WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На  правах рукописи

    Лебедева

Ирина  Сергеевна

  НЕЙРОФИЗИОЛОГИЧЕСКИЕ МЕХАНИЗМЫ ОБРАБОТКИ

СЛУХОВОЙ ИНФОРМАЦИИ В УСЛОВИЯХ

ИЗБИРАТЕЛЬНОГО ВНИМАНИЯ В НОРМЕ И ИХ

АНОМАЛИИ ПРИ ШИЗОФРЕНИИ

 

 

03.00.13 – физиология, биологические науки

 

А в т о р е ф е р а т

диссертации  на соискание ученой степени

доктора биологических наук

  Москва 2007

Работа выполнена

в Государственном учреждении Научный центр психического здоровья  Российской академии медицинских наук

Научные консультанты

Доктор биологических наук,

профессор  Изнак Андрей Федорович

Доктор медицинских наук,

профессор Цуцульковская Мэлла Яковлевна

Официальные оппоненты

Доктор медицинских наук, профессор  Стрелец В.Б.

Доктор биологических наук Славуцкая М.В.

Доктор биологических наук Федотчев А.И.

Ведущая организация: ГУ Научный Центр неврологии РАМН

Защита состоится  «11 » февраля 2008 г. в 12 часов

На заседании диссертационного совета Д 501.001.93

МГУ им.М.В.Ломоносова по адресу 119992, г.Москва,

Ленинские горы, стр.1, кор.12, МГУ Биологический факультет, 

Аудитория М1

С диссертацией можно ознакомиться в библиотеке Биологического факультета МГУ им. М.В.Ломоносова 

Автореферат разослан  «10» января 2008 г.

Ученый секретарь

Диссертационного совета,

Доктор биологических наук Б.А.Умарова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность исследования.

Известно, что одной из основных патопсихологических характеристик такого тяжелого психического заболевания как шизофрении является нарушение когнитивных процессов, которое проявляется на всех этапах заболевания, связано с выраженностью текущей симптоматики, генетическим предрасположением к болезни и играет существенную роль в социальной адаптации больного  (Критская В.П. с соавт., 1991; Б.В.Зейгарник, 1986; Поляков Ю. Ф.., 1974; Gold J., Weinberger D., 1995).

  Перспективным подходом в исследовании когнитивных процессов является  изучение вызванных потенциалов (ВП) (Иваницкий А.М, с соавт., 1984; Гнездицкий В.В., 1997; Рутман Э.М, 1978). Проведенные исследования с использованием различных методик регистрации ВП свидетельствуют о том, что при шизофрении нарушены различные процессы обработки информации, хотя степень этих нарушений  варьировала в разных исследованиях (Стрелец В.Б., 1968;  Кирпиченко А.А., 1978;  Ogura C., с соавт. 1991;  Roth, W. с соавт. 1980). В последние годы одной из наиболее информативных методик в биологической психиатрии признана регистрация слуховых ВП в условиях избирательного внимания (парадигма oddball), которая дает возможность сопоставлять реакцию на «значимый – незначимый» стимул,  выявляя аномалии на определенных, психофизиологически детерминированных этапах обработки слуховой информации (N.Boutros с соавт., 1997;  Polich J., 1999; Костандов Э.А.с соавт., 1993).

Актуальность настоящего исследования, однако,  связана не только с изучением  параметров слуховых ВП  в парадигме избирательного внимания  (как маркеров особенностей протекания когнитивных расстройств) при шизофрении,  но и с тем фактом, что в основу работы были положены два подхода, наиболее значимых на современном этапе изучения патогенеза шизофрении.

Во-первых, это представление о том, что изучение шизофрении должно происходить в рамках болезни не как фиксированного состояния, а относительно различных этапов ее развития.  Нейрофизиологические, да и, в целом, биологические исследования в этом аспекте крайне малочисленны.

Вторым значимым аспектом проводимого исследования стал мультидисциплинарный подход, который позволяет протестировать роль выявленных нейрофизиологических аномалий относительно других процессов, протекающих в головном мозге в норме и при шизофрении, расширить представления о психофизиологической значимости тех или иных волн ВП.  Бурное развитие в последние годы структурных (МРТ) исследований, изучения молекулярно-генетических основ функционирования головного мозга, иммунологических аспектов психических болезней требует синтеза этих данных с результатами нейрофизиологических исследований с целью определения многоуровневой иерархии механизмов обеспечения функций головного мозга в норме и в патологии. Однако аналогично тому, что говорилось выше,  число работ в этой области (особенно  молекулярно-генетических и иммунологических исследований) исчисляется единицами.

Таким образом, в проведенном исследовании нейрофизиологический метод анализа особенностей когнитивной сферы дополнялся мульдисциплинарными исследованиями структурно-функциональных особенностей головного мозга, и этот подход был применен к исследованиям в психически здоровой популяции и у больных шизофренией (с анализом динамики патологических процессов на различных этапах заболевания).

Цель и основные задачи исследования.

  Настоящая работа ставила своей целью определить особенности обработки информации головным мозгом в условиях избирательного внимания (с использованием метода слуховых ВП) в норме и патологии, и вычленить те нейрофизиологические процессы,  которые наиболее тесно связаны с патогенезом шизофрении.

Сообразно вышесказанному были сформулированы следующие задачи:

1) Определение особенностей нейрофизиологических механизмов обработки слуховой информации (по данным слуховых ВП в парадигме oddball) в популяции психически здоровых людей.

2) Выявление аномалий в процессах обработки слуховой информации в условиях избирательного внимания (по данным слуховых ВП в парадигме oddball) у больных шизофренией на различных этапах заболевания.

Определение взаимосвязей между нейрофизиологическими характеристиками слуховых ВП в парадигме оddball и клиническими особенностями протекания заболевания.

3) Сопоставление характеристик процессов обработки слуховой информации  c данными о структурно-функциональных особенностях головного мозга, определяемыми методами других наук (психологическим, структурно-морфологическим, иммунологическим, молекулярно-генетическим) и выявление изменения этих взаимосвязей, вызванных болезнью.

4)  Синтез полученной информации, определение связи между нарушением механизмов обработки слуховой информации  и патогенезом шизофрении.

Основные положения, выносимые на защиту.

1. Аномалии процессов обработки слуховой информации наблюдаются на всех этапах шизофрении,  проявляются до манифестации психоза, являются динамически развивающимися, нарастающими параллельно развитию заболевания.

2. Наиболее тесно связанными с патогенезом шизофрении являются две группы процессов: первая – существующая до манифестации болезни и  ассоциируемая с редукцией волны N100 на незначимый стимул, отражает  нарушения, связанные с циклом восстановления нервного субстрата, обеспечением длительно повторяющихся процессов, может трактоваться в терминах повышенной истощаемости нервного субстрата. Эти процессы  связаны в первую очередь со слуховой корой.

  Другая группа процессов, также берущая начало до манифестации болезни,  связана с редукцией волны Р300 и отражает структурно-функциональную дефицитарность широкой сети структур мозга, в том числе височной коры (включая и верхнюю височную извилину) лимбических структур, префронтальной коры, теменной коры, базальных ганглий и других зон, вовлеченных в процессы поддержания рабочей памяти с обновлением контекста, оценки значимости поступившей информации и произведенного действия, обеспечения проводимого действия.

3. Выделенные два типа процессов характеризуются определенной динамикой относительно манифестации и развития болезни:  так,  на этапе первого психотического эпизода второй тип  значимо интенсифицировался, в то время как первый практически не усиливался.  В то же время, по мере развития болезни происходит как нарастание выраженности обеих этих процессов, так и появление новых патологических изменений. 

4. Интенсивность упомянутых выше процессов связана с показателями, определяемыми на других уровнях патогенеза, в т.ч. с иммунологическими, психологическими, структурно-морфологическими аномалиями.

5. Шизофрения приводит к качественному изменению взаимосвязей в структуре межуровневого обеспечения функционирования головного мозга.

У психически  здорового человека гиппокамп, миндалина и хвостатые ядра «включены» в процессы обработки слуховой информации в условиях избирательного внимания. Более быстрое протекание ментальных процессов ассоциируется с меньшими объемами этих структур. При шизофрении взаимосвязи между процессами обработки слуховой информации и гиппокампом и миндалиной значительно редуцированы,  при этом в противоположность тому, что наблюдается у психически здоровых людей, меньшие объемы хвостатых ядер, гиппокампа, миндалины  ассоциируются с большими отклонениями в процессах обработки слуховой информации. Также у больных отсутствуют выявленные у психически здоровых людей ассоциации между амплитудой Р300 (связываемой с процессами обновления контекста, активацией следов памяти, оценкой значимости поступающей информации и завершением ее обработки) и полиморфизмом гена COMT (связываемым с уровнем дофамина в префронтальной коре головного мозга). 

Научная новизна исследования.

Впервые на репрезентативном материале были протестированы все основные компоненты слуховых ВП в парадигме oddball  (как маркеры  этапов обработки слуховой информации) относительно различных этапов патогенеза шизофрении.

Уникальным в мировом масштабе является определение нейрофизиологических показателей, которые можно рассматривать как генетические маркеры предрасположения к шизофрении, при этом впервые было показано, что числу этих маркеров относится не только редукция амплитуды волны Р300, но также и волны N100 ВП на незначимый стимул.

  Впервые были проанализированы корреляции между особенностями протекания нейрофизиологических процессов обработки слуховой информации в условиях избирательного внимания (по данным всех компонент слуховых ВП) и характеристиками лимбических структур (гиппокамп, миндалина) и хвостатых ядер в норме и при шизофрении, а также с  рядом иммунологических и психологических характеристик. Впервые были протестированы ассоциации между полиморфизмом гена COMT и параметрами всех волн слуховых ВП в парадигме oddball.

Впервые были проведены исследования изменений параметров слуховых ВП в парадигме oddball у больных эндогенным психозом во время первого психотического эпизода с акцентом на доминирование той или иной симптоматики,  впервые в одном исследовании сопоставлялись данные о профиле изменений всех этапов процессов обработки слуховой информации (по данным слуховых ВП в парадигме oddball) при разных формах эндогенных психических заболеваниях.

Теоретическое значение

Полученные данные значительно расширяют представления о нейрофизиологическом  обеспечении обработки слуховой информации в условиях избирательного внимания, связывает отдельные этапы этой обработки с рядом морфо-функциональных особенностей головного мозга,  вносят существенный вклад в понимание нейрофизиологических механизмов, наиболее тесно связанных с патогенезом шизофрении, и механизмов текущего болезненного процесса.

Практическая значимость работы.

Результаты настоящего исследования могут быть использованы в психиатрической практике, в частности в виде параклинических маркеров состояния психически больного человека, а также при обследовании групп риска по психическим заболеваниям. Развитие подходов, использованных в данной работе, позволит использовать нейрофизиологические показатели (параметры слуховых ВП в парадигме oddball) также для целей дифференциальной диагностики и прогноза проводимого лечения.

Публикации и апробация работы.

  Результаты диссертационной работы в качестве докладов были представлены на XXVIII конференции Европейского общества по изучению генетики человека в Лондоне в 1996 г.;  на III и V региональных конференциях Европейской коллегии по нейропсихофармакологии в Афинах в 1998 г. и в Санкт-Петербурге в 2000 г.,  на региональном конгрессе по биологической психиатрии во Флоренции в 1998 г.;  на VI,VIII, X, XII Всемирных конгрессах по психиатрической генетике в Бонне в 1998 г., в Версале в 2000 г., в Брюсселе в 2002 г. в Бостоне в 2005; на XII конгрессе Европейской коллегии по нейропсихофармакологии в Лондоне в 1999 г.;  на  XI  международном конгрессе по электромиографии и клинической нейрофизиологии в Праге в 1999 г.;  на XI, XIII Всемирных конгрессах по психиатрии в Гамбурге в 1999 г., в Каире в 2005 г.; X, XI конгрессах ассоциации европейских психиатров в Праге в 2000, в Стокгольме в 2002 г.;  на XI, XIII, XVI международных конгрессах Международного общества по электромагитной топографии мозга в Франкфурте-на-Майне в 2000, в Неаполе в 2002 г. в Берне в 2005 г.;  на VIII, XIV Съездах психиатров России в Москве в 2000 г., 2005 г.; на VII, VIII Всемирном конгрессе по биологической психиатрии в Берлине в 2001 г., в Вене в 2005 г., на конференции «Аффективные и шизоаффективные расстройства» в Москве в 2003 г., на тематической конференции Всемирной психиатрической ассоциации «Диагноз в психиатрии: интеграция разных наук» в Вене в 2003 г.,  на Всероссийской научной конференции по проблеме «Пластичность и структурно-функциональная взаимосвязь коры и подкорковых образований мозга» в Москве в 2003,  на XII, XIII зимних семинарах по шизофрении в Давосе в 2004 г., 2006 г.; на VIII, X конференциях «Стресс и поведение» в Санкт-Петербурге в 2004 г., в 2007 г.;  на XIV Всероссийской конференции «Нейроиммунология» в Санкт-Петербурге в 2005 г.; на II Международной конференции национального общества нейронаук Румынии в Бухаресте в 2006 г., на I Европейской конференции по исследованию шизофрении в Дюссельдорфе в 2007 г..  на Всероссийской конференции с международным участием «Структурно-функциональные, нейрохимические и иммунохимические закономерности асимметрии и пластичности мозга» в Москве в 2007, а также были представлены в виде доклада «Нейрофизиологические аспекты шизофрении» на секции проблем эволюции материи Московского общества испытателей природы в декабре 2003 г..

Публикации:  По материалам диссертации было опубликовано 54 научных работы, список которых приводится в конце автореферата.

Объем и структура работы.

Диссертация изложена на 240 страницах машинописного текста. Работа состоит из введения, 9 глав (обзор литературы, характеристика материалов и методов исследования, 7 глав по результатам собственных исследований), заключения,  выводов и списка литературы, содержащего 394 источника (из них 50 отечественных и 344  зарубежных). Работа иллюстрирована 56  таблицами и  29 рисунками.

МАТЕРИАЛ И МЕТОДЫ ИССЛЕДОВАНИЯ

Объект исследования

  Выборка психически здоровых испытуемых включала 90 человек в возрасте от 18 до 68 лет. Выборка психически больных включала 193  больных с разными формами эндогенного заболевания в возрасте 18-65 лет,  находящихся на лечении или проходящих консультативное обследование в клинике НЦПЗ РАМН или в Московской ГКПБ N 1 им.Н.Алексеева. У 126 человек была диагносцирована шизофрения (рубрика  F20 по МКБ-10), с параноидной и приступообразной формами течения болезни. У  21  человека  было диагносцировано шизотипическое расстройство или малопрогредиентная шизофрения (рубрика  F21 по МКБ-10),  у 28 человек - шизоаффективный психоз (F25 по МКБ-10), у 18 больных - аффективное расстройство (рубрики F31-33 по МКБ-10, все эти больные поступили в клинику с депрессивным состоянием различной степени выраженности).

  Третья выборка включала непораженных родственников (первой степени родства) больных. Она состояла из  104  родителя больных  (38-65 год),  22 сибса (17-45 лет), 7 детей больных (19-30 лет).

  Обследование испытуемых и клинический анализ проводили сотрудники НЦПЗ РАМН д.м.н. Абрамова Л.И,,  д.м.н. Каледа В.Г, к.м.н. Бархатова А.Н., Омельченко М.А,. д.м.н. Орлова В.А., к.м.н.Воскресенская Н.И.

Критериями включения для всех испытуемых являлись 1) отсутствие нарушений слуха, 2) отсутствие в анамнезе тяжелых соматических и неврологических заболеваний, ЧМТ с потерей сознания более 5 минут,

3) отсутствие в анамнезе алкогольной или наркотической зависимости,

4) праворукость.

Регистрация слуховых вызванных потенциалов

  Регистрация слуховых вызванных потенциалов проводилась в стандартной парадигме oddball с вероятностью  предъявления  целевого стимула (тон, частота 2 кГц, интенсивность 60 дБ) -  0.2 и нецелевого (тон, частота  1 кГц, интенсивность 60 дБ) -  0.8. Общее число целевых стимулов составляло 30,  они  подавались бинаурально, с частотой раз в две секунды,  межстимульный интервал варьировал в диапазоне 20%. Престимульный интервал составлял 60 мс.

Испытуемые находились  в положении полулежа или сидя, с закрытыми глазами,  им давалась инструкция как можно быстрее нажимать  большим пальцем правой руки на кнопку на предъявление  целевого стимула и пропускать нецелевые.

  ЭЭГ регистрировали на  электроэнцефалографе Эра-18 (Италия) в 16 отведениях с референтными ипсилатеральными ушными электродами, ВП регистрировались на системе картирования  Brain Atlas (Bio-logic, США). Эпоха анализа составляла 512 мсек, включая 60 мсек престимульный интервал. Во время записи автоматически выделялись и вырезались артефакты (отклонения более 100 мкВ). Обработка и выделение ВП проводилась системой картирования в автоматическом режиме по всем предъявленным стимулам.

Записанные файлы переводились в т.н. ascII форму и обрабатывались на РС. С помощью специальной программы для визуализации ВП на РС,  предоставленной  Шараевым Г.В. (1994)  проводилась автоматическая коррекция значений относительно престимульного интервала (суммация с последующим усреднением величин для периода престимульного интервала, всего 30 значений, с последующим вычитанием получившихся величин из значений для оставшегося временного интервала). Затем вручную проводилась маркировка пиков волн ВП с последующим автоматическим  обсчетом пиковых латентностей и амплитуд компонентов.

В ВП на незначимые стимулы выделялись пики N100 и Р200. Первый определялся как доминирующая негативная волна в интервале 80-160 мс, второй - как первая после N100 доминирующая позитивная волна в интервале 160-280 мс. В ВП на значимые стимулы выделялись пики N100, N200 и P300. Критерий выделения первого компонента был аналогичен тому, который использовался для анализа ВП на незначимые стимулы. Компонент N200 определялся как максимальная негативная волна (после компонента N100) в условном интервале 180-290 мс. Компонент Р300 выделялся как наибольшая позитивная волна в интервале 280-450 мс. Для каждого компонента ВП в отведениях F7,F3, F4, F8,T3, C3, CZ, C4, T4, P3, PZ, P4 определялись пиковые латентности и амплитуды. В случае, если запись была загрязнена артефактами или искомый компонент не выделялся,  делался пропуск, который затем учитывался путем исключения данного параметра из статистического анализа.

Статистический анализ данных проводился с помощью программ из пакета статистических программ SPSS10.0.  Для решения различных задач в отдельных главах были использованы разные выборки испытуемых и различные методы статистического анализа. 

  Особенности материала и методов, использованных для решения отдельных задач

I. Изучение компонентов слуховых ВП в парадигме oddball в популяции психически здоровых испытуемых проводили в группе психически здоровых испытуемых, состоящей из 56 человек (18-45 лет, ср. возраст 26.5+-6.8 лет;  23 мужчины и 33 женщины).

II.  Для выявления аномалий параметров слуховых ВП при шизофрении была выбрана группа из 68 больных (рубрики F20.00, F20.01, F20.02, F20.03, F20.09, F20.22, F20.29  по МКБ-10).  Группа включала 35 мужчин и 33 женщины,  возраст 18-45 лет, ср.возраст 26,0+-6.4 лет, длительность заболевания после манифестации составляла в среднем 3.3+-3.5 лет. Регистрация ВП осуществлялась незадолго до выписки из клиники, на фоне значительного редуцирования психопатологической симптоматики, больные были в стабилизированном состоянии, близком к ремиссии.

  Для сравнения с больными из выборки психически здоровых испытуемых была подобрана по возрасту и полу группа  контроля (48 человек, 21 мужчина, 27 женщин, ср.возраст 26,7+-6.9 лет).

III. Для определения нозологической специфичности аномалий ВП были обследованы группы больных с разной нозологией. На первом этапе обследовались 18 больных с аффективными расстройствами  (рубрики F31-33, 10 женщин, 8 мужчин, в возрасте 17-45 лет (ср. возраст  28.8+-8.1  лет)), 18 больных шизофренией (рубрики F20.00, F20.01, F20.02 и F20.03 по МКБ-10, 9 женщин и 9 мужчин, в возрасте 18-46 лет (ср.возраст  26.3+-8.8  лет)), контрольная группа психически здоровых испытуемых состояла из 9 женщин, 9 мужчин в возрасте 18-45 лет (средний возраст 28,3+-8,3 лет).





На втором этапе обследовались группа больных шизоаффективным психозом (17 мужчин, возраст 17-39 лет, ср.возраст 24.3+-6.5 лет),  больных  шизотипическим расстройством (17 мужчин, возраст 17-40 лет, ср.возраст 25.4+-6.3 лет), контрольная группа психически здоровых людей включала 17 мужчин (возраст 18-38 лет, ср. возраст  24.5+-6.3 лет). 

IV. Анализ корреляций между аномалиями параметров ВП и клиническими характеристиками состояния больного проводился в двух выборках больных. Первая состояла из 27 больных (18 мужчин, 9 женщин, средний возраст 28.3+-7.5 лет).  Оценка выраженности позитивных и негативных психопатологических расстройств проводилась согласно градации тяжести расстройств психической деятельности А.А.Снежневского. (Снежневский А.В. 1983) Уровни позитивной и негативной симптоматики оценивались на день нейрофизиологического обследования.

  Вторая выборка включала 14 больных мужчин (18-29 лет, ср. возраст 24.1+-5.3 лет). Все больные были первично обследованы на 1й-10ый день после поступления в стационар, т.е. в период выраженных психопатологических явлений. Повторное клиническое и нейрофизиологическое обследование проводилось у больных незадолго перед выпиской из клиники на фоне значительного улучшения психического состояния. Состояние больного оценивалось по шкале PANSS, для анализа была выбрана суммарная оценка по субшкале позитивных симптомов, а также общее количество балов по шкале PANSS. 

V. Для изучения аномалий слуховых ВП в парадигме oddball в выборке больных эндогенным психозом, госпитализированных с первым психотическим приступом была сформирована группа из 68 больных в том числе приступообразной формой шизофрении (F 20 по МКБ-10) и  шизоаффективным психозом (F25) мужского пола  юношеского возраста (17-25 лет) госпитализированных с первым психотическим  приступом. Группа была разделена на подгруппы с преобладанием кататонической симптоматики (22 чел., ср.возраст 21.1+-2.1); с преобладанием галлюцинаторно-бредовой симптоматики (22 чел., 20.9+-2.3); с преобладанием  аффективно-бредовой симптоматики (24 чел., 21.9+-2.1). Группа контроля включала 15 психически здоровых мужчин в возрасте 17-25 лет (ср.возраст 21.3+-2.7 лет).

VI. Для определения взаимосвязей между выявленными аномалиями слуховых ВП в парадигме oddball у больных шизофренией и отклонениями, выявленными методами других наук, в том числе психологическими, структурно-морфологическими и иммунологическими были сформированы несколько выборок испытуемых.

1)  Определение корреляции между нейрофизиологическими показателями обработки слуховой информации и патопсихологическими характеристиками внимания

  Исследование проводилось в рамках совместной работы с отделом по изучению состояния риска функциональных психических расстройств  НЦПЗ РАМН (психологическое обследование проводила к.п.н. Савина Т.Д.)

  Группу больных шизофренией  составляли  18 человек (7 женщин, 11 мужчин, возраст 20-29 лет, ср возраст  25.7+-4.0 лет), группа психически здоровых испытуемых включала 13 человек (8 женщин, 5 мужчин,  возраст 20-29 лет, ср возраст  25.6+-3.2).

Психологическое и электроэнцефалографическое исследования проводились в один и тот же день.  Психологическое обследование включало  определение особенностей внимания с использованием методик «парных цифр» Ш.Виттенборна,  «сложения однозначных чисел», «поиска зашумленных слов».  По результатам тестирования для каждого испытуемого определялись показатели объема, переключаемости, устойчивости внимания, характеристик внимания в условиях длительного сосредоточения и непроизвольного внимания (Савина Т.Д., 1980, 1982). 

2) Определение корреляции между нейрофизиологическими показателями обработки слуховой информации и данными о структурной патологии мозга

А)  Первый фрагмент исследований проводился в рамках совместной работы с отделением  лучевых и компьютерно-томографических исследований НЦПЗ РАМН (анализ данных проводился руководителем отдела к.м.н Савватеевой Н.Ю.). 

  Была обследована группа из 12 больных шизофренией  (7 женщин, 5 мужчин) в возрасте 18-65 лет (ср. возраст  34,6+-14,6 лет) . 

КТ-обследование проводили на аппарате "Somatom-CR" фирмы «Сименс» (Германия), поперечными сечениями шириной 4 и 8 мм в аксиальной проекции. МРТ-обследование проводили на аппарате 0.12 Т «Образ-1» (Россия) в режиме спин- и мультиэхо.  Исследование проводилось в аксиальной плоскости срезами шириной 8 мм.  Совпадение морфометрических данных, получаемых при использовании данных томографов было предварительно показано на материале одних и тех же семей, обследованных как на одном, так и на другом аппарате (Орлова В.А.с соавт., 1999). Для каждого испытуемого рассчитывались ширина переднего рога в области головки хвостатого ядра, ширина центрального отдела, ширина заднего рога боковых желудочков головного мозга. 

Б) Второй фрагмент исследований проводился в рамках совместной работы с Учебно-научным Межфакультетским и Междисциплинарным Центром Магнитной Томографии и Спектроскопии МГУ им. М.В. Ломоносова.  (МРТ обследование и анализ данных проводилось под руководством д.м.н., профессора Губского Л.В., в обследовании испытуемых участвовал Куприянов Д.А., анализ полученных изображений осуществлялся Воронковой Ю.А.)

  Выборка испытуемых включала 12 больных приступообразной шизофренией (9 мужчин, 3 женщины, возраст 18-44, ср.возраст 25,7+- 7,2 года) и 16 психически здоровых испытуемых (11 женщин, 5 мужчин, возраст 19-56, ср. возраст 38,3+-12,4 года.

МР-томография производилась на магнитно-резонансном томографе Tomikon S50 (BRUKER) с индукцией магнитного поля 0.5 Тесла. Исследование включало получение Т1-взвешенных изображений головного мозга  в косой корональной проекции с помощью градиентной трехмерной методики высокого разрешения SP GEFI 3D (TR=26.5 мс, TE=7 мс, толщина среза 3 мм, flip angle 35o, NEX - 4, размер воксела 0.625х0.625х3 мм). Модификация исходной импульсной последовательности SP GEFI 3D, реализованная на томографе Tomikon S50, была усовершенствована сотрудниками ЦМТС МГУ и адаптирована специально для исследований парагиппокампальной и гиппокампальной областей таким образом, чтобы получать Т1-взвешенные изображения высокого пространственного разрешения с максимальным контрастом серого и белого вещества мозга.

При настройке протокола сканирования пакет (или исследуемый объем) задавался таким образом, чтобы охватить весь головной мозг в косой корональной проекции, перпендикулярной длинной оси гиппокампов. Благодаря высокому соотношению сигнал/шум,  пространственной согласованности срезов и их малой толщине, позволяющей снизить влияние эффекта усреднения на результаты измерений, данная серия срезов использовалась для оценки объемов вышеуказанных структур мозга. Полученные серии изображений обрабатывались одним и тем же исследователем на рабочей станции SGI Indy MR-Station (Silicon Graphics Inc., USA) с помощью программного пакета ParaVision, входящего в стандартное обеспечение томографа.

Из предварительно обработанных серий изображений в программном пакете для работы с медицинскими изображениями OSIRIS версия 4.12, создавались пакеты срезов, содержащие исследуемые структуры. Дальнейшим этапом работы была сегментация анатомических образований, объемы которых измерялись. Использовался метод ручной сегментации. Производилось измерение абсолютных объемов левого и правого гиппокампа, объёмов левого и правого хвостатого ядра, объёмов левой и правой миндалины.

3) Определение корреляции между нейрофизиологическими показателями обработки слуховой информации и иммунологическими показателями

  Данное исследование проводилось как совместная работа с лабораторией молекулярной биохимии (иммунологический анализ проводился под руководством  д.б.н. Клюшник Т.П. с участием д.м.н Щербаковой И.В.). Анализировался показатель активации врожденного иммунитета - активность лейкоцитарной эластазы - протеолитического фермента и маркера дегрануляционной активности нейтрофилов.  Также определялся  уровень аутоантител к фактору роста нервов -  характеристики приобретенного иммунитета.

Были обследованы 18 больных шизофренией мужчин (F20 по МКБ-10), 18 - 25 лет (ср.возраст  21.4+-2.6 года). Больные обследовались однократно после поступления в клинику,  в состоянии обострения.  Состояние больного оценивалось по шкале PANSS.  Контрольную группу составили психически здоровые испытуемые - 16 человек (3 мужчин, 13 женщин), в возрасте 18-44 года (ср. возраст 27.3±7.9  лет).  Дополнительными критериями исключения для всех обследуемых в этом фрагменте работы являлись острые и хронические инфекционные, воспалительные, аутоиммунные заболевания,  онкологические заболевания.

         Материалом иммунологического анализа явилась сыворотка периферической крови. Кровь отбирали в микропробирки и после образования кровяного сгустка центрифугировали для получения сыворотки при 2500-3000 об/мин в течение 15-20 мин. Сыворотку замораживали и хранили до анализа при t = - 20є C 1-3 недели. Активность ЛЭ определяли модифицированным спектрофотометрическим энзиматическим методом с применением специфического субстрата N-BOC-Ala-ONp и оценивали в нмол/мин·мл (Доценко В.Л. с соавт., 1994). Уровень аутоантител к фактору роста нервов (ФРН) определяли с использованием твердофазного иммуноферментного анализа и оценивали в единицах оптической плотности (Е).(Клюшник Т.П., 1997).     

VII. Обследования родственников первой степени родства проводили в нескольких выборках, в том числе в выборках 15 родителей больных (7 женщин,8 мужчин  30-65 лет, ср.возраст 51.8+-10.8 лет), 15 сибсов и детей больных шизофренией или шизоаффективным психозом (7 женщин,8 мужчин, 17-35 лет,  ср.возраст 24.9+-4.7 года),  контрольная группа включала две подгруппы (7 женщин,8 мужчин в каждой): 30-68 лет (ср.возраст 49.3+-11.9 лет)  и 18-38 лет (26.0+-7.0 лет). Также обследовалась другая выборка из 52  психически здоровых родителя больных шизофренией (22 мужчин, 30 женщин, ср.возраст 50.6+-7.9 лет) и 22 психически здоровых испытуемых (ср.возраст 48.7+-10.7, 9 мужчин, 13 женщин). На последнем этапе обследовали психически здоровых родителей из семей с т.н. «спорадическими» случаями  (всего обследовано 40 человек, 19 мужчин, 21 женщина, возраст 40-65 лет (ср.возраст 51.7+-7.2 лет)), и психически здоровых людей из 22 семьей (всего обследовано 22 человека, 12 мужчин, 10 женщин, возраст 40-66 лет (ср.возраст 50.7+-7.6 лет), где  другой  родитель был диагносцирован как больной приступообразной шизофренией,  вялотекущей шизофренией, аффективным расстройством или являлся родственником первой или второй степени родства больному шизофренией.  Контроль в этом фрагменте работы включал психически здоровых испытуемых из семей без случаев психической патологии (22 человека, 9 мужчин, 13 женщин, возраст 36-65 лет, ср. возраст 49.5+-7.8 лет)

VIII. Выявление ассоциаций между полиморфизмом гена COMT и особенностями волн слуховых ВП в парадигме oddball  проводилось в рамках совместной работы с лабораторией клинической генетики НЦПЗ РАМН (работа проводилась сотрудниками лаборатории под руководством заведующей д.б.н.Голимбет В.Е.). Была проанализирована выборка больных из 64 человек больных шизофренией и шизоаффективным психозом (28 мужчин, 36 женщин, возраст 18-44 лет). Группа контроля включала в себя 72 психически здоровых родственников больных с разными эндогенными психическими заболеваниями,  36 мужчин и 36 женщин, возраст 17-60 лет, средний возраст 45,58±12,14 лет, из них родителей пробандов - 54 человек, сибсов – 18 человек.

  Молекулярно-генетическое исследование предусматривало отбор венозной крови больных, выделение ДНК с применением очистки фенолом и хлороформом и генотипирование с использованием полимеразной цепной реакции (ПЦР).

  При генотипировании СОМТ денатурацию проводили в течение 5 минут при 95oC, далее следовали 30 циклов амплификации (95oC – 30 сек;  55oC - 30 сек; 72oC – 30 сек). На заключительной стадии образцы прогревали при 72oC 5 мин. Полиморфные участки генов выявляли на анализаторе ДНК ABI Prism 310 по методике и с реагентами  набора «SnaPshot ddNTP Primer Extention Kit». Использовались следующие праймеры для амплификации и выявления полиморфизма: ACTGTGGCTACTCAGCTGТG

CCTTTTTCCAGGTCTGACAA и TGCACACCTTGTCCTTCA.

РЕЗУЛЬТАТЫ  ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ

1. ОСОБЕННОСТИ ПРОЦЕССОВ ОБРАБОТКИ СЛУХОВОЙ ИНФОРМАЦИИ В ПОПУЛЯЦИИ ПСИХИЧЕСКИ ЗДОРОВЫХ ЛЮДЕЙ

Согласно результатам проведенного исследования влияния на нейрофизиологические характеристики таких факторов как пол и возраст, было показано, что в психически здоровой популяции этапы обработки «незначимой» слуховой информации (отражающиеся в компонентах N100, Р200) являются процессами со слабой зависимостью от возраста, с малой вариабельностью локализации фокуса компонентов, вместе с тем, были получены свидетельства более раннего нарастания процессов оттормаживания «незначимой» слуховой информации у женщин. 

Процессы обработки «значимой» информации слабо зависит от пола, однако, с возрастом по мере старения выявляется снижение амплитуды начальных этапов обработки информации (N100) и позднего когнитивного потенциала (P300). Первое, вероятно, отражает ухудшение в процессах формирования следа памяти, а редукция активности на поздних этапах обработки слуховой информации, может быть вызвана отклонениями в  процессах, ассоциируемых с поддержанием рабочей памяти (когда происходит обновление умственной модели окружения), с выделением ресурсов внимания и др. Причиной подобных возрастных изменений очевидно является нарастание аномалий в соответствующем нейрональном субстрате (возрастные изменения в период от юношеского возраста до пожилого возраста в виде снижения объемов ряда структур, в т.ч. включая гиппокамп, префронтальную кору (Raz N с соавт., 1997; Allen J. с соавт., 2005), редукции белого вещества фронтальных и височных долей (Brickman A. с соавт., 2006) описаны рядом авторов,  хотя возрастных изменений в объеме передней поясной извилины при этом обнаружено не было (Raz N с соавт., 1997). 

  Таким образом,  в норме,  процессы обеспечения обработки «значимой» информации протекают сходным образом у мужчин и женщин, однако, отчетливо претерпевают изменения (редукция активности, десинхронизация) с возрастом, при этом минимальное влияние испытывают промежуточные этапы, связанные с классификацией стимулов и обеспечением двигательной реакции.

2.  ОСОБЕННОСТИ ПРОЦЕССОВ ОБРАБОТКИ СЛУХОВОЙ ИНФОРМАЦИИ У БОЛЬНЫХ ШИЗОФРЕНИЕЙ

  2.1 Анализ отклонений в параметрах слуховых ВП в парадигме oddball на разных этапах развития заболевания

2.1.1. Исследования в группах непораженных родственников больных шизофренией

  Проведенные исследования позволили выделить у непораженных родственников  первой степени родства больных шизофренией ряд отклонений в параметрах слуховых ВП в парадигме oddball (см Таблица 2).

Анализ соответствия полученных результатов критериям т.н. «эндофенотипов» (связь с заболеванием, наследование,  слабая зависимость от состояния больного; обнаружение у непораженных членов семей в большей пропорции, чем в общей популяции (Gottesman I.I., Gould T.D., 2003)) и синтез данных с исследованиями других авторов (Blackwood D.H.R. с соавт., 1991; Price, G.W.с соавт., 2006;  Almasy L. с соавт. 1999; O’Connor S. с соавт. 1994) позволили предположить, что редукция биоэлектрической активности в диапазоне N100 на незначимый стимул и диапазоне Р300 является маркером предрасположения к шизофрении, испытывающим значительное влияние генетических факторов и  может быть выявлена у будущих больных еще до манифестации заболевания. Следует отметить, что снижение амплитуды Р300 у родственников первой степени родства удалось выявить только при выделении в выборке испытуемых с более высокой вероятностью «носительства» патологических генов (родители из семей с т.н. «спорадическими» случаями  заболевания). При этом замедление волны Р300 испытывает на себе как генетические, так и средовые влияния, и не может быть однозначно отнесено к маркерам предрасположения.

Таблица  2.  Результаты сопоставления параметров слуховых ВП в парадигме oddball в трех выборках родственников первой степени родства больных шизофренией с подобранными по возрасту и полу выборками психически здоровых испытуемых из семей без отягощения по эндогенным психическим заболеваниям.

Компоненты

Выборка 1

Выборка 2

Выборка 3

Родители (15 чел)

Сибсы и дети больных(15 чел)

Родители (52 чел)

Родители (40 чел), семьи со спорадическими случаями заболевания

Родители (22 чел), семьи, где второй родитель болен или родственник больного

N100 незнач.

Амп.снижена

Не изменен

.Амп.снижена

Амп.снижена

Не изменен

P200

Амп.снижена

Не изменен

Не тестир.

Не изменен

Не изменен

N100 знач

Не изменен

ЛП увеличен

Не тестир.

Не изменено

Не изменен

N200

ЛП увеличен

ЛП увеличен

ЛП увеличен

Не изменен

Не изменен

P300

Не изменен

ЛП увеличен

ЛП увеличен

Амп.снижена, ЛП увеличен

ЛП увеличен

Примечание: Выделение зеленым цветом при меньших, чем в контроле,  величинах тестируемого показателя, желтым – при больших, чем в контроле показателях

2.1.2. Анализ параметров слуховых ВП у больных эндогенным психозом во время первого психотического эпизода

Обследование больных во время первого психотического эпизода показало наличие значимых отклонений у больных по сравнению с данными у психически здорового контроля (см рис. 1 )

Рис.1. Топография статистически (p<0.05) значимых различий между подгруппами больных эндогенным психозом во время первого психотического эпизода и группой контроля для  отдельных компонентов слуховых ВП в парадигме oddball.  Рис.А  - данные для волн N100 и Р200 ВП на незначимый стимул (обозначения соответствующих компонентов ВП слева), рис.Б – данные для волн N100,  N200, Р300 ВП на значимый стимул (обозначения соответствующих компонентов слева). 

  А

Б

Примечание: Данные сгруппированы отдельно для латентных периодов и амплитуд соответствующих компонентов ВП и отдельно для подгрупп больных (1 подгруппа – с доминированием  кататонических расстройств, 2 – с доминированием галлюцинаторно-бредовых расстройств, 3 – аффективно-бредовых расстройств). На стандартном схематическом изображении головы отведение ЭЭГ обозначалось точкой, если различия между тестируемой группой и контролем достигали уровня значимости (p<0.05).

  Очевидно, что аномалии в процессах обработки слуховой информации, которые, как предполагается, существуют до манифестации болезни, сохраняются (снижение амплитуды N100 на незначимый стимул) и  даже усиливаются (снижение амплитуды Р300, увеличение ее ЛП) во время первого психотического эпизода. Независимо от доминирования той или иной симптоматики, у всех больных также  обнаруживается снижение амплитуды волны N100 на значимые стимулы  (уровня достоверности оно достигает преимущественно в височных отведениях).  Таким образом,  при переходе барьера здоровье-болезнь, появляются и иные патологические процессы связанные со слуховой корой – наиболее вероятной причиной является расширении зоны поражения, не исключены также нарушения в проекциях к лимбическим структурам, а также фронтальной коре. Нельзя исключить, что на нейрофизиологическом уровне это проявляется в редукции т.н. негативности рассогласования (MMN) – связываемой с процессами автоматического сопоставления поступающих звуков со следом памяти. Так, было показано, что на момент первого психотического эпизода амплитуда MMN коррелирует с объемом серого вещества в зоне Гешля (Salisbury DF с соавт., 2007), и редуцирована у больных шизофренией (Oades R. с соавт., 2006).

В то же время ряд нейрофизиологических изменений в обследованных подгруппах больных был связан с доминированием той или иной психопатологической симптоматики: нарастание максимума волны N200 было достоверно замедлено у больных с доминированием кататонической симптоматики и отсутствовало у больных с  аффективно-бредовой симптоматикой, что предполагает сохранность процессов классификации стимула в последней группе.  В группе больных с первым психотическим приступом с преобладанием галлюцинаторно-бредовой симптоматикой не выявлялось изменений волны Р200, что предполагает относительную сохранность в этой группе процессов оттормаживания незначимого стимула, по крайней мере на начальном этапе болезни. 

2.1.3.  Анализ аномалий слуховых ВП в парадигме oddball у больных с длительностью заболевания после манифестации несколько лет.

  Обследование больных с длительностью заболевания после манифестации несколько лет обнаружило выраженные аномалии нейрофизиологических характеристик  (см рис 2). 

Рис. 2.  Слуховые ВП в парадигме oddball на незначимый (А) и значимый (Б) стимул в разных отведениях (обозначение отведения слева) в группе больных шизофренией (цветные кривые) и психически здорового контроля (черные кривые). Результаты межгруппового сравнения указаны около соответств.  волны и обозначены А, если достоверные (p<0.05) различия обнаруживались по амплитуде, и ЛП – если по латентности.

А.

Б.

  Как видно из рисунка,  отклонения выявлялись на всех этапах обработки слуховой информации: была обнаружена редукция биоэлектрической активности всех компонентов ВП (кроме волны N200), а также замедление поздних  когнитивных потенциалов (N200, Р300).  Подобные обширные нейрофизиологические отклонения,  очевидно,  отражают нарастающие по мере развития заболевания  патологические процессы в головном мозге (в литературе для их описания часто используется термин «нейродегенеративные процессы» (Csernansky J., 2007)).

2.2. Влияние на выявленные аномалии слуховых ВП в парадигме oddball клинического состояния больного,  специфичность найденных отклонений  нейрофизиологических показателей в нозологически различных группах больных

При динамическом наблюдении больных шизофренией (оценивалась разница между вторым и первым обследованиями) был обнаружено, что чем больше снижались общие суммарные баллы по шкале PANSS ко второму исследованию, тем больше уменьшался ЛП N100 на незначимый стимул (отведение P4, r=0.56) , уменьшался ЛП Р200 (Cz, r=0.6),  тем больше нарастала амплитуда N100 на незначимый стимул (T4(r=-0.6), Р4 (r=-0.58)), больше снижалась амплитуда N200 (F3(r=0.9)). Чем больше снижались суммарные баллы по субшкале позитивных расстройств, тем больше уменьшался ЛП N100 на незначимый стимул (Pz (r=0.57)), больше нарастал ЛП N100 на значимый стимул (T3(r=-0.7)), больше нарастала амплитуда Р300 (F3 (r=-0.7), C3 (r=-0.55), P3 (r=-0.56)). Таким образом, улучшение клинического состояния (оцениваемое по динамике показателей шкалы PANSS) сопровождается «нормализацией» нейрофизиологических показателей, следует также отметить, что эта закономерность была выражена в максимальной степени для волн N100 на незначимый стимул и Р300.

При этом, первый нейрофизиологический показатель больше зависит от общей клинической оценки состояния больного (по шкале PANSS), в то время как динамика амплитуды Р300 ассоциируется преимущественно с выраженностью позитивной симптоматики (оцениваемой по той же шкале).

При сравнении параметров слуховых ВП в парадигме oddball у психически больных из нозологически разных групп были обнаружены отклонения нейрофизиологических показателей (см Таблица  3).

Таблица  3. Результаты статистического сравнения нейрофизиологических параметров слуховых ВП в парадигме oddball в группах больных с различной нозологией (в скобках шифр по МКБ-10) относительно данных у психически здоровых испытуемых

Нозологические группы

Шизофрения

(F20)

N=18

Шизоаффективный психоз

(F25)

N=17

Шизотипические расстройства

(F21)

N=17

Аффективные расстройства

(F31-33)

N=18

Компоненты ВП в парадигме oddball

N100 незнач

АМП

Снижена

Снижена

Снижена

Снижена

ЛП

Не изменен

Не изменен

Не изменен

Не изменен

P200

АМП

Не изменена в данной выборке1

Снижена

Снижена

Не изменена

ЛП

Не изменен

Не изменен

Снижен

Увеличен

N100 знач 

АМП

Не изменена в данной выборке2

Снижена

Снижена

Не изменена

ЛП

Не изменен

Не изменен

Не изменен

Увеличен

N200

АМП

Не изменена

Не изменена

Не изменена

Не изменена

ЛП

Увеличен

Не изменен

Увеличен

Увеличен

Р300

АМП

Снижена

Снижена

Не изменена

Не изменена

ЛП

Увеличен

Увеличен

Увеличен

Увеличен

Примечание: Выделение зеленым цветом при меньших, чем в контроле,  величинах тестируемого показателя, желтым – при больших, чем в контроле показателях

  Общим для всех тестируемых групп являлась редукция волны N100 ВП на незначимые стимулы и увеличение латентного периода волны Р300. Одновременно,  при аффективных расстройствах регистрировалось замедление всех этапов обработки слуховой информации без аномалий амплитудных показателей (за исключением вышеупомянутой волны N100 на незначимые стимулы), что предполагает минимальное нарушение функций обработки слуховой информации. Также относительно слабо выраженными были аномалии в группе с шизотипическим расстройством (где наблюдалось лишь замедление поздних «когнитивных» этапов без изменения их амплитудных параметров).  В то же время в группе больных с шизоаффективным психозом отклонения параметров слуховых ВП были максимально близки к тем, что регистрируются при шизофрении за исключением волны N200 (ассоциируемой с процессами классификации стимула и обеспечения реакции).

 

3.  АНАЛИЗ ВЗАИМОСВЯЗЕЙ МЕЖДУ ОСОБЕННОСТЯМИ ПРОЦЕССОВ ОБРАБОТКИ СЛУХОВОЙ ИНФОРМАЦИИ И СТРУКТУРНО-ФУНКЦИОНАЛЬНЫМИ ХАРАКТЕРИСТИКАМИ ГОЛОВНОГО МОЗГА, ОПРЕДЕЛЕННЫМИ МЕТОДАМИ ДРУГИХ НАУК, В НОРМЕ И ПРИ ШИЗОФРЕНИИ

  3.1. Корреляции между параметрами слуховых  ВП в парадигме oddball и характеристиками ряда структур мозга

В психически здоровой популяции для механизмов, обеспечивающих обработку слуховой информации, была обнаружена зависимость от объема ряда лимбических и подкорковых структур. Более быстрое протекание ментальных процессов на всех этапах обработки слуховой информации (за исключением диапазонов Р200  и N100 ВП на значимый стимул) ассоциировалось с меньшими объемами гиппокампа и миндалины, а для латентного периода волн на поздних когнитивных этапах (N200, P300)  – еще и с меньшими объемами хвостатых ядер в левом полушарии. При этом амплитуда волн Р200 и N100 на значимый стимул коррелировала с объемом гиппокампа (с обратной зависимостью в первом случае и с положительным знаком – во втором).  Выявленные взаимосвязи предполагают «включенность» данных структур в соответствующие нейрофизиологические процессы. Наиболее вероятная причина данного феномена определяется меньшей длиной проводящих путей, однако для этапов оттормаживания незначимого стимула (компонент Р200) и оценки физических параметров значимого стимула и формирования первичного следа памяти (компонент N100 на значимый стимул) очевиден более комплексный механизм взаимодействия, с преимущественным включением лимбических структур одного из полушарий.

При шизофрении достоверные корреляции с параметрами гиппокампа и миндалины выявлялись в значительно  меньшей степени (прямые корреляции обнаруживались только с амплитудами волн Р200 и N200) , что может быть связано с вызванным болезнью искажением взаимосвязей, свойственных «нормальному» мозгу.

Большим объемам хвостатых ядер у больных шизофренией соответствовали большие амплитуды компонентов P200, P300 и меньшие амплитуды компонентов N100 на значимые стимулы, N200,  т.е. меньшие аномалии  нейрофизиологических характеристик (особенно тех, что связаны с процессами оттормаживания «ненужной» информации, оценкой значимости стимула, обновления информации, хранящейся в памяти).  В контексте данных о структурных аномалиях при шизофрении (Harrison P.J., 2000; Tauscher-Wisniewski S. с соавт. 2002; S. Heckers,  1997) большие объемы хвостатых ядер могут трактоваться как следствие меньших атрофических процессов в этих структурах  и\или результат большего влияния  фармакотерапии нейролептиками и\или результат неких компенсаторных реакций, что по сути предполагает большую «нормальность» процессов, вовлекающих хвостатые ядра. 

Большей ширине боковых желудочков соответствовали меньшие амплитуды Р200 и большие ЛП этого компонента, меньшие амплитуды N200 в лобных и передневисочных отделах и большие амплитуды этой волны в центро-теменных зонах,  меньшие амплитуды и большие ЛП Р300. Известно, что расширение боковых желудочков (БЖ) мозга  относится к одним из наиболее часто встречающихся структурных аномалий при шизофрении (Pearlson G., Marsh L., 1999). Обнаруженная межуровневая сопряженность является следствием того, что часть генераторов упомянутых выше волн находится в ряде подкорковых структур (McCarley R. с соавт. 1989; Egan M. с соавт., 1994; Kiehl K., Liddle P., 2001), а расширение боковых желудочков связывают с атрофическими процессами  в том числе в этих областях (DeLisi L., 1999). 

  3.2.  Корреляции между параметрами слуховых  ВП в парадигме oddball и характеристиками внимания

  Для параметров слуховых ВП в парадигме oddball в психически здоровой популяции значимые взаимосвязи с характеристиками внимания были выражены только для волны Р300 и проявлялись в виде замедления данного компонента у испытуемых с более выраженными нарушениями  переключаемости внимания и непроизвольного внимания, параметрами внимания в условиях длительного сосредоточения. Учитывая, что используемые психологические методики вовлекают зрительную модальность, можно сделать вывод, что процессы поддержания внимания в этом случае перекрываются  с нейрофизиологическими процессами обработки слуховой информации только на поздних этапах, относящихся к временному диапазону после 270 мсек от момента предъявления стимула. 

  В группе больных отмечались значимые  корреляции с параметрами  всех компонентов ВП, в частности,  большие нарушения объема внимания ассоциировались с меньшими амплитудами N100 ВП на незначимый стимул, Р200, N200, Р300, большие отклонения устойчивости внимания были связаны с  меньшей амплитудой N100 ВП на незначимый стимул, амплитудой Р200, амплитудой Р300, аномалии в характеристиках непроизвольного внимания коррелировали с меньшей амплитудой N100 ВП на незначимый стимул, амплитудой N200. 

Выраженные межуровневые корреляции в группе больных и незначительное число подобных взаимосвязей в группе психически здоровых испытуемых, вероятно,  связаны с тем, что в последнем случае  различия в показателях внимания в большей степени были вызваны типологическими особенностями и отражались лишь в замедлении\ускорении ментальных процессов. В то время как у  больных шизофренией грубые нарушения внимания имели в основе морфо-функциональные аномалии,  включающие, в том числе, и генераторы волн ВП, что приводило к редукции  амплитуды ряда волн. 

3.3. Корреляции между параметрами слуховых  ВП в парадигме oddball и некоторыми иммунологическими показателями (активностью лейкоцитарной эластазы (ЛЭ) и уровнем аутоантител к фактору роста нервов)

Результаты корреляционного анализа между нейрофизиологическими и иммунологическими показателями представлены в Таблице 4.

Таблица 4. Величины значимых (p<0.05) коэффициентов корреляций (в скобках) между показателями активности ЛЭ и уровнем антител к ФРН и рядом параметров ВП  и топография выявленных  взаимосвязей

Иммунологические показателя

Аутоантетела к ФРН (Е)

Активность ЛЭ (нмоль/мин.мл)

Нейрофизиологические показатели

Амплитуда N100 в ВП на незначимый стимул, мкВ

С3 (-0.58),  CZ (-0.56),

C4 (-0.60)

Амплитуда N100 в ВП на значимый стимул, мкВ

F4 (-0.58), C4(-0.6),

CZ(-0.59), С4 (-0.72),

Т4 (-0.65)

ЛП N100 в ВП на значимый стимул, мсек

F3 (0.52), C3 (0.56), CZ (0.59)

Амплитуда Р300, мкВ

T3(-0.54), C3(-0.54),

СZ(-0.61).

ЛП Р300, мсек

T3(0.55), C4(0.57), Р3(0.59), РZ (0.5), P4(0.72).

  Как было показано в ряде исследований,  активность ЛЭ может рассматриваться как маркер обострения шизофренического процесса, в то время как уровень аутоантител к фактору роста нервов связан с тяжестью заболевания (Клюшник Т.П., Лидеман Р.Р., 2001; Щербакова И.В., 2005).  Высказывалась гипотеза о том, что при шизофрении развитие некоего патологического процесса в мозге больных запускает цепь событий, способствующих активации иммунитета, в первую очередь врожденного. Вероятно, при патологическом процессе в мозге дегрануляция нейтрофилов (с освобождением ЛЭ) происходит преимущественно на эндотелии сосудов гематоэнцефалического барьера, способствуя увеличение его проницаемости. Вследствие этого,  попадающие в кровоток антигены мозга воспринимаются клетками иммунной системы как чужеродные и инициируют иммунные реакции, в частности, могут вызывать синтез соответствующих  аутоантител, хотя высокий  уровень аутоантител характерен лишь для наиболее тяжелых  нарушений функционирования нервной системы ( Башина В.М. с соавт., 1997; Щербакова И.В. с соавт., 2003; Козловская Г.В., 2000;  Клюшник Т.П., Лидеман Р.Р., 2001; Klushnik T.P., et al., 1999)..

В настоящей работе высокий уровень аутоантител к ФРН ассоциировался с низкими амплитудами N100 в ВП  как значимый, так и незначимый стимул. Подобные нейрофизиологические изменения предполагают выраженное функциональное и\или морфологическое поражение генераторов нейрональной активности в интервале 80-160 мсек после предъявления стимула. Как считают,  генераторы данных волн расположены в  первичной и вторичной слуховой, и префронтальной коре (Calhoun V.D с соавт., 2006; Naatanen R, 2003) и, таким образом, можно предположить, что аутоантитела к ФРН вовлечены в формирование поражений в выше  указанных  зонах головного мозга.  В то же время  влияние процессов, маркером которых являются аутоантитела к ФРН, на генераторы Р300 либо былo невелико, либо скомпенсировано,  и отклонения проявились только в виде замедления активации этих структур и\или некоторой десинхронизации их активности. 

Для показателя активности лейкоцитарной эластазы (маркера обострения шизофренического процесса)  наблюдалась обратная зависимость:  повышенный уровень ЛЭ ассоциировался с выраженной  редукцией Р300. Так как активность лейкоцитарной эластазы модулируется клиническим состоянием больного и  снижается до  «нормальных» величин у больных в состоянии ремиссии (Щербакова И.В., 2006) и сходные закономерности наблюдаются и для волны Р300, можно предположить, что природа выявленной взаимосвязи определяется в первую очередь функциональными изменениями в морфологическом субстрате данного компонента ВП, в т.ч. в виде выраженной десинхронизации его генераторов, имеющей место у больного шизофренией в состоянии обострения. 

3.4. Ассоциации между параметрами слуховых  ВП в парадигме oddball и полиморфизмом гена COMT

Анализ ассоциаций между параметрами волн ВП и молекулярно-генетическими характеристиками в группе контроля выявил связь между полиморфизма гена COMT  и амплитудой Р300: у носителей генотипа Val/Val по сравнению с  Met/Met  наблюдались достоверно меньшие амплитуды Р300 в отведениях Р3 (F=3.2, p=0.05, Post-hoc Бонферрони:  р=0.04), и Рz (F=4,3,p=0.02; Post-hoc Бонферрони:  p=0.02).

Ассоциация генотипа Met/Met СОМТ с более высокими значениями амплитуды Р300 в контроле согласуется с результатами других авторов (Gallinat J. с соавт., 2003). Эти результаты находятся в соответствии с  данными о влиянии генотипа Met/Met на когнитивные функции: а именно, при более высокой концентрации  дофамина, которую обеспечивает наличие этого генотипа, достигаются лучшие результаты при  выполнении  когнитивных задач на внимание и рабочую память (Goldberg T. с соавт., 2003). При этом данные некоторых работ (Egan M. с соавт., 2001; Goldberg T. с соавт., 2003) указывают, что родственники больных шизофренией с генотипом Met/Met отличались большей эффективностью выполнения нейрокогнитивных тестов. 

  У больных подобных ассоциаций не выявлялось, что сходно с данными и других авторов, изучавших,  например, связь полиморфизма COMT с эффективностью выполнения тестов на внимание (Rosa А. с соавт., 2004).  Природа этого явления  может определяться целым рядом причин, в том числе и из-за влияния при болезни целого ряда факторов,  не связанных с данными особенностями генотипа.

4. ЗАКЛЮЧЕНИЕ

  Подводя итоги настоящей работы, нельзя не остановиться на вопросе о  возможном влиянии на полученные данные фактора проводимой у больных фармакотерапии.

В работе Hirayasu Y.с соавт.(1998) при сопоставлении групп больных шизофренией, никогда не леченных, ранее получавших лечение и контроля, амплитуда Р300 была сходным образом достоверно меньше в обеих группах больных (что, по мнению авторов, предполагает слабое влияние фармакотерапии), в то время как латентные периоды N200, Р300 были увеличены у больных, ранее получавших лечение по сравнению с больными никогда не леченным и нормой (т.е. эти параметры испытывали влияние приема психотропных препаратов). В работе Ford J. с соавт. (1994) было обнаружено, что ЛП N100 ВП на незначимые стимулы снижался, а амплитуда Р200 нарастала при приеме нейролептика (только для слуховой модальности). Coburn K с соавт., (1998), Gonul А.с соавт. (2003) и Schall U. с соавт. (1998) указывали на нарастание амплитуды Р300 в результате лечения больных шизофренией различными нейролептиками.

С другой стороны, в целом ряде работ было показано отсутствие влияния проводимой фармакотерапии, например, на параметры Р300 (Bramon E. с соавт. 2004;  B. О’Donnell с соавт., 1995; Weir N. с соавт., 1998).  Ford J.с соавт. (1994)  не обнаружили медикаментозного влияния на волны N100, N200, P300 и предположили, что выявляемые другими авторами различия между группами без терапии и на терапии связаны, скорее, с тем, что эти больные различаются по тяжести заболевания. В ряде исследований на здоровых добровольцах также не выявлялось влияние нейролептиков на Р300 (Hubl D. с соавт., 2001).

В целом, следует признать, что используемые в психиатрической клинике  препараты  обладают способностью влиять на нейрональную активность, а, значит, параметры ВП. Однако  приведенные выше данные свидетельствует о том, что эффекты медикаментации следует рассматривать, преломляя через фактор заболевания как такового и состояния больного человека. 

 

  Синтезируя результаты, полученные в настоящей работе, с данными научной литературы, может быть выдвинута гипотеза о взаимосвязи аномалий нейрофизиологических механизмах процессов обработки слуховой информации с патогенезом шизофрении.

Полученные данные указывают на то, что наиболее ассоциируемыми с патогенезом шизофрении (проявляющимися на всех этапах заболевания, связанными с характерными для данного заболевания клиническими и патопсихологическими характеристиками) являются процессы, отражающиеся в редукции волн N100 ВП на незначимый стимул и Р300. Следует отметить, что если второй компонент ВП часто обсуждается в данном контексте, то относительно первого настоящая работа является первым таким широкомасштабным исследованием в мировой литературе.

Как предполагается,  во временном интервале волны N100  осуществляется «кодировка» физических характеристик звука в первичной слуховой коре (Naatanen R., Picton T. , 1987). Затем происходит сопоставление между поступившей «информацией» и имеющейся в памяти, после чего (в случае незначимого стимула)  «включаются» активные процессы его оттормаживания  (Giard M с соавт., 2000). 

В свою очередь, во временном интервале  волны Р300, как считается, проходят процессы, связываемые с обновлением контекста, активацией следов памяти, оценкой значимости поступающей информации и завершением ее обработки (Donchin E. с соавт. 1986; Иваницкий А.М. с соавт., 1984; Kramer, A., Strayer, D.,1988; Polich, J., 2003; Strandburg R. с соавт., 1990). 

Снижение амплитуды N100 в ВП на незначимый стимул и амплитуды Р300 может быть следствием как поражения соответствующих генераторов, так и\или десинхронизации их активности.

Данные, полученные в настоящей работе, свидетельствуют в пользу того, что «перекрывание» механизмов процессов, связанных с N100 и Р300 является неполным: так, структура корреляций, например, с активностью лейкоцитарной эластазы  или шириной боковых желудочков включает только амплитуду Р300, в то время как корреляции с уровнем аутоантител к фактору роста нервов включают только амплитуду волн N100,  разными оказываются взаимосвязи с клиническими оценками состояния больного  - динамика амплитуды Р300 связана с динамикой выраженности уровня позитивной симптоматики (оцениваемой по шкале PANSS),  а  амплитуды N100 ВП на незначимый стимул – с динамикой суммарной оценки по шкале PANSS, и т.д.

Причина более низкой амплитуды N100 при шизофрении, вероятно,  связана в первую очередь с нарушением цикла восстановления нервного субстрата, обеспечением длительно повторяющихся процессов.  В работе  Mathalon D.H., с соавт. (2004) было высказано предположение, что первопричиной является нарушение височно-лобных связей, однако, данные настоящего исследования и данные литературы не исключают и более обширной топографии поражения. Процессы, отражающиеся в волне N100, вовлекают первичную и вторичную слуховую кору, префронтальные зоны коры, а  также гиппокамп и миндалину (Hegerl U. с соавт., 1994;  Calhoun V. с соавт. 2007; Tarkka I. с соавт. , 1995; Hajek M. c соавт., 1997),  ряд авторов особо подчеркивает роль и передней поясной извилины, (Mulert С. с соавт.2001),  так что патологические изменения в этих структурах и\или их связях являются одним из факторов развития шизофрении (а также, судя по данным об относительной нозологической неспецифичности редукции N100 ВП на незначимые стимулы, и целого ряда других психических заболеваний).

Аналогичный подход может быть применен и при анализе аномалий волны Р300. Широкий функциональный диапазон этого компонента слуховых ВП обеспечивается распространенным морфологическим субстратом,  включающим такие структуры мозга, как верхнюю височную извилину, префронтальную кору, теменную кору, гиппокамп, таламус, поясную извилину, базальные ганглии и др. (Kiehl K., Liddle P., 2001; Menon V.с соавт., 1997; Frodl-Bauch T. с соавт., 1999). Структурно-функциональные нарушения в этой сети очевидно вовлечены в патогенез шизофрении, хотя вклад отдельных звеньев выяснен еще не до конца. 

  При переходе барьера «здоровье-болезнь» усиление первого типа процессов (связанных в первую очередь со слуховой корой и отражающихся преимущественно в редукции волны N100 на незначимый стимул) выражено незначительно. В это же время процессы, связанные с редукцией волны Р300, отчетливо нарастают – здесь можно предположить качественный патологический сдвиг в какой-то (или каких-то) структурах, определяющих генерацию данного компонента волны слуховых ВП или связанных с его генераторами.

В Ы В О Д Ы:

1) В психически здоровой популяции возраста 18-45 лет этапы обработки «незначимой» слуховой информации являются процессами со слабой зависимостью от возраста, с малой вариабельностью локализации фокуса компонентов, хотя были получены свидетельства более раннего нарастания процессов оттормаживания «незначимой» слуховой информации у женщин. 

Процессы обеспечения обработки «значимой» информации протекают сходным образом у мужчин и женщин, однако, отчетливо претерпевают изменения (редукция активности, десинхронизация) с возрастом, при этом минимальное влияние испытывают промежуточные этапы, связанные с классификацией стимулов и обеспечением двигательной реакции.

2) У психически  здорового человека гиппокамп, миндалина и хвостатые ядра «включены» в процессы обработки слуховой информации в условиях избирательного внимания. Более быстрое протекание ментальных процессов ассоциируется с меньшими объемами гиппокампа и миндалины,  а в диапазоне волн N200 и Р300 – еще и с меньшими объемами хвостатых ядер в левом полушарии.

3) Аномалии процессов обработки слуховой информации наблюдаются на всех этапах шизофрении,  проявляются до манифестации психоза, являются динамически развивающимися, нарастающими параллельно развитию заболевания.

4)  Наиболее тесно связанными с патогенезом шизофрении являются две группы процессов: первая – существующая до манифестации болезни и  ассоциируемая с редукцией волны N100 на незначимый стимул, отражает  нарушения, связанные с циклом восстановления нервного субстрата, обеспечением длительно повторяющихся процессов, может трактоваться в терминах повышенной истощаемости нервного субстрата. Эти процессы  связаны в первую очередь со слуховой корой.

  Другая группа процессов, также берущая начало до манифестации болезни,  связана с редукцией волны Р300 и отражает структурно-функциональную дефицитарность широкой сети структур мозга, в том числе височной коры (включая и верхнюю височную извилину) лимбических структур, префронтальной коры, теменной коры, базальных ганглий и других, вовлеченных в процессы поддержания рабочей памяти с обновлением контекста, оценки значимости поступившей информации и произведенного действия, обеспечения проводимого действия.

5) Выделенные два типа процессов характеризуются определенной динамикой относительно манифестации и развития шизофрении:  так,  на этапе первого психотического эпизода второй тип  значимо интенсифицировался, в то время как первый практически не усиливался.  В то же время, по мере развития болезни происходит как нарастание выраженности обеих этих процессов, так и появление новых патологических изменений. 

6) Интенсивность упомянутых выше процессов связана с показателями, определяемыми на других уровнях патогенеза, в т.ч. с иммунологическими, психологическими, структурно-морфологическими аномалиями.

7)  Шизофрения приводит к качественному изменению взаимосвязей в структуре межуровневого обеспечения функционирования головного мозга.

Так,  при шизофрении взаимосвязи между процессами обработки слуховой информации и гиппокампом и миндалиной значительно редуцированы,  в противоположность тому, что наблюдается у психически здоровых людей, меньшие объемы тестируемых структур ассоциируются с большими отклонениями в процессах обработки слуховой информации. Также у больных отсутствуют выявленные у психически здоровых людей ассоциации между амплитудой волны Р300 и полиморфизмом гена COMT. 

8)  Выявленные отдельные аномалии обработки слуховой информации при шизофрении регистрируются при аффективных расстройствах, шизоаффективном психозе, шизотипических расстройствах, что  свидетельствует о «перекрывании» ряда патогенетических процессов в этих нозологически разных группах.

СПИСОК РАБОТ  ОПУБЛИКОВАННЫХ ПО  ТЕМЕ ДИССЕРТАЦИИ

1) Lebedeva I.S., Orlova V.A., Trubnikov V.I. To the search of psychoneurophysiological markers in the group of genetic risk of schizophrenia//  Abstracts of the XXVIII meeting of the European Society of human genetics, London, 11-13 April, 1996, P. 101

2) Lebedeva I.S., Orlova V.A., Savina T.D.  P300 in the families of

Schizophrenics //Abstracts of the III ECNP regional meeting, Athene, Greece, 2-4 April, 1998, P.18

3) Lebedeva I.S., Orlova V.A., Savina T.D.  Correlations between P300 and impairment of psychological characteristics in schizophrenics //Abstracts of Reg.Congress of Biological psychiatry, Florence, Italy, April, 1998

4) Lebedeva I.S., Orlova V.A., Savina T.D.  P300 in the families of

Schizophrenics //Abstracts of VI World Congress on psychiatric genetics, Bonn, October 4-12, American Journal of medical genetics. Neuropsychiatric genetics, 1998, V.81, N.6, P.496

5) Savina T.D., Lebedeva I.S., Orlova V.A. A comparative analysis of

psychological aspect and EEG characteristics in sibs of schizophrenics //Abstracts of conference  “Novel therapy strategy in schizophrenia spectrum and mood disorders. European decade of brain research». Venice, Italy, 1998, P. 180.

6) Lebedeva I.S., Orlova V.A., Savina T.D. The reflection of schizophrenic cognitive impairment in electrophysiological data //Abstracts of XII ECNP Congress, September 21-25, London, 1999.

7) Lebedeva I.S., Orlova V.A., Savina T.D. The patterns of P300 deviations in schizophrenics and their first degree rela­tives //Abstracts XI International Congress of electromyography and clinical neurophysiology, Prague, September 7-11, 1999.

8) Lebedeva I.S., Savina T.D., Orlova V.A. P300 correlations with clinical and psychological characteristics in schizophrenics //Abstracts of the XI  World Congress on psychiatry, Hamburg, 1-7 August, 1999, V.2, P. 155.

9) Лебедева И.С., Орлова В.А., Каледа В.Г., Цуцульковская М.Я. Р300 слуховых вызванных потенциалов при шизофрении //Ж неврол. и психиатрии им. С.С. Корсакова, 2000, V.100, N.1, C. 47-49

10) Lebedeva I.S., Kaleda V.G., Oleichik I.V.  A comparative P300 study of young adult patients with depressive and depressive-delusional disorders //Abstracts of X congress of the association of European psychiatrists, October 28- November 1, Prague, 2000

11) Lebedeva I., Rollover V. EEG pattern in schizophrenics and their sibs: probable links with genetic predisposition //Abstracts of the V ECNP regional meeting. St.-Petersburg., 2000, P2-022.

12) Lebedeva I.S., Orlova V.A., Trubnikov V.I. To the study of heritability of auditory P300 amplitude in the families of schizophrenics //Abstracts of the VIII World Congress on psychiatric genetics., 2000, Versailles, France, 27-31 August, P.133

13) Lebedeva I., Orlova V. Auditory event-related potentials (AEP) in parents of schizophrenics //Abstracts of the XI International ISBET congress, November 16-19, Frankfurt-on-the Main, Germany, 2000

14) Лебедева И.С., Орлова В.А. ЭЭГ и Р300 у больных шизофренией и родственников больных первой степени родства  //Материалы VIII съезда психиатров России, 10-13 октября, 2000, Российское общество психиатров, М., 2000, C.363-364.

15) Лебедева И.С., Орлова В.А. Особенности Р300 у родственников больных шизофренией //Физиология человека, 2001, V.27, N.3, C.37-41

16) Lebedeva I., Orlova V. Auditory event-related potentials (ERP) to target stimuli in patients with schizophrenia and their unaffected parents //Abstracts of VII World Congress of Biological Psychiatry, Berlin, 1-6 July, 2001. World J.Biol. Psychiatry, 2001, V.2, Suppl.1, p.11S

17) И.С.Лебедева, Л.И.Абрамова, В.В.Бондарь, В.Г.Каледа, И.В.Олейчик, М.Я.Цуцульковская Особенности обработки слуховой информации у больных шизофренией и аффективными расстройствами //Ж неврол. и психиатрии им. С.С. Корсакова, 2002, V.102, N.1, C.56-60

18) Lebedeva I. , Orlova V, Kaleda V , Bondar V , Abramova L  Auditory N1, N2, P3 in parents of patients with schizotypal and schizoaffective disorders //Abstracts of the X World Congress on Psychiatric Genetics 2002. Brussel, 9-13 October, 2002, P. 69.

19) Lebedeva I., Kaleda V.G., Correlations between P2 and P3 amplitudes and positive scores //Abstracts of XIII International Symposium of International Society for Brain Electromagnetic Topography (ISBET), Napoli , October 27-29, 2002, Brain Topography, 2003, V.15,N.3, P..201

20) Lebedeva I., Kaleda V., Orlova V., Fedorova E. P3 and negative disorders scores in patients with schizophrenia //Abstracts of the XI AEP Congress, Stockholm, 4-8 May 2002, P. 337

21) Лебедева И.С., Абрамова Л.И. Аномалии нейрофизиологических характеристик когнитивных функций мозга у женщин с маниакально-депрессивным психозом // Конференция  «Аффективные и шизоаффективные расстройства», Москва, 1-3 октября 2003, C. 78.

22) Lebedeva I., Kaleda V.G.  Information processing in patients with schizophrenia and schizoaffective disorder //Abstracts of WPA International Thematic conference “Diagnosis in psychiatry: integrating the sciences”,  Vienna 2003, 19-22 June, P. 245.

23) Лебедева И.С., Орлова В.А., Каледа В.Г., Бондарь В.В., Абрамова Л.И  Нейрофизиологические корреляты когнитивной деятельности у родителей больных шизофренией и шизоаффективным психозом //Тезисы Всероссийской конференции с международным участием «Современные проблемы биологической психиатрии и наркологии»,  Томск, 12-13 марта 2003 г., Сибирский вестник психиатрии и наркологии, 2003, V.1, N.27, C.94-95

24) Лебедева И.С., Орлова В.А., Савватеева Н.Ю.  Взаимосвязи между параметрами Р300 и шириной боковых желудочков мозга у больных шизофренией и их родственников //Физиология человека, 2003, V.29, N.6, C. 101-104

25) Лебедева И.С., Каледа В.Г. Цуцульковская М.Я. О сопряженности изменений клинического состояния больных шизофренией с параметрами слуховых вызванных потенциалов и фоновой электроэнцефалограммы //Ж. неврол. и психиатрии им. С.С. Корсакова, 2003, V.103, N.7, C.16-20

26) Судаков С.А. , Лебедева И.С., Каледа В.Г. Применение кластерного анализа при исследовании клинико-нейрофизиологических корреляций //Ж. неврол. и психиатрии им. С.С. Корсакова, 2003, V.103, N.7, C. 40-43

27) Лебедева И.С., Орлова В.А., Каледа В.Г. , Бондарь В.В. , Абрамова Л.И. , Воскресенская  Н.И. , Ганишева Т.К., Кайдан Л.В.  Биоэлектрическая активность головного мозга у родителей больных шизофренией //Ж. неврол. и психиатрии им.С.С.Корсакова, 2003, V.103, N.11, C.43-48

28) Лебедева И.С., Бойченко Ю.А., Губский Л.В., Орлова В.А., Воскресенская Н.И., Ганишева Т.К., Кайдан Л.В., Сейку Ю.В., Солохина Т.А. Р300 и морфометрические характеристики подкорковых и лимбических структур у больных шизофренией: межполушарная асимметрия //Сб.  материалов Всероссийской научной конференции по проблеме «Пластичность и структурно-функциональная взаимосвязь коры и подкорковых образований мозга». 30-31 октября, 2003. Москва, C.19

29) Ю.А. Бойченко, И.С.Лебедева, Л.В. Губский, В.А.Орлова, Н.И.Воскресенская, Т.К.Ганишева, Т.С.Кайдан, Ю.В.Сейку, Т.А.Солохина. Подкорковые и лимбические структуры мозга при шизофрении: морфометрические (по данным МРТ) особенности и их взаимосвязи с клиническими характеристиками //Сб. материалов Всероссийской научной конференции по проблеме «Пластичность и структурно-функциональная взаимосвязь коры и подкорковых образований мозга». 30-31 октября, 2003. Москва, C. 18

30) I. S. Lebedeva, V. A. Orlova, Y.A.Boitchenko, L. V. Gubsky, N.I. Voscresenskaya  The  relationships between auditory P300 and psychological and MRI characteristics in patients with schizophrenia //Abstracts of the XII Biennial Winter Workshop on schizophrenia, Davos, February 2-7, 2004, Schizophrenia Research, V.67, N.1, Suppl.1, P.130

31) I.S.Lebedeva, T.D.Savina, V.A.Orlova, N.I.Voskresenskaya, T.A.Solokhina N200, P300 and anxiety level in unaffected sibs of patients with schizophrenia and psychiatry healthy subjects //Abstracts of VIII Conference “Stress and Behavior”, 2004 Sankt-Petersburg,  Психофармакология и биологическая наркология, N.2-3, 2004, C.728.

32) Орлова В. А., Савватеева Н. Ю., Судаков С. А., Лебедева И. С., Смирнов П. В. Наследуемость показателей асимметрии желудочков мозга в семьях больных шизофренией (по данным компьютерно-томографического исследования) //Российский психиатрический журнал, 2004, N.6,  C. 7-10

33) I. Lebedeva, V. Orlova, T. Klushnik, I. Shcherbakova, L. Gubsky, N. Efanova,  T. Savina  The association of  auditory P300 deviations with the other indices of schizophrenia  //Abstracts of XVI meeting of ISBET, 2005, 5-8 October, 2005, Bern, Switzerland, Brain Topography, 2005, V.18, N.2, P.27

34) I. Lebedeva, V. Orlova, T. Savina, L. Gubsky, N. Efanova, N. Voskresenskaya. Auditory P300 in the structure of brain indices in the families of schizophrenics and mentally healthy subjects //Abstracts of VIII Congress of biological psychiatry, June 28-July 3, 2005, Vienna, Austria. The World journal of biological psychiatry, 2005, V.6, Suppl. 1, P.231-232

35) I.S.Lebedeva, T.D.Savina, N.P.Sherbakova, E.A.Solenova, V.A.Orlova, V.G.Kaleda, L.I.Abramova On the convergence of neurophysiological and neuropsychological anomalies in patients with schizophrenia //Abstracts of XIII WPA World Congress, Cairo. September 10-15, 2005

36) I. Lebedeva, V. Orlova, V. Kaleda,  N. Tsherbakova , T. Savina,  L.Gubsky, P300 in the hierarchy of schizophrenia pathogenesis //Abstracts of XIIIth WPA World Congress,  Cairo. September 10-15, 2005

37) Lebedeva I., Kaleda V., Barkhatova A., Straltsova M. On the perspectives of neurophysiological “cognitive” index (P300) in schizophrenia //Abstracts of the XIII Biennial Winter Workshop on schizophrenia research. Davos, 2-8 February 2006. Schizophrenia research, 2006, V.81, N.1,Suppl.1, P. 171

38) Лебедева И.С., Савина Т.Д.,  Ефанова Н.А, Губский Л.В., Клюшник Т.П.Щербакова И.В, Орлова В.А,, Каледа В.Г., Бархатова А.Н., Абрамова Л.И., Воскресенская Н.И. Р300 при шизофрении: конвергенция с психологическими, МРТ и иммунологическими данными //Материалы XIV съезда психиатров России, 15-18 ноября 2005, Москва

39) Орлова В.А., Воскресенская Н.И., Савина Т.Д., Ефанова Н.Н., Соленова Е.П., Щербакова Н.П., Корсакова Н.К., Лебедева И.С., Губский Л.В., Куприянов Д.А., Анисимов Н.В., Солохина Т.А. Маркеры генетического риска шизофрении: многоуровневые проявления, сопряженность характеристик. XIV съезд психиатров России, 15-18 ноября 2005, Москва.

40)  В.Е. Голимбет, И.С. Лебедева,  Г.И. Коровайцева, Т.В. Лежейко, Л.И. Абрамова, М.А. Стрельцова, В.Г. Каледа. Молекулярно-генетический полиморфизм и компонент Р300 слуховых вызванных потенциалов у больных шизофренией и их родственников //Материалы XIV съезда психиатров России, 15-18 ноября 2005 г. Москва, C.475

41) Ю.А. Воронкова, И.С. Лебедева, Л.В. Губский, В.А. Орлова,  Н.И. Воскресенская, Д.А.  Куприянов,  Н.В. Анисимов,  Т.А  Солохина Подкорковые и лимбические структуры мозга и Р300 у больных шизофренией //Физиология человека, 2005, V.31, N.2. C. 18 - 23

42) Т.Д.Савина, И.С.Лебедева, В.А.Орлова, Н.И. Воскресенская, Т.К. Ганишева, Л.В.Кайдан, Р.А.Николаев, Л.П. Фролова, Ю.В. Сейку, Т.А.Солохина, Н.В.Зверева Особенности внимания в семьях больных шизофренией: сопряженность психологических и нейрофизиологических характеристик //Ж. неврол. и психиатрии им.С.С.Корсакова,  2005,  V.105, N.3,  C.35-39

43) Клюшник Т.П., Лебедева И.С.,  Щербакова И.В., Орлова В.А., Лидеман Р.Р., Воскресенская Н.И., Каледа В.Г. Взаимосвязь иммунологического и нейрофизиологического маркеров активации шизофренического процесса //Ж. неврол. и психиатрии им.С.С.Корсакова, 2005, V.105, N.10, C.42-45

44) Голимбет В.Е., Лебедева И.С., Гриценко И.К., Коровайцева Г.И., Алфимова М.В, Лежейко Т.В., Абрамова Л.И., Каледа В.Г., Эбштейн Р.П., Рогаев Е.И.  Связь полиморфизма генов серотонинергической и дофаминергической систем с вызванными потенциалами (компонент Р300) у больных шизофренией и их родственников //Ж. неврол. и психиатрии им.С.С.Корсакова, 2005, V.105, N.10, C.35-41

45) Golimbet V. , Gritsenko I., Alfimova M., Lebedeva I., Lezheiko T., Ebstein R.  Association study of the COMT gene Val158Met polymorphism with auditory P300 and performance on neurocognitive tests in patients with schizophrenia and their relatives //Abstracts for the XII World Congress of Psychiatric Genetics, Boston  American Journal of Medical Genetics Part B: Neuropsychiatric Genetics, 2005, V. 130B, N.1,  P.110-111

46) Щербакова И.В., Орлова В.А., Ефанова Н.Н., Лебедева И.С., Воскресенская Н.И., Губский Л.В., Клюшник Т.П. Взаимосвязь аутоиммунных реакций с нейрофизиологическими и нейроанатомическими особенностями при шизофрении //Материалы XIV Всероссийской конференции «Нейроиммунология». Санкт-Петербург, 19-22 мая 2005 г. //Журнал Нейроиммунология, 2005, V.3, N.2, C.199-200.

47) Голимбет В.Е., Лебедева И.С. , Алфимова М.В. , Коровайцева Г.И. , Лежейко Т.В. , Абрамова Л.И. , Каледа В.Г Слуховые вызванные потенциалы (волна Р300), полиморфизм гена переносчика серотонина и некоторые психопатологические и психологические особенности больных шизофренией и их родственников //Ж. неврол. и психиатрии им.С.С.Корсакова, 2006, V.106, N.2, C. 44-49

48) Golimbet V., Gritsenko I., Alfimova M., Lebedeva I., Lezheiko T., Abramova L., Kaleda V., Ebstein R. Association study of COMT gene Val158Met polymorphism with auditory P300 and performance on neurocognitive tests in patients with schizophrenia and their relatives //World J Biol Psychiatry. 2006, V.7, N.4, P.238-245.

49) T.V. Lezheiko, I.S. Lebedeva, G.I. Korovaitseva, M.A. Alfimova, A.N. Barkhatova, S.A. Borozdina, K.V. Chubabria, V.E. Golimbet Auditory-evoked potentials P300 and genes implicated with serotononergic and dopaminergic systems in patients with schizophrenia and their relatives //Abstracts of II International Conference of the National Neuroscience Society of Romania. Neuronal excitability: from molecular level to system. Romanian Academy Library Bucharest, September 1-3, 2006. P.61

50) Lebedeva I., Kaleda V., Barkhatova A., Streltsova M., Abramova L. Anomalies of auditory oddball N100 and P300 as the markers closely related to the pathogenesis of schizophrenia //Proceedings of the X Jubilee multidisciplinary international conference of biological psychiatry Stress and Behavior, St.Petersburg, Russia, May 16-20, 2007, P. 29-30

51) И.С.Лебедева, В.Г. Каледа, А.Н. Бархатова Нейрофизиологические характеристики когнитивных функций у больных с первым приступом эндогенного психоза юношеского возраста //Ж. неврол. и психиатрии им.С.С.Корсакова, 2007, V.107, N.2,  C.12-20

52) Lebedeva I., Kaleda V., Barkhatova A., Omelchenko M. Anomalies of auditory oddball ERP in the first episode patients  //Abstracts of the Ist European Conference on schizophrenia research, 26-28 September 2007, Dusseldorf, Germany.

53) Лебедева И.С. Параметры слуховых ВП в парадигме oddball как возможные маркеры предрасположения к шизофрении //Материалы Всероссийской научно-практической конференции «Количественная ЭЭГ и нейротерапия», 15-16 октября 2007, Санкт-Петербург, C. 55

54) Лебедева И.С., Клюшник Т.П., Омельченко М.А., Каледа В.Г., Сарманова З.В., Отман И.Н. О взаимосвязи ряда нейрофизиологических и иммунологических показателей при шизофрении //В сб: Структурно-функциональные, нейрохимические и иммунохимические закономерности асимметрии и пластичности мозга (Материалы Всероссийской конференции с международным участием). Под. ред. С.Н.Иллариошкина, Москва, 2007,  «Икар», C. 336-339


1 При анализе большей по объему выборки больных шизофренией в настоящей работе обнаружено значимое снижение амплитуды Р200 относительно психически здоровых испытуемых.

2 При анализе большей по объему выборки больных шизофренией в настоящей работе обнаружено значимое снижение амплитуды N100 на значимый стимул относительно психически здоровых испытуемых.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.