WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

Мазепа Владимир Николаевич

Оптимизация и комплексное использование полимеразной цепной реакции в диагностике актуальных инфекционных заболеваний на модели острых кишечных, хеликобактерной, негонококковых урогенитальных инфекций и вирусных гепатитов.

03.02.03-микробиология

Автореферат

диссертации на соискание ученой степени

доктора биологических наук

Москва

2010

Работа выполнена в ФГУН «Нижегородский научно-исследовательский институт эпидемиологии и микробиологии им. академика И.Н. Блохиной» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека.

Научные консультанты:

Доктор медицинских наук, профессор Ефимов Евгений Игоревич

Официальные оппоненты:

Доктор медицинских наук, профессор  Несвижский Юрий Владимирович

Доктор медицинских наук, профессор  Русакова Екатерина Владимировна

Доктор биологических наук, профессор  Белецкий Игорь Петрович

Ведущая организация:

Государственное образовательное учреждение высшего профессионального образования Военно-медицинская академия им. С.М. Кирова МО РФ

Защита диссертации состоится «_____» ______________ 20___ г. в ____ часов на заседании Диссертационного совета Д 208.046.01 при Федеральном государственном учреждении науки «Московский научно-исследовательский институте эпидемиологии и микробиологии им. Г.Н. Габричевского» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по адресу: 125212, г. Москва, ул. Адмирала Макарова, д. 10.

С диссертацией можно ознакомиться в библиотеке ФГУН «Московский научно-исследовательский институте эпидемиологии и микробиологии им. Г.Н. Габричевского» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по адресу: 125212, г. Москва, ул. Адмирала Макарова, д. 10.

Автореферат разослан «____» ____________ 2010 г.

Ученый секретарь диссертационного совета,

доктор медицинских наук                                                О.Ю. Борисова                        

                                                                       

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы.

На современном этапе для успешного выполнения приоритетных национальных проектов и правительственных программ в сфере здравоохранения, которые традиционно ориентированы на предупреждение распространения и ликвидацию актуальных и социально-значимых инфекционных заболеваний, важное значение приобретает совершенствование методов их лабораторной диагностики.

Актуальной задачей является разработка и внедрение в практическую медицину и систему эпиднадзора технологий, отвечающих следующим требованиям: высокая чувствительность, прецизионная специфичность, информативность, объективность, экспрессность, высокая производительность, универсальность (выявление различных возбудителей в любом типе клинического материала), биобезопасность для исполнителей, возможность автоматизации процесса. Полимеразная цепная реакция (ПЦР), основанная на выявлении уникальных фрагментов геномов инфекционных агентов, соответствует данным требованиям, существенно расширяет возможности диагностики, позволяет обнаруживать некультивируемые и труднокультивируемые формы микроорганизмов (Говорун B.М.,2000; Шагинян И.А.,2000;Ребриков Д.В., 2009; Mullis K.B., 1994; Newton C.R.,1997; Farrell D.J., 2001). Универсальность метода ДНК-диагностики и автоматизация практически всех этапов анализа позволяют осуществлять одновременное выявление нескольких инфекционных агентов, способных вызывать определенный тип патологии, проводить скрининговые обследования различных контингентов населения в профилактических целях.

Несмотря на обилие публикаций, посвященных методу ПЦР и его использованию в диагностике отдельных нозологических форм, работы содержащие материалы комплексных ПЦР исследований инфекционных заболеваний, обусловленных широким спектром возбудителей, достаточно редки. Данные о частоте выявления возбудителей зачастую противоречивы, а проблемы ПЦР обследования обширных контингентов одновременно на несколько различных инфекционных агентов и определения роли и места молекулярно-биологических методов в общей системе лабораторной диагностики инфекционных заболеваний освещены недостаточно.

Широко распространенные социально значимые инфекционные заболевания, такие как острые кишечные и негонококковые урогенитальные инфекции, хеликобактериозы и вирусные гепатиты приносят  значительный вред здоровью жителей России и экономический ущерб (Кишкун А.А., 2002; Козлова В.И., 2003; Шахгильдян И.В. 2003; Подколзин А.Т., 2004,). Кроме этого, хеликобактериозы и гепатиты существенно снижают продолжительность жизни, а негонококковые урогенитальные инфекции отрицательно влияют на репродуктивную функцию. Активизация и оптимизация внедрения современных технологий в диагностику этих инфекций способствует своевременному назначению этиотропной терапии, уменьшению продолжительности лечения и количества осложнений.

В связи с вышеизложенным, особую актуальность приобретают вопросы выбора наиболее значимых направлений и объектов исследования, создания и подбора тест-систем для ПЦР-диагностики, их апробации и адаптации к медицинской практике, разработки оптимальных алгоритмов применения как отдельных диагностикумов, так и сочетаний нескольких тест-систем для улучшения технологичности, повышения эффективности и уменьшения стоимости исследований.

Цель работы – Оптимизировать и адаптировать собственные и имеющиеся отечественные экспериментальные и коммерческие ПЦР тест-системы к решению задач диагностики острых кишечных инфекций, хеликобактерной инфекции, негонококковых урогенитальных инфекций, вирусных гепатитов; разработать стратегию и тактику использования метода ПЦР для наиболее рационального и эффективного выявления возбудителей этих заболеваний.

Задачи исследования:

1. Провести оптимизацию методов ПЦР-диагностики для выявления актуальных патогенов - возбудителей ОКИ, хеликобактерной инфекции, вирусных гепатитов В и С, НУГИ.

2. Разработать алгоритмы диагностики ОКИ, хеликобактерной инфекции, вирусных гепатитов В и С, НУГИ с использованием оптимизированных нами методов на основе отечественных ПЦР тест-систем.

3. Апробировать и адаптировать к практической диагностике систему молекулярно-биологических методов выявления актуальных бактериальных возбудителей ОКИ – бактерий родов Shigella, Salmonella, Yersinia, Campylobacter и генов, ответственных за патогенность энтеробактерий.

4. Оценить возможности метода ПЦР при изучении распространения бактерий H. pylori у больных разных возрастных групп с различными типами гастродуоденальной патологии, а также при внутривидовом типировании и выявлении генов факторов патогенности H pylori.

5. Разработать экономичный вариант метода ПЦР для оценки вирусной нагрузки у больных вирусными гепатитами В и С, изучить особенности репликации вирусов гепатитов В, С, D, G при моно- и смешанном инфицировании, определить эффективность и значимость вертикального пути передачи вирусов гепатитов В и С в Нижегородском регионе.

6. С помощью комплексного ПЦР исследования получить новые знания о распространении и особенностях циркуляции наиболее значимых возбудителей НУГИ (U. urealyticum, M. hominis, C trachomatis, Cytomegalovirus, Herpes simplex I/II) у взрослых и детей, и о возможной связи отдельных представителей НУГИ с формированием различных форм патологии.

7. На основе полученных новых знаний определить роль и место молекулярно-биологических методов в лабораторной диагностике НУГИ, ОКИ,  хеликобактерной инфекции, парентеральных вирусных гепатитов, провести апробацию разработанных алгоритмов их диагностики в практической медицине.

Научная новизна работы.

Впервые в Нижегородском регионе проведено освоение и внедрение в практическое здравоохранение и систему эпиднадзора метода ПЦР. На основе многолетних системных исследований группы возбудителей актуальных инфекционных заболеваний (ОКИ, хеликобактерная инфекция, НУГИ, вирусные гепатиты) получена новая объективная информация о распространенности и особенностях циркуляции инфекционных агентов среди населения.

Разработаны оптимальные алгоритмы применения амплификационных методов для решения задач диагностики ОКИ, хеликобактерной инфекции, вирусных гепатитов, НУГИ. Определены роль и место данных технологий в общей системе диагностических исследований для наиболее рациональной и эффективной реализации последних.

Впервые разработаны экспериментальные лабораторные тест-системы для выявления бактерий рода Shigella, и генов токсинов энтеробактерий (термолабильного – LT; термостабильного - ST; шигатоксина первого типа - VT1).

Впервые установлено, что использование ПЦР при первичном обследовании больных с подозрением на ОКИ позволяет более чем в 2 раза увеличить эффективность выявления бактерий родов Shigella и Salmonella по сравнению с классическим микробиологическим исследованием.

Впервые в РФ проведен многолетний мониторинг (18 лет) клинических изолятов энтеробактерий. Установлены особенности циркуляции в Нижнем Новгороде штаммов энтеробактерий, содержащих гены факторов патогенности. Наиболее распространены варианты, имеющие оперон инвазивности (Shigella ssp., E.coli). Показано, что циркуляция токсигенных штаммов энтеробактерий нехарактерна для Нижегородского региона. Выявлены единичные случаи обнаружения гена шигаподобного токсина первого типа у представителей Shigella ssp., E. col.i Впервые выявлен факт наличия у E. coli O127 генетических структур, сходных по нуклеотидной последовательности с геном адгезии холерного вибриона.

Установлена широкая распространенность H. pylori среди больных разных возрастов с различными типами гастродуоденальной патологии в Нижнем Новгороде (частота выявления 58,9% у детей и 82,9% у взрослых). Определена распространенность токсигенных вариантов H. pylori в бактериальной популяции. Варианты сagA +  составили 76,4%, а варианты  vakА + - 66,0% в популяции соответственно.

Определена активность репликации вирусов у больных хроническими гепатитами В и С разных возрастов при моноинфицировании, частота выявления вирусных нуклеиновых кислот составляла 48 - 50%. Установлено, что эффективность репликации вирусов гепатитов B, C, D, G снижается при смешанном инфицировании (вирусные нуклеиновые кислоты выявлялись суммарно в 25,5 -37,0% случаев в зависимости от состава ассоциации).

Определена вероятность вертикальной передачи вирусов гепатитов В и С в Нижнем Новгороде - 12,8% и 10,0% соответственно.

Впервые изучена циркуляция наиболее распространенных в Европе генотипов вируса гепатита С (1а, 1b, 2, 3а) на территории г. Нижнего Новгорода и Нижегородской области. Показано доминирование генотипов 1b и 3а, частота их выявления несколько варьировала по годам и составляла 51,8-54,3% и 46,1-49,5% соответственно.

Исследованы особенности распространенности наиболее значимых возбудителей НУГИ – U. urealyticum, M. hominis, C trachomatis, Cytomegalovirus, Herpes simplex I/II. Они обнаружены у 68% женщин и 40% мужчин. Показано многолетнее стабильное сохранение распределения возбудителей по частоте выявления. В течение всего периода наблюдения чаще других обнаруживались U. urealyticum (54,2% у женщин, 29,7% у мужчин)и M. hominis (25,8% у женщин, 14,5% у мужчин). Остальные виды инфекционных агентов определялись существенно реже.

На основе анализа частоты выявления возбудителей НУГИ в разных возрастных группах установлены этапы колонизации макроорганизма уреаплазмами, микоплазмами и вирусами группы гепеса. Показана связь возбудителей НУГИ с нарушениями репродуктивной функции и воспалительными процессами в различных отделах урогенитального тракта.

На клонированные фрагменты генов термолабильного токсина (LT) фактора адгезии (CFA1) и на алгоритм использования метода ПЦР для выявления возбудителей НУГИ у детей первых лет жизни получены патенты Российской Федерации № 2031948 по заявке №5016860/13; №2049822 по заявке № 92 – 012954/13; №2271003 по заявке №2003132188 соответственно.

Теоретическое значение работы.

Работа является одной из первых в Российской федерации, в которой рассматриваются проблемы комплексного подхода к ПЦР диагностике инфекционных заболеваний, обусловленных широким спектром возбудителей.

Предложена система адаптации отечественных ПЦР тест-систем к решению задач практической медицины и эпиднадзора, а также разработки алгоритмов рационального использования метода ПЦР в диагностике актуальных инфекционных заболеваний.

Полученные новые данные о распространенности труднокультивируемых форм возбудителей расширяют представления об эпидемиологических особенностях ОКИ, хеликобактерной инфекции, НУГИ и вирусных гепатитах.

Предложенные алгоритмы диагностики НУГИ, ОКИ, парентеральных вирусных гепатитов, хеликобактерной инфекции с применением метода ПЦР могут быть использованы в дальнейшем при разработке новых диагностических стандартов. Перечни ведущих инфекционных агентов, предложенные для одновременного выявления при комплексной ПЦР-диагностике НУГИ и ОКИ могут служить основой комплектации мультиплексных ПЦР-тест-систем с детекцией продуктов амплификации методом биочипов.

Практическое значение работы.

Направления исследований были выбраны в соответствии с потребностями и пожеланиями учреждений практического здравоохранения Нижегородского региона. Внедрение в практику метода ПЦР и разработка алгоритмов их применения позволили усовершенствовать клиническую диагностику и систему эпиднадзора и мониторинга за возбудителями бактериальных ОКИ, хеликобактериоза, НУГИ и вирусных гепатитов.

Оптимизация использования тест-систем , проведение одномоментного выявления наиболее распространенных инфекционных агентов, пулирование исследуемых субстратов позволили повысить эффективность выявления возбудителей, уменьшить продолжительность и стоимость исследований.

Основные положения, выносимые на защиту.

1. Для успешного внедрения и использования метода ПЦР в диагностике бактериальных и вирусных инфекционных заболеваний необходимо проведение стадий адаптации, оптимизации диагностикумов, определение наиболее важных и существенных аспектов, требующих привлечения ПЦР.

2. ПЦР может успешно использоваться для первичной скрининговой детекции бактериальных возбудителей ОКИ в лабораторной диагностике и санитарно-эпидемиологическом надзоре. Эффективность этиологической диагностики возрастает при одновременном выявлении ведущих инфекционных агентов: бактерий родов Shigella, Salmonella, Campylobacter и Y. enterocolitica.

3. Использование отечественных ПЦР тест-систем позволяет проводить не только первичную индикацию H .pylori, осуществлять оценку количества инфекционного агента и контролировать эффективность антихеликобактерной терапии, но и получять ряд существенных характеристик микроорганизма, таких как наличие генов факторов патогенности сagA и vakА, устойчивости к антибиотикам - макролидам без культивирования микроорганизма.

4. Наиболее значимыми направлениями использования ПЦР в решении проблемы парентеральных вирусных гепатитов является определение результативности противовирусной терапии, интенсивности репликации вирусов при и моно- и смешанном инфицировании и совершенствование профилактики вертикального пути передачи вирусов. Для этого успешно может быть использован разработанный нами экономичный полуколичественный вариант ПЦР.

5. ПЦР является основным методом детекции возбудителей НУГИ, позволяющим эффективно выявлять любой из микроорганизмов этой группы (вирусы, бактерии). Наиболее эффективно и экономически оправдано одновременное выявление у пациента пяти наиболее значимых и распространенных возбудителей: U. urealyticum, M. hominis, C trachomatis, Cytomegalovirus, Herpes simplex I/II в пуле субстратов (смеси соскобов слизистых уретры, вагины, цервикального канала у женщин; смеси соскоба слизистой уретры и осадка мочи у мужчин; смеси слюны, мочи, слезного отделяемого у детей), в которых наиболее вероятно их присутствие.

       В работу вошли результаты совместных исследований с Соринсоном С.Н., Бокаревым А.А., Бруснигиной Н.Ф., Черневской О.М. ,Маховой М.А., Орловой К.А., Немовым В.В., которые представлены публикациями в соавторстве. Автор выражает огромную благодарность сотрудникам лаборатории молекулярно-генетических методов надзора за инфекционными заболеваниями, сотрудникам ЛПУ, учреждений Роспотребнадзора, практических лабораторий, принимавших участие в проведении данных исследований и внедрении их результатов.

Апробация работы.

Диссертация апробирована на Ученом Совете ФГУН «Нижегородский научно-исследовательский институт эпидемиологии и микробиологии им. академика И.Н. Блохиной» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека 28.02.08 г., Протокол № 2.

Результаты работы доложены и обсуждены на II Съезде Биохимического общества РАН, г. Москва 1997 г.; на I Российском форуме «Мать и дитя», г. Москва, 1999 г.; на II Российском форуме «Мать и дитя», г. Москва, 2000 г.; на III Российском форуме «Мать и дитя», г. Москва, 2001 г.; на Научно-практическом симпозиуме «Технологии генодиагностики в практическом здравоохранении» в рамках Международной конференции «Геномика , протеомика и биоинформатика для медицины», г. Москва, 2002 г.; на Всероссиской научно-практической конференции «Генодиагностика инфекционных заболеваний», г. Москва, 2002 г.; на Всероссиской научно-практической конференции «Медицинская микробиология – XXI век», г. Саратов 2004 г.; на Всероссиской научно-практической конференции «Генодиагностика инфекционных болезней», г. Москва, 2004 г.; на Научной конференции, посвященной 75-летию Нижегородского НИИЭМ «Новые технологии в профилактике, диагностике, эпиднадзоре и лечении инфекционных заболеваний», г. Н.Новгород, 2004 г.; на VII Российском съезде инфекционистов «Новые технологии в диагностике и лечении инфекционных болезней», г. Н.Новгород, 2006 г.; на Научной конференции, посвященной 85-летию со дня рождения академика РАМН И.Н.Блохиной «Новые технологии в профилактике, диагностике, эпиднадзоре и лечении инфекционных заболеваний», г. Н.Новгород, 2006 г.; на VI Всероссийской научно-практической конференции с международным участием «Молекулярная диагностика – 2007», г. Москва, 2007 г.; на Международном симпозиуме «Папилломавирусная инфекция и злокачественные образования. Интегрированная система надзора и профилактики», г. С-Петербург, 2009 г.; на X Международном медицинском форуме «Профилактика заболеваний – основа качества медицинской помощи и благополучия человека», г. Н.Новгород, 2009 г.

Внедрение.

Получены патенты Российской Федерации: № 2031948 «Фрагмент ДНК LTf, предназначенный для выявления гена термолабильного энтеротоксина энтеробактерий» (27.03.95 г.); №2049822. «Фрагмент ДНК CFv, используемый для выявления энтеробактерий, обладающих фактором колонизации CFA I» (10.12.95 г.); №2271003 «Способ выявления наиболее значимых возбудителей негонококковых урогеннитальных инфекций (Chlamydia trachomatis, Mycoplasma hominis, Ureaplasma urealyticum, Cytomegalovirus, Herpes symplex I/II) у детей с использованием метода ПЦР» (27.02.2006 г.).

На основании материалов работы написаны: пособие для врачей «Полимеразная цепная реакция для выявления пилорического хеликобактера», 2000 г. утверждено Председателем секции по эпидемиологии, инфекционным болезням и вирусологии МЗ РФ академиком РАМН Покровским В.И., протокол №5 от 28.11.2000; методические рекомендации «Метод ПЦР-диагностики в обследовании новорожденных и детей первого года жизни», 2000 г.утверждены Главным государственным санитарным врачом Нижегородской области Петровым Е.Ю.; пособие для врачей «Принципы отбора, хранения и транспортировки биологических субстратов для проведения ПЦР-диагностики бактериальных и вирусных инфекций», 2002 г. утверждено Председателем секции по эпидемиологии, инфекционным болезням и вирусологии МЗ РФ академиком РАМН Покровским В.И., протокол №4 от 25.12.2001; пособие для врачей «Комплексное ПЦР-обследование на наличие возбудителей негонококковых урогенитальных инфекций женщин с гинекологической патологией и отягощенным акушерско-гинеколгическим анамнезом», 2005 г., утверждено Председателем секции по эпидемиологии, инфекционным болезням и вирусологии МЗ РФ академиком РАМН Покровским В.И., протокол №5 от 02.12.2005; медицинская технология «Комплексное ПЦР-обследование пациентов с инфекционно-аллергическими заболеваниями органов дыхания», 2008 г. рзрешение № 209/084 от 21.04.09 Минсоцздрава РФ; книга для практического врача «Диагностика и биокоррекция нарушений антиинфекционного гомеостаза в системе «мать-дитя», г. Нижний Новгород, 2004 г.; аналитические обзоры «Молекулярно-биологические методы в микробиологической диагностике», 1998 г.; «Современные методы диагностики ИППП», 2007 г.;

Диссертационная работа выполнена на базе лаборатории молекулярно-генетических методов надзора за инфекционными заболеваниями ФГУН «Нижегородский НИИ эпидемиологии и микробиологии им. академика И.Н.Блохиной» Роспотребнадзора. Исследования осуществлялись в рамках Федеральной Программы «Здоровье населения России», отраслевой научно-исследовательской программы МЗ РФ № 034 «Эпидемиология и микробиология» по договору «Новые технологии в профилактике,  диагностике и лечении инфекционных заболеваний и использование их в эпиднадзоре» и ведомственной (отраслевой) целевой программы «Научные аспекты обеспечения санитарно-эпидемиологического благополучия в Российской Федерации на 2006-2010 г.г» по комплексной теме «Разработка комплексных мероприятий по диагностике, профилактике, лечению и эпиднадзору за актуальными инфекциями».

В настоящее время предложенные нами алгоритмы ПЦР диагностики ОКИ, хеликобактериоза, вирусных гепатитов, НУГИ используются практическими лабораториями медицинских учреждений Нижнего Новгорода, применяющими метод ПЦР, что увеличивает точность индикации патогенов и приносит существенный экономический эффект, за счет оптимизации расхода диагностикумов.

Публикации. По теме диссертации опубликовано 69 печатных работ, в том числе 20 в журналах из них 12 в рекомендуемых ВАК изданиях.

       Объем и структура работы.

Диссертация состоит из введения, обзора литературы, материалов и методов исследования, результатов собственных исследований, заключения, выводов, списка цитируемой литературы, содержащего 94 отечественных и 306 зарубежных источников. Работа изложена на 334 страницах, компьютерного текста. Включает 47 таблиц и 36 рисунков.

СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы.

Материалы.

Образцы фекалий, ректальные пробы, смывы с объектов внешней среды, пробы воды и продуктов питания, клинические изоляты бактерий и музейные культуры бактерий для исследований по диагностике ОКИ поступали из Нижегородского предприятия по производству иммуно-биологических препаратов «ИМБИО», детской клинической инфекционной больницы №8, клинической инфекционной больницы №9 (г. Н. Новгород), Городского центра санэпиднадзора Н.Новгорода, Областного центра санэпиднадзора Нижегородской области, кафедры эпидемиологии Нижегородской государственной медицинской академии, кафедры молекулярной биологии и иммунологии биологического факультета Нижегородского государственного университета.

Биоптаты слизистых желудка и двенадцатиперстной кишки, желудочный сок, фекалии для исследований по диагностике хеликобактерной инфекции были предоставлены клиникой Нижегородского НИИ эпидемиологии и микробиологии, ФГУ «Нижегородский НИИ детской гастроэнтерологии Росмедтехнолгий», ГУЗ «Нижегородский областной клинический диагностический центр», кафедрой внутренних болезней Военно-медицинского института Федеральной пограничной службы, кафедрой общей и клинической фармакологии Нижегородской государственной медицинской академии, ООО «Санаторий имени ВЦСПС» г. Н. Новгород.

Пробы крови, сывороток крови, плазмы крови для исследований по диагностике гепатитов были получены из гепатологического центра ГУЗ «Городская инфекционная клиническая больница №2», ГУЗ «Городская инфекционная клиническая больница №23» (г. Н. Новгород), Медсанчасти №50 г. Сарова Нижегородской области.

Соскобы слизистой уретры, влагалища, цервикального канала, образцы крови, мочи, слюны, слезного отделяемого для исследований по диагностике НУГИ представлены из лечебно-профилактических учреждений г. Н. Новгорода (МЛПУ Женская консультация №5, №20; Медсанчасть Нижегородского автозавода, Роддом №3, №6, №7; ГУЗ «Нижегородская областная клиническая больница им. Н.А.Семашко»; ГУЗ «Нижегородская областная детская клиническая больница»; МЛПУ Городская детская клиническая больница №1; МЛПУ Городская детская клиническая больница №27, ФГУ «Нижегородский институт детской гастроэнтерологии Росмедтехнологии», МЛПУ Городская клиническая больница №39).

Объем выполненных исследований представлен в таблице 1.

Таблица 1.

Объекты и объем исследований

Раздел

работы

Объект

исследования

Объем исследования

Количество объектов

Количество ПЦР исследований

Диагностические исследования ОКИ

Взрослые

108

432

Дети

884

2214

Объекты внешней среды

450

1084

Чистые культуры бактерий.

1814

4240

Исследования

на H.pylori

Взрослые

975

1462

Дети

318

478

Исследования

на гепатиты

Взрослые

3247

7143

Дети

986

2170

Исследования

на возбудители

НУГИ

Взрослые

17860

39128

Дети

7084

19836

Секционный материал

364

1930

Всего

34090

80117

Методы.

Молекулярно-биологические методы

Проведение работ с ДНК зондами, выделение хромосомных и плазмидных ДНК, выделение фрагментов ДНК из плазмид, препаративный гель-электрофорез, трансформация плазмидной ДНК в бактериальные клетки, введение метки в состав зондов, дот-гибридизация, гибридизация колоний проводились с использованием методов, изложенных в руководстве Маниатис Т. с соавт., (1984).

Подготовку клинических проб к проведению ПЦР осуществляли методом ферментативного лизиса и фенольно-хлороформной депротеинизации (в модификации Марковой Г.А. с соавт.,1994). Выделение ДНК проводили также наборами «ДНК-сорб А», «ДНК-сорб Б», а выделение РНК набором «Рибо-сорб-50» (все разработки ФГУН ЦНИИЭ Роспотребнадзора) в соответствии с наставлениями по их применению.

Выявление генов факторов патогенности энтеробактерий, бактерий родов Shigella, Salmonella, Campylobacter, Y. enterocolitica, H. pylori, вирусов гепатитов В, C, D, G, возбудителей НУГИ проводили методом ПЦР. Использовали диагностикумы авторской разработки, экспериментальные и коммерческие отечественные тест-системы производства ГУ НИИЭМ им. Н. Ф. Гамалеи РАМН, НИИМ МО РФ г. Киров, фирм «Литех» (г. Москва), «Лагис» (г. Москва), «Интерлабсервис» (г. Москва).

Иммунологические методы.

Выявление антигенов вируса гепатита В, антител к вирусам гепатитов В, С, D, G; цитомегаловирусу, герпесу простому I и II типов, C. trachomatis проводили методом ИФА, Использовали тест-системы фирм «Диагностические системы» (г. Н. Новгород), «Имбио» (Н. Новгород), «Вектор-Бест» (г. Новосибирск).

Выявление антигена C .trachomatis проводили методом ПИФ. Использовали тест-системы фирмы «Ниармедик» (г. Москва).

Микробиологические методы

Выявление бактерий родов Shigella, Salmonella проводили согласно Методическим указаниям, регламентирующим микробиологическую диагностику заболеваний, вызванных энтеробактериями.

Для выявления и культивирования U. urealyticum, M. hominis использовали дифференциально-диагностические среды фирмы «Диагност» (г. Омск) и клиники акушерства и гинекологии им. В.Ф. Снегирева (г. Москва).

Для визуализации клеток H. pylori использовали метод изучения парафинизированных срезов слизистой желудка и двенадцатиперстной кишки (Аруин Л.И. с соавт., 1993); исследование мазков отпечатков биоптатов слизистой желудка и двенадцатиперстной кишки (Анчукова Э.Г., 1992); микроскопирование отпечатков пристеночной слизи желудка и двенадцатиперстной кишки (Морозов И.А., 2000).

Статистические методы

Обработка данных выполнялась на компьютере с использованием программ Microsoft office (Excel), пакета статистических программ Statz, Statistica 6,0. Достоверность различий определяли общепринятым методом расчета ошибки среднего (m) и показателя существенности и вероятности (t).

В работу вошли результаты совместных исследований с Соринсоном С.Н., Бокаревым А.А., Бруснигиной Н.Ф., Черневской О.М. ,Маховой М.А., Орловой К.А., Немовым В.В., которые представлены публикациями в соавторстве. Автор выражает огромную благодарность сотрудникам лаборатории молекулярно-генетических методов надзора за инфекционными заболеваниями, сотрудникам ЛПУ, учреждений Роспотребнадзора, практических лабораторий, принимавших участие в проведении данных исследований и внедрении их результатов.




РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ

Формирование материальной базы для проведения исследований.

На момент начала наших исследований в Российской Федерации достаточного опыта практической ПЦР диагностики не имелось, поэтому на исходном этапе работы значительное внимание было уделено решению ряда методических проблем - выбору оптимального материально-технического обеспечения ПЦР освоению и адаптации этого метода к практическим лабораторным исследованиям. Предпочтение было отдано отечественным разработкам.

При формировании приборной базы предпочтение было отдано амплификатору модели «Терцик МС2» («ДНК-технология, Москва). По рабочим параметрам он близок к зарубежным аналогам. В настоящее время этот прибор является базовым для большинства ПЦР-лабораторий Российской Федерации. Большая часть экспериментов проведена с использованием амплификаторов «Терцик МС2».

Среди изученных способов подготовки проб клинического материала были выбраны так называемые «сорбционные технологии», состоящие из стадий лизиса, сорбции ДНК на носителе, отмывки сорбированной ДНК от других макромолекул и элюирования ДНК с носителя. Этот способ технологичнее классического ферментно-фенольного метода, требует 2-2,5 раза меньше времени, получаемые препараты ДНК достаточно очищены и пригодны для постановки ПЦР. Для практических исследований нами использовались наборы для сорбционного выделения ДНК и РНК производства фирмы «Интерлабсервис» (Москва), которые обладали лучшими рабочими характеристиками по сравнению с аналогами.

       Для выявления возбудителей ОКИ, хеликобактерной инфекции, НУГИ, вирусных гепатитов нами в основном использовались коммерческие и экспериментальные тест системы отечественных разработчиков и производителей. Однако на момент начала исследований некоторые необходимые диагностикумы, в частности, тест-системы для выявления генов факторов патогенности энтеробактерий в стране не производились. В связи с этим нами были созданы «in house» ПЦР тест системы для выявления генов термостабильного токсина (ST), термолабильного токсина (LT), шигаподобного токсина первого типа (VT1) и оперона инвазивности шигелл и энтероинвазивных эшерихий (Inv). Для этого на основании компьютерного анализа нуклеотидных последовательностей ранее клонированных нами фрагментов генов факторов патогенности и имеющихся в банках данных аналогичных последовательностей были подобраны праймеры:

ST        ТТ-1  5- АTGACGGGAGGTAACATGAA - 3  (прямой)

TT-2  5- TCCCTCTAAGCTTTTTAATA - 3 (обратный)

LT        LT-1  5- TCTCTATATGCACACGGAGC- 3 (прямой)

LT-2  5- CCATACTGATTGCCGCAAT - 3  (обратный)

VT1        VT1/1  5- GTCCTGCAGGGCGTGGAGGA - 3 (прямой)

VT1/2  5- CGTAAAGCTTCAGCTGTCAC - 3 (обратный)

Inv        SF-1  5 - GGAAGCTTAATACTCCTGAACGGCG - 3 (прямой)

SF-2  5 - GGAAGCTTAGGTGTCGGCTTTTCTG - 3;  (обратный)

Праймеры синтезированы на базе Института биоорганической химии им. Ю.А.Овчинникова и М.М. Шемякина РАН (Москва). Праймеры на оперон инвазивности в дальнейшем успешно использовались для детекции бактерий рода Shigella и энтероинвазивных Escherichia.

       При проведении исследований рядом тест систем по инструкциям их разработчиков наряду со специфическими фрагментами синтезировались неспецифические фрагменты, которые затрудняли интерпретацию результата. Для снижения эффективности неспецифического синтеза проводили изменения программы амплификации и состава реакционной смеси по следующей схеме:

  • поградусное увеличении температуры отжига праймеров.
  • уменьшение продолжительности стадии синтеза цепи;
  • обеднение реакционной смеси (уменьшение количества праймеров, нуклеотидтрифосфатов, Taq-полимеразы);

Благодаря модификации доведены до приемлемых характеристик тест системы для выявления бактерий родов Salmonella фирмы «Ниармедик» (г.Москва); детекции генов патогенности холерных вибрионов НИИМ МО РФ (г.Киров); для выявления Н.pylori «Нelicobacter» фирмы «Ниармедик» (г.Москва); для детекции гена VacA Н.pylori «Хеликопол VA» фирмы Литех (г. Москва). В частности, наиболее качественные результаты при использовании тест-системы «Нelicobacter» были получены после увеличения температура отжига праймеров с 66оС до 67оС, уменьшения продолжительности стадии синтеза с 4 до 2,5 мин и уменьшения количества праймеров, трифосфатов и фермента до 80%.

       Модификации при использовании других тест-систем были не столь значительны и ограничивались изменениями температуры отжига праймеров с целью улучшения качества электрофореграмм продуктов ПЦР.

       Для оценки вирусной нагрузки при гепатитах В и С разработаны экономичные, полуколичественные варианты ПЦР с использованием коммерческих тест систем «АмплиСенс-HCV», «АмплиСенс-HBV» фирмы «Интерлабсервис» (г. Москва). Они базируются на исследовании десятикратных разведений кДНК для ВГС и десятикратных разведений ДНК пробы для ВГВ.

       С целью определения концентрации Н.pylori и контроля эффективности противохеликобактерной терапии создан полуколичественный вариант ПЦР, основанный на определении возбудителя в десятикратных разведениях ДНК, выделенной из желудочного сока. Использована коммерческая тест-система «АмплиСенс-Helicobacter pylori-520» «Интерлабсервис» (г. Москва).

       Поскольку ни одна из коммерческих ПЦР тест систем для выявления Н.pylori не комплектуется ВКО, предложен вариант оценки работоспособности используемых тест систем с помощью универсального ВКО для тест-систем на возбудители НУГИ.

Значимые направления использования молекулярно-биологических методов в диагностике бактериальных ОКИ.

Выявление генов факторов патогенности энтеробактерий.

Одним из важных аспектов диагностики бактериальных ОКИ является выявление штаммов, обладающих факторами патогенности (токсинами, факторами адгезии и инвазии). Они обуславливают эпидемическую значимость штаммов энтеробактерий и их способность вызывать инфекционный процесс в макроорганизме. Доказанная ранее возможность обмена генами факторов патогенности между разными видами энтеробактерий (Хесин Р.Б.,1985), позволяла предполагать их распространение в природных популяциях Enterobacteriaceae.

Для изучения этого вопроса могут быть применены только молекулярно-генетические методы исследования, так как классические методы выявления факторов патогенности неприемлемы из-за их сложности и невозможности исследования значительных количеств культур микроорганизмов. Впервые в Российской федерации в Нижнем Новгороде был проведен многолетний мониторинг (1985-2006 гг.) клинических изолятов энтеробактерий, с целью выявления генов наиболее значимых факторов патогенности. Всего было изучено 1814 штаммов. В разные периоды исследования использовались различные молекулярно-биологические технологии (по мере их совершенствования в стране): 1985-1994 гг. - ДНК зонды для выявления генов термолабильного и термостабильного токсинов, фактора инвазивности (собственная разработка) с радиоактивной и нерадиоактивной метками, 1994 - 1999 гг. «in hоuse» ПЦР-тест системы (собственная разработка), 1999 - 2005 гг. ПЦР тест-системы разработки отечественных производителей. Несмотря на существенную разницу диагностических возможностей этих методов и тест-систем получены непротиворечивые результаты. Показано, что для Нижегородского региона не характерна циркуляция токсигенных штаммов энтеробактерий. При изучении распространения четырех генов токсинов (термолабильного, термостабильного, шигаподобного 1 и 2 типов) отмечено только два эпизода появления в Нижегородском регионе токсигенных штаммов (в 1994 и 2003 гг). Все они содержали ген шигаподобного токсина 1 типа.

Наиболее распространеными оказались генетические детерминанты оперона инвазивности, что вполне логично, так как они являются обязательным атрибутом бактерий рода Shigella (табл. 2)

Гены факторов патогенности обнаружены только у шигелл и эшерихий. У представителей других изученных нами родов Enterobacteriaceae они не выявлены.

Таблица 2.

Распространенность генов факторов патогенности у представителей семейства Enterobacteriaceae (1985-2006 гг.).

Энтеробактерии

Исследовано

штаммов

Частота выявления генов факторов патогенности (в абс.ч.)

vt1

vt2

lt

st

inv

Shigella

542

23

-

-

-

536

Еscherichia

284

21

-

-

-

6

Salmonella

505

-

-

-

-

-

Klebsiella,Enterobacte,

Haffnia

297

-

-

-

Полученные результаты свидительствуют об отсутствии необходимости широких скрининговых исследований с целью мониторинга токсигенных штаммов и целесообразности избирательной проверки микроорганизмов, выделенных от больных с тяжелыми формами ОКИ. Нерешенной остается задача выявления токсигенных штаммов непосредственно в клиническом материале, продуктах питания и объектах внешней среды.

ПЦР-детекция бактерий родов Shigella и Salmonella.

Бактериальные возбудители ОКИ – бактерии родов Shigella и Salmonella представляют собой классические объекты медицинской микробиологии. Они давно и успешно выявляются бактериологическим методом, являющимся «золотым стандартом» их индикации. В своих исследованиях по изучению возможностей ПЦР при детекции этих микроорганизмов мы предполагали получить положительный эффект за счет уменьшения продолжительности анализа.

       Для решения этой задачи была разработана «in hоuse» ПЦР тест-система для выявления бактерий рода Shigella, основанная на выявлении фрагмента ДНК оперона инвазивности, апробированы и адаптированы к практическим исследованиям экспериментальные отечественные ПЦР тест-системы фирмы «Интерлабсервис» (г. Москва).

       Проведено обследование больных ОКИ - 165 человек на наличие шигелл и 526 человек на наличие сальмонелл. Эффективность выявления бактерий родов Shigella и Salmonella методом ПЦР была в 2,2-2,6 раза выше, чем бактериологическим методом. Исследование занимало не более одного рабочего дня.

       Сходные результаты были получены при использовании метода ПЦР при проведении плановых противоэпидемических мероприятий (проверка санитарного состояния предприятий пищевой промышленности и торговли) и расследовании случаев вспышечной заболеваемости сальмонеллезами и шигеллезами. Частота выявления инфекционных агентов в смывах с объектов внешней среды, оборудования и продуктах питания (всего 450 образцов) ПЦР была в 2-2,5 раза выше, чем при бактериологическом исследовании. Высокая специфичность и чувствительность в сочетании с надежностью и простотой в применении позволили нам рекомендовать эти тест-системы для использования в практических лабораториях.

Комплексное ПЦР-исследование по выявлению основных бактериальных возбудителей ОКИ.

Внедрение нами в практическую диагностику экспериментальных тест-систем для выявления бактерий рода Campylobacter и Yersinia enterocolitica (разработки «ЦНИИЭ Роспотребнадзора») позволили проводить комплексное ПЦР-исследование одновременно на 4 ведущих возбудителя бактериальных ОКИ. В результате этого этиологическая расшифровка ОКИ возросла на 21,6% у детей и на 38,6% у взрослых больных. Этот показатель был достигнут за счет повышения эффективности детекции шигелл и сальмонелл и выявления бактерий рода Campylobacter и Y. enterocolitic, исследования на которые бактериологическими методами не проводятся. На рисунке 1 представлены результаты параллельного и одномоментного обследования 153 детей больных ОКИ методом ПЦР и бактериологическим методом

  Shigella Y. enterocolitica

  Salmonella  Возбудитель не выявлен

  Campylobacter

Рис.1. Выявление бактериальных возбудителей ОКИ у детей
1)методом ПЦР (данные в %),

2) бактериологическим методом (данные в %).

Следует отметить, что себестоимость комплексного ПЦР исследования на 4 инфекционных агента ниже себестоимости бактериологического исследования на бактерии родов Salmonella и Shigella. Все четыре ПЦР тест-системы могут успешно использоваться практическими лабораториями.

       Продемонстрированное в настоящем исследовании столь значительное преимущество ПЦР детекции бактерий родов Salmonella, Shigella по сравнению с бактериологическим анализом (эффективность выявления выше в 2-3 раза), оказалось достаточно неожиданным. На наш взгляд имеется несколько причин, определивших большую разницу в эффективности методов.

Более высокая чувствительность метода ПЦР объясняется способностью выявлять погибшие клетки, а также «некультивируемые формы» бактерий. ПЦР является в настоящее время единственным надежным методом детекции подобных форм микроорганизмов. Обнаружение «некультивируемых форм» бактерий имеет важное практическое значение, так как при попадании в организм (или снижении концентрации антибиотика) они реверсируют в исходную форму, способную вызывать заболевание.

       Наряду с преимуществами метода ПЦР в детекции бактериальных возбудителей ОКИ, имеется проблема, решить которую данным методом не представляется возможным – это определение видовой принадлежности шигелл и серовариантов сальмонелл, а также внутривидовая характеристика этих микроорганизмов. Несмотря на этот недостаток, ПЦР может быть рекомендована в качестве метода экспресс-детекции на уровне родов для бактерий Shigella, Salmonella, Campylobacter и на уровне вида для бактерий Y.еnterocolitica, что позволит существенно повысить оперативность и качество диагностики ОКИ. Наиболее целесообразно комплексное ПЦР обследование пациентов с подозрением на ОКИ, заключающееся в одномоментном выявлении всех четырех выше названных инфекционных агентов.

       В диагностике и профилактике ОКИ примение ПЦР целесобразо по следующим направлениям:

-обследование лиц, поступающих в инфекционные стационары при спорадической заболеваемости для выявления основных бактериальных

возбудителей ОКИ.

-оперативное скрининговое обследование лиц, обсемененности объектов внешней среды, продуктов питания для определения источника, факторов и путей передачи инфекции при расшифровке вспышечной заболеваемости ОКИ.

-выявлениетруднокультивируемых возбудителей ОКИ;

-обнаружение генов факторов патогенности клинических изолятов Shigella, E. coli, выделенныхот больных ОКИ

-определение эффективности проведенных санитарно-противоэпидемических мероприятий.

ПЦР в диагностике хеликобактерной инфекции и изучении ее возбудителя.

H. pylori открыт относительно недавно (1983 г.) и система индикации этого микроорганизма в Российской Федерации окончательно не сложилась. Основные затруднения связаны со сложностью прямой специфической детекции H. pylori. Используемые в лабораторной диагностике методы, основанные на микроскопии, неспецифичны и субъективны. В связи с этим, мы рассматривали метод ПЦР как один из наиболее перспективных вариантов решения проблемы выявления H. pylori. Кроме этого, в условиях отсутствия возможности культивирования хеликобактера, нами ставилась задача оценить возможности ПЦР в качестве способа получения штаммовой характеристики этих микроорганизмов.

Оптимизация ПЦР-детекции H. pylori.

Впервые освоение метода ПЦР для целей практической диагностики осуществлялось нами на модели хеликобактера. На подготовительном этапе апробированы и адаптированы к практической ПЦР-детекции H. pylori отечественные экспериментальные тест-системы, подобраны оптимальные температурно-временные режимы амплификации и состав реакционной смеси.

Усовершентсвованный вариант ПЦР-детекции с высокой эффективностью выявлял H. pylori в биоптатах слизистой и желудочном соке. Между показателями частоты выявления хеликобактера в желудочном соке и биоптатах (71,9±4,0% и 72,6±3,9%) статистически достоверных различий не обнаружено (t < 2,6). С учетом последнего, желудочный сок, как субстрат с менее инвазивным получением и как более интегративный материал, рекомендован нами для исследования при детекции H. pylori.

       При сравнении выявления H. pylori с помощью ПЦР и традиционными методами, доступными медицинской практике, установлено существенное преимущество ПЦР. Она в 2,5 раза эффективнее выявляет H. pylori, чем метод световой микроскопии (табл. 3).                                                

Таблица 3

Сравнение результатов выявления H. pylori методами ПЦР и световой микроскопии, полученных при параллельном исследовании (n =107)

Метод исследования

ПЦР

Микроскопия

Результат

Н.р.+

Н.р.-

Н.р.+

Н.р.-

В абс. значениях

81

26

33

74

В %

75,7±4,1

24,29±4,1

30,8±4,4

69,16± 4,5

«Н.р.+» - H.  pylori выявлен; « Н.р.-» - H. pylori не выявлен

       

       Наиболее близки к результатам ПЦР данные, полученные микроскопией пристеночной слизи (браш-биопсия), но и этот метод уступает ПЦР в чувствительности. Эффективность выявления H. pylori методом ПЦР составила 83,3±6,0% от числа всех положительных проб. При исследовании пристеночной слизи желудка методом brush-биопсии хеликобактер выявлен в 70,8±7,4% случаев.

Изучение распространения H. pylori в Нижегородском регионе.

Метод ПЦР позволил определить объективную инфицированность хеликобактером больных с гастродуоденальной патологией в Нижегородском регионе, она составила 58,9±2,9% у детей и 82,9±1,8% у взрослых. Высокая частота обнаружения H. pylori среди населения г. Нижнего Новгорода во многом обеспечивается за счет раннего инфицирования детей. При всех типах гастродуоденальной патологии наблюдается высокая инфицированность больных H. pylori, что свидетельствует о способности этого микроорганизма провоцировать развитие и осложнять течение различных форм гастродуоденальных заболеваний. Особо следует отметить практически 100%-ную частоту выявления H. pylori у лиц с резекцией желудка (обследовано 20 человек) и ушиванием перфоративной язвы (46 человек). Эти данные позволяют сделать вывод о неэффективности эррадикации H. pylori при хирургических вмешательствах и необходимости проведения своевременной специфической антибактериальной терапии.

Разработка варианта ПЦР-детекции H. pylori, направленного на оценку эффективности проводимой антихеликобактерной терапии.

Для раннего контроля эффективности противохеликобактерной терапии (через 1-2 недели после окончания курса лечения) нами разработан и апробирован полуколичественный вариант ПЦР-детекции H. pylori. Он основан на выявлении ДНК микроорганизма в 10-кратных разведениях ДНК, выделенной из желудочного сока. Анализ отдаленных последствий проведенной терапии показал, что результаты исследований полуколичественным вариантом ПЦР имеют прогностическое значение при оценке предполагаемого эффекта от антихеликобактерной терапии. У пациентов, которые имели в контрольном ПЦР снижение концентрации H. pylori более чем в 1000 раз или отрицательный результат, при проведении контрольной эзофагогастродуоденоскопии наблюдались эндоскопические и клинические улучшения: рубцевание язв, эпителизация эрозий, уменьшение активности гастродуоденита. В течение года больные данной группы отмечали хорошее самочувствие, не обращались за медицинской помощью. У трех больных без эффекта эррадикации H. pylori (титр H. pylori до и после лечения одинаков), отказавшихся от повторного курса лечения, через 17-18 месяцев отмечен рецидив язвенной болезни. На рисунке приведен результат полуколичественного исследования желудочного сока пациента на наличие H. pylori до и после лечения.

1  2 3 4 5 6 7 8  9 10

Линия старта ⇒        

       

исх  10-1  10-2 10-3 исх  10-1 10-2  10-3  К+  К-

проба проба

до лечения         после лечения

Рис. 2. Электрофореграмма разведений ДНК H. pylori из проб желудочного сока.

Использование ПЦР для выявления факторов патогенности и антибиотикорезистентности H. pylori.

Изучена возможность применения экспериментальных отечественных ПЦР тест-систем для получения биологической характеристики штаммов хеликобактера. В частности, апробирована система для выявления гена токсигенности сagA H. pylori. Тест-система «Диаген-Helicobacter» (фирмы «Лагис», г. Москва) не давала неспецифического синтеза, была удобна в работе и пригодна для практических исследований. С ее помощью установлена широкая распространенность токсигенных сagA+ штаммов H. pylori (76,4%). Показано, что большая часть заболеваний желудка ассоциирована с токсигенными штаммами H. pylori (63,4±4,9% всех «сagA+»-вариантов были обнаружены в биоптате слизистой желудка), а при патологии двенадцатиперстной кишки чаще выявлялись сagA-отрицательные варианты (82% от всех сagA-отрицательных изолятов);

Для выявления гена фактора патогенности H. pylori vacA использована тест-система «Хеликопол VA» (фирма «Литех», г. Москва). Ген vacA выявлен у 66% ПЦР-изолятов H.pylori (у 33 из 50), и только у 55% из них (у 18 из 33) установлен полный аллельный вариант гена vacA. Сложность и нестабильность работы тест-системы «Хеликопол VA», затруднения с интерпретацией результатов, возникающие из-за неспецифического синтеза, существенно затрудняют использование этого диагностикума в практических исследованиях.

Устойчивость H. pylori к антибиотикам – макролидам определяли с помощью ПЦР тест-системы «Эритропол» (фирма «Литех», г. Москва). Исследованы 97 образцов в которых ранее выявлена ДНК H. pylori. Устойчивые варианты выявлены в 3 случаях, что свидительствует о низком уровне резистентности к макролидам штаммов H. pylori, циркулирующих в Нижнем Новгороде. Проблем с интерпритацией результатов не возникало. Диагностикум может быть рекомендован для использования в практике.

Изучение гетерогенности нуклеотидных последовательностей фрагментов гена CagA H .pylori методом гетеродуплексного анализа.

При изучении возможности использования фрагмента гена cagA для определения генетического разнообразия штаммов H. pylori методом гетеродуплексного анализа была проведена оценка вариабельности его нуклеотидной последовательности. Показано, что фрагменты гена cagA у разных ПЦР-изолятов отличались между собой нуклеотидной последовательностью. По результатам гетеродуплексного анализа выявлено два варианта фрагментов. Ген cagA является перспективным в качестве одного из возможных маркеров для изучения штаммового разнообразия H. pylori (рис. 3)

1  2 3  4  5  6 7  8  9 10 11  12 К+

Рис. 3. Электрофореграмма гомодуплексов и гетеродуплексов фрагментов гена cagA H. pylori. Треки 5 и 6 содержат гетеродуплексы.

Таким образом, за счет оптимизации и адаптации экспериментальных отечественных ПЦР тест-систем был предложен комплекс методов, дающий возможность проводить прямую, высокочувствительную, специфическую детекцию H. pylori в клиническом материале, осуществлять ранний контроль эффективности противохеликобактерной терапии, проводить маркирование клинических ПЦР-изолятов H. pylori по наличию у них генов факторов патогенности cagА и vacА и по степени гомологии гена cag А, определять устойчивость к антибиотикам - макролидам. Этот комплекс методов позволяет в значительной степени компенсировать отсутствие возможности культивирования хеликобактера.

Возможные направления использования ПЦР в диагностике парентеральных вирусных гепатитов.

Парентеральные вирусные гепатиты являются одной из важнейших проблем здравоохранения и их диагностике уделяется пристальное внимание. Основная масса задач по исследованию этих инфекций успешно решается различными иммунологическими методами. При анализе возможностей метода ПЦР в диагностике парентеральных вирусных гепатитов и сопоставлении результатов ПЦР исследований и ИФА тестов на ВГС и ВГВ показана нецелесообразность использования ПЦР для массового первичного скрининга. Вместе с тем установлено, что проведение ПЦР при обследовании больных без белковых маркеров инфекции, но с клиническими признаками гепатита позволяет выявлять ВГС даже в период «серонегативного окна».

Разработка полуколичественного варианта ПЦР для детекции ВГВ и ВГС и оценки вирусной нагрузки

Основное преимущество метода ПЦР перед другими диагностическими технологиями выявления ВГС и ВГВ состоит в том, он наиболее точно позволяет определить активность репликации вирусов, оценить их концентрацию в крови и других биологических жидкостях, что дает возможность объективно охарактеризовать стадию развития заболевания и контролировать эффективность противовирусной терапии. В связи с этим, разработка варианта ПЦР для обследования больных гепатитами С и В до начала лечения и последующего контроля терапии представлялась нам одним из наиболее существенных аспектов применения ПЦР в диагностике вирусных гепатитов. Предложенный нами вариант базируется на использовании классической ПЦР с элекрофоретическим выявлением продукта реакции и возможностью оценки вирусной нагрузки. Для оценки концентрации вирусов был применен метод десятикратных серийных разведений: кДНК для ВГС и ДНК, выделенной из крови (плазмы или сыворотки) для ВГВ. Такой подход, названный нами полуколичественным, оказался достаточно объективным и информативным при оценке эффективности противовирусной терапии.

Предложенный вариант ПЦР значительно дешевле исследований с применением тест-систем, использующих гибридизационно-ферментное выявление продукта амплификации и ПЦР, базирующейся на технологии «Real - time». Возможно, современные технологии более точно определяют концентрацию вируса. Но эти показатели также являются относительными, поскольку при определении концентрации вируса амплификация реального образца сравнивается с калибровочной кривой, построенной на основании результатов амплификации десятикратных разведений контрольной сыворотки, при этом не имеется возможности сопоставить степень ингибирования амплификации в пробе и контроле.

Изучение распространенности ВГС ведущих генотипов в Нижегородском регионе.

Одним из важных этапов диагностики ВГС является определение его генотипа. Генотипирование ВГС имеет как научное, так и практическое значение, поскольку лечение больных, инфицированных ВГС генотипа 1b отличается от терапии заболеваний, вызванных вирусами других генотипов. Использование мультиплексной ПЦР тест-системы проиводства фирмы «Интерлабсервис» (Москва) позволило дифференцировать четыре наиболее распространенных в Евразии генотипа ВГС - 1b, 1а; 2; 3а (табл.4 ).

Таблица 4

Выявление доминирующих генотипов ВГС на территории Нижнего Новгорода и Нижегородской области за период 2002-2006 гг.

Период исследования

Частота выявления генотипов в %

1b

2

2001 г. (n=119)

52,1±4,6

48,7±4,6

0,8±0,8

-

2002 г. (n=198)

52,5±3,5

46,5±3,5

2,0±1,0

-

2003 г. (n=192)

48,4±3,6

51,6±3,6

1,6±0,9

-

2004 г. (n=221)

54,3±3,4

46,2±3,4

3,6±1,3

0,5±0,5

2005 г. (n=289)

54,2±2,9

49,5±2,9

2,7±1,0

2,1±0,8

2006 г. (n=141)

51,8±2,9

46,1±4,2

2,1±1,2

0,7±0,7

Всего (n=1160)

52,3±1,5

48,2±1,5

2,4±0,4

0,7±0,2

В Нижегородском регионе за период 2001-2006 гг. чаще других у больных гепатитом С обнаруживались вирусы генотипов 1b и 3а. Частота выявления генотипов 1b и 3а варьировала по годам и составляла 51,8-54,3% и 46,1-49,5% соответственно. Вирусы генотипа 2 обнаруживались каждый год с невысокой частотой от 0,8 до 3,6%, а вирусы генотипа 1а были выявлены только в 2004, 2005, 2006 гг. с частотой от 0,5 до 2,3%. С 2004 г. наметилась тенденция возрастание частоты инфицирования пациентов ассоциациями ВГС двух генотипов. В 2001, 2002, 2003 гг. частота обнаружения ассоциаций не превышала 1,7% и они представляли комбинацию двух ведущих генотипов 1b и 3а. В 2004 г. ассоциации составили 4,6% и были представлены 2 видами - 1b 3а и 1а 1b. К 2005 году частота выявления ассоциаций разных генотипов достигла 8% и имелось уже 4 типа ассоциаций: 1b 3а; 1а 1b; 1b 2; 1а 2. Увеличение количества микст инфекций ВГС вероятно связано с неоднократным инфицированием больных. Высокая частота выявления вирусов генотипа 1b и вероятность реинфекции ими больных, ранее заразившихся ВГС других генотипов, свидетельствует не только о необходимости определения генотипа при первичном обследовании, но и о целесообразности повторного определения генотипа в случае активизации репликации вируса на фоне успешного лечения.

Активность репликации вирусов при разных формах вирусных гепатитов.

Метод ПЦР позволил оценить особенности репликации вирусов гепатитов при различных вариантах инфицирования. При вирусных гепатитах В, С, G (моноинфекции) частота выявления вирусных нуклеиновых кислот была не менее 47±2,3%. Гепатиты смешанной этиологии характеризовались более низкой интенсивностью течения процесса. При микст-инфекции ВГС+ВГВ вирусные нуклеиновые кислоты выявлялись достоверно реже - в 25,5±1,4%; при микст-инфекции ВГС+ВГG - 37,0±2,4% (t > 2,6).

Такое ингибирование вирусной репликации возможно обусловлено явлением интерференции вирусов в клетке-хозяине. В большинстве случаев размножается только один из компонентов ассоциации. Случаи выявления одновременной репликации двух вирусных нуклеиновых кислот составили максимально 19,0% от числа положительных проб при миксте ВГС+ВГG и минимально – 8,1% от числа положительных проб для пары ВГС+ВГВ. Не выявлено случаев одновременной репликации нуклеиновых кислот трех вирусов. Не установлено доминирования одного из вирусов в ассоциациях из двух или трех компонентов. Вирусные нуклеиновые кислоты выявлялись, как правило, с близкими или практически одинаковыми частотами. Исключение составила ассоциация ВГВ+ВГD. Репликация ВГВ при смешанной инфекции наблюдалась в 2 раза чаще, чем репликация ВГD. Вероятно это объясняется тем, что ВГD является сателлитом ВГВ, а не самостоятельным, полноценным вирусом. Полученные результаты свидетельствуют о необходимости выявления нуклеиновых кислот всех вирусов ассоциации при проведении лечения гепатита смешанной этиологии.

ПЦР в профилактике вертикального пути передачи ВГС и ВГВ

Одной из важных проблем парентеральных вирусных гепатитов является профилактика вертикального пути передачи инфекции и ранняя диагностика гепатита у новорожденных и детей первого года жизни. Проведенные нами исследования показали, что несмотря на снижение активности вирусного процесса у беременных (частота выявления вирусных нуклеиновых кислот существенно ниже, чем в других группах больных) эффективность инфицирования детей достаточно высока. У детей, рожденных женщинами больными ВГС, в первый месяц жизни в 10,1±3,2% случаев выявляется РНК ВГС (табл.5)

Таблица 5

Частота выявления РНК вируса гепатита С у детей разных возрастных групп

Возраст

Количество

обследованных детей

Частота выявления РНК ВГС в %

  1месяц

89

10,1±3,2

  2 месяца

133

9,8±2,6

  3 месяца

231

10,0±2,0

  4 месяца

147

11,6±2,6

  5 месяцев

97

11,3±3,3

  6 месяцев

143

10,5±2,6

  7 месяцев

118

9,3±2,7

  8 месяцев

63

14,3±4,4

  9 месяцев

71

16,9±4,4

  10 месяцев

58

12,1±4,3

  11 месяцев

75

24,0±4,9

  1 год

102

17,6±3,8

  2 года

81

18,5±4,3

  3 года

72

18,1±4,5

  4 года

50

28,0±6/3

  5 лет

54

19,2±5,4

  6 лет

44

25,0±6,5

  7 лет

35

20,0±6,8

Аналогичный показатель при ВГВ составил 12,8±2,8%. Предварительная проверка больных ВГС беременных женщин (104 человека) на наличие вирусной РНК и проведение лечения при выявлении РНК позволили достоверно снизить вероятность инфицирования новорожденных. В этой группе частота выявления ВГС у детей составила 4,8±2,1%. Полученные результаты подтверждают необходимость проведения ПЦР-обследования на наличие вирусных нуклеиновых кислот женщин, имеющих белковые маркеры вирусных гепатитов, в дородовый период, а детей, рожденных ими, в первый месяц жизни.

Изучение эффективности метода минипулов при обследовании доноров.

Одним из возможных источников инфицирования вирусными гепатитами является контаминированная донорская кровь. В связи с этим, нами проведена оценка возможностей отечественных ПЦР-тест систем при проверке банков донаций крови методом минипулов. Анализ частоты встречаемости различных вариантов вирусных нагрузок у больных хроническим ВГС за период 1997-2006 гг. показал, что при использовании отечественных ПЦР тест-систем на ВГС, имеющих чувствительность 5х103 -103 частиц в мл, для проверки пулов донорской крови эффективность выявления вируса составит 60 - 85%. Этот показатель не позволяет рекомендовать данный вариант ПЦР-минипулов для практического применения.

В то же время показана высокая экономическая целесообразность ПЦР обследования на вирусные гепатиты постоянных доноров крови группы риска (повышенная активность ферментов печени). При анализе 1746 образцов крови РНК ВГС выявлена в 7,5% случаев, а ДНК ВГВ – в 2,8%. Стоимость лечения больных при минимальном инфицировании донорской кровью (90 доноров, у которых выявлены ВГС и ВГВ заразят только по 1 человеку) в 74 - 172 раза превысила бы стоимость данного исследования.

Таким образом, метод ПЦР в системе диагностики вирусных гепатитов наиболее целесообразен при обследовании больных перед лечением и для проведения контроля его эффективности. Для этой цели, на наш взгляд, с успехом может быть использован разработанный в данном исследовании экономичный полуколичественный вариант метода ПЦР. Кроме этого, имеется еще ряд важных аспектов, решение которых не возможно без использования методов РНК-ДНК диагностики, такие как - выявление мутантных форм ВГВ, детекция ВГС в период серонегативного окна, совершенствование профилактики вертикального пути передачи гепатитов и повышение безопасности манипуляций при переливании крови и трансплантации органов.

ПЦР в диагностике негонококковых урогенитальных инфекций.

Наиболее сложным и масштабным этапом данной работы были исследования, посвященные диагностике НУГИ, поскольку подобные работы в Нижегородском регионе ранее не проводились. Объективная информация о распространенности возбудителей НУГИ отсутствовала.

Особенности распространения и циркуляции возбудителей НУГИ.

Нами проводилось изучение распространенности и особенностей циркуляции наиболее значимых и важных представителей этой группы: U. urealyticum, M. hominis, C. trachomatis, Cytomegalovirus, Herpes simplex I/II. Было установлено широкое распространение этих возбудителей среди взрослого населения – здоровых и бессимптомных носителей. Они обнаружены у 68±1,3% женщин и 40±3,8% мужчин.

На протяжении всего двенадцатилетнего периода наблюдений сохранялось следующее распределение возбудителей по частоте их выявления: первое место занимали U. urealyticum (54,2% у женщин, 30,2% у мужчин); второе – M. hominis (25,8% у женщин, 14,5% у мужчин); третье – Cytomegalovirus у женщин – 10,8%; C. trachomatis у мужчин – 6,7%; четвертое – C. trachomatis у женщин – 8,4%, Cytomegalovirus у мужчин – 3,0%; пятое - Herpes simplex I/II (2,4% у жещин, 1,2% у мужчин).

Выявлена статистически достоверная разница в частоте выявления возбудителей НУГИ (за исключением хламидий) у женщин и мужчин. Инфицированность мужчин в 1,7 раза ниже. У женщин микоплазмы и уреаплазмы выявляются в 1,8 раза чаще, чем у мужчин; герпес – в 2 раза; цитомегаловирус – в 3,6 раза.

Выявлено широкое распространение ассоциаций возбудителей НУГИ. Так, у 38,8±1,7% инфицированных женщин выявлялись ассоциации микроорганизмов, у инфицированных мужчин ассоциации обнаружены в 29,9±5,6% случаев. Все инфекционные агенты, кроме U. urealyticum, чаще выявлялись в ассоциациях. Никаких преимущественных вариантов сочетаний и выраженных взаимоотношений возбудителей (симбиоз, антагонизм) не обнаружено. Вероятность выявления той или иной ассоциации определялась только частотами обнаружения составляющих ее микроорганизмов. Преобладали варианты из двух возбудителей (77,2±2,3% - у женщин и 80,0±8,9% - у мужчин) с доминированием ассоциации уреаплазма–микоплазма (45,4±2,8% всех ассоциаций у женщин и 45,0±11,1% - у мужчин). Варианты из 3 микроорганизмов составляли 20,7±2,3% у женщин и 20,0±8,9% - у мужчин. Смешанные инфекции, при которых обнаружены 4 или 5 возбудителей, выявлены только у женщин в 7 случаях, что составило 2,1±0,8%.

Показатели частоты выявления возбудителей НУГИ за 12 летний период исследования изменялись следующим образом: с 1998 года 2001 наблюдался рост числа инфицированных до максимума в 2000-2001 годах. В этот период соответствующие показатели увеличились: для U .urealyticum с 43,8% до 56,5%; M. hominis с 19,2% до 31,1%; Cytomegalovirus с 9,3% до 13,8%; C. trachomatis с 7,1% до 9,9%; Herpes simplex I/II с 1,1% до 2,6%. В период 2002-2003 годов отмечалось снижение частоты выявления инфекционных агентов до уровней, близких значениям 1998г. В 2004 -2005 гг. снова наметился рост. Второй максимум частоты выявления возбудителей НУГИ наблюдался в 2006 и 2007 гг., но показатели 2001 года  достигнуты не были, после чего в 2008 и 2009 годах частота выявления инфекционных агентов снизилась. Как увеличение, так и уменьшение частоты обнаружения возбудителей НУГИ, как правило, проходило синхронно для большинства выявляемых возбудителей (рис. 4).

Рис 4. Частота выявления возбудителей НУГИ у женщин репродуктивного возраста по годам, в %

У - U. urealyticum; М - M. hominis; Х – C .trachomatis; Ц – ЦМВ; Г – ВПГ I/II.

Зависимости частоты выявления возбудителей НУГИ от сезона года нами не выявлено. Средние показатели числа инфицированных за все зимние, весенние, летние и осенние сезоны по каждому из выявляемых микроорганизмов были практически одинаковы.

Особенности распространения возбудителей НУГИ при воспалительных заболеваниях урогенитального тракта и патологии репродукциии у женщин и мужчин.

По данным ряда отечественных и зарубежных авторов, в выборках больных людей частота выявления возбудителей НУГИ выше, чем в группе здоровых и бессимптомных носителей. При обследовании мужчин и женщин с воспалительными процессами в органах мочеполовой системы и женщин с отягощенным акушерско-гинекологическим анамнезом нами выявлено увеличение частоты выявления U. urealyticum, M. hominis, Cytomegalovirus, Herpes simplex I/II – у женщин и U. urealyticum, M. hominis, C. trachomatis, Herpes simplex I/II – у мужчин.

Наиболее ярко это проявляется при уретрите у мужчин, вагините, кольпите у женщин, а также у женщин с первичным бесплодием.

Роль U. urealyticum, M. hominis, C. trachomatis, Cytomegalovirus, Herpes simplex I/II в развитии воспалительных процессов в урогенитальном тракте подтверждается тем фактом, что при проведении лечения с учетом присутствия этих микроорганизмов удается достичь выздоровления пациентов. В то же время, выявление U. urealyticum, M. hominis с достаточно высокой частотой (40-60%) у здоровых людей и бессимптомных носителей свидетельствует о том, что их проникновение в организм не всегда сопровождается развитием заболевания.

При изучении распространенности папилломавирусов в Нижегородском регионе ВПЧ с генотипами высокого канцерогенного риска выявлены у 27,3±1,7% обследованных, не имевших признаков изменения эпителия слизистых. В группе женщин с признаками дисплазии и/или эрозии эпителия шейки матки онкогенные папилломавирусы выявлялись незначительно чаще - в 32,0±4,4% случаев.

Одной из важных проблем диагностики НУГИ является оценка эффективности проводимой терапии. Нами показано, что метод ПЦР позволяет проводить объективную оценку эффективности лечения. Среди возбудителей НУГИ наиболее устойчивыми к терапии оказались U. urealyticum, M. hominis. Они чаще других выявлялись при контрольных ПЦР исследованиях после лечения - 40,2±2,4% и 23,3±2,0% соответственно. Устойчивость, как было определено, связана с широким распространением антибиотикорезистентных форм этих микрорганизмов, в первую очередь, среди U. Urealyticum. Поэтому в алгоритм выявления возбудителей НУГИ, базирующийся на одномоментной ПЦР детекции U. urealyticum, M. hominis, C. trachomatis, Cytomegalovirus, Herpes simplex I/II, в случае выявления U. urealyticum, M. hominis, нами был введен этап микробиологического исследования, одной из целей которого является определение спектра антибиотикорезистентности.

Вертикальный путь передачи возбудителей НУГИ. Этапы колонизации организма возбудителями НУГИ.

Одним из важнейших аспектов НУГИ является их влияние на развитие беременности и плода. Инфекционные агенты из данной группы могут в случае реализации вертикального пути передачи вызывать различные патологические процессы у детей.

Сравнение частот выявления возбудителей НУГИ у беременных женщин и новорожденных выявил высокую вероятность передачи возбудителей НУГИ от инфицированных матерей новорожденным внутриутробно и во время родов. Теоретически рассчитанная эффективность инфицирования составила 44,3% для U. urealyticum; 58,5% для M. hominis; 39,3% для C. trachomatis; 55,6% для Cytomegalovirus; 16,7% для Herpes simplex I/II. Сходные результаты получены при обследовании 60 пар мать-ребенок (до 1 месяца), у них в 46% случаев выявлены одинаковые инфекционные агенты, преимущественно микоплазмы и цитомегаловирусы.

Анализ распространенности возбудителей НУГИ у детей разных возрастных групп позволил установить этапы колонизации макроорганизма вирусами группы герпеса и бактериями представителями родов Mycoplasma и Ureaplasma.

Цитомегаловирус и вирус герпеса простого обнаруживается у новорожденных в 5,8±1,3% и 0,4±0,3% случаев соответственно, что свидетельствует о том, что вертикальный путь передачи не является ведущим при инфицировании человека этими агентами. В дальнейшем частота их выявления резко возрастает. Активная колонизация организма вирусами группы герпеса происходит в первые месяцы и годы жизни за счет других путей передачи (контактно-бытового, аэрозольного) и к 2-х летнему возрасту не менее 65% людей инфицированы цитомегаловирусом и не менее 8% - вирусом герпеса простого. Нами представлены максимальные значения частот выявления активной репликации вирусов. С учетом того, что герпесвирусы могут длительное время пребывать в латентной форме, не размножаясь, показатели истинной инфицированности, по видимому, еще выше.

От 23,9±2,4% до 30,9±2,6% новорожденных инфицируются U. urealyticum внутриутробно и в процессе родов. Однако, у большей части детей заболевание не развивается, а бактерии элиминируются из организма. Это следует из того, что у детей старше года и до 13 лет частота выявления уреаплазм существенно меньше, чем у новорожденных и составляет 4-8%. Большая часть человеческой популяции колонизируется U. urealyticum начиная с 14-ти летнего возраста в период полового созревания и активной репродукции, в основном, за счет полового пути передачи. Частота выявления этих микроорганизмов в данный период у здоровых людей и бессимптомных носителей может превышать 50%.

Частота инфицирования детей M. hominis внутриутробно и при родах составляет 13,2±1,9 –15,2±2,0%. И в дальнейшем уровень выявления этого инфекционного агента стабильно поддерживается до 13-ти летнего возраста (12 - 15%). Второй этап колонизации макроорганизма так же, как и в случае с U. urealyticum, начинается с 14-ти лет и связан с половым путем передачи. Частота выявления M. hominis у здоровых людей в этот период может достигать 25%.

Особенности взаимодействия макроорганизма с возбудителями НУГИ.

Высокая частота выявления U. urealyticum и M. hominis у здоровых людей свидительствует о том, что проникновение этих мембранных паразитов в организм человека не всегда приводит к развитию заболевания. При инфицировании может происходить формирование своеобразного компонента общего микробиоценоза человека – микробиоценоза мембран клеток слизистых оболочек.

Развитие патологических процессов, обусловленных микоплазмами и уреаплазмами, является не только результатом внешнего заражения, а зачастую представляет собой сбой в сформировавшемся микробиоценозе, приводящий к нарушению нормального взаимодействия макро - и микроорганизма. По-видимому, это обусловлено нарушениями функционирования иммунной системы. Наряду с инфекционным компонентом при воспалительных процессах, ассоциированных с уреаплазмами и микоплазмами, обнаруживаются различные варианты аутоиммунных процессов. Нами было проведено одновременное обследование 38 больных женщин на возбудители НУГИ и антитела к нативной ДНК, кардиолипину, миоглобину, хорионическому гонадотропному гормону. Показано, что у всех инфицированных уреаплазмами и микоплазмами регистрировались повышенные концентрации аутоантител к одному или нескольким маркерам. Максимальные концентрации аутоантител и наибольшее их разнообразие отмечено для больных с ассоциацией уреаплазма – микоплазма. У пациентов, инфицированных C. trachomatis, аутоиммунные процессы не выявлены.

Проведенные исследования продемонстрировали, что ПЦР является основным базовым методом, позволяющим эффективно выявлять все виды возбудителей НУГИ. За счет его применения были получены оригинальные данные о распространении и особенностях циркуляции этих микроорганизмов, заключающиеся в высокой частоте выявления, значительном количестве ассоциаций инфекционных агентов и достаточно стабильном поддержании распределения возбудителей по частоте выявления. Анализ результатов ПЦР исследования позволил также установить этапы колонизации макроорганизма бактериями родов Mycoplasma, Ureaplasma и вирусами группы герпеса.

Нами установлены контингенты, которые целесообразно обследовать на наличие НУГИ. Предложен комлексный вариант ПЦР-детекции наиболее значимых возбудителей НУГИ, основанный на одномоментном выявлении U. urealyticum, M. hominis, C. trachomatis, Cytomegalovirus и Herpes simplex I/II. Для увеличения эффективности выделения инфекционных агентов рекомендуется исследовать смеси субстратов, в которых наиболее вероятно их присутствие: у женщин - смеси соскобов слизистых уретры, влагалища и цервикального канала; у мужчин - смеси соскоба слизистой уретры и осадка мочи; у детей - смеси мочи, слюны, слезного отделяемого.

На основании результатов проведенных исследований можно сделать вывод о том, ПЦР может рассматриваться как основной базовый метод в диагностике НУГИ и хеликобактерной инфекции и как метод первичного скрининга для выявления наиболее значимых бактериальных возбудителей ОКИ. Метод ПЦР нецелесообразно использовать в качестве стартового этапа обследования пациентов с подозрением на парентеральные вирусные гепатиты. По информативности и себестоимости он уступает тесту на HBs-антиген для ВГВ и тестам на антитела для ВГС. Но ПЦР является единственным из методов лабораторной диагностики, который дает возможность выявлять вирус в период «серонегативного окна», осуществлять контроль противовирусной терапии, проводить раннее выявление инфицирования новорожденных от больных ВГВ и ВГС матерей, отслеживать циркуляцию и смену генотипов вирусов.

Наиболее объективные результаты получаются при ПЦР диагностике тех заболеваний, при которых инфекционные агенты выходят в биологические жидкости организма (кровь, мочу, слюну, слезное отделяемое) или локализуются на кожных и слизистых покровах. При диссеминации инфекции и очаговой локализации возбудителя ПЦР диагностика не эффективна.

Повышение эффективности выявления инфекционных агентов, уменьшение продолжительности и себестоимости анализа достигается одновременным анализом пула (смеси) субстратов, в которых вероятно присутствие наиболее значимых для данной патологии возбудителей.

       Применение в современных ПЦР тест-системах внутреннего контрольного образца, антиконтаминационной модификации ампликонов и разработка тест-систем с флюоресцентной детекцией ампликона (технологии PCR - Real time и PCR - End point) значительно снизили вероятность контаминации и получения ложноположительных и ложноотрицательных результатов. Но все эти совершенствования затрагивают только стадии ПЦР и детекции продукта амплификации. Как показывает практика, наибольший риск перекрестной контаминации, вызывающей ложноположительные результаты и потеря исследуемого материала и разрушение инфекционных агентов в субстратах, приводящие к ложноотрицательным результатам, связаны со стадиями отбора, хранения и транспортировки образцов. Перекрестная контаминация возможна также  и на стадии подготовки материала к ПЦР. Вести объективный контроль этих стадий сложно, их успех, главным образом, определяет квалификация исполнителя.        Разработанные в ходе выполнения данной работы алгоритмы ПЦР диагностики НУГИ, ОКИ, парентеральных вирусных гепатитов, хеликобактерной инфекции с применением метода ПЦР могут быть использованы в дальнейшем при разработке новых диагностических стандартов. Предложенные перечни инфекционных агентов для комплексной диагностики НУГИ и ОКИ являются основой для комплектации мультиплексных ПЦР-тест систем с детекцией продуктов амплификации методом биочипов.

Учитывая опыт использования институтом молекулярно-биологических методов, и на основании исследований, проводимых при выполнении данной диссертационной работы на базе Нижегородского НИИ эпидемиологии и микробиологии в соответствии с приказом №2 от 03.01.1995 г. Государственного комитета санитарно-эпидемиологического надзора Российской Федерации был сформирован первый в Волго-Вятском регионе многопрофильный ПЦР диагностический центр (Волго-Вятский региональный научно-практический центр по индикации, идентификации и таксономии микроорганизмов и организации противоэпидемической работы в экстремальных условиях). Основу деятельности центра составили направления нашей работы: выявление возбудителей НУГИ, ОКИ, хеликобактериоза, вирусных гепатитов. При проведении диагностических исследований используется комплексный подход, заключающийся в одновременном выявлении наиболее значимых возбудителей заболеваний. Разработанные алгоритмы диагностики инфекционных заболеваний и модификации технологий непосредственно после апробации внедряются в работу центра.

В настоящее время в Нижегородском регионе наиболее востребованными аспектами в работе центра являются:

-по диагностике НУГИ - обследование семейных пар, планирующих рождение ребенка, взрослых с проблемами репродукции и воспалительными заболеваниями урогенитального тракта, детей с подозрением на ВУИ, секционного материала от мертворожденных и умерших новорожденных. У данного контингента проводится выявление U.urealyticum, M.hominis, C.trachomatis, Cytomegalovirus, Herpes simplex I/II, дополнительно проводится исследование на M.genitalium, T.gondii, папилломавирусы высокого канцерогенного риска.

- по диагностике ОКИ – исследование материала от больных с подозрением на ОКИ, анализ продуктов питания и смывов с объектов внешней среды при расследовании случаев вспышечной и спорадической заболеваемости. При этом, как правило, проводится одновременное выявление бактерий родов Salmonella, Shigella, Campylobacter и Yersinia enterocolitica.

-по диагностике хеликобактерной инфекции – обследование больных с гастродуоденальной патологией на наличие H.pylori до и после лечения; определение устойчивости H.pylori к макролидам.

- в диагностике вирусных гепатитов – контроль эффективности противовирусной терапии, раннее выявление инфицирования вирусами гепатитов В и С детей, рожденных больными матерями, контроль постоянных доноров, выявление вирусов гепатитов G и TTV у детей больных лейкозами.

       На основании запросов органов практического здравоохранения сформировался ряд новых направлений. Наиболее важные среди них:

- выявление возбудителей воспалительных заболеваний органов дыхания. При этом исследовании проводится детекция как труднокультивируемых форм (M.pneumoniaе, C.pneumoniae, C.psittaci), так и традиционных инфекционных агентов (S.pneumoniaе, H.influenzae). Эффективность выявления срептококка и хемофилла методом ПЦР в 1,5-2 раза выше, чем бактериологическим методом.

- выявление возбудителей гнойных и серозных менингитов. Проводится комплексное исследование ликвора на бактериальные и вирусные инфекционные агенты: S.pneumoniaе, H.influenzae, N.meningitidis, эетеровирусы, герпес простой и цитомегаловирус.

- обследование часто болеющих детей и детей с полилимфоаденопатиями на наличие активной репликации вирусов группы герпеса (цитомегаловирус, герпес простой, вирус Епштейн-Барр, герпес тип 6).

       В 90-е годы основными задачами центра являлись популяризация и внедрение в практику молекулярно биологических методов диагностики, подготовка специалистов и оказание методической помощи при организации ПЦР лабораторий в лечебных учреждениях и учреждениях санэпиднадзора. В настоящее время в условиях, когда работает множество лабораторий, использующих метод ПЦР, на первое место выходит референс функция (объективная оценка качества диагностики), а также проведение наиболее сложных и требующих высокой квалификации исследований при оперативном решении проблем, возникающих при диагностике инфекционных заболеваний в Нижегородском регионе.

       Многопрофильность центра позволяет максимально эффективно использовать имеющуюся материальную базу, быстро и гибко реагировать на изменяющуюся ситуацию (осваивать новые объекты и направления). В настоящее время имеется возможность выявления возбудителей более 30 нозологических форм в режиме сопровождения лечебного процесса, а не ретроспективного исследования.

При участии и методической помощи Центра были организованы ПЦР лаборатории в Нижегородском НИИ детской гастроэнтерологии, Нижегородском областном диагностическом центре, Нижегородском областном центре переливания крови, Нижегородском областном кожно-венерологическом диспансере, инфекционной больнице №2 Нижнего Новгорода, кожно-венерологическом диспансере Сормовского района Нижнего Новгорода и в целом ряде коммерческих медицинских организаций.

Выводы.

1. Научно обоснованы и разработаны оптимальные алгоритмы использования метода ПЦР для диагностики бактериальных ОКИ, хеликобактерной инфекции, парентеральных вирусных гепатитов и НУГИ на основе метода ПЦР. Показано, что диагностическая и экономическая эффективность выявления возбудителей повышается за счет одновременной ПЦР-детекции наиболее значимых патогенов в смеси информативных субстратов.

2. Разработка комплекса собственных тестов и использование экспериментальных отечественных ПЦР тест-систем позволили провести мониторинг клинических изолятов семейства Enterobacteriacea на наличие генов токсигенности, инвазивности за длительный период времени и определить особенности циркуляции таких штаммов. Использование скрининговых ПЦР-тестов для первичного обследования больных с подозрением на ОКИ более чем в 2 раза увеличило эффективность выявления основных возбудителей бактериальных ОКИ – бактерий родов Shigella и Salmonella по сравнению с классическим микробиологическим методом.

3. Выявлена высокая эффективность колонизации макроорганизма H. pylori, начинающаяся с первых лет жизни; установлены высокие показатели частоты выявления хеликобактера как у детей, так и у взрослых с различными формами гастродуоденальной патологии. Показано широкое распространение генов токсигенности сagA и vakA среди клинических изолятов H. pylori. Предложен экономичный полуколичественный вариант ПЦР-детекции H. pylori, позволяющий контролировать эффективность антихеликобактерной терапии и прогнозировать отдаленные результаты лечения.

4. Установлено, что на территории Нижнего Новгорода и Нижегородской области, на протяжении 6 лет (2000 – 2006 гг.) доминируют генотипы ВГС 1b и 3а, имеется тенденция к увеличению количества случаев инфицирования пациентов ВГС двух генотипов. Установлена высокая частота (10%) передачи ВГС внутриутробно и при родах. Показано, что возбудители вирусных гепатитов менее активно реплицируются при смешанном инфицировании (ВГВ+ВГС; ВГС+ВГG; ВГВ+ВГD; ВГВ+ВГС+ВГG)), по сравнению с моноинфекцией. Выраженного доминирования одного из вирусов над другим при микстинфекциях не установлено.

5. Показано широкое распространение возбудителей НУГИ (40-68%) среди взрослого населения как здоровых, так и больных с воспалительными заболеваниями урогенитального тракта. Характерно широкое распространение ассоциаций этих микроорганизмов. За 12-ти летний период наблюдений распространенность инфекционных агентов сохранялась на высоком уровне, неизменными оставались средние показатели частоты выявления определенных видов микрооргнизмов по годам и сезонам.

6. Установлены возрастные этапы колонизации макроорганизма возбудителями НУГИ: для вирусов группы герпеса характерно инфицирование макроорганизма в первые годы жизни воздушно-капельным и контактно-бытовым путями передачи; частота выявления U. urealyticum резко возрастает в период полового созревания с преимущественным половым путем передачи инфекционного агента, для M. hominis показаны два этапа колонизации: первый происходит внутриутробно и/или в процессе родов, второй этап – в период полового созревания преимущественно половым путем.

       7. Высокая частота выявления U. urealyticum и M. hominis у здоровых людей свидетельствует о том, что попадание этих бактерий в организм человека, как правило, не вызывает развитие заболевания, а приводит к формированию компонента общего микробиоценоза человека – микробиоценоза мембран.

Практические рекомендации

1. В диагностике бактериальных ОКИ применение ПЦР целесообразно для первичного обследования лиц поступающих в стационары при спорадической и вспышечной заболеваемости; для скринигового исследования продуктов питания, смывов с объектов внешней среды, материалов от контактных лиц с целью выявления источника, путей и факторов передачи инфекции при расшифровке вспышечной заболеваемости; для выявления труднокультивируемых форм возбудителей ОКИ; для выявления генов факторов патогенности у клинических изолятов возбудителей ОКИ.

2. При отсутствии информации о возбудителе наиболее эффективно применение комплексного ПЦР исследования с одновременным выявлением Salmonella, Shigella, Campylobacter и Y. enterocolitica.

3. В виду недостаточного развития микробиологического метода ПЦР детекция H. pylori является в настоящее время наиболее приемлемым вариантом прямого выявления данного микроорганизма. Препарат ДНК от пациента, в котором обнаружен H. pylori, на следующем этапе рекомендуется исследовать методом ПЦР на наличие генов факторов патогенности и устойчивость к макролидам.

4. При обследовании больных с гастродуоденальной патологией целесообразно применение полуколичественного варианта ПЦР исследования желудочного сока, разработанного в настоящей работе.

5. Основными направлениями применения ПЦР в диагностике вирусных гепатитов являются определение вирусной нагрузки у больных перед назначением терапии и при проведении последующего контроля лечения, детекция ВГС в период серонегативного окна, профилактика вертикального пути передачи гепатитов и повышение безопасности манипуляций переливания крови и трансплантации органов. Для решения этих задач рекомендуется использовать разработанный апробированный нами экономичный полуколичественный вариант метода ПЦР – детекции ВГС и ВГB.

6. Целесообразно проведение комплексного обследования на наличие возбудителей НУГИ следующих контингентов: семейные пары, планирующие рождение ребенка; мужчин с проблемами репродукции, воспалительными заболеваниями органов мочеполовой системы, заболеваниями опорно-двигательного аппарата; женщин, планирующих беременность, и беременных, женщин с отягощенным акушерско-гинекологическим анамнезом, воспалительными заболеваниями органов мочеполовой системы, заболеваниями опорно-двигательного аппарата; новорожденных от матерей, инфицированных НУГИ; новорожденных с подозрением на внутриутробное инфицирование; недоношенных детей; детей с гипотрофией, анемией, гепатоспленомегалией, гидроцефалией, энцефалопатией; часто болеющих детей; детей с инфекционно-аллергическими заболеваниями органов дыхания и опорно-двигательного аппарата; детей с дерматитами, конъюнктивитами, лимфаденитами.

7. Оптимально одновременное выявление U. urealyticum, M. hominis, C. trachomatis, Cytomegalovirus, Herpes simplex I/II в смеси соскоба клеток слизистой уретры и осадка первой утренней порции мочи у мужчин; в смеси соскобов слизистых уретры, влагалища и цервикального канала у женщин, смеси слюны, мочи, слезного отделяемого (смыва с конъюнктивы) у детей. Использование смесей субстратов увеличивает вероятность выявления инфекционных агентов.

Список работ, опубликованных по теме диссертации.

1. Блохина, И.Н. Применение метода молекулярной гибридизации для изучения энтеротоксигенных свойств сальмонелл/И.Н.Блохина, Н.Ф. Бруснигина, В.Н.Мазепа [и др.] // Журнал микробиологии, эпидемиологии и иммунобиологии.- №6.-1990.- C. 20-24.

2. Мазепа В.Н. Разработка тест-систем (ДНК-зондов) для выявления факторов вирулентности энтеробактерий / В.Н.Мазепа, Д.А.Бессараб, Т.И.Уланова [и др.] // Молекулярная генетика, микробиология и вирусология.- №1.- 1995.-С.21-24.

3. Бокарев, А.А. Исследование H.pylori при деструктивной патологии в динамике заболевания / А.А.Бокарев, В.Н.Мазепа, К.М.Перфилова // Российский журнал гастроэнтерологии, гепатологии и колопроктологии.-1996.- №4.- С.104-105.

4. Блохина, И.Н. Первичная структура ДНК и прикладная геносистематика бактерий с основами молекулярной эпидемиологии бактерий / И.Н.Блохина, Г.Ф.Леванова, В.Н.Мазепа // Материалы II Съезда биохимического общества Российской академии Наук, Пущино. -Часть I. - 1997.-С.101.

5. Панова, М.Г. Опыт работы диспансерного отделения по диагностике вирусных гепатитов В и С с учетом результатов предварительного скрининга / М.Г.Панова, А.И.Цыбасова, В.Н.Мазепа [и др.] // «Актуальные вопросы медицины».-Материалы юбилейной научно-практической конференции врачей, посвященной 275-летию Нижегородского военно-гарнизонного госпиталя, Н.Новгород.-1997.- С.63-67.

6. Соринсон, С.Н. Гепатит С: многолетние механизмы персистенции вируса и фазы течения инфекционного процесса / С.Н.Соринсон, Н.А.Селиванов, О.В.Корочкина, Ю.Е.Жданов, А.Ю.Афанасьев, А.В.Кривопустова, Н.М.Травина, В.Н.Мазепа // Клиническая медицина. -№10.- 1997.-С 27-30.

7. Соринсон, С.Н Пути совершенствования интерферонотерапии при HBV- и HCV-инфекции / С.Н.Соринсон, О.В.Корочкина, Н.А.Селиванов, Мукомолов, Ю.Е.Жданов, Ю.Л.Рыжова, М.В.Неумоина, Е.А.Фомин, А.Ю.Афанасьев, А.В.Кривопустова, Е.Е.Кузоватова, Н.И.Сивухина, П.Г.Зубаров, Н.М.Травина, В.Н.Мазепа // Российский журнал гастроэнтерологии, гепатологии и колопроктологии.- №5. -1997.- С.

8. Миловидова, О.В. Использование методов обследования, основанных на ПЦР, в акушерско-гинекологической практике / О.В.Миловидова, В.Н.Мазепа, И.В.Соловьева [и др.] // «Человек и лекарство».-Материалы IV Всероссийского национального конгресса, Москва.- 1997.- С.226.

9. Блохина, И.Н. Использование метода полимеразной цепной реакции (ПЦР) для индикации бактерий рода Salmonella на объектах внешней среды / И.Н.Блохина, В.Н.Мазепа, Н.Ф.Бруснигина [и др.] // Мат. VII съезда Всерос.общества эпидемиол.,микробиол. и паразитол.- М.- 1997.- Т.1.- С.376-377.

10. Жданов, Е.Е. Рандомизированный подход к изучению эпидемиологического процесса при вирусном гепатите С // Е.Е.Жданов, В.Н.Мазепа, Н.М.Травина [и др.]// Российский журнал гастроэнтерологии, гепатологии и колопроктологии. - Материалы 4-й Росс.гастроэнтерологической недели.- 1998.- Приложение 5.- С. 154.

11. Алексеева, О.П. Обнаружение HCV РНК в слюне у больных хроническим гепатитом С / О.П.Алексеева, О.В.Воробьев, Н.И.Сивухина, В.Н.Мазепа // Российский журнал гастроэнтерологии, гепатологии и колопроктологии. - Материалы 4-й Росс.гастроэнтерологической недели.- 1998.- Приложение 5.- С. 161-162.

12. Соринсон, С.Н О недостаточной информативности индикации суммарных антител HCV на разных этапах течения гепатита С / С.Н.Соринсон, А.ЮАфанасьев, А.В.Афанасьева, Н.М.Травина, В.Н.Мазепа // Российский журнал гастроэнтерологии, гепатологии и колопроктологии. - Материалы 4-й Росс.гастроэнтерологической недели.- 1998.- Приложение 5.- С. 166-167.

13. Соринсон, С.Н. Сравнительная оценка исходов острого гепатита С, протекающего с признаками желтухи и в их отсутствии / С.Н.Соринсон, О.В.Корочкина, А.Ю.Афанасьев, А.В.Афанасьева, В.Н.Мазепа // Российский журнал гастроэнтерологии, гепатологии и колопроктологии. - Материалы 4-й Росс.гастроэнтерологической недели.- 1998. -Приложение 5. -С. 164.

14. Мазепа, В.Н. Комплексное обследование женщин с урогенитальной патологией в условиях крупного промышленного центра / В.Н.Мазепа, В.В.Немов, О.М.Черневская [и др.] // «Экология и здоровье». - Материалы межрегиональной научно-практической конференции, Н.Новгород.- 1998.- С. 3.

15. Мазепа, В.Н. Опыт использования ПЦР-диагностики в санитарно эпидемиологической практике / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др.] // «Экология и здоровье».-Материалы межрегиональной научно-практической конференции, Н.Новгород.- 1998.- С 18.

16. Соринсон, С.Н. Острая фаза гепатита С: диагностика и перспектива интерферонотерапии / С.Н.Соринсон, О.В.Корочкина, Ю.Е.Жданов, А.Ю.Афанасьев, А.В.Кривопустова, Н.И.Сивухина, Н.М.Травина, В.Н.Мазепа // Российский журнал гастроэнтерологии, гепатологии и колопроктологии.- №1. -1999. -С.40-44.

17. Мазепа, В.Н. Динамическое исследование циркуляции внутриклеточных, мембранных паразитов, вирусов группы герпеса у женщин с гинекологической патологией, новорожденных и детей первого года жизни с подозрением на внутриутробное инфицирование / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др.] // Материалы II Российского форума «Мать и дитя», Москва.- 1999. -С.246-249.

18. Мазепа, В.Н. ПЦР-диагностика экологически обусловленных заболеваний / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др.] // Сб. «Естественные факторы защиты в профилактике экологически обусловленных заболеваний», Материалы научной конференции посвященной 70-летию Нижегородского НИИЭМ, Н.Новгород.- 2000.- С. 62-63.

19. Мазепа, В.Н. ПЦР-диагностика цитомегаловирусной инфекции у детей первого года жизни / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская О.М [и др.] // Сб. «Естественные факторы защиты в профилактике экологически обусловленных заболеваний», Материалы научной конференции посвященной 70-летию Нижегородского НИИЭМ, Н.Новгород.- 2000.- С.63-64.

20. Мазепа, В.Н. Создание мобильной ПЦР лаборатории и апробация ее на базе ЦРБ г.Бора / В.Н.Мазепа, К.А.Орлова, О.М.Черневская [и др.] // Сб. «Естественные факторы защиты в профилактике экологически обусловленных заболеваний», Материалы научной конференции посвященной 70-летию Нижегородского НИИЭМ, Н.Новгород.- 2000.- С.64-65.

21. Мазепа, В.Н. Опыт работы центра индикации идентификации и таксономии Нижегородского НИИ эпидемиологии и микробиологии им. академика И.Н. Блохиной / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др]// «Фундаментальные и прикладные проблемы медицинской биотехнологии», Материалы международной конференции, посвященной памяти академика РАМН и РАМТН И.Н.Блохиной, Москва.- Н.Новгород.- 2000.- С.64

22. Zubkova N.V. The use of the method of polymerase chain reaction for an estimation of efficacy of virus inactivation in model experiment / N.V.Zubkova, V.N.Mazepa, K.A.Orlova // Russian Jornal of HIV/AIDS and Related Problems.-2000.-V.4.-№1.-P.175.

23. Мазепа, В.Н. Обнаружение возбудителей негонококковых урогенитальных инфекций в секционном материале от мертворожденных и умерших новорожденных / В.Н.Мазепа, О.М.Черневская,Н.Ф. Бруснигина [и др.] // Материалы III Российского форума «Мать и дитя», Москва.- 2001.- С.566-567.

24. Мазепа, В.Н. Использование ПЦР-диагностики для выявления Helicobacter pylori в различном клиническом материале / В.Н.Мазепа, А.А.Бокарев, К.А.Орлова [и др.] // Фундаментальные и прикладные проблемы биотехнологии», Материалы международной конференции, посвященной памяти академика РАМН и АМТН РФ И.Н.Болхиной, Москва.- Н.Новгород.- 2001.- С.124-125.

25. Мазепа, В.Н. Выявление возбудителей негонококковых урогенитальных инфекций у женщин с гинекологической патологией и детей с подозрением на внутриутробное инфицирование / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская // Материалы международной конференции, посвященной памяти академика РАМН и АМТН РФ И.Н.Блохиной, Москва.- Н.Новгород.- 2001.- С.122-124.

26. Быстрова, Т.Н. Опыт использования метода RT-ПЦРдля обнаружения вируса гепатита А в воде / Т.Н.Быстрова, К.В Блохин, В.Н.Мазепа [и др.] // Вестник Нижегородского универсистета.-Серия Биология.- 2001.- Выпуск 1 (3).-С.74-75.

27. Мазепа, В.Н. Выявление методом ПЦР бактерий рода Shigella в фекальных пробах от больных с острыми кишечными инфекциями / В.Н.Мазепа, К.А.Орлова, О.М.Черневская [и др.] // Материалы международной конференции, посвященной памяти академика РАМН и АМТН РФ И.Н.Блохиной, Москва.- Н.Новгород.- 2001.- С.120-122.

28. Катышева, А.В. Значение эрадикации Helicobacter pylori при ранней реабилитации больных после ушивания перфоративных гастродуоденальных язв / А.В.Катышева, С.С.Белоусов, М.А.Махова, В.Н.Мазепа // Материалы III международного симпозиума «Диагностика и лечение заболеваний, ассоциированных с Helicobacter pylori».- Росс. журнал гастроэнтерологии, гепатологии, колопроктологии.- 2001. - №2. С.44-46.

29. Мазепа, В.Н. Репликативная активность вируса гепатита С у больных с различными классами антител к ВГС / В.Н.Мазепа, О.М.Черневская, Н.Ф.Бруснигина [и др.] // «Генодиагностика инфекционных заболеваний»-. Материалы 4 Всероссийской научно-практической конференции, Москва.- 2002.- С.159.

30. Орлова, К.А. Выявление методом ПЦР бактерий рода Shigella в фекальных пробах больных с острыми кишечными инфекциями / К.А.Орлова, В.Н.Мазепа, О.М.Черневская [и др.] // «Технологии генодиагностики в практическом здравоохранении», Сборник трудов научно-практического симпозиума в рамках международной конференции «Геномика, протеомика, биоинформатика для медицины», Москва.- 2002.- С.268-270.

31. Белоусов, С.С. Определение CagA-штаммов Helicobacter pylori в желудочном соке у больных с гастродуоденальной патологией / С.С.Белоусов, В.Н.Мазепа, М.А.Махова [и др.] // Материалы IV Российского научного форума c международным участием «Санкт-Петербург – Гастро-2002». - Гастробюллетень.- 2002. - №2-3.- С. 44.

32. Мазепа, В.Н. Гетеродуплексный анализ фрагментов гена CagA Helicobacter pylori, полученных из клинического материала методом ПЦР / В.Н.Мазепа, М.А.Махова // Тезисы III съезда биохимического общества, СПб.- 2002. – С. 298.

33. Мазепа, В.Н. Возбудители негонококковых урогенитальных инфекций и их роль в патологии репродукции / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская. [и др.] // «Молекулярная биология, биотехнология, здоровье человека».-Материалы научных чтений, посвященных 80-летию И.Н. Блохиной, Н.Новгород -2002.- С.5.

34. Мазепа, В.Н. Многолетнее изучение циркуляции возбудителей негонококковых урогенитальных инфекций в условиях крупного промышленного центра / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др.] // Сб. «Здоровье населения Нижегородской области», Итоги региональной программы, Н.Новгород.- 2002.- С. 31-38.

35. Богданова, Т.А. Иммунологическая реактивность детей, больных бронхиальной астмой, отягощенной цитомегаловирусной и микоплазменной инфекциями / Т.А.Богданова, Н.И.Кубышева, А.В.Максимова, В.Н.Мазепа [и др.] // Сб. «Здоровье населения Нижегородской области», Итоги региональной программы, Н.Новгород.- 2002.- С.101-105.

36. Мазепа, В.Н. Выявление возбудителей негонококковых урогенитальных инфекций у новорожденных и детей разного возраста с подозрением на внутриутробное инфицирование / В.Н.Мазепа, О.М.Черневская, Н.Ф.Бруснигина [и др.] // «Генодиагностика инфекционных заболеваний», Материалы 4 Всероссийской научно-практической конференции, Москва.- 2002.- С.50-52.

37. Махова, М.А. Апробация отечественных ПЦР-тест-систем для выявления факторов патогенности Helicobacter pylori / М.А.Махова, В.Н.Мазепа, К.А.Орлова // «Генодиагностика инфекционных заболеваний».- Материалы 4-й Всероссийской научно-практической конференции.- Москва.- 2002. С.218-219.

38. Мазепа, В.Н. Опыт применения ПЦР-тест системы для выявления Vibrio cholera / В.Н.Мазепа, К.А.Орлова, М.А.Махова [и др.] // «Генодиагностика инфекционных заболеваний», Материалы 4-й Всероссийской научно-практической конференции, Москва.- 2002.- С.282-283.

39. Зубкова Н.В. Эффективность тепловой инактивации вирусов в производстве внутривенного иммуноглобулина / Н.В.Зубкока, В.В.Анастасиев, В.Н.Мазепа [и др.] // Вестник службы крови России.- 2002.-№1.-С.31-33.

40. Мазепа, В.Н. Выявление РНК HCV и ДНК HBV у беременных и детей первых лет жизни / В.Н.Мазепа, М.Г.Панова, Н.Е.Сенягина [и др.] // Материалы Всеросс.конференции по вопросам ВИЧ-инфекции и вирусных гепатитов, Суздаль.- 2003.- С. 72-73.

41. Орлова, К.А. Применение комплексного ПЦР-исследования клинического материала для выявления бактериальных возбудителей ОКИ / К.А.Орлова, В.Н.Мазепа, Н.В.Перфилова [и др.] // Сб. трудов Всероссийской V науч. прак. конф. «Генодиагностика инфекционных заболеваний», Москва.- 2004.- т.2.- С.94-96.

42. Орлова, К.А. Выявление генов факторов патогенности в клинических изолятах энтеробактерий / К.А.Орлова, В.Н.Мазепа, М.А.Махова [и др.] // Сб. трудов Всероссийской V науч. прак. конф. «Генодиагностика инфекционных заболеваний», Москва.- 2004.- т.2.- С.96-97.

43. Мазепа, В.Н. Применение метода ПЦР в диагностике вирусных гепатитов у беременных и детей / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др.] // Сб. трудов Всероссийской V науч. прак. конф. «Генодиагностика инфекционных заболеваний», Москва.- 2004.- т.1.- С.244-246.

44. Мазепа, В.Н. Выявление бактерий родов Chlamydia, Mycoplasma и вирусов группы грпеса у детей с заболеваниями инфекционно-аллергической природы / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др.] // Сб. трудов Всероссийской V науч. прак. конф. «Генодиагностика инфекционных заболеваний», Москва.- 2004.- т.1.- С83-87.

45. Мазепа, В.Н. Распространение возбудителей урогенитальных инфекций (НУГИ) среди больных с заболеваниями инфекционно-аллергической природы / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др.] //Сб. «Новые технологии в профилактике, диагностике, эпиднадзоре и лечении инфекционных заболеваний», Материалы науч. конфер., посвящ.75-летию НИИЭМ, Н. Новгород.- 2004.-С.245-250.

46. Орлова, К.А. Опыт применения комплексного ПЦР-исследования для выявления бактериальных возбудителей острых кишечных инфекций / К.А.Орлова, В.Н.Мазепа, Г.А.Шипулин [и др.] //РЭТ-инфо.- 2004.- №1.- С.45-46.

47. Мазепа, В.Н. Изучение вирусной активности при гепатитах смешанной этиологии / В.Н.Мазепа, К.А.Орлова, Н.Ф.Бруснигина [и др.] // Материалы 6 Всероссийской науч.-практической конф. «Вирусные гепатиты – проблемы эпидемиологии, диагностики, лечения и профилактики», Москва.-2005. -С.188-190.

48. Мазепа, В.Н. ПЦР-диагностика вирусного гепатита С у беременных и детей. Мазепа В.Н., Бруснигина Н.Ф., Черневская // Материалы 6 Всероссийской науч.-практической конф. «Вирусные гепатиты – проблемы эпидемиологии, диагностики, лечения и профилактики», Москва. –2005. –С.190-192.

49. Мазепа, В.Н. Изучение распространения онкогенных папилломавирусов / В.Н.Мазепа, Н.Ф.Бруснигина, К.А.Орлова [и др.] // «Новые технологии в профилактике, диагностике, эпиднадзоре и лечении инфекционных заболеваний», Материалы научной конференции, посвященной 85-летию со дня рождения академика РАМН И.Н. Блохиной, Н.Новгород.- 2006.- С.126 - 127.

50. Мазепа, В.Н. Метод ПЦР в диагностике острых кишечных инфекций / В.Н.Мазепа, К.А.Орлова, Н.Ф.Бруснигина [и др.] // «Новые технологии в профилактике, диагностике, эпиднадзоре и лечении инфекционных заболеваний», Материалы научной конференции, посвященной 85-летию со дня рождения академика РАМН И.Н. Блохиной, Н.Новгород.- 2006.-С.127-128.

51. Мазепа, В.Н. Изучение особенностей циркуляции возбудителей НУГИ среди детей различных возрастов / В.Н.Мазепа, Н.Ф.Бруснигина, О.М.Черневская [и др.] // «Новые технологии в профилактике, диагностике, эпиднадзоре и лечении инфекционных заболеваний», Материалы научной конференции, посвященной 85-летию со дня рождения академика РАМН И.Н. Блохиной, Н.Новгород.- 2006.- С.129-132.

52. Мазепа, В.Н. Выявление вирусов Epstein-Barr и Cytomegalovirus у детей различных возрастов с разными формами патологии / В.Н.Мазепа, Н.Ф.Бруснигина, К.А.Орлова [и др.] // Тезисы VII Российского съезда инфекционистов «Новые технологии в диагностике и лечении инфекционных болезней», Н.Новгород.- 2006.-С.162-163.

53. Мазепа, В.Н. Опыт применения метода ПЦР при анализе вспышки Шигеллёза / В.Н.Мазепа, Н.Ф.Бруснигина, К.А.Орлова [и др.] // «Молекулярная диагностика-2007», Сб. трудов IV Всеросс. научн-практ.конф., Москва.-Т.1.-2007.-С.229.

54. Мазепа, В.Н. ПЦР в комплексной диагностике парентеральных вирусных гепатитов / В.Н.Мазепа, Н.Ф.Бруснигина, К.А.Орлова [и др.] // «Молекулярная диагностика-2007», Сб. трудов IV Всеросс. наун.-практ. конф., москва.-Т.1.-2007.-С.255-257.

55. Мазепа, В.Н. Выявление ВПЧ высокого канцерогенного риска у женщин репродуктивного возраста / В.Н.Мазепа, Н.Ф.Бруснигина, К.А.Орлова [и др.] //»Молекулярная диагностика-2007», Сб. трудов IV Всеросс. науч.-практ. конф., Москва. -Т.3.-2007.-С.133-134.

56. Мазепа, В.Н. Изучение распространения Chlamydia trachomatis в г. Н.Новгороде / В.Н.Мазепа, Н.Ф.Бруснигина, К.А.Орлова [и др.] // «Молекулярная диагностика-2007», Сб. трудов IV Всеросс. науч.-практ. конф., Москва. -Т.2.-2007.-С.180.

57. Подколзин А.Т. Сезонность и возрастная структура заболеваемости острыми кишечными инфекциями на территории РФ / А.Т.Подколзин, Е.Б.Фенске, Н.Ю.Абрамычева, Г.А.Шипулин, Р.Л.Битиева, О.И.Сагалова, В.Н.Мазепа [и др.] // Терапевтический архив.-2007.-№11.-С.10-16.

58. Леванова Г.Ф. Эпидемические штаммы различных плазмидоваров бактерий рода Shigella / Г.Ф.Леванова, С.Ю.Сидорова, С.Ю.Кашников, В.Н.Мазепа [и др.] // Журнал микробиологии, эпидемиологии и иммунобиологии.-2008.-№3.-С.13-15.

59. Подколзин А.Т. Надзор за ротовирусной инфекцией по данным госпитализации в отдельных городах РФ за 2005 2007 г.г. // А.Т.Подколзин, Е.Б.Фенске, Н.Ю.Абрамычева, Г.А.Шипулин, О.И.Сагалова, В.Н.Мазепа [и др.] // Инфекционные болезни.- 2008.-т.6.-№4.-С.28-32

60. Mazepa W. Wieloletni monitoring trudno hodujacych sif czynnikow chorobotoworczych wywolujacych negonokokowe infekcje urogenitalne (NGU) u kobiet w wieku rozrodczym miasta Niznij Nowgorod/ W. Mazepa, N. Brusnigina, o. Czernewskaja, A. Aleksiejczuk, M. Machova, K. Orlowa, E. Speranskaja//сб. «Problemy dermatologiczne w pielegniarstwe i kosmetologii».-Lomza.-2009.- p. 47-55

61. Бруснигина Н.Ф. Этиологическая структура внебольничной пневмонии/Н.Ф. Бруснигина, В.Н. Мазепа, Л.П.Самохина [и др.] // Медицинский альманах.-2009.-№2(7).- С.118-120.

62. Podkolzin A.T. Hospital-Based Surveillance of Rotavirus and Other Viral Agents of Diarrhea in Children/ A.T. Podkolzin, E. B. Fenske, N.Y. Abramycheva, G.A. Shipulin, O. I. Sagalova, V. N. Mazepa [et all] //The Journal of Infectious Diseases.- 2009.- v.200.-p. 228233.

63. Мазепа, В.Н. Полимеразная цепная реакция для выявления пилорического хеликобактера: пособие для врачей / В.Н.Мазепа, А.Н.Бокарев, Г.А.Шипулин [и др.] // утверждено Председателем секции по эпидемиологии, инфекционным болезням и вирусологии МЗ РФ академиком РАМН Покровским В.И., протокол №5 от 28.11.2000 г., Н.Новгород.-2000.-8С.

64. Мазепа, В.Н. Метод ПЦР-диагностики в обследовании новорожденных и детей первого года жизни: методические рекомендации / В.Н.Мазепа, Г.А.Шипулин, Н.Ф.Бруснигина [и др.] // утверждены Главным государственным санитарным врачом Нижегородской области Петровым Е.Ю., Н.Новгород.-2000.-16С.

65. Мазепа, В.Н. Принципы отбора, хранения и транспортировки биологических субстратов для проведения ПЦР-диагностики бактериальных и вирусных инфекций: пособие для врачей / В.Н.Мазепа, Черневская О.М., Г.А.Шипулин [и др.] // утверждено Председателем секции по эпидемиологии, инфекционным болезням и вирусологии МЗ РФ академиком РАМН Покровским В.И., протокол №4 от 05.12.2002 г., Н.Новгород.-2002.- 12С.

66. Мазепа, В.Н. Комплексное ПЦР-обследование на наличие возбудителей негонококковых урогенитальных инфекций женщин с гинекологической патологией и отягощенным акушерско-гинеколгическим анамнезом: пособие для врачей / В.Н.Мазепа, Черневская О.М., Г.А.Шипулин [и др.] // утверждено Председателем секции по эпидемиологии, инфекционным болезням и вирусологии МЗ РФ академиком РАМН Покровским В.И., протокол №5 от 02.12.2005 г., Н. Новгород.-2005.-14С.

67. Патент на изобретение № 2031948 Российская Федерация, НПК C12N15/31, Заявка №5016860/13 от 11.12.1991 г., публикация патента 27.03.95 г., бюлл № 9 / Фрагмент ДНК LTf, предназначенный для выявления гена термолабильного энтеротоксина энтеробактерий /Скобло Л.Е., Уланова Т.И.,Мазепа В.Н. [и др.]; заявитель и патентообладатель Нижегородский НИИЭМ.МЗ РФ.

68. Патент на изобретение №2049822 Российская Федерация, НПК C12Q1/68; C12N15/31 Заявка № 92 012954/13 от 21.12.1992 г., публикация патента 10.12.95 г., бюлл № 34. Фрагмент ДНК CFv, используемый для выявления энтеробактерий, обладающих фактором колонизации CFA I / Уланова Т.И., Мазепа В.Н., Пузырев В.Ф. [и др.]; заявитель и патентообладатель Нижегородский НИИЭМ МЗ РФ.

69. Патент на изобретение №2271003 Российская Федерация, НПК G01N33/48; C12Q1/68, Заявка №2003132188 от 03.11.2003 г., публикация патента 27.02.2006 г., бюлл № 6 Способ выявления наиболее значимых возбудителей негонококковых урогеннитальных инфекций (Chlamydia trachomatis, Mycoplasma hominis, Ureaplasma urealyticum, Cytomegalovirus, Herpes symplex I/II) у детей с использованием метода ПЦР /Мазепа В.Н., Черневская О.М., Бруснигина Н.Ф. [и др.]; заявитель и патентообладатель ФГУН «Нижегородский НИИЭМ им. акад. И.Н.Блохиной» Роспотребнадзора.

Список сокращений.

ВГС – вирусный гепатит С

ВГВ – вирусный гепатит В

ВГG - вирусный гепатит G

ВГD - вирусный гепатит D

ВКО – внутренний контрольный образец

ВПГ I/II – вирус простого герпеса I и II типов

ВПЧ – вирус папилломы человека

ВПЧ ВКР - вирус папилломы человека высокого канцерогенного риска.

ДНК – дезоксирибонуклеиновая кислота

ИФА – иммуно-ферментный анализ

ЛЦР – лигазная цепная реакция

НИФ - непрямая иммуно-флюоресценция

НК – нуклеиновая кислота

НУГИ – негонококковые урогенитальные инфекции

ОАГА – отягощенный акушерско-гинекологический анамнез

ОКЗ – острое кишечное заболевание

ОКИ – острая кишечная инфекция

ОТ – обратная транскрипция

ПИФ – прямая иммуно-флюоресценция

ПЦР – полимеразная цепная реакция

РНК – рибонуклеиновая кислота

ХВГС – хронический вирусный гепатит С

ХВГВ – хронический вирусный гепатит В

ЦМВ – цитомегаловирус






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.