифицикация используемого для получения антигенов штамма Рорр вируса Марбург: показана идентичность мол. весов белков исследуемого вируса белкам вируса Марбург. Показано также, что белок с мол. весом 96 кД реагировал с сывороткой реконвалесцента, переболевшего геморрагической лихорадкой Марбург (рис. 1).

Рис. 1. Электрофоретическое изучение белков вируса Марбург и вестерн-блот-анализ. Дорожка 1– маркер мол. весов, дорожка 2– белки вируса Марбург, дорожка 3– нормальная сыворотка козы, дорожка 4– иммунная сыворотка козы, дорожки 5 и 6 – фракции Ig G козы, дорожка 7– нормальная сыворотка кролика, дорожка 8– иммунная сыворотка кролика, дорожка 9– сыворотка реконвалесцента № 700808.

После этого выбирали культуры клеток для получения препаративных количеств вируса Марбург и определяли сроки сбора КВЖ (таблицы 1 и 2).

Таблица 1

Определение чувствительности культур клеток к вирусу Марбург

Культура клеток

Титр вируса* (lg ЛД50/мл)

GMK

5,80 + 0,60

CV-1

6,17 + 0,62

ДК-58

6,40 + 0,60

Vero

6,67 + 0,62

Л-68

6,16 + 0,61

Клетки комара Aedes aegypti

6,50 + 0,60

* титр вируса определен при внутрибрюшинном заражении морских свинок.

Таблица 2

Динамика накопления вируса Марбург в КВЖ при культивировании на монослойных культурах клеток ДК-58 и Л-68

Срок культивирования (ч)

Титр вируса* (lg ЛД50/мл)/ культура клеток

ДК-58

Л-68

24

2,85 + 0,12

4,92 + 0,27

48

5,19 + 0,15

6,74 + 0,32

72

5,91 + 0.17

7,58 + 0,33

144

6,45 + 0,26

6,16 + 0,41

* титр вируса определен при внутрибрюшинном заражении морских свинок.

Показано, что штамм Рорр вируса Марбург эффективно нарабатывается на использованных культурах клеток. Для дальнейшей работы была выбрана культура Л-68, которая решением ГИСК им. Л.А. Тарасевича от 09.06.87г. была рекомендована как возможный субстрат для производства медицинских иммунобиологических препаратов. Максимальных значений титр вируса достигал на 3-и сут после заражения и составлял 7,58 + 0,33 lg ЛД50/мл. Проверка показала, что после смены питательной среды на 3 сут концентрация вируса в КВЖ на 5-й день вновь достигала высоких значений (7,2 lg ЛД50/мл). После второй смены среды на 5-е сут и сбора КВЖ на 7-е сут вирус накапливается в КВЖ в меньших количествах (6,0 lg ЛД50/мл). Исходя из результатов исследования, дальнейшее накопление вируса проводили на монослое клеток Л-68 с множественностью заражения 0,1 ЛД50/кл., на однолитровых культуральных сосудах, используя двойной слив КВЖ.

Для получения препаратов белков NP и VP40 вируса Марбург использовали хроматографическое (ВГЖХ) фракционирование на колонке с носителем полисил-500-ОДС (рис. 2). Препараты рекомбинантных белков GP и VP24 были любезно предоставлены д-ром S. Becker (Институт вирусологии, Марбург, Германия). В качестве препарата сравнения использован концентрированный очищенный инактивированный вирус Марбург, полученный по технологии, описанной в патенте RU 2029561 С1.

Изучение гуморального ответа на введение препаратов показало, что рекомбинантный белок GP, полученный в бакуловирусной системе, вызывал индукцию специфических антител в наибольших титрах как при иммунизации мышей, так и при иммунизации морских свинок (рис. 3). Специфический клеточный ответ, изучаемый методом РБТЛ, регистрировался у животных только при введении белков NP и GP вируса Марбург. Иммунизация белком NP обеспечивала максимальную защиту морских свинок от введения летальных доз вируса Марбург – коэффициент защиты при введении дозы вируса Марбург 50 ЛД50 равнялся 70+14 %. Для препарата белка VP40 уровень защиты составлял 16+8 %, для препарата белка VP24 – 14+4 %, а для препарата белка GP –26+6 %.

Рис. 2. Профиль элюции белков вируса Марбург (А) и электрофореграммы фракций, выделенных в 12% ПААГ белков NP и VP40 вируса Марбург (Б). Дорожка 1 - фракция, содержащая белок NP, дорожка 2 - фракция, содержащая белки NP и VP40, дорожка 3 - фракция, содержащая VP40, дорожка 4 – электрофорез очищенного вируса Марбург.

Рис. 3. Формирования гуморального ответа у морских свинок после однократного (А) и двукратного на 0 и 14 сут (Б) введения препаратов белков вируса Марбург.

Таблица 3

Изучение протективной активности белков вируса Марбург при введении белка в дозе 20 мкг/ животное и дозе активного вируса Марбург для заражения 50 ЛД50/животное

Препарат белка

Кратность введения

Коэффициент защиты (%)

NP

1-кратно

47+12

2-кратно*

70+14

VP40

1-кратно

0

2-кратно

16+8

VP24

1-кратно

14+4

2-кратно

н.и.**

GP (б)

1-кратно

26+6

2-кратно

н.и.

GP (ВОВ)

1-кратно

0

2-кратно

н.и.

ИАМ

1-кратно

52+10

2-кратно

87+14

Контроль

1-кратно

0

2-кратно

0

* - введение с интервалом 16 сут,

** - не исследовали,

GP (б) - препарат рекомбинантного белка GP, полученный в бакуловирусной системе,

GP (ВОВ) - рекомбинантный белок GP в составе осповакцины.

Таким образом, были получены и изучены иммунологические свойства препаратов четырех структурных белков вируса Марбург. На основе полученных экспериментальных данных может быть оценен возможный вклад каждого из изученных белков в формирование иммунного ответа против геморрагической лихорадки Марбург.

Разработка средств профилактики кори. Вакцина против кори в связи с принятием программы по элиминации этого заболевания, остро востребована. В настоящее время все производители выпускают живую вакцину для парентерального использования. Стратегия вакцинации, позволяющая индуцировать формирование барьерного иммунитета на слизистых оболочках, могла бы быть более эффективной при защите от кори.

Работа по изучению возможности получения эффективной пероральной формы вакцины проведена на двух видах животных - кроликах и обезьянах. У животных после иммунизации оценивали показатели гуморального и клеточного иммунитета. Иммунизированные обезьяны кроме этого были заражены диким штаммом вируса кори. На модели кроликов показали принципиальную возможность создания вакцины против кори для перорального применения, а на модели обезьян подтвердили, что вирус при внесении в просвет кишечника, может вызвать формирование гуморального и клеточного иммунного ответов (табл. 4).

Таблица 4

Изучение иммуногенных и протективных свойств живой коревой вакцины при пероральном применении в дозе 103,5 ТЦД50/животное

Модель

Иммунизация

Наличие вируса в крови

(количество животных, у которых обнаружен вирус кори в крови/общее количество животных)

Изучение иммуногенности

Изучение протек-тивности (количество животных, у которых появился вирус кори в крови/общее кол-во животных)

Гуморальный ответ

(количество животных с положительным ответом/общее количество животных)

Титр антител в ИФА

Клеточный ответ (кол-во животных с положительным ответом/общее количество животных)

Появление специфи-ческих CD3+CD8+ клеток

ИЛ-4

Кролик

перорально

1/6

4/6

1:16 – 1:32

н.и.*

н.и

н.и.

в/мышечно

1/4

2/4

1:32

н.и.

н.и

н.и.

Обезьяна

перорально

0/2

0/2

0/2

2/2

2/2

в просвет тонкого кишечника

0/2

1/2

(1:1250)

1/2

2/2

1/2

в/мышечно

1/2

2/2

(1:1250)

2/2

2/2

0/2

* - показатель не изучался.

При заражении иммунизированных обезьян диким штаммом BIL вируса кори обнаружено, что вирус в лаваже и мононуклеарных клетках крови определялся только у контрольной обезьяны и у трех обезьян, у которых согласно приведенным в таблице 3 данным не был сформирован иммунный ответ. Обе обезьяны, вакцинированные внутримышечно, и одна из обезьян, которым вирус был введен в просвет тонкого отдела кишечника, оказались защищены от заражения.

В другой серии экспериментов был сконструирован и проверен вариант кандидатной ДНК-вакцины против кори, представляющий собой рекомбинантную плазмиду, содержащую встройку гена гемагглютинина вируса кори и включенного в ВПЧ (рис. 4). Такого рода вакцина может быть востребована для иммунодефицитных пациентов, которым нельзя вводить аттенуированный вирус или для вакцинопрофилактики заболевания на поздних этапах выполнения программы элиминации кори.

Рис. 4. Изучение гуморального (А) и клеточного (Б) ответа у мышей, 3-кратно иммунизированных вариантом кандидатной ДНК-вакциной против кори (стрелками обозначены сроки иммунизации).

Как следует из рисунка 4А, трехкратное введение препарата приводило к появлению общих и нейтрализующих антител в сыворотке крови мышей. Формирование гуморального иммунитета в ответ на введение кандидатной ДНК-вакцины подтверждено Вестерн-блот анализом. У иммунизированных препаратом ДНК-вакцины животных формировался также специфический клеточный ответ (рис. 4Б), изученный с использование РБТЛ и метода ELISPot.

Таким образом, обоснована перспективность двух направлений в разработке новых вакцин против кори: первое – возможность создания более безопасного с точки зрения применения и экономически выгодного, с точки зрения обеспечения процесса вакцинации, препарата. Второе – возможность создания профилактического противокоревого препарата на основе реплицирующегося вектора, включенного в ВПЧ, альтернативного живой аттенуированной вакцине.

Получение антигена вируса кори и разработка средств диагностики на его основе. Тест-система для выявления антител класса М к вирусу кори необходима при ранней диагностики заболевания, а для антител класса G – для подтверждения диагноза, и для проведения серомониторинга.

Для разработки иммуноферментной тест-системы использовали референс-штамм Эдмонстон и штамм NovО96, выделенный во время вспышки кори в детском доме в Новосибирске. Проведение электронно-микроскопических исследований зараженных клеток Vero выявило репродукцию парамиксовируса. Инфицированные клетки содержали типичные для парамиксовирусов скопления трубчатых нуклеокапсидов, а на поверхности цитоплазматических мембран наблюдалось формирование вирусных частиц. В целом ультраструктурное строение вируса кори соответствовало описанному в литературе для парамиксовирусов (Scheid А., 1987). Вирус кори был очищен центрифугированием в градиенте плотности сахарозы (10-60 %). После ультрацентрифугирования собранные фракции были изучены в реакции гемагглютинации с эритроцитами обезьяны Macaca mulatta; показано наличие гемагглютинирующей активности в двух фракциях (рис. 5, А). При электронно-микроскопическом исследовании в очищенных препаратах обнаружены вирусные частицы и нуклеокапсиды с характерной для вируса кори структурой. Вирусные частицы различались по форме и размерам. Электрофоретический анализ препаратов в ПААГ (рис. 5, Б) выявил высокую степень очистки вируса – 70-75 %. Видовая принадлежность штамма подтверждена в иммуноблоте (рис. 5, В): антитела из сыворотки реконвалесцента (пациента с клиническим диагнозом «корь», подтвержденным лабораторными методами) связывались с белками NP и F вируса кори.

А

Б В

  1 2 1  2

Рис. 5. Получение и изучение антигена вируса кори. (А) - Анализ фракций вируса кори после центрифугирования в градиенте плотности сахарозы в РГА. (Б) - Электрофорез белков вируса кори, шт. Эдмонстон. Дорожка 1- маркеры мол. весов: 205, 116, 97, 84, 66, 55, 45, 36, 29, 24, 20, 14.2, 6.5 кД. Дорожка 2 – белки вируса кори. (В) - Вестерн-блот-анализ. Дорожка 1 – стрип обработан сывороткой человека с клиническом диагнозом корь, подтвержденным лабораторно (разведение 1:500). Дорожка 2 – стрип обработан сывороткой человека, не имеющего антител к вирусу кори (разведение 1:100). Стрелками указаны: белок NP (верхняя) и F (нижняя) вируса кори.

Для получения антигена использовали смесь фракций, собранных с градиента плотности сахарозы после ультрацентрифугирования. Фракции, содержащие очищенный вирус, смешивали с фракциями, содержащими нуклеокапсиды вируса в пропорции 1:3. Используя полученный антиген, были подобраны условия проведения ИФА, оптимизированы концентрации основных компонентов тест-системы и сроки хранения. Оптимальная концентрация антигена составила 5 мкг/мл.

Проверка антигенных свойств штамма NovО/96 выявила существенное сходство с референс-штаммом Эдмонстон и с вакцинным штаммом Л-16 вируса кори (табл. 5). Сыворотки, полученные от 6 иммунизированных очищенным вирусом кори, штамм Эдмонстон, мышей линии BALB/c, и сыворотки, полученные от 6 иммунизированных очищенным вирусом кори, штамм NovО/96, мышей линии BALB/с, были исследованы в ИФА и РТГА. Сыворотки от всех иммунизированных вирусом кори, штамм Эдмонстон, мышей реагировали как со штаммами Эдмонстон и Л-16, так и со штаммом NovО/96. С другой стороны, сыворотки от всех мышей, иммунизированных штаммом NovО/96, реагировали как с самим штаммом NovО/96, так и со штаммами Эдмонстон и Л-16 (см. табл.5).

Таблица 5

Изучение антигенных свойств вируса кори штамм NovO/96

Специфич-ность сыворотки

№ сыворотки

Титр антител (обратные величины)/реакция для определения титра антител /

антиген (штамм), используемый в реакции

РТГА

ИФА

штамм Эдмонстон

штамм

Л-16

штамм

NovО/96

штамм Эдмонстон

штамм

Л-16

Штамм

NovО/96

Сыворотка против вируса кори штамм Эдмонстон

1

32

16

32

640

320

640

2

32

16

16

640

320

320

3

32

16

16

640

320

320

4

32

8

16

640

320

160

5

16

8

8

320

320

160

6

16

8

8

320

160

160

Среднее по группе

25,40

(17,44-36,98)

11,31

(7,6-16,85)

14,25

(8,24-24,65)

508,00

(348,9-739,56)

285,09

(211,84-383,66)

253,98

(140,24-460,0)

Сыворотка против выделенного штамма NovО/96

1

64

32

64

320

320

640

2

64

32

64

320

320

320

3

64

32

64

320

160

320

4

64

32

32

160

160

320

5

32

16

32

160

160

320

6

32

16

16

160

160

320

Среднее по группе

50,8

(34,9-73,96)

25,4

(17,44-36,98)

40,32

(22,26-73,02)

226,27

(151,92-337,03)

201,59

(138,46-293,49)

359,19

(266,9-483,38)

Таким образом, штамм NovО/96 по антигенным свойствам близок к референс-штамму Эдмонстон и к вакцинному штамму Л-16. Исходя из более высокой продуктивности штамма NovO/96 и близости к референс-штамму Эдмонстон и к вакцинному штамму Л-16 по антигенным свойствам, штамм NovO/96 был использован для получения антигена ИФА-тест-системы, которая позволила эффективно выявлять антитела к вирусу кори как у переболевших, так и у вакцинированных лиц.

Лабораторные варианты тест-системы использовали для изучения иммунного статуса различных возрастных групп населения Новосибирска в отношении вируса кори. В период с апреля по октябрь 2003 года с целью определения специфических антител к вирусу кори были собраны образцы сывороток крови 364 здоровых доноров, проживающих на территории Новосибирска и в РТГА, РН и методом ИФА изучено содержание в них антител к вирусу кори (рис. 6 и табл. 6).

Содержание антител в сыворотках (ИФА)

>0.35 МЕ - положительные сыворотки

>0.16 МЕ - слабоположительные сыворотки

0-0.15 МЕ - отрицательные сывороток

Титр антител, определенный в РТГА

>8 - протективный титр антител

>4 - положительные сыворотки

0-4 - отрицательные сыворотки

Титр антител, определенный в РН

> 120 - протективный титр антител

> 8 - положительные сыворотки

< 8 - отрицательные сыворотки

> 48 - расчетный уровень протективных антител

Рис. 6. Изучение иммунного статуса у представителей различных возрастных групп населения Новосибирска в отношении вируса кори. По оси абсцисс: Количество отрицательных и положительных сывороток в воз-растной группе, а также сывороток, содержащих протективные титры антител (%). По оси ординат: Возрастные группы (лет).

Таблица 6

Соотношение совпадения результатов определения антител к вирусу кори в сыворотках крови доноров Новосибирска методами ИФА, РТГА и РН

Возрастная группа доноров

Количество сывороток, положительных в ИФА, РТГА и РН, (%)

Количество сывороток, отрицательных в ИФА, РТГА и РН, (%)

3 – 4 года

62,8

7,1

9 – 10 лет

60,0

4,0

16 – 18 лет

45,0

13,3

20 – 25 лет

38,3

20,0

30 – 35 лет

71,4

15,3

старше 38 лет

77,8

1,4

В соответствии с рекомендациями ВОЗ, все доноры, принимавшие участие в исследовании, были разделены на следующие возрастные группы:

  • дети 3 - 4 года – вакцинированы в возрасте 1 года живой коревой вакциной (70 сывороток);
  • дети 9 - 10 лет – вакцинированы в возрасте 1 года и ревакцинированы в 6 лет живой коревой вакциной (50 сывороток);
  • подростки 16 - 18 лет – вакцинированы в возрасте 1 года и ревакцинированы в 6 лет живой коревой вакциной (72 сыворотки);
  • доноры возраста 20 - 25 лет – без учета сведений о прививочном анамнезе (71 сыворотка);
  • доноры возраста 30 - 35 лет – без учета сведений о прививочном анамнезе (46 сывороток);
  • доноры старше 38 лет – не вакцинированы, без учета сведений о заболевании корью в анамнезе (55 сывороток).

В результате проведенных исследований выявлена возрастная категория доноров с низкими или отрицательными значениями титров противокоревых антител - 20-25 лет. Кроме этого установлена не только выраженная корреляция между методами ИФА и РТГА, но и между методами ИФА и РН, что особенно важно, потому что ранее для доказательства наличия протективного иммунитета к кори проводили определение нейтрализующих антител в РН.

Известно, что РТГА является «золотым стандартом» определения антител к вирусу кори и давно используется для серомониторинга. Для доказательства возможности полноценной замены этого метода методом ИФА проведено их сравнение. В эксперименте были исследованы сыворотки, полученные от детей, вакцинированных живой коревой вакциной. Для определение противокоревых антител использовали стандартную РТГА и 3 лабораторные серии ИФА-тест-системы для выявления антител класса G к вирусу кори (табл. 7). Коэффициенты корреляции величин титров антител в исследуемых сыворотках, определенных с помощью ИФА для 1, 2 и 3 серии тест-системы, с РТГА составили соответственно +0,87, +0,86, +0,89. Такая корреляция свидетельствует о высокой степени связи между показателями (Рокицкий П.Ф., 1961). Таким образом, использование ИФА позволили с большей чувствительностью выявлять антитела к вирусу кори в сыворотках крови людей, чем это возможно в РТГА. Учитывая высокие значения коэффициента корреляции между методом ИФА и РТГА, тест-системы на основе иммуноферментного анализа могут успешно использоваться для серомониторинге кори.

Для оценки качества используемых в России тест-систем для определения антител класса G к вирусу кори была разработана и аттестована стандартная панель сывороток, содержащих и не содержащих антитела класса G к вирусу кори «Стандарт АТ-G(+/-)корь». Панель была сформирована таким образом, чтобы сыворотки, вошедшие в нее, не содержали белки ВИЧ и антитела к белкам ВИЧ, НВs-антиген, антитела к вирусу гепатита С. Шесть сывороток не содержали антитела класса G к белкам вируса кори, при этом две из них содержали антитела к основным специфическим белкам вируса краснухи, а две – аутоантитела, явившиеся причиной экзантемы их доноров. Одиннадцать сывороток содержали антитела к белкам вируса кори, их специфическая активность установлена в РТГА и РН. Для этих сывороток специфическая активность противокоревых IgG определена в международных единицах на мл (МЕ/мл). Замена понятия «титр» на понятие «специфическая активность, МЕ/мл» в широкой международной практике была предпринята ВОЗ для стандартизации серологических методов определения противокоревых антител. По заказу ВОЗ Национальным институтом биологических стандартов и контролей Великобритании в 1990 году был разработан первый Международный стандарт противокоревой сыворотки («1st International Standard, 1990, Anti-Measles antibody 66/202, 5 International Units per ampoule» (World Health Organization, WHO International Laboratory for biological standard, Hertfordshire, EN63QG, England). Каждая ампула с лиофильно высушенным пулом сывороток содержит 10 МЕ противокоревых антител.

Таблица 7

Сравнительные испытания трех лабораторных серий иммуноферментной тест-системы для определения антител к вирусу кори в сыворотках крови людей

№ сыворотки

Титр антител/ номер серии тест системы/реакция

1 серия

2 серия

3 серия

РТГА

ИФА

РТГА

ИФА

РТГА

ИФА

1

2

3

4

5

6

7

2

1:8

1:100

1:8

1:100

1:8

1:100

3

1:4

1:200

1:8

1:200

1:4

1:200

4

<1:4

<1:50

<1:4

<1:50

<1:4

<1:50

5

1:32

1:200

1:16

1:200

1:32

1:300

6

1:16

1:200

1:16

1:200

1:16

1:200

7

1:4

1:200

1:4

1:200

1:8

1:200

11

1:32

1:300

1:16

1:300

1:32

1:400

13

1:32

1:800

1:16

1:800

1:32

1:800

14

1:64

1:800

1:64

1:800

1:64

1:800

19

1:64

1:800

1:64

1:800

1:64

1:800

20

1:32

1:200

1:16

1:300

1:32

1:300

23

1:8

1:100

1:8

1:100

1:8

1:100

24

1:16

1:150

1:16

1:150

1:8

1:200

25

1:8

1:100

1:8

1:100

1:8

1:100

26

1:16

1:150

1:16

1:200

1:16

1:200

27

1:16

1:300

1:16

1:400

1:16

1:400

28

1:32

1:200

1:16

1:300

1:32

1:300

29

<1:4

1:50

<1:4

1:50

<1:4

1:100

30

1:64

1:400

1:64

1:400

1:64

1:800

31

1:64

1:300

1:64

1:400

1:64

1:400

32

1:64

1:400

1:64

1:400

1:64

1:400

33

1:32

1:200

1:16

1:200

1:32

1:200

35

1:64

1:800

1:64

1:800

1:64

1:800

36

1:16

1:100

1:16

1:100

1:16

1:200

40

1:16

1:300

1:16

1:300

1:16

1:300

49

<1:4

1:50

<1:4

1:50

<1:4

1:50

57

<1:4

<1:50

<1:4

<1:50

<1:4

<1:50

0316*

1:128

1:2000

1:128

1:2000

1:128

1:2000

0256*

1:64

1:1200

1:64

1:1400

1:64

1:1400

Коэффициент корреляции

0,87

0,86

0,89

* - сыворотки от переболевших пациентов с лабораторно подтвержденным диагнозом корь.

Приготовленная нами панель была откалибрована по этому стандарту при соблюдении условий рекомендованного ВОЗ и утвержденного национальным контрольным институтом ГИСК им. Л.А. Тарасевича теста на параллелизм и линейность для медицинских иммунобиологических препаратов. Панель была аттестована как «Отраслевой Стандартный Образец стандартной панели сывороток крови человека, содержащих и не содержащих антитела класса IgG к вирусу кори» (ОСО 42-28-394-07).

Первые опытно-промышленные серии тест-системы были использованы для оценки параметров серийного продукта. С помощью РТГА были отобраны 76 отрицательных (титр 1:2) и 236 положительных (титр 1:4) сывороток, среди которых 134 сыворотки имели протективный титр (титр 1:8). Результаты сравнительных постановок в ИФА показали, что чувствительность и специфичность тест-системы «Корь-IgG-ДС» не уступает тест-системе «Enzygnost® Anti-Measles-Virus/IgG» (Dade Behring, ФРГ) и превышает аналогичные показатели тест-системы «Measles IgG ELISA» (Wampole Laboratories, США). Чувствительность тест-системы «Корь-IgG-ДС» составила 98,7 %, специфичность – 96,2 %.

Европейское региональное бюро ВОЗ организовало тестирование тест-системы «Корь-IgG-ДС» в глобальной сети лабораторий Всемирной организации здравоохранения, которое было проведено в 2004-2005 гг. в НИИ эпидемиологии и микробиологии (Минск, Республика Беларусь) и Национальной лаборатории здравоохранения (Ньюфаундленд, Канада). В заключительном отчете показано соответствии результатов тестирования «Корь-IgG-ДС» в сравнении с национальными эталонами при анализе охарактеризованных панелей сывороток, содержащих и не содержащих антитела класса G к вирусу кори. Сделан вывод о полной пригодности тест-системы «Корь-IgG-ДС» для оценки иммунитета к вирусу кори. Государственные испытания в ГИСК имени Л.А. Тарасевича подтвердили эффективность разработанной иммуноферментная тест-система «Корь – IgG-ДС» и она была разрешена для использования на территории Российской Федерации (ФСП 42-0155-7032-05).

Используя высокоспецифичный иммуносорбент, а также рабочую панель сывороток, содержащих и не содержащих антитела класса М к вирусу кори, была разработана ИФА-тест-система для ранней диагностики заболевания. Для панели были отобраны положительные по наличию IgM образцы сывороток больных корью и краснухой с использованием рекомендованной ВОЗ и МЗ и СР РФ коммерческой ИФА тест-ситемы «Enzygnost Anti-Measles-Virus/IgМ» (Dade-Behring, ФРГ). В результате отбора сывороток, подходящих по специфичности, качеству и объемам материала, была сформирована рабочая панель из 16 образцов. Оптимизация тест-системы проходила в 3 этапа: сначала было определено конечное разведение образцов в лунках иммуносорбента, затем была подобрана оптимальная концентрация антигена. Оптимальный титр конъюгата анти-IgM человека с пероксидазой хрена в растворе конъюгата был определен, исходя из установленных первых двух параметров. На третьем этапе главным критерием было достижение 100 % специфичности тест-системы (отсутствие ложноположительного сигнала) с обязательным учетом параметра чувствительность (выявляемость положительных образцов). Примененный алгоритм оптимизации параметров тест-системы позволил добиться 100 % чувствительности и специфичности на охарактеризованной панели сывороток.

Таким образом, в результате проведенных исследований созданы два диагностических препарата, позволяющих выявлять антитела классов G и M к вирусу кори. Препараты успешно прошли испытания на национальном и международном уровнях и показали высокую чувствительность и специфичность в сравнении с лучшими зарубежными аналогами. Для корректного сравнительного испытания разработанных тест-систем была получена панель сывороток, содержащих и не содержащих антитела к вирусу кори «Стандарт АТ-G(+/-)корь» (ОСО 42-28-394-07), специфическая активность сывороток в которой выражается в международных единицах. На базе ЗАО «МБС» было налажено производство промышленных серий тест-систем «Корь – IgG-ДС» и «Корь-IgМ», которые были успешно применены для выполнения национальной программы элиминации кори.

Получение антигена вируса паротита и разработка средств диагностики на его основе. Для разработки иммуноферментной тест-системы были использованы референс-штамм Эндерс и штамм Драгун, выделенный при вспышке заболевания эпидемическим паротитом в р.п. Кольцово Новосибирской области в январе-июне 1994 года. Вирус паротита был очищен ультрацентрифугированием в градиенте плотности сахарозы из КВЖ и лизата зараженных клеток. Фракции, собранные с градиента плотности сахарозы после ультрацентрифугирования, были изучены в реакции гемагглютинации с эритроцитами обезьяны Macaca mulatta. Вирус обладал типичной для паротита способностью агглютинировать эритроциты обезьяны. Результаты анализа фракций в РГА приведены на рисунке 7, А. Концентрирование вируса из культуральной вируссодержащей жидкости позволило получить вирус в препаративных количествах уже после однократного ультрацентрифугирования. Изучение препаратов методом электронной микроскопии показало, что в очищенных препаратах находятся вирионы и нуклеокапсиды с характерной для вируса паротита структурой.

Для подтверждения принадлежности выделенного изолята Драгун к вирусу паротита из КВЖ была выделена суммарная РНК, синтезирована кДНК и проведена ПЦР. Для проведения полимеразной цепной реакции были использованы пары праймеров, перекрывающие районы генома в области, кодирующей участки генов F- и SH-белков (позиции 5276 – 5785 указаны для фрагмента кДНК вируса паротита, штамм SBL, изолят SBL-1). Расчетный размер данного участка с учетом включенных в праймеры сайтов для рестриктаз составляет 548 нуклеотидов, что соответствовал размеру ампликона. Первичная структура праймеров для фрагмента, соответствующего концу F-гена и SH-гену, приведена ниже:

F primer - TTGGATCCTTGTAGCAGCCTTAGTTTTGAG,

R primer – CGGAATTCTGCTTTTTTCTTTATGTCTCATG.

Секвенирование амплификационного фрагмента показало принадлежность штамма Драгун к вирусу паротита.

А

Б

  1 2  3  4


Рис. 7. Получение и изучение антигена вируса паротита. (А) - Анализ фракций вируса паротита после центрифугирования в градиенте плотности сахарозы в РГА. (Б) - Электрофорез белков вируса паротита, шт. Эндерс. Дорожки 1 и 4- маркеры мол. весов: 66, 45, 36, 18 кД. Дорожка 3 – белки вируса паротита. Стрелками указаны: белок NP (верхняя полоса), М (нижняя полоса) вируса паротита.

Для разработки ИФА-тест-системы выбрали штамма вируса паротита с такими характеристиками как высокая репродуктивность штамма, антигенное родство (высокая серологическая перекрываемость) с другими штаммами вируса паротита, природное происхождение из географического региона проведения будущих исследований. Штаммы Эндерс, Л-3, Jeryl-Linn и Драгун вируса паротита использовали для получения препаративных количеств антигена. Штаммы культивировали на монослое культур клеток: ФЭК, Vero, CV-1, FRhK и Л-68. После культивирования собирали КВЖ и клеточный лизат для определения титра вируса. При получении урожая значительная часть вируса остается связанной с клеточными структурами, поэтому оставшиеся после слива КВЖ клетки разрушали замораживанием-оттаиванием, клеточный детрит осаждали низкоскоростным центрифугированием и надосадочную жидкость собирали. Результаты определения титра вируса паротита в КВЖ и клеточном лизате приведены в таблице 8. Как видно из данных таблицы 8 штаммы вируса паротита размножались во всех клеточных культурах. Максимальные титры вируса паротита достигались на 5-6 сут после заражения монослоя клеток Vero и для штамма Эндерс составляли 6,32 + 0,29 lg ТЦД50/мл, а для штамма Драгун – 7,93 + 0,49 lg ТЦД50/мл.

Таблица 8

Определения чувствительности культур клеток к вирусу паротита при стационарном способе культивирования

Штамм вируса паротита

Культура клеток

Титр вируса/ образец

КВЖ

Лизат клеток

ГАЕ/мл

lg ТЦД50/мл

ГАЕ/мл

lg ТЦД50/мл

Эндерс

ФЭК

30,4 +3,2

6,21 + 0,42

16,8+4,3

5,21 + 0,31

FRhK

4,3+0,8

6,63 + 0,38

15,6+3,3

н.о.

ЛЭЧ

2,6+0,4

н.о.

4,0+0,5

н.о.

Л-68

2,1+0,8

н.о.

7,8+1,7

н.о.

Vero

34,9+3,1

6,32 + 0,29

31,1+3,6

5,39 + 0,28

Л-3

ФЭК

30,1+2,3

5,30 + 0,43

36,0+5,5

5,15 + 0,39

FRhK

2,2+0,3

6,30 + 0,40

н.о.

н.о.

Vero

15, 6+2, 8

6,56 + 0,54

8,5+2,0

5,23 + 0,41

Jeryl-Linn

ФЭК

8,8+2,5

6,07 + 0,38

30,4+2,6

5,88 + 0,42

FRhK

1,9+ 0,2

6,90 + 0,43

1,7+ 0,3

н.о.

Vero

2,9+ 0,9

6,78 + 0,48

8,7+2,7

5,39 + 0,35

Драгун

ФЭК

16,0+4,1

6,97 + 0,37

32,2+4,1

5,64 + 0,33

FRhK

8,1+2,8

6,90 + 0,42

3,8+0,6

5,69 + 0,29

Vero

16,8+4,4

7,93 + 0,49

32,9+4,6

6,46 + 0,53

н.о. - титр вируса не определяли.

Для выбора антигена были взяты сыворотки лабораторных животных, любезно предоставленные к.б.н. Т.Н. Юнасовой (ГИСК им. Л.А. Тарасевича). Использование для сорбции на планшет фракций с цельным вирусом штамма Эндерс, выделенным из КВЖ, в отличие от использования фракций, выделенных из лизата клеток, инфицированных штаммом Эндерс (фракции, обогащенные нуклеокапсидами), повышает чувствительность реакции (табл. 9). Максимальные титры противокоревых антител выявлялись при использовании для сорбции на планшет антигена на основе штамма Драгун. По этой причине в качестве иммуносорбента для ИФА был выбран суммарный антиген на основе штамма Драгун, полученный смешиванием фракций, выделенных на градиенте плотности сахарозы при очистке КВЖ и лизата зараженных вирусом клеток, в пропорции 1:2 – 1:3.

Таблица 9

Определение титра антител в сыворотках крови лабораторных животных

Антиген

Титр антител (Хср геом (I95)/ серологическая реакция/ сыворотка

РТГА

ИФА

1*

2*

3*

4*

1*

2*

4*

Штамм Эндерс - фракция, содержащая цельный вирус -фракция, содержащая нуклеокапсиды вируса

112,4

(92,2-

134,1)

53

(44,4-

68,1)

51,8

(43,0-

71,2)

13,5

(9,2-

19,5)

<1:4

5,8

(2,2-

9,1)

<1:4

529,8

(324,4 – 848,7)

243,4

(192,2-

290,8)

1202,6

(931,1-

1458,4)

881,7

(653,3-

1296,5)

9,3

(3,7-

10,1)

5,8

(2,9-

8,2)

Штамм Л-3**

49,1

(30,5-

68,2)

96,3

(59,9-

124,6)

<1:4

<1:4

139,5

(111,7-

134,1)

478,3

(310,3 – 634,1)

4,8

(0,4-

9,1)

Штамм Jeryl-Linn**

36,6

(23,9-

49,4)

19,7

(8,7-

27,4)

<1:4

<1:4

92,6

(79,7-

105,8)

194,5

(173,8-

217,3)

4,1

(0,6-

7,8)

Штамм Драгун**

295,3

(270,1-

319,3)

165,3

(148,7-

186,8)

<1:4

12,6

(9,3-

14,7)

1007,4

(944,6-

1165,2)

1469,0

(1273,3-

1585,7)

19,2

(8,4-

26,3)

*        1 - сыворотка кролика, иммунизированного цельным вирусом (получена из ГИСК им.Тарасевича);

       2 - сыворотка кролика, иммунизированная очищенным нуклеокапсидом из лизата клеток;

       3 - нормальная кроличья сыворотка;

       4 - сыворотка крысы, иммунизированной цельным вирусом (получена из ГИСК им. Тарасевича).

** - в качестве антигенов использованы суммарные (цельный вирус и нуклеокапсиды) фракции, собранные с градиента плотности сахарозы.

В препарате очищенного инактивированного антигена определяли общий белок методом Лоури (Lowry O.H. et al., 1951). Исходя из концентрации белка, на карбонатно-бикарбонатном буфере (рН=9.6) готовили разведения препарата, содержащего 0,5; 1,0; 4,0 и 10,0 мкг/мл антигена вируса паротита, и вносили его по 100 мкл в лунки 96-луночных планшетов (Nunс, США). Показано, что 0,4 мкг препарата на лунку является оптимальной дозой антигена вируса паротита, обеспечивающей максимальные различия между положительными и отрицательными сыворотками (рис. 8).

Далее был проведен подбор оптимального разведения конъюгата и изучены сроки хранения тест-системы для определения антител класса G к вирусу паротита.

Рис. 8. Определение оптимальной концентрации антигена вируса паротита для постановки ИФА. По оси ординат показана разница соответствующих оптических плотностей положительного и отрицательного образцов.

Для выявления корреляции при определении титров антител между методами ИФА и РТГА были использованы сыворотки мышей линии BALB/c, иммунизированных очищенным вирусом паротита. Очищенный вирус паротита штаммов Эндерс и Драгун вводили животным внутрикожно трехкратно с интервалом 16 сут в дозе 50 мкг/животное, используя при первой иммунизации полный адъювант Фрейда, а при повторных – неполный адъювант Фрейда. Определение титра антител проводили через 21 сут после последней иммунизации. Результаты экспериментов приведены в таблице 10. Использование разработанной ИФА-тест-системы позволяет выявлять антитела в сыворотках крови животных, в титрах более высоких, чем это возможно в РТГА. С помощью разработанной ИФА-тест-системы использовали для выявления антител класса G в сыворотках крови людей, вакцинированных живой паротитной вакциной или переболевших эпидемическим паротитом разной степени тяжести. Всего в работу взяли сыворотки 41 пациента. Результаты анализа сывороток на содержание противопаротитных антител методом ИФА сравнивали с результатами, полученными в РТГА. Значения титров антител в исследуемых сыворотках крови людей, определенных с помощью тест-системы, коррелировало со значениями титров антител в этих сыворотках, определенных в РТГА.

Таблица 10

Сравнение эффективности выявления антител к вирусу паротита в сыворотках крови иммунизированных животных

Специфичность сыворотки

N сыв-

ки

Титр антител (обратные величины)/ Реакция / Антиген

РТГА

ИФА

штамм Эндерс

штамм

Драгун

штамм Эндерс

штамм

Драгун

Сыворотка против вируса

паротита,

штамм Эндерс

1

128

128

1280

640

2

128

64

640

320

3

128

32

640

320

4

64

32

640

320

5

64

32

320

320

6

64

32

320

160

Среднее по группе

90,51

(60,77-134,81)

45,25

(24,62-83,17)

570,18

(329,76-985,87)

320

(202,0-506,93)

Сыворотка

против вируса

паротита,

штамм Драгун

1

256

512

640

2560

2

256

512

320

1280

3

256

512

320

1280

4

128

256

320

640

5

64

256

160

640

6

64

128

160

640

Среднее по группе

143,68

(70,27-293,75)

322,54

(178,09-584,15)

285,09

(164,88-492,93)

1015,94

(560,95-1839,96)

Значения ОП контролей (положительный контроль, отрицательный контроль и контроль конъюгата) соответствовали требованиям, необходимым для учета результатов и указанным в проекте "Инструкции по применению тест-системы иммуноферментной для определения титра антител к вирусу паротита". Определение коэффициента корреляции между методами показало высокую степень корреляционных связей: значения коэффициентов корреляции находились в интервале значений от 0,73 (для сывороток людей) до 0,90 (для сывороток животных).

Таким образом, полученный антиген вируса паротита был использован для разработки тест-системы, позволяющей выявлять антитела класса G к вирусу паротита в сыворотке крови человека. Результаты определения титра антител, полученные с использованием разработанной тест-системы, имели высокий коэффициент корреляции с результатами определения титра антител, полученными с использованием «золотого» стандарта – реакции торможения гемагглютинации.

Изучение разнообразия вирусов кори и паротита, циркулирующих на территории Западной Сибири. Детальное изучение передачи инфекционного агента особенно важно в вирусологии и эпидемиологии. Анализ изолятов, выделенных в 50-60-е годы XX столетия, показал, что циркуляция Эдмонстон-подобного генотипа А вируса кори, по-видимому, была достаточно широко распространена в мире (Takeda М. et al., 1999). Выделенные в России штаммы Buk 88, Gag 88 и Il 88 (Tikhonova N.T. et al., 1992) и штамм Loss (Jin L. et al., 1996) также относились к генотипу А.

Начиная с 1996 года, проведена работа по сбору образцов от больных с клиническим диагнозом корь и генотипированию вируса кори, циркулирующего на территории Новосибирской области. В 1996 году при вспышке кори в детском доме у мальчиков 11 и 13 лет были получены образцы носоглоточных смывов и крови, из которых были выделены изоляты вируса кори Нов1/96 и Нов2/96. Фрагмент, включающий часть M- и F- генов (позиции 4725 - 5015) изолята Нов1/96, был секвенирован. Проведено сравнение нуклеотидной последовательности этого изолята с последовательностями других изолятов вируса кори. Результаты анализа показали генетическое сходство выделенного изолята Нов1/96 с выделенным в России штаммом Buk88 и используемым для вакцинации в России штаммом Л-16 вируса кори (Haider А. et al., 1997). Изолят принадлежал к генотипу А. В 1997 году выделены еще два изолята, отнесенные к генотипу А и один изолят, принадлежащий к генотипу D6, ранее не выявляемый на территории России. Этот изолят был выделен при локальной вспышке заболевания в детском коллективе у мальчика 8 лет с клиническим диагнозом корь. Различий в клиническом проявлении кори у больных, от которых были выделены изоляты с генотипом А, и у больного, от которого был выделен изолят с генотипом D6, отмечено не было. Вирус, вызвавший заболевание у ребенка, был наиболее близок по нуклеотидной последовательности штамму New Jersey.USA/94/1, являющемуся референс-штаммом генотипа D6. В 1998 были генотипированы еще 2 штамма вируса кори, принадлежащие к генотипу А. После этого генотип А вируса кори более не обнаруживался. Слежение за вирусом кори показало, что генотип А был вытеснен генотипом D6. Все 8 штаммов вируса кори, обнаруженные на территории Западной Сибири в срок с 1998 по 2001 гг, относились к генотипу D6.

Циркуляция генотипа D6 в Западной Европе была показана ранее: этот генотип был найден в Великобритании в 1992-1995 годах (Jin L. et al., 1997) и в Испании в 1994 (Rima B.K. et al., 1995). Известно, что генотип D6 вызвал вспышку заболевания корью в Бразилии в1997 году, в Аргентине – в 1998 году и в Уругвае – в 1999 (Baumeister E. et al., 2000). Есть предположение, что в РФ этот генотип попал из Европы, где он уже продолжительное время циркулирует.

Вирус паротита, как и вирус кори, в генетическом плане является стабильным вирусом с высокой степенью устойчивости к мутациям. Тем не менее, анализ последовательностей геномов различных изолятов, показал, что существует несколько различающихся вариантов вируса паротита – генотипов, которые циркулируют на определенных территориях. Ген SH (мРНК – 316 н.о., кодирует белок 57 а.о.) является самым вариабельным в геноме, и генотипирование штаммов вируса паротита проводится главным образом по этому гену. Филогенетический анализ, проведенный по генам HN и F, практически совпадает с данными, полученными по SH-гену.

Начиная с 1994 года, проведена работа по сбору образцов от больных эпидемическим паротитом и генотипированию вируса, циркулирующего на территории Западной Сибири.

В период с 12 января по 07 июня 1994 года в поселке Кольцово Новосибирской области была зарегистрирована вспышка заболевания эпидемическим паротитом. Всего за этот срок заболевание было диагностировано у 64 детей и 7 взрослых. Наибольший процент заболевших составили дети до 12 лет (35,8 % – дети 7-8-летнего возраста и 28,0 % – 11-12-летнего возраста). Течение инфекции было типичным: заболевание начиналось с повышения температуры тела до 38 0C, появления припухлости околоушной слюнной железы (как правило, с одной стороны), через 1-2 дня появлялась припухлость и другой околоушной железы, которая исчезала через 8-10 дней после начала заболевания. На основании клинических проявлений и по нарастанию титров противопаротитных антител в парных сыворотках, определенных с помощью РТГА и ИФА, больным был поставлен диагноз – эпидемический паротит. От двух больных были выделены изоляты вируса паротита (табл. 11).

Таким образом, был выделен и первично охарактеризован новый штамм вируса паротита, вызвавший вспышку заболевания эпидемическим паротитом в Новосибирской области в 1994 году. Штамм получил название "Драгун" (изоляты “Драгун-1” и “Драгун-2”) и был депонирован в коллекции вирусов ГНЦ ВБ РФ "Вектор" (номер – VB-05). Секвенирование нуклеотидной последовательности показало принадлежность штамма к генотипу С. Полная нуклеотидная последовательность штамма была расшифрована в 2004 году и депонирована в базу данных GenBank (№ AY669145).

Таблица 11

Получение и изучение свойств штамма «Драгун» вируса паротита

Идеентификационный номер

Возраст, пол и вакци-нальная история

Срок забора образцов от появления клинических признаков

Образцы

Лабораторные исследования

Штамм

ПЦР

Серологические исследования (титры антител)

Биологические исследования (посев на культуру клеток Vero)

Название изолята

Генотип

Ig M

Ig G

Появление симпластов

ПЦР с культурой клеток

П-04/04

/03

8 л, М,

в 1.5 год вакцинирован

72 ч

Кровь

Смыв

-

+

-

1:100

-

+

-

+

Дра-гун 1

С

11 сут

Кровь

Смыв

-

-

+

1:220

-

-

-

-

14 сут

Кровь

Смыв

н.и

н.и

+

1:410

-

-

-

-

5,5 мес

Кровь

Смыв

н.и

н.и

-

1:580

н.и.

н.и.

н.и.

н.и.

П-07/04

/03

7 л, Ж,

в 1.5 год вакциниро-вана

64 ч

Кровь

Смыв

-

+

-

1:50

-

+

-

+

Дра-гун 2

С

11 сут

Кровь

Смыв

-

-

+

1:110

-

-

-

-

14 сут

Кровь

Смыв

н.и

н.и

+

1:240

-

-

-

-

н.и. - не исследовалось

Штамм ПетроНов был выделен от больного (возраст 17 лет) с клиническим диагнозом: эпидемический паротит, средней степени тяжести (табл. 12). Через 3 сут после появления температуры было зарегистрировано резкое увеличение околоушных слюнных желез, озноб, рвота, общая слабость, боли при глотании, головные боли. При осмотре зафиксировано увеличение подчелюстных лимфоузлов до 3,0 х 3,0 см, болезненность околоушных слюнных желез, ригидность затылочных мышц, повышение температуры тела до 39,90С.

Таблица 12

Получение и изучение свойств штамма ПетроНов вируса паротита

Идеентификационный номер

Возраст, пол и вакци-нальная история

Срок забора образцов от появления клинических признаков

Образцы

Лабораторные исследования

Штамм

ПЦР

Серологические исследова-ния (титры антител)

Биологические исследования (посев на культуру клеток Vero)

Название штамма (изолята)

Генотип

Ig M

Ig G

Появление симпластов

ПЦР с культурой клеток

П-04/04

/03

17 л,

в 1.5 год вакцинирована

7 сут

Кровь

Смыв

-

+

-

1:280

-

+

-

+

ПетроНов

Н

11 сут

Кровь

Смыв

-

-

+

1:330

-

-

-

-

14 сут

Кровь

Смыв

н.и

н.и

+

1:370

-

-

-

-

5,5 мес.

Кровь

Смыв

н.и

н.и

-

1:616

н.и.

н.и.

н.и.

н.и.

н.и. - не исследовалось.

Для проведения работ по генотипированию выделенного изолята продукт ПЦР, полученный при использовании образца носоглоточного смыва, был секвенирован. Анализ генома вируса показал его принадлежность к генотипу Н (рис. 9).

Рис. 9А

Рис. 9Б

Рис. 9В

Рис. 9. Филогенетические деревья для изученных последовательностей вируса паротита, (А) – по SH-гену (сравнение с референс-штаммами), (Б) - по полным нуклеотидным последовательностям генома вируса, (В) – по М-гену.

Принятое обозначения штамма: AUS64Jl2 = A- генотип, US- страна выделения (США), 64–год выделения, Jl – сокращенное название штамма (Jeryl-Lynn), 2 – номер деривата штамма (если несколько дериватов одного штамма), Х - неизвестно.

CRU94DRA – штамм Драгун,

HRU03Pet – штамм ПетроНов.

Для изучения возможных изменений в геноме вируса, вызвавших тяжелое течение инфекции и столь длительную циркуляцию вируса в организме больного, из зараженной культуры клеток Vero (3-й пассаж вируса от исходного, выделенного из носоглотки больного) была выделена РНК в достаточном для проведения работ по секвенированию количестве. После секвенирования было проведено выравнивание нуклеотидных последовательностей для 16 полных геномов относительно штамма ПетроНов и построен график плотности распределения в них мутаций (рис. 10). Изученные геномы распределились по последовательностям на три группы. В первую группу попал штамм ПетроНов и наиболее близкий к нему штамм HUSXX881, другая группа, наиболее далекая от названных, представлена тремя вакцинными штаммами Jeryl Lynn (AUS64Jl1, AUS64Jl2, AUS64Jl3), остальные 12 штаммов образуют третью, промежуточную группу. Следует отметить, что точки пересечения кривых для этих трех групп отсутствуют, что говорит об отсутствии явных рекомбинационных механизмов для исследованных штаммов вируса паротита.

Филогенетический анализ, как для полных геномов в целом, так и отдельно для каждого гена показал, что между дикими и вакцинными штамммами явных отличий нет (см. рис. 9). С незначительными перестановками внутри подгрупп, деревья для всех генов были схожи и практически повторяют дерево для полного генома (см. рис. 9, Б). Тем не менее, интересно отметить, что филогенетическое дерево отдельно для М-гена отличается от деревьев для всех других генов: штамм ПетроНов попадает в подгруппу вакцинных штаммов А-генотипа; а описанный ранее авторами штамм Драгун по М-гену наиболее близок к вакцинному штамму AUS64Jl2 (см. рис. 9, В). В настоящее время принято генотипировать изоляты вируса паротита по наиболее вариабельному фрагменту генома, включающему С-концевую часть гена F и SH-ген. Выделенный изолят относился к генотипу Н (см. рис. 9, А). Для отнесения выделенного изолята к этому генотипу были использованы референс-штаммы, предложенные в работе L. Jin и соавт. (2005).

В результате проведенной работы был выделен и первично охарактеризован новый штамм вируса паротита. Штамм получил название ПетроНов и был депонирован в коллекцию микроорганизмов ГНЦ ВБ "Вектор" (номер - V-330). Полная нуклеотидная последовательность штамма была депонирована в базу данных GenBank (№ AY681495).

NP  P(V/I)  M F  SH  HN  L гены вируса

Рис. 10. Плотность вариабельности для 16 полных геномов вируса паротита относительно штамма ПетроНов. Окно расчета 1500 н.о., шаг - 20 н.о.

Принятое обозначения штамма: AUS64Jl2 = A- генотип, US- страна выделения (США), 64–год выделения, Jl – сокращенное название штамма (Jeryl-Lynn), 2 – номер деривата штамма (если несколько дериватов одного штамма), Х – неизвестно.

В результате проведенных исследований впервые на территории России (Западная Сибирь) была показана циркуляция 2 генотипов вируса паротита – С и Н.

Таким образом, проведены молекулярно-эпидемиологические исследования, позволившие выявить основные генотипы вирусов кори и паротита, циркулирующие на территории Западной Сибири. Показана циркуляция генотипа D6 вируса кори в России и циркуляция генотипов С и Н вируса паротита. Выделенные изоляты этих генотипов позволили изучить основные свойства новых генотипов этих вирусов.

ВЫВОДЫ

  1. Разработана и запатентована технология получения концентрированных препаратов вируса Марбург из культуральной вируссодержащей жидкости в соответствии с принципами обеспечения биологической безопасности в вирусологических лабораториях.
  2. На экспериментальных лабораторных животных (белые мыши, морские свинки) изучены иммуногенные и протективные свойства основных структурных белков вируса в сравнении с инактивированным препаратом вируса Марбург. При этом установлено:

а) препарат нативного белка NP, полученный методом обращенно-фазовой хроматографии, вызывает образование вирусспецифических антител, стимулирует развитие специфического клеточного иммунитета и защищает животных от введения летальных доз вируса Марбург (коэффициент защиты К.З. = 47 + 12 %, 70 + 14 %1),

б) препарат нативного белка VP40, полученный методом обращенно-фазовой хроматографии, вызывает образование вирусспецифических антител, стимулирует развитие специфического клеточного иммунитета и защищает животных от введения летальных доз вируса Марбург (К.З.= 0 %, 16 + 8 %),

в) препарат рекомбинантного белка GP, полученный в бакуловирусной системе, вызывает образование вирусспецифических антител, стимулирует развитие специфического клеточного иммунитета и защищает животных от введения летальных доз вируса Марбург (К.З.= 16 + 6 %)2,

г) рекомбинантный белок GP в составе осповакцины вызывает образование вирусспецифических антител, стимулирует развитие специфического клеточного иммунитета, но не защищает животных от введения летальных доз вируса Марбург (К.З.= 0 %),

в) препарат рекомбинантного белка VP24, полученный в бакуловирусной системе, вызывает образование вирусспецифических антител, стимулирует развитие специфического клеточного иммунитета и защищает животных от введения летальных доз вируса Марбург (К.З.= 14 + 4 %),

  1. Предложены и обоснованы новые способы доставки живой коревой вакцины и создания рекомбинантных препаратов. При этом установлено:

а) использование таблетированной и инкапсулированной форм живой коревой вакцины для перорального применения вызывает у кроликов появление специфических антител к вирусу кори,

б) введение живой коревой вакцины в просвет тонкого отдела кишечника обезьяны приводит к появлению специфических антител классов M, A и G, а также нейтрализующих антител,

в) при введении кандидатной ДНК вакцины на основе белка H вируса кори у мышей формируется специфический гуморальный и клеточный ответ.

  1. На основе выделеного изолят вируса кори (штамм НовО96) разработана и после государственных испытаний и испытаний в сети лабораторий ВОЗ внедрена в практику здравоохранения «Тест-система иммуноферментная для определения антител класса G к вирусу кори» с регистрацией результатов в МЕ.
  2. В рамках программы элиминации кори проведены работы по изучению коллективного иммунитета в различных возрастных группах населения, выявлена группа (возраст 16-25 лет) с наибольшим количеством серонегативных лиц.
  3. Разработана «Тест-система иммуноферментная для определения антител класса М к вирусу кори», использованием собранной и аттестованной панели сывороток, содержащих и не содержащих антитела класса М к вирусу кори, подтверждена ее эффективность.
  4. На основе выделенного изолята вируса паротита (штамм Драгун) разработана «Тест-система иммуноферментная для определения антител класса G к вирусу паротита».
  5. Показана циркуляция генотипа D6 вируса кори и генотипов C и H вируса паротита на территории РФ.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

Статьи в ведущих научных журналах, рекомендованных ВАК Минобразования и науки РФ для публикации основных результатов диссертации

  1. Стрельцова М.А., Агафонов А.П., Игнатьев Г.М. Чувствительность культур клеток различных линий к вирусу Марбург // Вопр. вирусол.– 1991.– N. 5.– C.437-438.
  2. Игнатьев Г.М., Стрельцова М.А, Агафонов А.П., Кузьмин В.А. и др. Сравнительное изучение некоторых иммунологических показателей при введении инактивированного вируса Марбург морским свинкам // Вопр. вирусол.– 1991.– N. 2.– C.421-423.
  3. Лавриненко И.А., Агафонов А.П. Изучение функциональной активности лимфоцитов у людей, вакцинированных против геморрагической лихорадки Марбург // Иммунология .– 1993.– N. 1.– C.34-36.
  4. Игнатьев Г.М., Стрельцова М.А., Агафонов А.П. Жукова Н.А., Кашенцева Е.А., Воробьева М.С. Некоторые показатели иммунитета у животных, иммунизированных инактивированным вирусом Марбург, после заражения гомологичным вирусом // Вопр. вирусол.– 1994.– N. 1.– C.13-17.
  5. Игнатьев Г.М., Стрельцова М.А., Агафонов А.П. Прозоровский Н.С., Жукова Н.А., Кашенцева Е.А., Воробьева М.С. Иммунологические показатели у морских свинок при моделировании геморрагической лихорадки Марбург // Вопр. вирусол. – 1994.– N. 5.– C.169-171.
  6. Игнатьев Г.М., Стрельцова М.А., Агафонов А.П., Кашенцева Е.А. Механизмы протективного иммунного ответа при моделировании лихорадки Марбург на обезьянах // Вопр. вирусол. – 1995.– N. 3.– C.109-113.
  7. Агафонов А.П., Калиберов С.А., Патрушева И.В., Ничеухина С.Н., Перебоева Л.А., Игнатьев Г.М. Изучение иммуно-биологических свойств штаммов вируса паротита // Вопр. вирусол.– 1995.– N. 3.– C.115-119.
  8. Ignatyev G.M., Agafonov A.P., Streltsova M.A., Kashentseva E.A. Inactivated Marburg virus elicits a nonprotective immune response in Rhesus monkeys //J. Biotechnol.– 1996.– N. 44.– P.111-118.
  9. Игнатьев Г.М., Стрельцова М.А., Агафонов А.П., Кашенцева Е.А., Прозоровский Н.С. Экспериментальное изучение возможности лечения геморрагической лихорадки Марбург десфералом, рибавирином и гомологичным интерфероном // Вопр. вирусол.– 1991.– N. 5.– C.206-209.
  10. Агафонов А.П., Игнатьев Г.М., Патрушев Н.А., Ничеухина С.Н., Рябчикова Е.И., Денисов С.И., Блинов В.М.. Выделение сибирского изолята вируса паротита // Вопр. вирусол.– 1997.– N. 5.– C.222-226.
  11. Агафонов А.П., Ничеухина С.Н., Мерзликн Н.В., Кломакова Е.А., Гончаров А.Н., Майданюк А.Г., Игнатьев Г.М. Сравнительное изучение методов определения антител к вирусу кори // Вопр. вирусол.– 1997.– N. 1.– C.44-47.
  12. Santibanez S., Heider A., Gerike E., Agafonov A., Schreier E. Genotyping of measles virus isolates from Central Europe and Russia // J. Med. Virol. – 1999.– Vol. 58. –N. 3.– P.313-320.
  13. Полтавченко А.Г., Агафонов А.П., Ничеухина С.Н., Караваев В.С., Игнатьев Г.М. Использование иммуносуспензий на основе угля для определения антител к вирусу паротита методом дот-иммуноанализа // Биотехнология. – 1999.– N. 3.– C.86-91.
  14. Ignatyev G., Steinkasser A., Streltsova M., Atrasheuskaya E., Agafonov A., Lubitz W. Experimental study on the possibility of treatment of some hemorrhagic fevers // J. Biotechnol. – 2000.– N. 83.– P. 67-76.
  15. Агафонов А.П., Стрельцова М.А., Суслопаров И.М., Игнатьев Г.М. Иммунологические показатели у больных эпидемическим паротитом // Вопр. вирусол. – 2001.– N. 4.– C.30-33.
  16. Колокольцов А.А., Давидович И.А., Стрельцова М.А., Агафонов А.П. Использование препаратов интерферона для экстренной профилактики геморрагической лихорадки Марбург на модели обезьян // Бюлл. экспер. биол. – 2001.– N. 7.– C.88-91.
  17. Stittelaar K.J., de Swart R.L., Vos H.W., van Amerongen G., Agafonov A.P., Nechaeva E.A., Osterhaus A.D. Enteric administration of a live attenuated measles vaccine does not induce protective immunity in a macaque model // Vaccine. – 2002.– Vol. 20. –N. 23-24.– P.2906-2912.
  18. Agranovski I. E., Safatov A. S., Borodulin A. I., P'ankov O. V., Petrishchenko V. A., Sergeev A. N., Agafonov A. P., Ignatiev G. M., Grinshpun S.S. Agranovski V. New personal sampler for viable airborne viruses: feasibility study // J. Aerosol Science. – 2003.– Vol. 34.– P.581-592.
  19. Агафонов А.П., Каменева С.Н., Агафонова О.А., Неверов А.А., Игнатьев Г.М. Изучение вирусологических и иммунологических показателей у больных рассеянным склерозом // Вестник РАМН. – 2004.– N. 8.– C.3-6.
  20. Максимов Н.Л., Букин Е.К., Агафонов А.П., Неверов А.А., Карпенко Л.И., Ильичев А.А., Игнатьев Г.М. Противокоревая ДНК-иммунизация в эксперименте: иммуногенность и безопасность // Вопр. вирусол. – 2005.– N. 1.– C.4-8.
  21. Агафонов А.П., Игнатьев Г.М., Свистов В.В., Смирнов И.В., Кривошеин Ю.С. Изучение in vitro антивирусных свойств Мирамистина в отношении вирусов кори и паротита // Антибиотики и химиотерапия. – 2005.– N. 5-6.– C.17-19.
  22. Агафонов А.П., Неверов А.А., Каменева С.Н., Сараев Д.В., Гинько З.И., Блинов В.М., Чумаков К.М., Игнатьев Г.М., Зверев В.В. Выделение, генотипирование и анализ полной нуклеотидной последовательности сибирского изолята вируса паротита // Эпидемиол. и вакцинопрофилакт. – 2007.– N. 5.– C.34-41.
  23. Agranovski I.E., Safatov A.S., Agafonov A.P. Pyankov O.V., Sergeev A.N. Monitoring of airborne mumps and measles viruses in a hospital // Clean. – 2008.– Vol. 36. –N. 10-11.– P.845-849.

Работы, опубликованные в сборниках научных трудов, материалах конференций и других изданиях:

  1. Игнатьев Г.М., Агафонов А.П., Твердохлебов А.В., Стрельцова М.А. и др. Изучение иммуногенности инактивированных вирусов Марбург и Мачупо// В кн: Итоги науки и техники. Серия "Вирусология", "Арбовирусы и арбовирусные инфекции". М. 1991 г, С.18-22.
  2. Agafonov A.P., G.M.Ignatyev, Z.A.Akimenko, V.E.Volchkov. Study of immunogenic and protective properties of Marburg virus GP, NP and VP40 protein// Abstracts IXth International congress of virology.- Glasgow Scotland.- 1993.- P52-7.- p.300.
  3. Ignatyev G.M., Volchkov V.E, Blinov V.M., Samukov V.V., Agafonov A.P., Streltsova M.A., Kashentseva E.A. Phenomenon of immunosupression caused by Filoviruses // Intern. J. Immunorehabilitat, – 1994.– N. 1(Supp).– C.78-79.
  4. Agafonov A.P., Streltsova M.A., Kashentseva E.A., Ignatyev G.M. Possible mechanism of immunosuppression for filoviruses infection // Intern. J. Immunorehabilitat, – 1994.– N. 1(Supp).– C.86-87.
  5. Ignatyev G.M., Streltsova M.A., Agafonov A.P., Kashentseva E.A. Immunity indeces in the personnel involved in Marburg virus investigation // Transactions of the Royal Society of Tropical Medicine and Hygiene. – 1996.– Vol. 90. –N. 5.– P.472.
  6. Becker S., Volchkov V. E., Muhlberge E., Klenk H.-D., Agafonov A.P., G.M.Ignatyev. A recombinant vaccina virus expressing the surface protein of Marburg virus does not protected guinea pigs against Marburg-virus infection // Abstracts Xth International congress of virology.- Ierusalem, Israel.- 1996, PW 60-40, P. 259
  7. Nechaeva E.A., Varaksin N.A., Rjabicheva T.A., Kolokoltsova T.D., Ignatiev G.M., Agafonov A.P. Development of production technology of live measles vaccine for peroral administration. Animal Cell Technology: from Vaccine to Genetic Medicine, Kluwer Academic Publishers, M.J.T. Carrondo (eds), 1997, Р.197-202.
  8. Ignatyev G.M., Streltsova M.A., Kashentseva E.A., Patrushev N.A., Ginko S.I., Agafonov A.P. Immunity indexes in the personnel involved in haemorrhagic virus investigation. // In book: Proceedings of the 1996 ERDEC Scientific Conference on Chemical and Biological Defense Research. Ed. D.A.Berg, 1997., Aberdeen Proving Ground, MD 21010-5423, P. 323-330.
  9. Nechaeva E.A., Kashentseva E.A., Agafonov A.P., Varaksin N.A., Bondarenko V.N., Konstantinov A.P., Kitz I.V., Senkina T.Y., Zhilina N.V. New form of the live measles vaccine for oral administration. Animal Cell Technology: New Developments-New Application, Kluwer Academic Publishers, 1998, Р.573-575.
  10. Агафонов А.П., Каменева С.Н., Отрашевская К. А., Игнатьев Г.М. Молекулярно-эпидемиологическое изучение кори в Западно-Сибирском регионе в 1995-2001гг // Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера. Вторая научная конференция с международным участием. Новосибирск, Россия, 2002. - С.228.
  11. Ignatyev G., Agafonov A.P., Kameneva S., Atrasheuskaya A. Molecular epidemiological study of measles in Western Siberia (Russia) during 1995 - 2001: in XIIth International Congress of Virology. Poster Abstract 143V- #V1302. IUMS Paris, France; 2002.
  12. Bukin E.K., Atrasheuskaja E.A., Kamaneva S.N., Maksimov N.L., Agafonov A.P., Ignatiev G.M. Evaluation of measles-specific immunity in a high-risk group // Clin. Microbiol. And Infection. – 2004.– Vol. 10. –N.3 (Supp.). P.340.
  13. Agranovski I.E., Sergeev A.N., Pyankov O.V., Petrishchenko V.A., Agafonov A.P., Ignat’ev G.M., Borodulin A.I., Safatov A.S. Testing of a new personal sampler for detection of viable viruses in aerosol state // Atmos. Oceanic Opt. – 2004. – Vol. 17, N. 5-6. – P. 429 - 432.
  14. Agranovski I. E., Safatov A. S., Borodulin A. I., Pyankov O. V., Petrishchenko V. A., Sergeev A. N., Agafonov A. P., Ignatiev G. M., Sergeev A. A. and Agranovski V. Inactivation of viruses in bubbling processes utilized for personal bioaerosol monitoring // Appl. Environm. Microbiol. – 2004.– Vol. 70. –N. 12.– P.6963-6967.
  15. Тихонова Н.Т., Журавлева Ю.Н., Мамаева Т.А., Наумова М.А., Игнатьев Г.М., Неверов А., Агафонов А.П., Liffick S., Tashaev V., Rota P., Bellini W. Генотипы вируса кори, циркулирующего на территории РФ // Развитие международного сотрудничества в области изучения инфекционных заболеваний: Междунар. конф. Новосибирск: ЦЭРИС, 2004. С.57.
  16. Игнатьев Г.М., Неверов А.А., Отрашевская Е.В., Каменева С.Н., Агафонов А.П., Максимов Н.Л., Тимошенко Л.А., Carbone K. Проблемы лабораторной диагностики кори и паротита. Развитие международного сотрудничества в области изучения инфекционных заболеваний: Междунар. конф. Новосибирск: ЦЭРИС,2004. С.249.
  17. Дутов В.Н., Пьянков С.А., Демина О.К., Агафонов А.П., Сергеев А.Н., Дроздов И.Г. Изучение коллективного иммунитета к кори у детей Новосибирской и Смоленской областей в ходе реализации национальной программы элиминации кори //Биотехнология в Казахстане: Проблемы и перспективы инновационного развития: Междунар. науч.-практич. конф., посвящ. 50-летию науч.-исслед. ин-та пробл. биол. безопасности. Алматы. 2008. С.452.

Монографии:

  1. Агафонов А.П., Пьянков С.А., Нечаева Е.А., Неверов А.А., Каменева С.Н., Рябчикова Е.И., Агафонова О.А., Сергеев А.Н., Нетесов С.В., Игнатьев Г.М., Лосев М.В. Корь: современные представления о возбудителе, клиника, диагностика, профилактика // Новосибирск, изд. «Полиада про», 2005, 39 с.
  2. Онищенко Г.Г., Ежлова Е.Б., Пакскина Н.Д., Брагина И.В., Кутырев В.В., Куличенко А.Н., Топорков А.В.,……., Дроздов И.Г., Сергеев А.Н., Нетесов С.В., Локтев В.Б., Агафонов А.П., и соавт. Лабораторная диагностика опасных инфекционных болезней. Практическое руководство / Под ред. Академика РАМН, проф. Г. Г. Онищенко, чл.-корр. РАМН, проф. В.В. Кутырева.- М.: ОАО «Издательство «Медицина», издательство «Шико», 2009.- 472 с.
  3. Агафонов А.П., Агафонова О.А., Азаев М.Ш., Гинько З.И., Демина О.К., Дроздов И.Г., Дутов В.Н., Иванова Л.К., Козловский Л.И., Лосев М.В., Малкова Е.М., Нетесов С.В., Нечаева Е.А., Пьянков С.А., Рябчикова Е.И., Семенцова А.О., Сергеев А.Н., Сергеев А.А., Терновой В.А., Шиков А.Н. Вакциноуправляемые респираторные вирусные инфекции. Грипп, корь, эпидемический паротит, краснуха / Под ред. проф. И.Г. Дроздова / Новосибирск: Изд-во Типография N 1, 2008. - 210с.

Патенты:

  1. Агафонов А.П., Стрельцова М.А., Игнатьев Г.М., Твердохлебов А.В.; Чепурнов А.А.; Калиберов С.А.; Кузьмин В.А.; Черный Н.Б. Способ получения концентратов вирусов, вызывающих геморрагические лихорадки и обладающих иммуногенной и протективной активностью. 1995. Патент РФ RU 2029561 С1.
  2. Полтавченко А.Г., Игнатьев Г.М., Агафонов А.П., Полтавченко А.Г. Иммунодиагностикум для определения сывороточных антител к инфекционным агентам методом ДОТ-иммуноанализа на пористых стрипах.1999. Патент РФ № 2187121 (420).
  3. Агафонов А.П., Каменева С.Н., Игнатьев Г.М. Штамм вируса кори NovO/96 для получения антигена - компонента тест-системы и иммуноферментная тест-система для диагностики антител к вирусу кори. 2002. Патент RU № 2230785 C2.
  4. Агафонов А.П., Пьянков С.А., Дутов В.Н., Демина О. К., Туманов Ю.В., Лосев М. В., Сергеев А.Н., Дроздов И.Г. Штамм вируса паротита Драгун для получения антигена - компонента тест-системы и иммуноферментная тест-система для диагностики антител к вирусу паротита. 2007. Патент RU 2348691 С1.

Методические указания:

  1. Покровский В.И., Шипулин Г.А., Манзенюк И.Н.; Кутырев В.В., Шарова И.Н., Осина Н.А., Куклев В.Е., Щербакова С.А.; Куличенко А.Н.; Игнатьев Г.М.; Дроздов И.Г., Сергеев А.Н., Шиков А.Н., Семенцова А.О., Бабкина И.Н., Терновой В.А., Агафонов А.П.; Верещагин А.И., Зароченцев М.В., Воронцова Т.В., Опочинский Э.Ф. Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I - IV групп патогенности. Методические указания МУ 1.3. 2569-09. – М.: Федеральный центр гигиены и эпидемиологии Роспотребнадзора, 2009. - 17 c.

Список использованных сокращений:

БОЕ

бляшкообразующая единица

ВГЖХ

высокоэффективная газо-жидкостная хроматография

ВИЧ/СПИД

вирус иммунодефицита человека, синдром приобретенного иммунодефицита

ВОЗ

Всемирная Организация Здравоохранения

ВПЧ

вирусоподобная частица

ГИСК

Государственный институт стандартизации и контроля

ДНК

дезоксирибонуклеиновая кислота

ИАМ

инактивированный антиген вируса Марбург

ИЛ

интерлейкин

ИФА

иммуноферментный анализ

КВЖ

Культкральная вируссодержащая жидкость

ЛД50

50%-ная, или средняя, летальная доза

МЕ

международная единица (измерение активности препарата)

МЗ РФ

Министерство здравоохранения Российской Федерации

МНТЦ

Международный научно-технический центр

ОП

оптическая плотность

ООВИ

особо опасные вирусные инфекции

ПААГ

полиакриламидный гель

РБТЛ

реакция бластной трансформации лимфоцитов

РН

реакция нейтрализации

РТГА

реакция торможения гемагглютинации

ФСП

Фармакопейная статья предприятия

АТСС

Американская коллекция клеточных культур (American Type Cultures Collection)

CDC

Центры по контролю и профилактике заболеваний США (Centers for Disease Control and Prevention)

СD

антигенраспознающий Т-клеточный рецептор

WHO

Всемирная Организация Здравоохранения (World Health Organization)


при 2-х кратной иммунизации дозой 20 мкг/животное, доза вируса 50 ЛД50/животное

при 1-х кратной иммунизации дозой 20 мкг/животное, доза вируса 50 ЛД50/животное

 



© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.