WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

Горбачева Любовь Руфэльевна

Нейропротективное действие ключевых

протеиназ гемостаза

03.00.13 - физиология

Автореферат

диссертации на соискание ученой степени

доктора биологических наук

Москва – 2008

Работа выполнена на кафедре физиологии человека и животных биологического факультета МГУ им. М.В. Ломоносова, в лаборатории мембранологии с группой генетических исследований ГУ Научного центра здоровья детей РАМН (Москва) и в институте нейробиохимии университета Отто-фон-Герике, Магдебург (Германия).

Научные консультанты:

доктор биологических наук, профессор

Струкова Светлана Михайловна

доктор медицинских наук, профессор

Пинелис Всеволод Григорьевич

Официальные оппоненты:

доктор медицинских наук, профессор

Мирзоян Рубен Симонович

руководитель лаборатории фармакологии цереброваскулярных расстройств ГУ НИИ фармакологии имени В.В.Закусова РАМН

доктор биологических  наук,  профессор

Хаспеков Леонид Георгиевич

руководитель лаборатории экспериментальной нейроцитологии ГУ Научного центра неврологии РАМН

доктор биологических  наук,  профессор

Кошелев Владимир Борисович

заведующий кафедрой нормальной и патологической физиологии ГУНУ ФФМ МГУ им. М.В.Ломоносова

Ведущая организация:

Институт физиологически активных веществ РАН,

г. Черноголовка

Защита состоится _17 ноября_ 2008 года на заседании диссертационного совета Д 501.001.93 при биологическом факультете Московского государственного университета  им. М.В. Ломоносова по адресу: 119991, Москва, Ленинские горы, МГУ, биологический факультет, ауд. М-1.

С диссертацией можно ознакомиться в библиотеке биологического факультета МГУ

им. М.В.Ломоносова

Автореферат разослан  17 октября  2008г.

Ученый секретарь диссертационного совета,

доктор биологических наук         Умарова Б.А.

общая характеристика работы



Актуальность проблемы

Исследование механизмов регуляции нейродегенеративных процессов при инсультах, травмах мозга, болезнях Альцгеймера, Паркинсона, Гентингтона и др., – одна из важнейших проблем современной физиологии, направленная на разработку новых подходов к лечению этих тяжелых заболеваний.

Известно, что система свертывания крови и её протеиназы одни из первых в организме осуществляют запуск сложной ответной реакции на повреждающее воздействие. Увеличение проницаемости гематоэнцефалического барьера (ГЭБ) при критических состояниях приводит к появлению в нервной ткани ключевых сериновых протеиназ системы свертывания крови, таких как тромбин, фактор Xа (ФХа) и активированный протеин С (АРС), у которых, наряду с протеолитической активностью в отношении специфических белковых субстратов, обнаружены свойства сигнальных молекул – клеточных регуляторов процессов воспаления, репарации тканей, в том числе нейрорепарации, нейродегенерации и др. (Esmon, 2005; Ossovskaya, Bunnett, 2004; Hollenberg, Houle 2005; Strukova, 2001, 2006). Более того, обнаружена экспрессия мРНК протромбина и ФХа в мозге. (Striggow et al., 2001; Wang et al., 2002; Pompili et al., 2004; Rohatgi et al., 2004).

Тромбин - ключевой фермент свертывающей системы крови, образуется в результате ограниченного протеолиза протромбина фактором Ха свертывания крови в участках повреждения ткани, в том числе нервной, при травме, ишемических и геморрагических инсультах, нарушении ГЭБ при воспалении, гипертензии, эпилептическом статусе. Тромбин может индуцировать ретракцию отростков нейронов, пролиферацию глии и модулировать процессы гибели нейронов, в зависимости от концентрации и времени воздействия (Струкова и др., 2005; Henrich-Noack et al., 2005). Функции другой сериновой протеиназы свертывания крови - ФХа - вне гемостаза и воспаления мало известны.

Сериновые протеиназы регулируют функции клеток через трансмембранные рецепторы, активируемые протеиназами (PARs), сопряженные с G-белками (Coughlin, 2000, 2005; Hollenberg, Houle, 2004; Saito, Bunnett, 2005). Протеиназы расщепляют одну пептидную связь во внеклеточном домене PAR и новый N-конец рецептора («привязанный лиганд») активирует рецептор. К настоящему времени клонированы четыре подтипа PAR (PAR1, 3, и 4 - рецепторы тромбина, PAR2 - рецептор трипсина, триптазы тучных клеток, ФXa и др.), но есть основания полагать, что это семейство имеет большое число подтипов PAR и агонистов. Экспрессия PARs обнаружена в областях мозга, наиболее уязвимых для ишемического повреждения, среди них - кора, стриатум, гипоталамус, гиппокамп и мозжечок (Rohatgi et al., 2004). Изменение экспрессии данных рецепторов наблюдали при травмах, воспалении и ишемии мозга. Данные о роли PAR и протеиназ гемостаза в травматическом и ишемическом повреждении мозга крайне противоречивы. Обнаружено, что при повреждении, нейровоспалении и ишемии активация PAR2 ведет к подавлению гибели клеток (Kawabata et al., 2005; Noorbakhsh, 2005), активация PAR1 - к повреждению мозга (Olson, 2004), а активация PAR1, PAR2 и PAR4 в астроцитах имеет нейропротективное действие (Wang et al., 2007). Тромбин рассматривают как фактор гибели, так и как фактор выживания нервных клеток (Киселева и др., 2005; Suo et al., 2004; Vergnolle et al., 2005). Так, внутримозговое введение тромбина в высоких концентрациях повреждает нейроны, снижает когнитивные функции у крыс (Mhatre et al., 2004), вызывает апоптоз в дофаминергических нейронах (Choi et al., 2003). Вместе с тем, тромбин защищает астроциты и гиппокампальные нейроны от гибели, вызванной гипогликемией и окислительным стрессом (Henrich-Noack et al., 2005). Внутримозговое введение низких доз тромбина (прекондиционирование) уменьшает повреждения мозга, вызываемые последующим введением высоких доз тромбина, внутримозговыми кровоизлияниями или церебральной ишемией (Masada et al., 2000; Sokolova, Reiser, 2008). Обнаружена как повреждающая провоспалительная, так и протекторная противовоспалительная функция не только тромбина, но и других протеиназ, в том числе ФХa, который активирует PAR2 и PAR1 (Olson et al., 2004; Noorbakhsh et al., 2005; Feistritzer et al., 2005). В фибробластах ФXa повышает внутриклеточный кальций и стимулирует пролиферацию, продукцию проколлагена через PAR1 (Blanc-Brude et al., 2005).

АРС – мультифункциональный фермент, участвует в регуляции не только свертывания крови, но также воспаления и апоптоза, проявляя антивоспалительные и цитопротекторные свойства (Riewald et al., 2002; O'Brien et al., 2006). Рекомбинантная форма АРС (дготрекогин альфа) снижает смертность пациентов от тяжелого сепсиса (Abraham et al., 2005). Молекулярные основы антивоспалительного и анти-апоптотического действия APC еще не выяснены. АРС ингибирует апоптоз и блокирует воспаление, изменяя профиль экспрессии генов в эндотелиальных клетках (Griffin et al., 2007), снижает образование провоспалительных цитокинов активированными моноцитами (Joyce et al., 2004). APC индуцирует протективные гены, активируя либо эндотелиальный рецептор протеина С (EPCR) (Esmon, 2005, 2007), либо каскад рецепторов EPCR-PAR1 (Ruf, 2005). Поэтому исследования экспрессии PARs и EPCR нейронами и их участия в действии APC на клетки представляется весьма перспективным для выяснения механизмов анти/проапоптотического действия APC. Известно, что использование в терапии тромботических инсультов тканевого активатора плазминогена (tPA) связано с риском развития осложнений- геморрагий, эксайтотоксичности (Kaur et al., 2004). Поиск новых нейропротекторов при эксайтотоксичности, вызванной tPA - весьма перспективная задача (Mosnier, Griffin, 2006).

В последнее время активно изучают протективные функции белков теплового шока (HSP) (Hooven et al., 2004; Salehi et al., 2006; Lee et al., 2007). Обнаружено, что в PAR1-опосредованном изменении формы астроцитов под действием тромбина принимает участие белок теплового шока 90 (HSP90) (Pai et al., 2002). Показано специфическое взаимодействие PAR1 с HSP90 в дрожжах (Pai et al., 2001). На основании этих данных рецептор тромбина PAR1 включен в список клиентных белков, взаимодействующих с цитозольной формой HSP90. Известно, что ингибитор HSP90, гелданамицин, блокирует АТФазную активность HSP90 и предотвращает его взаимодействие с клиентными белками. Механизмы участия HSP90 в действии тромбина и APC на нейроны мозга еще не изучены.

Одним из важнейших пусковых механизмов развития нейродегенеративных процессов при инсультах, травмах мозга, болезнях Альцгеймера, Паркинсона, Хантингтона и др., является гиперстимуляция глутаматных рецепторов (Hossain, 2005), приводящая к эксайтотоксичности, которая является причиной повреждения и гибели клеток. В настоящей работе для изучения роли ключевых протеиназ гемостаза в нейропротективных и нейродегенеративных процессах использована модель глутаматной эксайтотоксичности. Первичная культура нейронов является удобной экспериментальной моделью для изучения нейродеструктивных процессов, вызываемых глутаматом, так как цитологические и биохимические характеристики культивируемых нейронов близки тем, что наблюдаются у нейронов in situ (Хаспеков, 1995). Эксайтотоксичность – пусковой механизм нейрональной смерти (некротической и апоптотической) при многих неврологических нарушениях, таких как инсульт, травма, глаукома, рассеянный склероз или нейродегенеративные заболевания. При острой фокальной ишемии головного мозга в межклеточном пространстве значительно повышается содержание нейротрансмиттера глутамата, токсическое действие которого на нейроны вызывает быстрое и неконтролируемое увеличение [Ca2+]i (Orrenius et al., 2003). Массивный вход Са3+ в нервные клетки по каналам ионотропных глутаматных рецепторов нарушает гомеостаз этого внутриклеточного мессенджера, запускает каскад внутриклеточных реакций, которые завершаются быстрой или отсроченной гибелью клеток механизмами апоптоза или некроза (Berliocchi et al., 2005).

В процессе гибели нейронов и других клеток, участвующих в воспалении, пролиферации, ангиогенезе и др. участвует транскрипционный фактор NF-kB (гетеродимер NF-kBр65 и р50). Получены данные о том, что активация NF-kB в нейронах, которая ведет к деградации его ингибиторов IkBs и транслокации NF-kB в ядро, вносит вклад как в гибель клеток при ишемии мозга (Schneider et al., 1999; Zhang et al., 2005; Crack et al., 2006), так и в выживание нейронов, повышая экспрессию антиапоптотических генов (Karin, Lin, 2002; Nakano et al., 2006).

Роль PAR рецепторов в действии ФXa на выживаемость/гибель культивируемых нейронов мозга при эксайтотоксичности, вызванной глутаматом, ранее не изучалась. Отсутствуют данные о влиянии АРС на нейроны в условиях токсического действия глутамата и тромбина на клетки. Не известен рецепторный механизм действия АРС на нейроны гиппокампа и его влияние на активность транскрипционного фактора NF-kB в этих клетках.

Таким образом, актуальность и перспективность исследования роли ключевых сериновых протеиназ гемостаза, а также рецепторов, активируемых протеиназами, в процессах нейропротекции и нейродегенерации не вызывает сомнений и представляет интерес как для фундаментальной физиологии, так и для практической медицины и фармакологии.

Цель исследования

Выяснение механизмов влияния ключевых протеиназ системы гемостаза: тромбина, фактора Ха и активированного протеина С (АРС) на выживаемость нейронов мозга при эксайтотоксичности.

Задачи исследования:

  1. Исследовать влияние тромбина, ФХа и АРС в широком диапазоне концентраций (от пМ до нМ) на выживаемость и кальциевый гомеостаз культивируемых нейронов гиппокампа и коры мозга крысы в норме и при эксайтотоксичности, вызванной глутаматом. Оценить вклад IP3-рецепторов эндоплазматического ретикулума нейронов в действие протеиназ на внутриклеточную концентрацию кальция.
  2. Исследовать экспрессию рецепторов, активируемых протеиназами (PARs), и эндотелиального рецептора протеина С (EPCR) в кортикальных и гиппокампальных нейронах в норме и при токсическом действии глутамата.
  3. Изучить вклад подтипов рецепторов, активируемых протеиназами в реализацию нейропротекторных эффектов тромбина и ФХа на гиппокампальные нейроны мозга при глутаматной эксайтотоксичности.
  4. Исследовать участие рецепторов EPCR, PAR1 и белка теплового шока 90 (HSP90) в защитном действии АРС на гиппокампальные нейроны мозга крысы при токсичности, вызванной глутаматом.
  5. Изучить вклад транскрипционного фактора NF-kB в гибель/выживание культивируемых гиппокампальных нейронов крысы при эксайтотоксичности и участие его в механизме нейропротекторного действия АРС.

Положения, выносимые на защиту:

  1. Протеиназы гемостаза в зависимости от концентрации могут вызывать как протекторное, так и повреждающее действие на клетки нервной системы. Тромбин, ФХа и АРС в узком диапазоне низких концентраций (пМ - нМ), не достаточных для участия в процессах свертывания крови, защищают гиппокампальные и кортикальные нейроны от гибели, вызванной высокими концентрациями глутамата. Высокие концентрации протеиназ вызывают гибель нейронов, сопоставимую с действием токсических концентраций глутамата.
  2. Рецепторы, активируемые протеиназами, необходимы для реализации протекторного действия протеиназ системы гемостаза. Для нейропротекторных эффектов протеиназ необходима протеолитическая активность ферментов. Тромбин защищает гиппокампальные и кортикальные нейроны от глутаматной эксайтотоксичности через PAR1, ФХа - через неизвестный подтип PAR. Два рецептора – EPCR (эндотелиальный рецептор протеина С) и PAR1 необходимы для нейропротекторного действия АРС на нейроны мозга крыс при эксайтотоксичности.
  3. Тромбин через PAR1 вызывает быстрое и транзиторное увеличение внутриклеточного кальция в гиппокампальных и кортикальных нейронах механизмом, опосредуемым преимущественно через IP3-рецепторы эндоплазматического ретикулума.
  4. Прединкубация клеток с тромбином или ФХа повышает количество нейронов, восстанавливающих низкий уровень внутриклеточного кальция после действия высоких концентраций глутамата.
  5. Действие токсических концентраций глутамата и тромбина на нейроны гиппокампа вызывает транслокацию в ядро одной из субъединиц NF-kB – NF-kBp65. Hизкиe концентрации протеиназ стабилизируют цитоплазматический комплекс NF-kB. АРС защищает нейроны от гибели, блокируя активацию NF-kB в нейронах, вызванную токсическими воздействиями.
  6. Рецепторы, активируемые протеиназами, обладают высокой пластичностью и, в зависимости от состояния нейрона, изменяется их экспрессия. Соотношение подтипов PAR различно в коре и гиппокампе, что может определять и их разную чувствительность к протеиназам. Экспрессия подтипов PAR зависит от возраста нейронов. Протеиназы гемостаза осуществляют контроль экспрессии собственных рецепторов PAR в нейронах мозга по принципу обратной связи.
  7. Протекторное действие протеиназ на клетки мозга при повреждении и эксайтотоксичности позволяет отнести их к клеточным регуляторам физиологических и патофизиологических процессов.

Научная новизна

Впервые обнаружено, что:

  • активированный протеин С (в низких (пМ) концентрациях) оказывает прямое анти-апоптотическое действие на культивируемые нейроны мозга при эксайтотоксическом действии глутамата и высоких концентраций тромбина;
  • в нейронах гиппокампа и коры крысы экспрессируется эндотелиальный рецептор протеина С (EPCR). Уровень экспрессии EPCR модулируется под действием тромбина и глутамата;
  • протекторное действие АРС на нейроны мозга реализуется через два типа рецепторов – EPCR и PAR1 при участии HSP90;
  • гиппокампальные нейроны более чувствительны (на два порядка) к действию АРС, чем кортикальные;
  • тромбин и ФХа в низких концентрациях повышают способность гиппокампальных нейронов восстанавливать базальный уровень внутриклеточного кальция после длительного глутаматного воздействия;
  • токсические концентрации глутамата и тромбина вызывают активацию транскрипционного фактора NF-kB в нейронах гиппокампа и коры, транслокацию в ядро субъединицы NF-kBp65 и отсроченную гибель нейронов;
  • АРС защищает нейроны от гибели, блокируя активацию транскрипционного фактора NF-kB, вызванную глутаматом или тромбином.

Теоретическая и практическая значимость

Важность работы для фундаментальной науки и практической медицины обусловлена необходимостью понимания молекулярных механизмов нейропротекторного действия протеиназ гемостаза при эксайтотоксичности, которая является одним из основных компонентов ишемии мозга и нейродегенеративных заболеваний.

Показано, что исследованные протеиназы - тромбин, ФХа и АРС - в узком диапазоне низких концентраций через активацию подтипов PAR, защищают гиппокампальные и кортикальные нейроны от гибели при эксайтотоксичности. Протекторное действие тромбина на нейроны при эксайтотоксичности реализуется через PAR1, ФХа - через неизвестный подтип PAR, а АРС - через EPCR и PAR1.

Нейропротекторное действие тромбина и ФХа обусловлено уменьшением дестабилизации кальциевого гомеостаза нейронов при глутаматной эксайтотоксичности. АРС защищает нейроны от гибели, блокируя активацию NF-kB, вызванную токсическим действием на нейроны высоких концентраций глутамата или тромбина.

Полученные данные о протекторном действии протеиназ в низких физиологических концентрациях на клетки при эксайтотоксичости позволяют отнести тромбин, ФХа и АРС к клеточным регуляторам физиологических и патофизиологических процессов.

Данные о прямом цитопротекторном действии протеиназ гемостаза могут служить основой для разработки новых подходов к лечению травматических и ишемических повреждений нервной ткани и создания на базе агонистов и антагонистов рецепторов PAR препаратов с анти-апоптотическими, анти-воспалительными и репаративными свойствами, защищающими клетки от гибели и восстанавливающими ткани при терапии данных повреждений.

Результаты этой работы могут найти применение в теоретической и экспериментальной физиологии, патофизиологии и фармакологии. Данные о новых функциях протеиназ гемостаза вне системы свертывания могут быть включены в курсы лекций по теме «Физиология и патофизиология гемостаза», «Нейрофармакологии».

Апробация работы

Материалы диссертации были представлены на I Съезде физиологов СНГ (Дагомыс, 2005); 4thи 5th International Symposium Focus 2006, 2008:Cerebral Ischemia and Stroke (Magdeburg, 2006, 2008); 18th International Congress of Fibrinolysis and Proteolysis (San Diego, 2006), XX Съезде Физиологического общества им. И.П. Павлова (Москва, 2007); 3rd Intern Congress ”Neuroscience for Medicine and Psychology” (Sudak, Crimea, Ukraine, 2007); XXI Congress of ISTH (Geneva, 2007); VI Международном симпозиуме "Химия протеолитических ферментов" (Москва, 2007); XIX International Congress on Fibrinolysis and Proteolysis (Vienna, 2008); докладывались на отечественных и международных конференциях: «Тромбозы, геморрагии, ДВС-синдром. современные достижения» (Ярославль, 2005); «Биотехнология и медицина» (Москва, 2006, 2007); «Нейроспецифические метаболиты и энзимологические основы деятельности ЦНС» (Пенза, 2006); «Протеолиз, механизмы его регуляции и роль в физиологии и патологии клетки» (Минск, 2007); «Новые информационные технологии в медицине, биологии, фармакологии и экологии» (Украина, Крым, Ялта-Гурзуф, 2006, 2007); «Клиническая гемостазиология и гемореология в сердечно-сосудистой хирургии» (Москва, 2007). Результаты работы обсуждались на заседаниях кафедры физиологии человека и животных МГУ им. М.В.Ломоносова и лаборатории мембранологии с группой генетических исследований ГУ НЦЗД РАМН.

Публикации

По теме диссертации опубликовано 40 научных работ в отечественной и зарубежной печати.

Структура и объем диссертации

Диссертация изложена на  стр., состоит из введения, обзора литературы, методов исследования, результатов собственных исследований, обсуждения, заключения, выводов и списка литературы, включающего  отечественных и зарубежных источников. Работа иллюстрирована  рисунками, содержит  таблиц.

основные материалы и методы исследования

В работе были использованы следующие препараты: активированный протеин С (APC) и тромбин человека, фактор Ха быка, NaCl, KCl, CaCl2, MgCl2, KH2PO4, HEPES, глюкоза, глутамат, glutamax, ARAC, поли-D-лизин, гелданамицин, MTT(3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide), ЭГТА, 2-APB, дантролен, иономицин, тетродотоксин, NMDA, ФМСФ, ARAC, TritonX-100, поли-D-лизин (Sigma,USA); Fura-2/AM, Fura-2/FF, флуоресцентные красители Hoechst 33342, SYTO-13, SYTOX (Molecular Probes, Eugene OR, США); синтетический пептид-агонисты PAR1 (PAR1-AP, TFLLRN) и PAR2 (PAR2-AP, SLIGRL) (Biosyntan, Germany) и антагонисты PAR1 (YFLLRN, (Tyr1)-TRAP-7) (Bachem Biochemica) и Mpr(Cha) (Mercaptopropionyl-F(Cha-Cha)RKPNDK-NH2)( любезно предоставлен A. Kawabata, Япония); антитела: antiNF-kBp65 - (C22B4) rabbit mAb, анти-PAR1 (ATAP2, S-19), анти-PAR3 (H103, M-20), анти-EPCR (RCR-252, P-20); нейробазальная среда – А (“Gibco”), содержащая 2% Supplement B-27 (Gibco) и L-глутамин (Gibco); LDH-L реагент (Diagnostic Chemicals Limited, Канада); NF-kBp65 total kit ELISA (Biosource).

Все эксперименты с животными были выполнены в соответствии с этическими принципами и нормативными документами, рекомендованными Европейским научным фондом (ESF) и декларацией о гуманном отношении к животным.

Получение культуры гиппокампальных и кортикальных нейронов. Исследования проводили на первичных культурах нейронов гиппокампа (9-10 дневных) или коры (7-8 дневных), извлеченных из мозга 1-3 дневных крысят Вистар. Суспензию клеток (106 клеток/мл) получали по ранее описанному методу (Ходоров и др., 2001) и переносили на покровные стекла, покрытые поли-D-лизином (10 мг/мл). Через час добавляли 1,5 мл культуральной среды (нейробазальная среда – А, содержащая 2% Supplement B-27 и 0.5 мМ L-глютамина). На 3-4 день добавляли арабинозид (ARAC, 10-5М) на сутки для подавления роста глиальных клеток.





Оценка гибели нейронов. Гибель нейронов в культуре определяли через сутки после 30-минутного действия глутамата (100 мкМ) и исследуемых веществ, которые добавляли к клеткам, сменив временно культуральную среду на HEPES-солевой буфер (HBSS). Состав HBSS в мМ: NaCl – 145, KCl – 5, CaCl2 – 1.8, MgCl2 – 1.0 (без MgCl2 в случае экспозиции клеток с глутаматом); Gly, 0.01; HEPES – 20, глюкоза – 5 (рН 7.4). Гибель оценивали двумя способами: биохимическими (с помощью MTT-метода (Castoldi et al., 1998) и по высвобождению из клеток лактатдегидрогеназы) и морфологическим. МТТ добавляли в культуральную среду до конечной концентрации 1 мг/мл и инкубировали клетки 3 часа при 37 0С. Затем среду отбирали и добавляли DMSO для растворения формазанов. Оптическую плотность измеряли на иммуноферментном анализаторе «Униплан» АИФР-01 (ЗАО «Пикон») при 590 нм. Оценивали результаты в процентах по отношению к контролю. Второй способ оценки выживаемости был основан на измерении высвобождения лактатдегидрогеназы (ЛДГ) в культуральную среду. Активность ЛДГ оценивали спектрофотометрическим методом при 340 нм на микропланшетном люминометре Аnthos Lucy1 (Anthos Labtec Instruments, Salzburg, Австрия) с помощью LDH-L реагента (Diagnostic Chemicals Limited, Charlottetown, PE, Канада). Процент выживаемости нейронов рассчитывали как (1 - активность ЛДГ в среде / общая величина ЛДГ) х 100, где общая величина ЛДГ определялась как активность ЛДГ в культуральной среде после 15 минутной инкубации в 0,2% Triton Х-100 при 370С для каждой культуры клеток в отдельности.

Морфологическая оценка гибели нейронов включала исследование ядерной фрагментации (апоптоза) с помощью флуоресцентного ДНК-тропного красителя Hoechst 33342 (абсорбция 360 нм, эмиссия 460 нм) (Liu et al., 1997) и витального красителя SYTO-13 (абсорбция 488 нм, эмиссия 590 нм) (Frey, 1995). Окрашенные клетки исследовали, подсчитывали визуально под флуоресцентным микроскопом (Axiovert 200 Zeiss, Германия) и количество апоптотических клеток выражали в процентах по отношению к общему количеству клеток.

Спектрофлуориметрические исследования.

Регистрация внутриклеточной концентрации кальция ([Ca2+]i).

[Ca2+]i измеряли спектрофлуориметрическим методом с помощью флуоресцентного зонда Fura-2/AM с высоким сродством к Ca2+ (Grynkewics et al.,1985) или Fura-2/FF c низкой аффинностью к Ca2+ (Hyrc et al., 1997). Спектр флуоресценции зонда смещается к более коротким волнам при увеличении связывания молекул зонда с Са2+. Клетки загружали зондом (5 мкМ) в течение 40 мин до начала опытов в культуральной среде, затем культуры отмывали HBSS. Стекло с клетками помещали в перфузионную камеру на столике инвертированного микроскопа (Axiovert 200, Zeiss, Германия). Для возбуждения флуоресценции использовали свет с двумя длинами волн 340 и 380 нм (поочередное освещение по 100-200 мс), длина волны эмиссии составляла 505 ± 10 нм. Встроенная видеокамера (Roper Scientific, США) и компьютерная программа Metafluor 6.1 (Universal Imaging Corp., США) позволяли получать цифровую запись эксперимента и ее обрабатывать. В опытах определяли абсолютные значения [Ca2+]i, используя калибровочные растворы по методике (Kiedrowski et al., 1994).

Иммунофлуоресцентное окрашивание.

Прикрепленные клетки промывали PBS и фиксировали в 4% параформальдегиде (25 мин). После отмывки (1х10 мин 120 мМ Na-фосфатом) блокировали неспецифическое связывание сывороткой (FSBB) и инкубировали клетки в течение ночи при 40С с первичными антителами NF-kBp65 ((C22B4) rabbit mAb, 1:100) в FSBB. После этого клетки трижды отмывали и инкубировали 1,5 часа со вторичными антителами (Alexa 488 (1:500) или Alexa 546 (1:250)). Далее снова отмывали и инкубировали клетки с ядерным красителем SYTOX (1:10000, Molecular Probes) или с пропидиумом йодидом (1:500). Имиджи записывали с помощью инвертированного конфокального лазерного сканирующего микроскопа, LSM-Pascal (Zeiss, Jena, Германия).

Изображения анализировали с помощью программы LSM-510 Image software. В каждом опыте осуществляли анализ не менее 30 нейронов в 4-5 хаотично выбранных полях. В ходе экспериментов оценивали отношение интенсивности флуоресценции цитоплазмы к флуоресценции ядра для каждого нейрона (Mikenberg et.al., 2007).

Иммуноферментный анализ.

Анализ NF-kBp65 в ядерной фракции и цитоплазматической фракции осуществляли с помощью NF-kBp65-ELISA (Biosource) и в соответствии с протоколом, предложенным производителем. Для выделения ядерной и цитоплазматической фракций клетки собирали и промывали холодным PBS, концентрировали клетки центрифугированием. Полученный осадок ресуспензировали в гипотоническом буфере и инкубировали 15 минут на льду, затем добавляли детергент NP40 и центрифугировали при 40С (3000 об/мин, 10 минут). Супернатант, содержащий цитоплазматическую фракцию, замораживали (-800С), а осадок суспензировали в 50 мкл экстракционного буфера в присутствии ингибиторов протеиназ (30 мин) и центрифугировали при 40С (13000 об/мин, 30 мин). Супернатант (ядерная фракция) собирали, замораживали и хранили до измерения при -800С.

Обратная транскрипция (ОТ) и полимеразная цепная реакция (ПЦР).

Для выделения тотальной РНК использовали набор SV Total RNA Isolation System (Promega) и лизировали 4х106 нейронов на пробу. Этап ДНКазной обработки проводили в процессе выделения на колонке. Для проведения ОТ использовали RevertAid™ First Strand cDNA Synthesis Kit (Fermentas), согласно протоколу фирмы.

ПЦР проводили в конечном объеме 25 мкл, содержащем 2.5 мкл of 10×PCR Buffer,  0.5 мкМ каждого праймера, 200 мкМ dNTP, 2,5 mM MgCl2, 0.5 ед Тaq-полимеразы AmpliTaq Gold (Applied Biosystems) и 2 мкл ДНК-матрицы. В качестве отрицательного контроля использовали аналогичные пробы с эквивалентным количеством РНК, не прошедшей ОТ. ПЦР проводили в следующем режиме: исходная денатурация матрицы – 95°С, 15 мин.; денатурация – 94°С, 30 сек; отжиг праймеров – 64°С, 30 сек; элонгация – 72°С, 30 сек, заключительная достройка продуктов реакции – 72°С, 10 мин. Реакцию проводили в течение 40 циклов.

Для качественной оценки уровня экспрессии исследуемых генов использовали сравнение с уровнем экспрессии двух референсных генов: глицеральдегид-3-фосфат-дегидрогеназы (GAPDH) и гидроксиметилбилан-синтазы (Hmbs). Выбор праймеров для ПЦР проводили на основании данных GeneBank. Последовательности использовавшихся праймеров в направлении 5’ – 3’ (прямой/обратный) и длины продуктов (в квадратных скобках) приведены ниже: Gapdh (NM_017008): TGCCATCAACGACCCCTTCA/ ACTCAGCACCAGCATCACCC [189]; Hmbs (NM_013168) CCATCTGCAAACGGGAAAACC/TGAGGGAACTTTCTCTGTAGCTG [145]; Par1 (F2r) (NM_012950): AGCCTGTGCGGTCCTTTG/GGGGGTTTGGCGTAGCAT [94]; Par2 (F2rl1) (NM_053897):GAAGTCTCAGCCTGGCGT/GCGTGTCCAATCTGCCAATCA [129]; Par3 (F2rl2) (NM_053313): GCACACTTAGTGACATCCCATAAC/ GTTGCCATTAAAACTCTCAGCAG [163]; Par4 (F2rl3) (NM_053808): CTCGGGTTCAGCATCAGC/ GGGGACTTCGACTCATTAAGTTCTA [125]; Epcr (Procr) (NM_001025733) TGTGGCTGTGAATGGAAGTG/ CATCAGGATACCCAGGACCA [256]. Синтез праймеров осуществлен ЗАО «Синтол» (Москва). Визуализацию продукта ПЦР проводили методом электрофореза в 2% агарозном геле, окрашенном бромистым этидием, при напряжении поля 10 В/см.

Статистическую обработку данных проводили в парных выборках, используя t-критерий Стьюдента (GraphPads Prism). Для анализа использовали данные 4-6 независимых экспериментов. Различия считали достоверными при р<0,05, n – число независимых экспериментов.

результаты исследования и их обсуждение

1. Влияние протеиназ гемостаза - тромбина, фактора Xa и АРС, на выживаемость культивируемых нейронов в норме и при эксайтотоксичности, вызванной глутаматом.

Известно, что в условиях острой фокальной ишемии мозга наблюдается выброс возбуждающих аминокислот из ишемизированных нейронов. Основным нейромедиатором, вызывающим эксайтотоксичность в тканях мозга, является глутамат. Глутаматная эксайтотоксичность развивается в течение первых суток после инсульта, приводя к формированию инфаркта мозга. Вместе с тем, процессы, запущенные высокими концентрациями внеклеточного глутамата в первые 3-6 часов после повреждения, индуцируют отдалённые последствия ишемии, вызывая экспрессию генов, кодирующих регуляторы клеточных процессов отсроченной гибели нейронов.

Рис.1. Влияние тромбина на гибель нейронов в норме (А) и при токсическом действии глутамата на клетки (Б). Гибель оценивали через 24 часа после воздействия по уровню высвобождения лактатдегидрогеназы из клеток: * р<0.05 по сравнению с глутаматом, здесь и далее n=5-7 независимых экспериментов.

Мы исследовали влияние высоких концентраций глутамата на культивируемые нейроны гиппокампа через 4, 12, 24 и 48 часов и показали, что максимальная гибель клеток наблюдается через 24 часа после 30-минутной инкубации с 100 мкМ глутамата.

Известно, что протеиназы гемостаза появляются в ткани мозга при травме, воспалении, нарушении гематоэнцефалического барьера. Некоторые из них могут генерироваться нейронами мозга (Ossovskaya, Bunnett, 2004).

Нами исследовано влияние протеиназ гемостаза - тромбина, ФХа и АРС (в широком диапазоне концентраций (пМ-нМ)) - на выживаемость культивируемых нейронов мозга крысы в условиях токсического действия 100мкМ глутамата на клетки.

Выживаемость культивируемых гиппокампальных нейронов крыс была исследована биохимическими и морфологическими методами через 24 часа после 30-ти минутного действия 100 мкМ глутамата. Показано, что тромбин в концентрациях от 0,1 до 10 нМ почти двукратно снижает гибель нейронов, вызванную токсическим действием глутамата (рис.1Б). Максимальное снижение гибели нейронов при эксайтотоксичности наблюдали при действии 1нМ тромбина.

Обнаружено, что тромбин в высокой концентрации (100 нМ) вызывал гибель 32% клеток, сопоставимую с гибелью, индуцированную глутаматом (34%) (рис. 1А, Б).

Рис.2. Влияние ФХа на гибель нейронов при токсическом действии глутамата на клетки. Гибель оценивали через 24 часа после воздействия по уровню высвобождению лактатдегидрогеназы из клеток: * р<0.05 по сравнению с глутаматом, здесь и далее n=5-7 независимых экспериментов.

Эти данные могут объяснить высокую гибель нейронов в очаге повреждения мозга, где, как известно, обнаруживают высокие концентрации тромбина (Xi et al, 2003).

Показано, что ФXa в концентрациях от 1 нМ до10нМ снижал гибель нейронов, вызванную 30-ти минутным действием глутамата до 12 и 20%, соответственно (рис. 2).

Рис. 3. Влияние разных концентраций активированного протеина С (APC) (0,01-100нМ) и инактивированного PMSF фермента – APCi (1нM) на гибель гиппокампальных (А) и кортикальных (Б) нейронов в норме и при 30-минутной инкубации культур со 100 мкМ глутамата. Гибель нейронов оценивали МТТ-методом через 24 часа после действия глутамата. Результаты представлены в процентах по отношению к контролю: * р<0,05 по сравнению с глутаматом, # уровень значимости р<0,05 по сравнению с контролем.

APC в низких концентрациях ( 50 нМ) не вызывал гибели гиппокампальных и кортикальных нейронов при инкубации культур с ферментом в течение 45 минут (рис. 3 А, Б). Вместе с тем, уже 50 нМ APC вызывал гибель 26,9 % гиппокампальных нейронов, что сравнимо с результатами токсического действия глутамата. В отличие от гиппокампальных нейронов у кортикальных нейронов в норме регистрировали достоверную гибель клеток (21,2% клеток) только при увеличении концентрации APC до 100 нМ, что свидетельствует о более низкой чувствительности этого типа нейронов к ферменту (рис. 3).

АРС дозозависимо, в узком диапазоне низких (от 50 пМ) концентраций, защищал нейроны от гибели, вызванной токсическим действием глутамата (рис. 3 А, Б, 4). Диапазон эффективных концентраций APC был уже для гиппокампальных нейронов (0,05-1нM) (рис. 3 А, 4), чем для кортикальных нейронов (0,05-10нM) (рис. 3Б). 0,01 нM APC не оказывал нейропротекторного действия на оба типа нейронов. 100 нM АРС проявлял проапоптотическое действие и не защищал нейроны от эксайтотоксичности, вызванной глутаматом (рис. 3).

Обнаружено, что тромбин, так же как ФХа и АРС, лишенный протеолитической активности вследствие инактивации PMSF, не оказывал нейропротекторного действия на нейроны (рис. 3, 6). Это позволяет предполагать участие именно расщепляемых рецепторов PARs в защитных эффектах этих ферментов при действии глутамата, и исключить возможность непосредственного взаимодействия протеиназ с клеточными структурами, например с глутаматными рецепторами, NMDA.

Рис. 4. Влияние АРС (0,1нМ) на выживаемость гиппокампальных нейронов при действии глутамата (100М). а, в, д -флуоресценция клеток, окрашенных витальным красителем SYTO-13; б, г, е – флуоресценция нейронов, окрашенных ядерным ДНК-тропным красителем Hoechst 33342. Флуоресценция нейронов через 24 часа после 45-минутного воздействия буфера (а, б – контроль), 30-минутного воздействия 100 М глутамата (в, г) и 15-минутного воздействия 0,1нМ АРС с последующим глутаматным воздействием (д, е).

Для проверки этого предположения, мы проанализировали, какие рецепторы необходимы для реализации нейропротекторного действия исследуемых протеиназ.

2. Участие рецепторов, активируемых протеиназами (PAR) в нейропротекторном действии тромбина, фактора Ха и АРС

Для выяснения вопроса об участии PAR в нейропротекторном действии протеиназ, мы исследовали экспрессию всех четырех подтипов PAR и показали экспрессию всех подтипов- PAR1, PAR2, PAR3 и PAR4 - с преобладанием подтипа PAR1, а также впервые показали экспрессию EPCR в исследуемой культуре гиппокампальных нейронов в норме (рис. 5).

Рис. 5. Экспрессия PAR и EPCR рецепторов в 7 дневной культуре гиппокампальных нейронов. Результаты ОТ ПЦР визуализированные методом электрофореза в 2% агарозном геле, окрашенном бромистым этидием, при напряжении поля 10 В/см.

Участие PAR1 рецепторов в активации нейронов тромбином подтверждено в экспериментах с селективным пептидом-агонистом PAR1 (PAR1-АР) – TFLLRN, избирательно активирующим только PAR1 и пептидом - антагонистом PAR1 (аPAR1)- Mpr(Cha).

Как видно на рис. 6, PAR1-AP (100мкМ) защищал нейроны от гибели при глутаматной цитотоксичности подобно тромбину, а пептид-антагонист PAR1 (100мкМ) - отменял нейропротекторный эффект тромбина (рис.6). Эти результаты указывают на участие PAR1 в реализации нейропротекторного действия тромбина.

Поскольку эффект ФХа на клетки опосредуется преимущественно через PAR2 (Ossovskaya et al., 2004; Nomura et al, 2007), для выяснения механизма действия ФХа на нейроны кроме антагониста PAR1 мы использовали агонист и антагонист PAR2 рецептора.

Обнаружено, что блокада рецепторов PAR1 и PAR2 антагонистами не отменяла защитного действия ФХа (рис.7). Как видно на рис. 7, синтетический пептид–агонист PAR2 (PAR2-AP, 100 мкМ SLIGRL) не имитировал действие ФXa на выживаемость нейронов при цитотоксичности, вызванной глутаматом.

Данные, полученные биохимическим и морфологическим методами, хорошо согласуются друг с другом и свидетельствуют о том, что в нейропротекторном действии ФXa не принимают участие рецепторы par1 и par2, вместе с тем для протекторного действия ФXa необходима протеолитическая активность фермента. По-видимому, защитный эффект ФXa реализуется через неизвестный подтип расщепляемого рецептора PAR.

Рис. 6. Влияние 10 нМ тромбина, 100 мкМ агониста PAR1 (PAR1-AP) и 100 мкМ антагониста PAR1 (аPAR1, MPR(Cha)) в сочетании с тромбином на апоптотическую гибель нейронов, вызванную глутаматом. * р<0,05 по сравнению с глутаматом.

Рис. 7. Влияние 10 нМ ФXa, 100 мкМ агониста PAR2 (PAR2-AP), 100 мкМ антагонистов PAR1 (аPAR1, Mpr(Cha)) и PAR2 в сочетании с ФXa на апоптотическую гибель нейронов, вызванную глутаматом. * р<0,05 по сравнению с глутаматом

К настоящему времени нет единого представления о рецепторном механизме действия АРС. Получены доказательства участия как PAR1 и EPCR (Ruf, 2005; Riewald, Ruf, 2006), так и только EPCR (Esmon, 2005) в защитном и антивоспалительном действии АPС на клетки эндотелия и моноциты. Кроме того, Guo с соавторами (2004) показали, что в кортикальных нейронах протекторное действие АPС при стауроспорин-вызванном апоптозе опосредуется через PAR1 и PAR3.

Для выявления рецепторов, опосредующих действие АРС на кортикальные и гиппокампальные нейроны при глутамат-вызванной эксайтотоксичности, мы использовали как специфические пептиды-антагонисты PAR1, так и антитела, специфически блокирующие рецепторы PAR1, PAR3 и EPCR.

Рис.8 Влияние 0.1 нМ APC и пептида-антагониста PAR1 - YFLLRN ((Tyr1)-TRAP-7, 20 мкМ) на гибель гиппокампальных нейронов, вызванную 30-минутной инкубацией культур с 100 мкМ глутаматом.

Ранее нами и другими авторами показано, что пептид (Tyr1)-TRAP-7(YFLLRN) может блокировать PAR1-зависимые эффекты тромбина в тромбоцитах и нейронах (Rasmussen et al., 1993; Gorbacheva et al., 2007). В нашей работе мы исследовали участие PAR1 в цитопротекторном действии АРС с помощью пептида-антагониста PAR1- (Tyr1)-TRAP-7. Установлено, что 20 мкМ Tyr1-TRAP-7 непосредственно не влияет на гибель нейронов, но отменяет защитное анти-апоптотическое действие низких (0,1 нМ) концентраций APC при глутаматной токсичности (рис. 8). Эти данные позволяют сделать вывод о том, что прямое нейропротекторное действие АРС на нейроны гиппокампа при эксайтотоксичности реализуется через рецепторы подтипа PAR1.

Рис. 9. Влияние блокады рецепторов PAR1, PAR3 или EPCR на протекторное  действие АРС при токсическом действии глутамата на нейроны гиппокампа. Гибель нейронов оценивали по уровню высвобождения лактатдегидрогеназы из клеток через 24 часа после инкубации клеток в присутствии глутамата (100мкM, 30 мин) или в сочетании с прединкубацией нейронов с АРС (1 нM, 15 мин) и с блокирующими PAR1 (aPAR1), PAR3 (aPAR3) (20мкг/мл, 30 мин) и EPCR (aEPCR) (10мкг/мл, 30 мин) антителами. PAR1 (cPAR1), PAR3 (cPAR3) и IgG антитела (cEPCR, 20мкг/мл, 30 мин) служили негативным контролем. * p < 0.05 по отношению к глутамату.

Показано, что антитела к PAR1, также как и пептид-антагонист Tyr1-TRAP-7 отменяют защитное действие АРС на культивируемые нейроны при эксайтотоксичности (рис.9). Блокада PAR3 рецепторов гиппокампальных нейронов антителами к PAR3 не влияла на протекторные эффекты АРС (рис.9). Вместе с тем, установлено, что предварительная блокада EPCR специфическими антителами полностью предотвращала нейропротекторное действие АРС в условиях цитотоксичности, вызванной глутаматом (рис.9). Эти результаты свидетельствуют о необходимости участия двух  рецепторов - PAR1 и EPCR, в прямом нейропротекторном действии АРС на гиппокампальные нейроны мозга крысы при эксайтотоксичности. Наши данные о PAR1/EPCR-зависимом протекторном действии АРС на нейроны согласуются с данными Riewald и Ruf (2006) о механизме анти-воспалительного эффекта АРС на клетки эндотелия.

Нами показано, что тромбин, активируя PAR1, даже в низких концентрациях (1-10 нМ) может вызывать гибель небольшой части нейронов в контроле (18,9+1,9 %) (рис. 10). Если в протекторном действии АРС участвует PAR1, то прединкубация клеток с АРС должна приводить к десенситизации рецептора и отсутствию ответа на последующие предъявления тромбина, агониста PAR1.

Как видно на рис. 10, предобработка гиппокампальных нейронов с APC (1,8 нМ) до действия 10 нМ тромбина в 9 раз снижает гибель нейронов, вызванную тромбином (до 2,0 %), что сопоставимо с контрольными значениями гибели клеток в популяции (4,6%). Эти данные подтверждают участие PAR1 в реализации действия АРС на нейроны

Рис. 10. Снижение гибели гиппокампальных нейронов, вызванной  тромбином под действием АРС. Предварительная инкубация клеток с APC (1.8 нМ, 15 мин.) отменяла гибель нейронов, вызванную 15-минутной инкубацией культур с 10 нМ тромбина. * р<0,05 по сравнению с тромбином.

3. Влияние протеиназ гемостаза на концентрацию внутриклеточного кальция-  [Ca2+]i в культивируемых нейронах.

В основе очагового некроза ткани мозга при острой ишемии лежат быстрые реакции глутамат-кальциевого каскада, происходящие в нейронах в первые минуты и часы после нарушения кровообращения (Olney, 1994; Chinopoulos, Adam-Vizi, 2006; Bano, Nicotera, 2007; Concannon et al., 2008). Нарастание внутриклеточной концентрации ионов кальция приводит к транзиторной активации различных Са2+-зависимых ферментов, включая Са2+/кальмодулин-зависимую протеинкиназу С, кальцинейрин, фосфолипазу А2, фосфолипазу С, NO-синтазу и ряд эндонуклеаз. Самым первым признаком последующей гибели клетки является невозможность ею восстановить исходную концентрацию [Ca2+]i после глутаматного воздействия (Randall, Thayer, 1992), стойкое возрастание [Ca2+]i наблюдается в тех нейронах, которые затем погибают. Доказательство связи степени возрастания [Ca2+]i с последующей нейрональной гибелью получены в исследованиях Ogura et al. (1988) и Limbrick et al. (1995). Всё это указывает на несомненную важность контроля кальциевого гомеостаза в нейронах для модуляции негативных процессов при ишемии.

Поэтому исследование влияния протеиназ гемостаза на состояние внутриклеточного кальция в культивируемых нейронах мозга крысы как в норме, так и при глутаматной эксайтотоксичности - представляет большой интерес.

Рис. 11. Влияние инактивированного (с помощью PMSF)(А) и активного тромбина (10нМ) на концентрацию внутриклеточного кальция ([Ca2+]i) в нейронах А – изменение [Ca2+]i в четырёх отдельных гиппокампальных нейронах; Б – динамика изменения [Ca2+]i (нМ) как средняя величина значений, полученных от 52 нейронов в трёх независимых экспериментах.

Нами показано, что активация гиппокампальных нейронов 10нМ тромбином вызывала быстрое транзиторное увеличение [Ca2+]i, концентрация которого достигала максимума (150-200 нМ) в течение 20-30 секунд (рис.11). Далее, несмотря на присутствие тромбина в среде инкубации, [Ca2+]i возвращается к исходному уровню. Количество нейронов, ответивших на тромбин изменением [Ca2+]i, составляло в среднем 60-65% от общего числа исследованных нейронов. 

Предварительная инкубация клеток с блокатором IP3 рецепторов ретикулума 2-APB (100 мкМ), уменьшала кальциевый ответ нейронов на тромбин более чем в 3 раза (рис.12), при этом количество нейронов, ответивших на тромбин в присутствии 2-APB, снижалось с 60-65% до 20-24%.

Предварительная инкубация клеток с 30мкМ дантроленом (Dantr), ингибитором рианодиновых рецепторов, не изменяла количество клеток, ответивших на тромбин, но уменьшала амплитуду кальциевого ответа (рис.12) и не увеличивала эффект 100 мкМ 2-APB при совместной с ним инкубации (данные не приведены).

Таким образом, вызываемое тромбином PAR1-опосредованное изменение внутриклеточного кальция в нейронах гиппокампа – это результат выхода ионов кальция из ретикулума преимущественно по IP3-рецептор-зависимому механизму.

Показано, что ФХa и АРС, в отличие от тромбина, не вызывают изменения [Ca2+]i во всех исследованных концентрациях (0,1-80 нМ, данные не приведены).

Рис. 12. Влияние блокады IP3 рецепторов эндоплазматического ретикулума нейронов 2-аминоетоксидифенил боратом( 2-aminoethoxydiphenyl borate (2-APB), 10, 30 и 100 мкМ) и блокады рианодиновых рецепторов дантроленом (Dantr, 30 мкМ) на кальциевый сигнал, вызванный 10нМ тромбина. * р<0,05 по сравнению с тромбином. Вверху – оригинальная запись изменения [Ca2+]i (нМ) в нейроне гиппокампа в ответ на тромбин (слева) и тромбин в сочетании с 2-АРВ (справа).

Далее мы анализировали влияние тромбина и ФXa на изменение концентрации внутриклеточного кальция при длительном (20 мин) действии 100мкМ глутамата, которое вызывало в нейронах стойкое двухфазное увеличение [Ca2+]i (рис.13А). После отмены глутамата величина [Ca2+]i в подавляющем большинстве нейронов не возвращался к исходному уровню (рис. 13 А, Г).

Рис. 13. Влияние тромбина и фактора Ха на [Ca2+]i в гиппокампальных нейронах в условиях длительного действия глутамата. А – оригинальная запись изменения [Ca2+]i в отдельных нейронах до, во время и после действия глутамата (Глу). После отмены глутамата клетки отмывали бескальциевой средой, содержащей 100 мкМ ЭГТА; Б – прединкубация культуры с тромбином 10 (нM); В – прединкубация культуры с фактором Ха (10 нМ); Г – влияние тромбина и фактора Ха на способность нейронов восстанавливать базальный уровень [Ca2+]i после отмены глутамата. * - р<0,01 по сравнению с глутаматом.

Предварительная инкубация клеток с 10нМ тромбином существенно не влияла на повышение [Ca2+]i при действии глутамата, однако увеличила число нейронов (более чем в 2 раза), восстановивших базальный уровень [Ca2+]i через 15 минут после отмены глутамата (рис. 13 Б, Г). 10нМ ФXa, так же как тромбин, способствовал быстрому восстановлению внутриклеточного кальциевого гомеостаза после длительного действия глутамата (рис. 13 В, Г). В отличие от тромбина и ФХа, АРС не влиял на [Ca2+]i гомеостаз при длительном действии глутамата на гиппокампальные нейроны (данные не приведены).

4. Влияние протеиназ гемостаза на активацию транскрипционного фактора NF-kB в нейронах.

Острая церебральная ишемия вызывает активацию комплекса генетических программ с последующей экспрессией про- и антиапоптотических генов. Активация транскрипционных факторов наблюдается не только в зоне инфаркта, но и в периферических отделах ишемизированной зоны (Гусев, 2003). Одним из транскрипционных факторов является NF-kB, который активируется ROS, цитокинами (TNF-, IL-1,и др.), ультрафиолетовым излучением и др.. NF-kB - гетеродимер, состоящий из субъединиц NF-kBр50 (50 kD) и NF-kBр65 (60 kD), и находящийся в цитоплазме в комплексе с ингибиторами- IBs. При активации IBs фосфорилируются IB киназами (IKKα, IKK β и IKKχ(NEMO)) и субъединицы - NF-kBр65 и р50 - транслоцируются в ядро, где инициируют синтез ряда ключевых белков (среди которых цитокины, ростовые факторы, металлопротеиназы и другие молекулы), участвующих в процессах воспаления, иммунного ответа, пролиферации, ангиогенеза, апоптоза и др. (Carroll et al., 2000; Nakano et al., 2006; Crack et al., 2006; Massa, 2006). Ряд авторов связывают активацию NF-kB с провоцируемой ишемией гибелью нейронов (Irving et al., 2000). Показано также, что NF-kB контролирует выживаемость клеток, повышая экспрессию антиапоптотических генов (Karin, Lin, 2002; Nakano et al., 2006). Данных о влиянии глутаматной эксайтотоксичности на активацию NF-kB в гиппокампальных культивируемых нейронах нами не обнаружено, поэтому исследование транслокации в ядро NF-kBр65, а также изучение возможной роли протеиназ в регуляции активности NF-kB представляет теоретический и практический интерес.

С помощью иммуноферментного метода и иммунофлуоресцентного окрашивания нами установлено, что 30-ти минутное глутаматное воздействие на культуру гиппокампальных нейронов приводит к транзиторной активации NF-kB и транслокации в ядро NF-kBр65 (рис.14). Исследование динамики транслокации NF-kBp65 в ядро (по изменению отношения ядерной/цитоплазматической фракции NF-kBp65) показало достоверное повышение ядерной фракции NF-kBр65 через 1 час после токсического воздействия глутамата (100 мкМ, 30 мин), которое достигает максимума через 2-4 часа и к 8 часам возвращается к исходному уровню (рис.14).

Ранее нами показано, что максимальная гибель нейронов после токсического действия глутамата (100мкМ, 30мин.) наблюдается через 24 часа (рис. 1-4). Полученные нами данные о динамике транслокации NF-kBр65 в ядро, по-видимому, свидетельствуют о том, что активация NF-kBр65 является одним из начальных ключевых этапов сложного каскадного процесса запуска клеточной гибели.

Рис.14. Динамика изменения отношения ядерной/цитоплазматической фракции NF-kBp65 после инкубации гиппокампальных нейронов с глутаматом (100 мкМ, 30 мин), АРС (1нМ, 15 мин.) или АРС (1нМ, 15 мин.) с последующим действием глутамата (100 мкМ, 30 мин). Данные получены с помощью иммунофлуоресцентного метода с использование в качестве первичных антител NF-kBp65 ((C22B4) rabbit mAb, 1:100). * - р<0.05 по отношению к контролю.

Предварительная инкубация нейронов с низкими концентрациями АРС (1нМ) полностью отменяла вызванную глутаматом активацию NF-kB и предотвращала транслокацию NF-kBр65 в ядро (рис.14). Установлено, что низкие концентрации протеиназ гемостаза (тромбина, ФХа и АРС) не оказывали влияния на уровень ядерной фракции NF-kBр65 в нейронах. Вместе с тем, высокие концентрации тромбина (50нМ) (которые, как отмечалось выше (рис. 9), оказывают токсическое действие на нейроны) вызывают активацию NF-kB и транслокацию NF-kBp65 в ядро. Предобработка гиппокампальных нейронов АРС блокирует активацию NF-kB, вызванную 50 нМ тромбином (рис.15).

Рис.15. Влияние глутамата, АРС и тромбина на уровень NF-kBp65 в ядерной фракции гиппокампальных нейронов (данные, полученные с помощью ELISA). Нейроны инкубировали с глутаматом (100мкM, 30 мин), или с тромбином (50 нM, 45 мин), или прединкубировали с АРС (1 нM, 15 мин) перед последующей экспозицией клеток с 50 нМ тромбина (45 мин).

* - p < 0.05 по сравнению с контролем, данные представлены как среднее + ошибка среднего (3–4 независимых экспериментов).

Известно, что АРС обладает анти-воспалительным действием, способен ингибировать NF-kB в моноцитах (Yoke et al., 2002) и проявляет протекторное действие на клетки эндотелия при геморрагии, вызванной введением тканевого активатора плазминогена (tPA), при ишемии спинного и головного мозга в экспериментальных моделях на животных (Cheng et al., 2006; Yamauchi et al., 2006).

Для решения вопроса о том, через какие рецепторы АРС реализует нейропротекторное действие, мы изучили влияние специфических антител, блокирующих PAR1 и EPCR, на вызванную АРС блокаду транслокации NF-kBр65 в ядро при эксайтотоксичности.

Установлено, что действие АРС на вызванную глутаматом транслокацию NF-kBp65 в ядро нейронов отменяется при блокаде PAR1 и EPCR или обоих рецепторов специфическими антителами к этим рецепторам (рис.16).

Рис.16. Влияние блокады PAR1 и EPCR на транслокацию NF-kBp65 в ядро гиппокампальных нейронов на фоне инкубации клеток гиппокампа с АРС (0,1 нМ, 15 нМ) и глутаматом (100 мкМ, 30 мин). Анализ осуществляли через 4 часа после воздействия с помощью иммунофлуоресцентного метода с использованием в качестве первичных антител NF-kBp65 ((C22B4) rabbit mAb, 1:100). блокирующие PAR1 и EPCR антитела: аPAR1 (20мкг/мл, 30 мин) аEPCR (10мкг/мл, 30 мин) (соответственно). сPAR1 и сEPCR антитела, использованные как негативный контроль. * - р<0.05 по отношению к контролю.

Эти данные свидетельствуют о том, что АРС модулирует активность NF-kB через расщепляемый PAR1 и собственный рецептор EPCR, поскольку блокирование этих рецепторов отменяет АРС-вызванную регуляцию уровня ядерной фракции NF-kBр65 при глутаматной эксайтотоксичности.

5. Влияние ингибитора белка теплового шока HSP90 на нейропротекцию, вызванную APC, тромбином и пептидом-агонистом PAR1.

Для выяснения роли HSP90 в нейропротекции, вызванной тромбином, пептид-агонистом PAR1 (TFLLRN) и APC, мы использовали гелданамицин (ГА) - специфический ингибитор HSP90, который связывает N-концевой домен HSP90, ингибирует ATPазную активность и предотвращает взаимодействие цитозольного HSP90 с клиентными белками (Roe et al., 1999; Pratt et al., 2003), среди которых – и рецептор тромбина PAR1 (Pai et al., 2001,2002).

Рис.17. Влияние гелданамицина (ГА, 200нМ), глутамата (Глу, 100мкМ), АРС (1нМ), тромбина (10нМ) и PAR1-AP (100мкМ) на гибель гиппокампальных нейронов (данные получены МТТ-методом). * - р<0.05 по отношению к глутамату.

Нами показано, что 2-х часовая предварительная инкубация клеточных культур нейронов с гелданамицином (200 нМ) отменяет нейропротекторное действие 10 нМ тромбина, 100 мкМ агониста PAR1 и 1 нМ APC при глутаматной эксайтотоксичности (рис. 17). Это подтверждает наше предположение о том, что анти-апоптотическое действие APC реализуется через PAR1, подобно действию тромбина и пептида-агониста PAR1, по механизму, зависимому от HSP90. Добавление гелданамицина в используемой концентрации не влияло на гибель нейронов при глутаматной эксайтотоксичности (рис. 17).

Полученные результаты свидетельствуют о том, что в защитном PAR1-опосредованном действии APC на поврежденные глутаматом нейроны участвует цитозольная форма HSP90.

6. Энтеропептидаза как эндогенный инактиватор рецептора тромбина - PAR1.

Влияние энтеропептидазы на вызванное тромбином изменение внутриклеточного кальция в культивируемых нейронах мозга крысы.

Результаты наших исследований указывают на повреждающее действие высоких концентраций тромбина на нейроны. Известно появление токсических концентраций тромбина в тканях мозга при нарушении гематоэнцефалического барьера, при травмах и повреждении сосудов мозга. Поиск новых эндогенных модуляторов тромбиновых рецепторов и ингибиторов токсического действия высоких концентраций тромбина на нейроны является весьма актуальным для терапии этих патологических состояний.

Рис. 18. Катализируемая энтеропептидазой активация трипсиногена (A); протеолиз N-концевого пептида PAR1 человека, ведущий к активации рецептора (тромбин; трипсин; катепсин G (CG)) и к инактивации рецептора (трипсин, CG, протеиназа 3 (PR3), эластаза (HLE) и, гипотетически, энтеропептидаза (Б).

Известно, что тромбин и другие сериновые протеиназы регулируют активность клеток, расщепляя одну пептидную связь во внеклеточном домене PAR и открывая новый N-конец рецептора, так называемый "привязанный лиганд", который служит агонистом этого рецептора (Coughlin, 2000, 2002). Из 4-х известных на данный момент PARs, PAR1 является наиболее изученным рецептором семейства GPCR (рецепторов, сопряженных с G-белками). Внеклеточный N-конец PAR1 человека содержит сайт расщепления для тромбина (LDPR41↓S42FLLRN), а также последовательность заряженных остатков (D51KYEPF56) (рис. 18Б) (Vu et al., 1991). Заряженный домен взаимодействует с анион-связывающим сайтом тромбина, что способствует эффективному гидролизу рецептора.

Ряд протеиназ расщепляет PAR по сайтам, отличным от сайтов активации, с образованием рецепторов, не способных к последующей протеолитической активации (рис.18). Так, катепсин G и трипсин могут расщеплять PAR-1 не только по сайту Arg41-Ser42, но и Phe43-Leu44, Phe55-Trp56, Tyr69-Arg70 в первом случае или Arg70- Leu71 и Lys82-Ser83 (Loew et al., 2000; Nakayama et al., 2004). При этом происходит удаление привязанного лиганда, что делает рецептор нечувствительным к тромбину. Такая инактивация может работать как механизм регуляции, посредством которой внеклеточные протеиназы и протеиназы клеточной поверхности терминируют активацию PAR (Nakayama et al., 2004) и служат их инактиваторами.

Энтеропептидаза - высокоспецифическая протеиназа пищеварительного тракта, природным субстратом которой является трипсиноген. Энтеропептидаза локализована в слизистой дуоденума и тонкого кишечника, однако при патологии ее обнаруживают в кровотоке (McCutcheon, 2000), ее экспрессия наряду с трипсином обнаружена в опухолевые клетках человека (рак желудка) (Miyata et al., 1999). В структуре трипсиногена энтеропептидаза катализирует гидролиз полипептидной цепи после N-концевой последовательности DDDDK, которая считалась консервативной и была обнаружена только в структуре активационных пептидов различных трипсиногенов (Guy et al., 1976).

Обнаружено, что активируемые тромбином рецепторы PAR1 также содержат аналогичную последовательность: -EDEEK- (PAR1 человека и обезьян), -DEEEEK-(PAR1 мыши), -DEEEK-(PAR1 хомяка и крысы). Этот специфический энтеропептидазный сайт в PAR1 человека (57-61) находится в составе N-концевого привязанного лиганда, активирующего PAR1 при протеолизе тромбином.

Гидролиз PAR1 энтеропептидазой должен, таким образом, инактивировать рецептор и приводить к отмене сигнала (рис. 18). В качестве модели для изучения действия энтеропептидазы на PAR1 мы выбрали культивируемые гиппокампальные нейроны мозга крыс.

Рис.19 Индуцированное тромбином изменение внутриклеточного кальция [Ca2+]i, нM в гиппокампальных нейронах: контроль (А);  влияние предварительной инкубации клеток с энтеропептидазой (8 нM; Б) и с инактивированной энтеропептидазой (8 нM; В). Данные представлены как среднее значение + стандартное отклонение  ( n = 22).

Как показано нами ранее, активация гиппокампальных нейронов 10 нМ тромбином вызывала быстрое транзиторное увеличение [Ca2+]i, концентрация которого достигала максимума (250 нM) в течение 20-30 секунд (рис. 19). Не все гиппокампальные нейроны отвечали на тромбин изменением [Ca2+]i, количество ответивших нейронов составило в среднем 64% от общего числа исследованных нейронов.

Предварительная инкубация клеток с энтеропептидазой (1-8 нM) достоверно снижала вызванное тромбином увеличение внутриклеточного кальция (до 22 нM) без изменения количества ответивших на тромбин клеток (рис. 19Б). Инактивирование энтеропептидазы отменяло данный эффект и, как видно из рисунка 19В, амплитуда кальциевого ответа на тромбин в случае инкубации с энтеропептидазой (8 нM) инактивированной BPTI, практически не отличалась от контрольных значений (рис. 19А). Полученные результаты свидетельствуют о том, что энтеропептидаза не активирует рецепторы типа PAR1 нейронов. Oднако, энтеропептидазa может быть инактиватором PAR1 вследствие гидролиза фрагмента -EDEEК61-N- после остатка Lys61 в рецепторе. Таким образом, мы показали, что энтеропептидаза может служить новым регулятором функций тромбина, реализуемых через расщепление PAR1.

Заключение.

Выявление эндогенных модуляторов выживаемости клеток при эксайтотоксичности и исследование механизмов их действия является актуальным и необходимым для оптимизации подходов к терапии неврологических заболеваний.

Увеличение проницаемости ГЭБ при критических состояниях приводит к появлению в нервной ткани сериновых протеиназ системы свертывания крови, у которых обнаружены свойства клеточных регуляторов или стимуляторов процессов воспаления, репарации тканей, в том числе нейрорепарации и нейродегенерации (Балезина и др., 2004; Струкова и др., 2005; Wang, Reiser, 2003; Suo et al., 2004; Ossovskaya, Bunnett, 2004; Riewald, Ruf, 2005; Hollenberg, 2005; Sheehan, Tsirka, 2005). Однако, данные о влиянии протеиназ гемостаза на нейроны - противоречивы и не многочисленны (Xi et al., 2003, Guo et al., 2004; Suo et al., 2004; Wang et al 2007), а вопрос о механизмах их действия на нейроны еще не решен.

В работе исследована роль антикоагулянта - активированного протеина С, и двух прокоагулянтов - тромбина и его предшественника в каскаде свёртывания, фактора Хa, вне системы гемостаза, в модели глутаматной эксайтотоксичности.

Полученные результаты показывают, что в низких концентрациях (до 10 нМ) протеиназы оказывают нейропротекторный эффект при токсическом действии глутамата. В высоких концентрациях (50-100 нM) протеазы вызывают гибель клеток. Минимальные нейропротекторные концентрации тромбина и АРС составляют 0,1 нМ, а FХa - на порядок выше (1 нМ). Разную специфичность ферментов в отношении субстратов – рецепторов PAR можно объяснить определенными различиями третичных структур этих родственных ферментов, а именно, наличием только в молекуле тромбина специфического анионсвязывающего экзосайта – ABE1, узнающего в структуре экзодомена PAR1 комплементарный этому экзосайту участок, подобный отрицательно заряженному С-концу гирудина, высокоспецифического ингибитора тромбина. Структурные особенности ферментов отвечают за различия в выборе субстратов и рецепторов.

Свое действие на клетки тромбин реализует как через PAR1, так и через PAR4 (Струкова, 2001; Striggow et al., 2001; Suo et al., 2003; Ossovskaya, Bunnett, 2004). Использование агониста и антагониста PAR1 позволило нам установить, что тромбин оказывает нейропротекторное действие на гиппокампальные нейроны через PAR1, поскольку антагонист PAR1 отменял защитное действие тромбина, а агонист PAR1 - имитировал его действие (рис. 6).

Таким образом, тромбин реализует свое нейропротекторное действие в узком диапазоне очень низких концентраций с участием PAR1-рецепторов. Тогда как в повреждающих эффектах тромбина, возможно, одновременно задействованы оба типа рецепторов тромбина PAR1 и PAR4.

До настоящего времени отсутствуют данные о рецепторном механизме действия ФХа на нейроны. Наши исследования показали, что предварительная инкубация клеток с пептидом-агонистом PAR2 не защищала клетки от гибели, вызванной глутаматом, а с антагонистами PAR1 и PAR2 не устраняла нейропротекторный эффект ФXa (рис.7). Однако инактивация ФХа с помощью PMSF отменяла нейропротекторный эффект фермента. Можно предположить вовлечение в нейропротекторный эффект ФХа других подтипов PAR.

Известно, что тромбин уже в низких концентрациях активирует образование антикоагулянта APC из протеина С крови, связывая высокоаффинный рецептор - тромбомодулин эндотелия (Egan et al., 1997; Esmon, 2003). Кроме регуляции образования тромбина и свертывания крови АРС проявляет цитопротекторную и антивоспалительную активности (Joyce, Grinnell, 2002; Riewald et al., 2002; Esmon, 2005; O'Brien et al., 2006; Griffin et al., 2006). Однако механизмы действия APC при эксайтотоксичности, индуцируемой высокими концентрациями глутамата - не выяснены.

Наши исследования впервые показали, что уже в концентрации 50 пM APC может защищать нейроны гиппокампа и коры от гибели при эксайтотоксичности. Эффективная концентрация АРС соответствует концентрации эндогенного фермента, образуемого при активации свертывания крови (0,04 нМ) (Griffin et al., 2006).Следует отметить обнаруженные нами различия в действии APC на кортикальные и на гиппокампальные нейроны. Устойчивость нейронов к гибели, вызываемой высокими концентрациями APC, различалась: на кортикальных нейронах токсическим действием обладали 100 нМ АРС, а на гиппокампальных – 50 нМ. При этом максимальная концентрация АРС, обладающая нейропротекторным действием, на кортикальных нейронах была на порядок выше, чем в гиппокампальных. Выявленные нами различия в действии АРС на нейроны разных структур мозга указывают на разную чувствительность гиппокампальных и кортикальных нейронов к APC.

В литературе имеются данные о действии APC на клетки не только через подтип PAR1, но и через другие подтипы – PAR2 и PAR3 (Riewald et al., 2003; Guo et al., 2004). Так, показано, что APC активирует экспрессию протекторных генов (включая MCP-1) через PAR1 и PAR2 эндотелиальных клеток человека по механизму, зависимому от рецептора EPCR (Riewald et al., 2003). На кортикальных нейронах показана реализация анти-апоптотического действия APC через PAR1 и PAR3 при стауроспорин-вызванном апоптозе (Guo et al., 2004).

Нами установлено, что регуляторное действие APC на нейроны зависит от его протеолитической активности, что подчеркивает участие расщепляемого рецептора, возможно PAR1, в нейропротекторном действии APC.

Мы исследовали участие PAR1, PAR3 и EPCR в цитопротекторном действии АРС с помощью пептида-антагониста PAR1- (Tyr1)-TRAP-7 и специфических антител, блокирующих PAR1, PAR3 и EPCR. Обнаружено, что блокада PAR1 и EPCR, но не PAR3 отменяла нейропротекторное действие APC на гиппокампальные (рис. 8,9) и кортикальные нейроны (данные не приведены). Кроме того, прединкубация клеток с APC в эффективной концентрации (1,8 нМ) существенно (в 9 раз) снижала гибель клеток, вызванную 10 нМ тромбина (рис.10), что также свидетельствует о PAR1–опосредованном действии APC.

Таким образом, антиапоптотическое действие APC на нейроны при эксайтотоксичности, вызванной глутаматом, реализуется через два рецептора - PAR1 и EPCR. Эти данные подтверждены изучением экспрессии рецепторов в исследуемых нами клеточных культурах. Так, мы впервые выявили экспрессию EPCR в гиппокампальных и кортикальных нейронах крысы. Кроме того, мы обнаружили экспрессию в нейронах всех 4-х типов PAR рецепторов, причем  преобладала экспрессия подтипа PAR1. В отличие от данных Guo с соавторами (2004), которые исследовали гибель кортикальных нейронов, вызванную стауроспорином, мы не обнаружили участия PAR3 в нейропротекторном действии АРС. Возможно, это связано с особенностями использованной нами модели глутаматной эксайтотоксичности.

Поскольку глутамат в токсических концентрациях вызывает длительное и необратимое повышение [Ca2+]i, можно предположить, что уменьшение нейротоксического воздействия глутамата на клетки при инкубации с тромбином осуществляется через модуляцию [Ca2+]i.

Наши исследования влияния тромбина на кальциевый гомеостаз нейронов показали, что вызываемое тромбином транзиторное повышение [Ca2+]i, в основном, реализуется преимущественно через IP3 рецепторы эндоплазматичекого ретикулума. Только благодаря этому механизму изменение концентрации [Ca2+]i в ответ на действие тромбина реализуется в 50% всех нейронов. Вместе с тем, рианодиновые рецепторы, вероятно, вносят свой вклад в изменение [Ca2+]i в нейронах под влиянием тромбина, однако мы не наблюдали нейронов, где блокада этих рецепторов дантроленом полностью отменяла бы эффект тромбина. В литературе имеются единичные данные об изменении [Ca2+]i в гиппокампальных нейронах крысы под влиянием 100 нМ тромбина (Smith-Swintosky et al., 1995). В настоящей работе мы подтвердили полученные нами ранее данные (Киселева Е.B. c соавт., 2004), что кальциевый сигнал тромбина в гиппокампальных нейронах имитирует пептид агонист PAR1 и блокирует антагонист PAR1. Полученные нами результаты о ведущей роли IP3 рецепторов в реализации индуцируемого тромбином кальциевого сигнала согласуются с данными о том, что механизм PAR1-зависимого кальциевого ответа олигодендроцитов опосредуется также через IP3 рецепторы эндоплазматического ретикулума (Wang et al., 2004).

Поскольку в основе токсического эффекта глутамата на нейроны лежит перегрузка клеток кальцием и нарушение кальциевого гомеостаза клетки, мы исследовали влияние тромбина на вызываемое глутаматом увеличение [Ca2+]i в нейронах гиппокампа. Показано, что тромбин и ФXa улучшают восстановление кальциевого гомеостаза нейронов после действия глутамата (рис.13). Механизм такого эффекта неизвестен, однако можно предположить, что сериновые протеазы через активацию внутриклеточных факторов улучшают состояние систем транспорта кальция из клеток наружу (прежде всего Ca2+-АТФазы плазматической мембраны). Другой возможный механизм - кальций, выбрасываемый из ретикулума, тормозит вход Ca2+ по канал глутаматных рецепторов по принципу отрицательно обратной связи. Не исключена и возможность того, что протеиназы уменьшают [Ca2+]i сигнал, вызываемый активацией глутаматных рецепторов. Так, ранее обнаружено, что предварительная инкубация клеток с низкими концентрациями тромбина снижала внутриклеточный кальциевый сигнал в гиппокампальных нейронах при аппликации NMDA, агониста NMDA-глутаматных рецепторов (Киселева с соавт., 2004). По данным Blaabjerg с соавт. (2003), нейропротекция в нейронах гиппокампа может быть реализована через снижение ионных токов, опосредованных NMDA-рецепторами.

Полученные данные дают основания полагать, что тромбин защищает нейроны гиппокампа от токсического действия глутамата, модулируя вызванные глутаматом изменения [Ca2+]i (опосредованно через IP3 рецепторы эндоплазматического ретикулума) и улучшая восстановление кальциевого гомеостаза в постглутаматный период. Поскольку ФXa не вызывает кальциевого сигнала в нейронах, его нейропротекторный эффект связан с кальций-зависимым механизмом вызванной глутаматом гибели клеток, по-видимому, более сложным образом.

Таким образом, хотя тромбин может сам вызывать гибель части популяции нейронов гиппокампа, однако при сочетанном действии тромбина (в низкой концентрации) с глутаматом он способен защищать клетки от индуцированного глутаматом апоптоза, причем в отдаленный период после действия глутамата. Механизм нейропротекции неизвестен. Увеличение внутриклеточной концентрации Са2+, вызываемое активацией PAR, может влиять на ряд внутриклеточных факторов как в ядре, так и в цитоплазме (транскрипционный факторы – NF-kB, FosB/JunD AP-1 и др.) и запускать/тормозить экспрессию различных генов, в том числе тех белков (Bax/Bad семейства Bcl, AIF, MAP-киназы, каспазы), активность которых определяет развитие апоптоза при токсическом действии глутамата (Sanchez-Perez et al., 2005).

Мы предположили, что важный транскрипционный фактор - NF-kB может вовлекаться не только в кальций-зависимый протекторный механизм действия тромбина, но в механизм действия на нейроны другой протеиназы - АРС. Согласно данным литературы, антивоспалительное действие АРС связывают с блокадой индукции провоспалительных агонистов клетками эндотелия и моноцитами. Известно, что ишемия сопровождается воспалительным процессом. Мы обнаружили, что 30-минутное воздействие высокой концентрации глутамата вызывает в культивируемых нейронах транзиторную активацию NF-kB и транлокацию субъединицы NF-kBp65 в ядро с максимум через 2-4 часа после токсического воздействия глутамата. Действие глутамата на фоне низких концентраций АРС не сопровождалось значимым повышением уровня NF-kBp65 в ядерной фракции (по сравнению с контролем), что свидетельствует о защитном эффекте АРС при эксайтотоксичности.

Таким образом, механизм протекторного действия АРС на нейроны, подобно его антивоспалительному эффекту, реализуется, в частности, через модуляцию активации транскрипционного фактора NF-kB. Запуск этого процесса опосредуется PAR1 и EPCR, на что указывают эксперименты с использованием специфических антител к рецепторам. Блокада этих рецепторов полностью отменяет индуцируемое АРС снижение уровня NF-kBp65 в ядре после токсического действия глутамата и высоких концентраций тромбина на нейроны.

В механизме гибели клеток, индуцированной гиперактивацией глутаматных рецепторов, особую роль играют некоторые белки теплового шока, в частности HSP90, способные защищать клетки от гибели (Hooven et al., 2004; Dou et al., 2005; Ouyang et al., 2005; Lee et al., 2007). Ранее обнаружено, что HSP90 участвует в изменении формы астроцитов, вызванном тромбином через активацию PAR1 (Pai et al., 2002), и показано специфическое взаимодействие HSP90 с C-концом PAR1 в дрожжах (Pai et al., 2001).

Поскольку PAR1 может взаимодействовать с цитозольной формой HSP90 (Pai et al., 2002; Pratt et al., 2003), мы предположили, что ингибирование активности HSP90 гелданамицином (Grenert et al., 1997) может блокировать защитное действие АРС и других агонистов PAR1. Полученные нами результаты показали, что нейропротекторное действие APC, также как и низких концентраций тромбина и пептида-агониста PAR1, отменяется гелданамицином (рис. 16). Эти данные подтверждают PAR1-опосредованный характер нейропротекторного действия APC на культивируемые нейроны при глутаматной токсичности и предполагают возможность участия HSP90 в этом процессе.

Таким образом, можно предположить, что нейропротекторные функции тромбина и APC в культивируемых гиппокампальных и кортикальных нейронах реализуется через PAR1 при участии HSP90.

Полученные данные указывают на важную роль PAR1 в реализации эффектов как тромбина, так и АРС. Следовательно, регуляция функциональной активности этого рецептора позволит корректировать нейродегенеративные и нейропротективные функции протеиназ. Нами обнаружен новый эндогенный регулятор PAR1 – энтеропептидаза, которая, инактивируя рецептор, отменяет, в частности, кальциевый ответ нейронов на тромбин.

На основании полученных данных можно рассматривать тромбин, ФХа и APС как клеточные регуляторы, которые взаимодействуя со своими специфическими расщепляемыми рецепторами, а в случае АРС с расщепляемым рецептором - PAR1 и EPCR, способны модулировать выживаемость нейронов при токсических воздействиях.

На основании прямого протекторного действия на нейроны мозга протеиназ гемостаза - тромбина, ФХа и APС могут быть разработаны новые подходы к лечению травматических и ишемических повреждений нервной ткани с помощью агонистов и антагонистов рецепторов PAR и на их основе созданы препараты с анти-апоптотическими, анти-воспалительными и репаративными свойствами.

Выводы

  1. В культивируемых гиппокампальных и кортикальных нейронах мозга крысы экспрессируется EPCR (эндотелиальный рецептор протеина С) и все четыре подтипа PAR (рецептор, активируемый протеиназой) – PAR1, PAR2, PAR3 и PAR4. Низкие концентрации тромбина стимулируют экспрессию PAR2 и PAR3 (через 4-12 часов) в культурах гиппокампальных и кортикальных нейронов.
  2. Тромбин в диапазоне низких концентраций (0,1-10 нМ) через рецептор PAR1 оказывает нейропротекторное действие на культивируемые гиппокампальные и кортикальные нейроны мозга крысы при эксайтотоксичности, вызванной глутаматом. Высокие концентрации тромбина (100 нM) обладают повреждающим действием на нейроны, вызывая гибель клеток.
  3. Фактор Ха (ФХа) в низких концентрациях (1-10 нМ) защищает культивируемые гиппокампальные нейроны от токсического действия высоких концентраций глутамата. Поскольку инактивация ФXa отменяет протекторное действие фермента, а блокада PAR1 и PAR2 - не отменяет нейропротекторного эффекта ФXa, эти данные могут свидетельствовать о вовлечении нового подтипа расщепляемого рецептора PAR в защитное действие ФXa на культивируемые нейроны мозга крысы.
  4. В нейропротекторном действии тромбина и ФХа (но не активированного протеина С (АРС)) на культуры гиппокампальных нейронов при токсическом действии глутамата участвует Са2+-зависимый механизм.
  5. Энтеропептидаза является эндогенным модулятором PAR1 и отменяет вызванное тромбином повышение внутриклеточного кальция в нейронах.
  6. АРС в диапазоне низких концентраций (0,05-10 нМ) защищает культивируемые гиппокампальные и кортикальные нейроны от гибели при эксайтотоксичности, вызванной действием высоких концентраций глутамата или тромбина на нейроны.
  7. Для нейропротекторного действия АРС на гиппокампальные и кортикальные нейроны при эксайтотоксичности необходимо присутствие двух рецепторов – EPCR и PAR1, поскольку их блокада специфическими антителами полностью отменяет защитное действие этой протеиназы.
  8. Длительное воздействие 100 мкМ глутамата на культивируемые гиппокампальные и кортикальные нейроны вызывает активацию транскрипционного фактора NF-kB и транслокацию субъединицы NF-kBр65 в ядро. АРС оказывает нейропротекторное действие на культивируемые нейроны при глутаматной токсичности, блокируя активацию транскрипционного фактора NF-kB и транслокацию NF-kBр65 в ядро.
  9. Специфический ингибитор белка теплового шока 90, гелданамицин, полностью отменяет PAR1-опосредованные протекторные эффекты АРС и тромбина при эксайтотоксичности, что свидетельствует об участии HSP90 в нейропротекторном действии АPС и тромбина на культивируемые гиппокампальные нейроны.
  10. Ключевые протеиназы гемостаза – тромбин, ФХа и АРС являются регуляторами выживаемости нейронов в условиях глутаматного токсического воздействия на клетки мозга. Агонисты и антагонисты PAR1 могут быть использованы для разработки новых препаратов, направленных на коррекцию травматических, ишемических повреждений мозга.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ:

  1. Горбачева Л.Р., Сторожевых Т.П., Киселева Е.В., Пинелис В.Г., Струкова С.М. Рецепторы первого типа, активируемые протеиназами, участвуют в механизмах  защиты нейронов гиппокампа крысы от токсического действия глутамата.// Бюлл.эксп.биол.мед., 2005, 139(9), C.265-268.
  2. Storozhevykh T., Gorbacheva L., Kiseleva E., Pinelis V., Strukova S. PARs ( Protease Activated Receptors) Activation By Thrombin And Factor Xa Protects Hippocampal Neurons Against Glutamate-induced Apoptosis.// J Thromb Haemost., 2005, 3, P.2349.
  3. Сторожевых Т.П., Киселева Е.В., Горбачева Л.Р., Пинелис В.Г., Струкова С.М. Тромбин защищает культивируемые нейроны гиппокампа крысы от апоптоза, вызванного глутаматом.// Сб. матер. конф. «Нейрохимия: фундаментальные и прикладные аспекты». Москва (14-16 марта), 2005, C. 200.
  4. Горбачева Л.Р., Сторожевых Т.П., Киселева Е.В., Пинелис В.Г., Струкова С.М. Новые нейротропные функции протеиназ системы свёртывания крови: фактора Xa  и тромбина.// Матер. Всеросс. конф. "Тромбозы,геморрагии,ДВС-синдром", Ярославль(12-14октября), 2005, C.27-29.
  5. Русанова А.В., Умарова Б.А., Горбачева Л.Р., Сидорова Е.И., Васильева Т.В., Марквичева Е.А., Грандфис К., Струкова С.М. Протекторное действие пептида-агониста рецептора тромбина(PAR1-АР) в модели язвы желудка у крыс.// Матер. Всеросс. конф. «Тромбозы, геморрагии, ДВС-синдром". Ярославль(12-4октября), 2005, C.91-93.
  6. Горбачева Л.Р., Сторожевых Т.П., Киселева Е.В., Пискунов А.К., Пинелис В.Г., Струкова С.М. Фактор Xa свертывания крови защищает гиппокампальные нейроны от глутаматной цитотоксичности.// Науч. труды I Съезда физиологов СНГ (Сочи, Дагомыс,19-23сент), 2005, Т.1, N 89, C.36.
  7. Горбачева Л.Р., Сторожевых Т.П., Киселева Е.В., Пинелис В.Г., Струкова С.М. Рецепторы, активируемые протеиназами  вносят вклад в выживаемость гиппокампальных нейронов.// Матер. междунар. симпозиума «Механизмы адаптивного поведения». Санкт-Петербург, Колтуши (7 -9 декабря), 2005,.C. 87-88.
  8. Горбачева Л.Р., Сторожевых Т.П., Киселева Е.В., Пинелис В.Г., Струкова С.М. Сериновые протеиназы- фактор Xa  и тромбин защищают  нейроны гиппокампа от глутаматной  цитотоксичности.// Матер. Междунар. конф. «Рецепция и внутриклеточная сигнализация». Пущино (6-9 июня), 2005, C.120- 122.
  9. Русанова А.В., Умарова Б.А., Горбачева Л.Р., Васильева Т.В., Ланге М.А., Грандфис К.,. Марквичева Е.А., Струкова С.М. PAR1 - агонист пептид, биоинкапсулированный в микрочастицы, вызывает ускорение репарации тканей на модели язвы желудка у крыс.// Научные труды I Съезда физиологов СНГ. Сочи,Дагомыс (19-23сент), 2005, Т. 2, N 505, C.178.
  10. Gorbacheva L., Storozhevykh T., Kiseleva E., Pinelis V., Smirnov M., Strukova S. Protease activated receptors (PARs) involved in protection of neurons from glutamate toxicity.// Abstracts of the 3rd Neuron Satellite Meeting, Neurons and Sensory System. Washington DC (Nov10-11), 2005, P.90.
  11. Strukova S.M., Kiseleva E.V., Storozhevykh T.P., Gorbacheva L.R., Pinelis V.G. The connection between coagulation and inflammation:impact of protease and  protease activated receptors.// Матер. II-ой всеросс. науч. конф. «Клиническая гемостазиология и гемореология в сердечно-сосудистой хирургии»( с международным участием). Москва(2-4 февраля), 2005, С. 318-319.
  12. Strukova S., Gorbacheva L., Storozhevykh T., Pinelis V., Smirnov M. Factor Xa like to thrombin can protect hippocampal neurons from glutamate toxicity.// J.Thromb.Haemost., 2006, 4(6), Р. 1409-1410.
  13. Горбачева Л.Р., Сторожевых Т.П., Пинелис В.Г., Ишивата С., Струкова С.М. Модуляция  тромбином и фактором Xa выживаемости гиппокампальных нейронов.// Биохимия. 2006, 71(10), С. 1338-1346.
  14. Русанова А.В., Макарова А.М., Марквичева Е.А., Горбачева Л.Р., Сташевская К.C., Васильева Т.В., Сидорова E.И., Беспалова Ж.Д., Грандфис К., Струкова С.М. Пептид - агонист рецептора тромбина, иммобилизованный в микросферы, ускоряет репаративные процессы  в модели  язвы желудка у крыс.// Бюлл.эксп.биол.мед., 2006, 142(7), С. 42-46.
  15. Макарова А.М., Русанова А.В., Горбачева Л.Р., Умарова Б.А., Струкова С.М. Влияние активированного протеина С на секреторную активность перитонеальных тучных клеток крысы.// Бюлл.эксп.биол.мед., 2006, 142(10), С. 382-385.
  16. Сташевская К.С., Марквичева Е.А., Русанова А.В., Макарова А.М, Горбачева Л.Р., Прудченко И. А., Зубов В.П., Грандфис К., Струкова С.М. Биодеградируемые микрочастицы с иммобилизованным пептидом для заживления ран.// Биомедицинская химия, 2006, 52(1), С. 83-94.
  17. Горбачева Л.Р., Сторожевых Т.П., Киселева Е.В., Пинелис В.Г., Струкова С.М. Новые нейропротекторные эффекты протеиназ системы свертывания крови- тромбина и фактора Xa.//  «Неврология длиною в жизнь» (под ред И.Д. Стулина), Изд-во МГМСУ, Москва, 2006, С. 176-179.
  18. Струкова С.М., Горбачева Л.Р., Сторожевых Т.П., Пинелис В.Г. Нейропротективные свойства агонистов рецепторов, активируемых протеиназами.// Матер. Московской междунар. конф. «Биотехнология и медицина». Москва (14-17 марта), 2006, С. 205.
  19. Gorbacheva L., Storozhevykh T., Pinelis V., Ishiwata S., Strukova S.  Proteinase activated receptors impact to hippocampal neurons survival.// Abstracts of the 4th International Symposium "Neuroprotection and Neurorepair. Focus 2006: Cerebral Ischemia and Stroke", Magdeburg (May3-6), 2006, Р. 50.
  20. Горбачева Л.Р., Сторожевых Т.П., Пинелис В.Г., Струкова С.М. Участие сериновых протеиназ системы свёртывания крови  - тромбина и фактора Ха в регуляции кальциевого сигнала гиппокампальных нейронов.// Матер.  XIV Междунар. конф. "Новые информ. технологии в медицине, биологии, фармакологии и экологии", Гурзуф, 2006, С. 86-88.
  21. Горбачева Л.Р., Сторожевых Т.П., Пинелис В.Г., Струкова С.М. Рецепторы, активируемые протеиназами, защищают гиппокампальные нейроны от глутаматной цитотоксичности.// Матер. конф. «Нейроспецифические метаболиты и энзимологические основы деятельности ЦНС», Пенза (25 – 27 сентября), 2006, С. 43-44.
  22. Rusanova A., Makarova A., Gorbacheva L., Vasileva T., Markvicheva E.,
    Grandfils Ch., Bespalova Z., Umarova B., Strukova S. Thrombin receptor agonist peptide as a novel antiulcerogenic factor.// In: «New Aspects of Biotechnology and Medicine» Eds: A M. Egorov  and GE. Zaikov. NY: Nova Biomedical Books, 2007, Chapter 11, Р. 142-147.
  23. Strukova S., Gorbacheva L.R., Storozhevykh T.P., Pinelis V.G. Neuroprotective properties of agonists of protease activated receptors.// In: «New Aspects of Biotechnology and Medicine» Eds: A M. Egorov and GE. Zaikov. NY: Nova Biomedical Books, 2007, Chapter 13, Р.121-125.
  24. Струкова С.М., Горбачева Л.Р., Сторожевых Т.П., Макарова А.М., Ишивата С. Нейропротекторные и противовоспалительные свойства агонистов рецепторов, активируемых протеиназами.// Матер. III-ей Всеросс. науч. конф. «Клиническая гемостазиология и гемореология в сердечно-сосудистой хирургии»( с международным участием), Москва(1-3 февраля), 2007, С. 231.
  25. Макарова А.М., Горбачева Л.Р., Русанова А.В., Струкова С.М. Роль рецептора PAR1 тучных клеток в противовоспалительном  действии активированного протеина С.// Матер. III-ей Всеросс. науч. конф. «Клиническая гемостазиология и гемореология в сердечно-сосудистой хирургии»(с международным участием), Москва(1-3 февраля), 2007, С. 132-133.
  26. Русанова А.В., Макарова А.М., Горбачева Л.Р., Марквичева Е.А., Струкова С.М. Протекторное действие инкапсулированного пептида-агониста рецептора тромбина(PAR1) в модели язвы желудка крыс.// Матер. III-ей Всеросс. науч. конф. «Клиническая гемостазиология и гемореология в сердечно-сосудистой хирургии» (с международным участием), Москва(1-3 февраля), 2007, С. 209-210.
  27. Горбачева Л.Р., Сторожевых Т.П., Пинелис В.Г., Струкова С.М. Активированный протеин С защищает нейроны мозга от глутаматной эксайтотоксичности.// Матер. III-ей Всеросс. науч. конф. «Клиническая гемостазиология и гемореология в сердечно-сосудистой хирургии»(с международным участием), Москва(1-3 февраля), 2007, С. 57-58.
  28. Струкова С.М., Горбачева Л.Р., Макарова А.М., Сторожевых Т.П., Пинелис В.Г., Ишивата С. Нейропротекторные и противовоспалительные функции агонистов рецепторов, активируемых протеиназами.// Матер. IV-го симпозиума «Химия протеолитических ферментов», Москва (23-25 апреля), 2007, С. 46.
  29. Горбачева Л.Р., Сторожевых Т.П., Пинелис В.Г., Струкова С.М. Активированный протеин С защищает гиппокампальные нейроны от гибели через рецепторы 1-го типа, активируемые протеиназами.// Матер. IV-го симпозиума «Химия протеолитических ферментов», Москва (23-25 апреля), 2007, С. 47.
  30. Макарова А.М., Горбачева Л.Р., Замолодчикова Т.С., Румш Л.Д., Струкова С.М. Разнонаправленное действие сериновых протеиназ – активированного протеина С и дуаденазы на тучные клетки.// Матер. IV-го симпозиума «Химия протеолитических ферментов», Москва (23-25 апреля), 2007, С. 129.
  31. Gorbacheva L., Storozhevykh T., Pinelis V., Strukova S. Neuroprotective effects of serine proteinases: thrombin, Factor Xa and activated protein C.// Abstracts of the 3rd Intern Congress ”Neuroscience for Medicine and Psychology” (Sudak, Crimea, Ukraine, June 12-20, 2007), 2007, Р. 84-85.
  32. Makarova A.M., Gorbacheva L.R., Zamolodchikova T.S., Rumsh L.D., Smirnov M., Strukova S.M. The role of PAR1 in the protective action of activated protein C in the non-immune mast cell activation.// Biomed Khim., 2007, 53(4), Р. 412-26.
  33. Strukova S.M., Gorbacheva L.R., Storojevykh T.P., Pinelis V.G. Anti-apoptotic effects of serine proteinases of hemostasis at glutamate-induced neurotoxicity.// Abs XXIst Congress of ISTH, Geneva (July 6–12), 2007, Abs P-M- 070.
  34. Makarova A., Gorbacheva L., Zamolodchikova T., Rumsh L., Smirnov M., Strukova S. Direct protective effect of activated protein C on mast cells degranulation.// Abstracts of the XXIst Congress of ISTH. Geneva (July 6–12), 2007, Abs P-M-080.
  35. румш л.д., лихарева в.в., михайлова а.г., горбачева л.р., струкова с.м. Пути реализации уникальной специфичности энтеропептидаы. Физиологическая роль  энтеропептидазы.// Матер. Междунар. конф. «Протеолиз, механизмы его регуляции и роль в физиологии и патологии клетки», Минск (25-26 октября), 2007 
  36. Gorbacheva L.R., Storozhevykh T.P., Pinelis V.G., Strukova S. Protease-activated receptor (PAR)1-mediated anti-apoptotic effect of activated protein C on glutamate excitotoxicity in hippocampal neurons.// Thromb Haemost, 2007, 98(5), Р. 1150-1152.
  37. Rumsh L.D., Likhareva V.V., Mikhailova A. G, Gorbacheva L.R., Strukova S.M. Ways of realization of high specifcity and effciency of enteropeptidase. Physiological role of enteropeptidase.// PNAS (Belarus), Ser Med Sci, 2008, N 1, Р. 31—37.
  38. Горбачева Л.Р., Сторожевых Т.П., Пинелис В.Г., Струкова С.М. Активированный протеин С через рецептор PAR1 регулирует выживаемость нейронов при глутаматной эксайтотоксичности.// Биохимия, 2008, 73(6), С. 893 – 902.
  39. Gorbacheva L., Strukova S., Pinelis V., Ishiwata Sh. and Reiser G. Activated protein C protects hippocampal neurons from thrombin-induced toxicity// Abstracts of the 5th International Symposium "Neuroprotection and Neurorepair. Focus 2008: Cerebral Ischemia and Stroke", Magdeburg, Germany, May 17-20, 2008, P.20.
  40. Gorbacheva L., Storozhevykh T., Pinelis V., Strukova S. and Reiser G. Activated protein C can protect the rat cortical and hippocampal neurons from glutamate-induced death // J Thromb Haemost., 2008, 6, Suppl. 1, P.26.





© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.