WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи



БОРОННИКОВА  СВЕТЛАНА  ВИТАЛЬЕВНА


Молекулярно-ГЕНЕТИЧЕСКИЙ  АНАЛИЗ ГЕНОФОНДОВ  РЕДКИХ  и исчезающих  ВИДОВ  РАСТЕНИЙ  ПЕРМСКОГО  КРАЯ

Специальность 03.00.15 генетика



Автореферат

диссертации на соискание ученой степени

доктора биологических наук




Уфа 2009

Работа выполнена в Государственном образовательном

учреждении высшего профессионального образования

Пермском государственном университете

Официальные оппоненты:

доктор биологических наук, академик РАСХН, профессор

Драгавцев Виктор Александрович

Агрофизический НИИ РАСХН

доктор биологических наук, профессор

Янбаев Юлай Аглямович

Сибайский  институт-филиал Башкирского государственного

университета

доктор биологических наук, старший научный сотрудник

Путенихин  Валерий Петрович

Ботанический сад-институт Уфимского научного центра РАН

Ведущее учреждение:

Институт общей генетики имени Н.И.Вавилова РАН

Защита состоится «____»_______________200___г.  в «___» часов

на заседании Диссертационного совета ДМ 002.133.01 по адресу:

г.Уфа, 450054, пр. Октября, 71

С диссертацией можно ознакомиться в библиотеке Уфимского научного центра РАН и на сайтах ВАК РФ и ИБГ УНЦ РАН

ibg.anrb.ru/dissov.html

Автореферат разослан «____»______________2009г.

Ученый секретарь

Диссертационного совета

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

ВВЕДЕНИЕ

Актуальность проблемы

Сохранение биологического разнообразия занимает особое место среди глобальных проблем современности (Вахрамеева, 1988; Конвенция о биологическом разнообразии..., 1992; Алтухов, 2004). Основой биологического разнообразия является его генетическая компонента. Сокращение видового и генетического разнообразия представляет реальную угрозу для биосферы, поскольку устойчивость воспроизводства природных экосистем и агроэкосистем непосредственно связана с их генетически обусловленным потенциалом к адаптациям к меняющимся условиям окружающей среды (Мэгарран,1992; Глазко, 1998; Лебедева и др., 1999, Жученко, 2001, Динамика популяционных генофондов..., 2004). К середине текущего столетия прогнозируется увеличение числа видов растений, исчезающих, с 7 до 60 тысяч (Frankel, 1995; Стратегия сохранения ..., 2004).

Впервые концепция о необходимости контроля и мобилизации мировых растительных ресурсов была разработана Н.И.Вавиловым, что легло в основу планомерной работы по созданию банков растительных ресурсов в разных странах. К настоящему времени в них собраны миллионы образцов, однако до сих пор нет универсальных принципов их отбора (Жученко, 2001). При изучении редких и исчезающих видов растений не всегда учитывается необходимость сохранения внутривидовой изменчивости,  как на межпопуляционном, так и на внутрипопуляционном уровнях (Тихонова, 1985). Популяционный подход остается наименее разработанным в области сохранения биоразнообразия растений, поскольку до сих пор отсутствуют общепринятые методы идентификации не только популяционных, но даже видовых особенностей генофондов. Анализ молекулярно-генетических маркеров полиморфизма белков и различных участков геномной ДНК позволил выявлять внутривидовое генетическое разнообразие, оценить гетерозиготность, реконструировать филогенетические взаимоотношения между видами и пространственные взаимосвязи между популяциями (Алтухов, 1975, 1995; Янбаев, 2007; Политов, 2007). В то же время, эффективность использования традиционных молекулярно-генетических маркеров (структурных генов, мини- и микросателлитных локусов) для исследований генофондов до сих пор остается достаточно низкой из-за ограниченности количества локусов, доступных для одновременного генотипирования особей. Это требует поиска новых подходов одновременного молекулярного маркирования многих геномных участков, которые могли бы позволить создавать «геномный портрет» каждого отдельного индивидуума и, таким образом, наиболее объективно оценивать  своеобразие генофондов популяций. Особую важность разработка таких методов имеет для решения главной проблемы в поддержании биоразнообразия - отбора наиболее типичных представителей популяций и создания генетически обоснованных программ по их сохранению. К настоящему времени у редких эндемичных видов растений Урала изучен ряд характеристик внутривидовой изменчивости (Кучеров и др., 1987; Янбаев, 2007), но практически не исследована генетическая изменчивость травянистых реликтовых редких видов растений, в том числе и в Пермском крае.

Актуальность диссертационной работы обусловлена:

а) недостаточной теоретической разработанностью молекулярно-генетических подходов к изучению геномов дикорастущих редких видов растений, представленных популяциями с малой численностью;

б) важностью определения молекулярно-генетических основ генетического разнообразия редких и исчезающих видов растений на популяционном уровне;

в) отсутствием экспериментальных методов молекулярного маркирования многих участков геномов редких видов растений, пригодных для массового анализа;

г) недостатком методов  для  оптимизации сохранения генофондов редких и исчезающих  видов растений.

Цель и задачи исследования

Цель работы – разработать принципы множественного молекулярно-генетического геномного маркирования и технологию идентификации и паспортизации генофондов редких реликтовых видов растений Пермского края  в качестве модельной системы оптимизации сохранения генофондов редких и исчезающих видов растений.

Для достижения цели были поставлены следующие основные задачи:

1. Подобрать наиболее полиморфные стабильные ДНК-маркеры и разработать методы оценки мультилокусного полиморфизма ДНК с целью оптимизации исследования генофондов популяций редких и исчезающих видов растений.

2. Исследовать генетическое разнообразие популяций некоторых  редких реликтовых видов растений, распространенных на территории Пермского края.

3. Определить общую и эффективную численность популяций, способ размножения и семенную продуктивность некоторых редких реликтовых видов растений.

4. Установить популяции с типичными и  специфическими характеристиками генофондов.

5. Разработать методику и провести молекулярно-генетическую паспортизацию (ключевого звена технологии идентификации генофондов популяций редких и исчезающих видов растений), на модельных редких реликтовых видах растений Пермского края.

Положения, выносимые на защиту

  1. Наиболее эффективным для оценки генетического разнообразия популяций редких и исчезающих видов растений является использование ДНК-фингерпринтинга (анализа полилокусных спектров) высоко полиморфных и стабильных ISSR- и IRAP-маркеров.
  2. Оптимизация cохранения генофондов редких и исчезающих видов растений возможна с учетом показателей генетического разнообразия, установленных по результатам молекулярного маркирования множественных геномных участков, а также с обязательным учетом уровней внутри- и межпопуляционного разнообразия.
  3. Для сохранения генофондов редких и исчезающих видов растений рекомендуются отбор в природных условиях популяций и их групп как с наиболее типичными так и со специфичными характеристиками генофондов.
  4. Для оптимизации сохранения генетического разнообразия на популяционном уровне  необходима молекулярно-генетическая идентификация и паспортизация генофондов редких и исчезающих видов растений, позволяющая на основании оценок полилокусного сочетания моно- и полиморфных участков ДНК составить молекулярно-генетическую формулу, штрих-код популяций и обобщить данные в виде генетического паспорта.

Научная новизна полученных результатов

Впервые разработана концепция идентификации генофондов редких и исчезающих видов растений с использованием оценок геномного распределения повторов, таких как микросателлиты и ретротранспозоны. Впервые получены и систематизированы данные о генетическом разнообразии популяций ряда редких реликтовых видов растений, произрастающих на территории Пермского края: адониса весеннего Adonis vernalis L., адониса сибирского Adonis sibirica Patrin ex Ledeb., бубенчика лилиелистного Adenophora lilifolia (L.) A.DC., пиона уклоняющегося Paeonia anomala L., наперстянки крупноцветковой Digitalis grandiflora Mill. Впервые оценена эффективность в исследованиях генофондов редких видов растений IRAP-метода, основанного на использовании в полимеразной цепной реакции (ПЦР) в качестве праймеров терминальных последовательностей ретротранспозонов. С целью анализа геномов редких реликтовых видов растений были клонированы и секвенированы последовательности ДНК 5 редких видов растений Пермского края. Нуклеотидные последовательности LTR ретротранспозонов изученных редких видов растений были секвенированы и включены в мировую базу генетических данных «GenBank» NCBI под номерами: EF191000-EF191012 (http://www.ncbi.nlm.nih.gov/).

С целью изучения взаимосвязи генетического разнообразия с показателями численности выявлены общая и эффективная численность популяций и изучены биологические особенности модельных реликтовых редких видов растений, такие как преимущественный способ опыления, способ и эффективность  размножения. Даны характеристики изученных популяций с определением степени антропогенного воздействия в соответствии с рекомендациями, разработанными автором диссертационной работы. С целью оптимизации сохранения генофондов редких и нуждающихся в охране видов растений разработана методика молекулярно-генетической паспортизации на популяционном уровне, которая включает в себя анализ полиморфизма стабильных ISSR- и IRAP-маркеров, выявление идентификационных мономорфных (родовых и видовых) и полиморфных и уникальных ДНК-маркеров, составление молекулярно-генетической формулы, штрих-кода и генетического паспорта. На основании полученных данных рекомендованы научно обоснованные меры сохранения генофондов изученных редких реликтовых видов растений и разработаны подходы оптимизации сохранения генофондов редких и исчезающих видов растений.

Практическая значимость и реализация результатов исследований

Использование ретротранспозонов для анализа геномов открывает новые возможности изучения организации и функционирования геномов редких и  исчезающих видов растений, являющихся наиболее уязвимым звеном в растительных сообществах, выявления механизмов их устойчивости. Поддержание исторически сложившегося уровня генетического разнообразия популяций как основы сохранения их адаптационного потенциала в естественно колеблющейся и антропогенно трансформированной среде является необходимым условием их существования и развития. Изучение генетической изменчивости природных популяций, оценка их состояния позволяют рекомендовать научно обоснованные меры сохранения популяций редких видов растений.

Разработанная технология идентификации генофондов и ее ключевое звено (методика молекулярно-генетической паспортизации) позволяют оптимизировать сохранение генофондов растений, включая редкие и исчезающие виды растений. Научные выводы работы и рекомендации непосредственно используются при проведения мониторинга популяционного разнообразия редких и исчезающих видов растений Пермского края, так как автор диссертационной работы является куратором 5 редких реликтовых видов растений от Управления по охране окружающей среды Пермского края. На основании анализа динамики показателей  численности и генетического разнообразия бубенчик лилиелистный (Adenophora lilifolia (L.)А.DC.) внесен в Красную книгу Пермского края (2008). Результаты и выводы исследований могут быть использованы для сохранения генофондов редких и исчезающих видов растений и оптимизации сохранения генетического разнообразия на популяционном уровне и в других регионах страны.

Теоретические и практические результаты исследований используются при преподавании учебных дисциплин и специальных курсов студентам Новосибирского, Уральского, Челябинского и Пермского государственных университетов, а также Калининградского технического университета, что подтверждено справкой и 4 актами внедрения результатов исследований в учебный процесс.

Связь работы с научными программами

Диссертационная работа выполнялась в ходе подготовки и реализации ПГУ приоритетного инновационного национального проекта «Образование» в части  «Молекулярная генетика». Популяционно-генетические исследования были частично связаны с последовательным циклом программ Управления по охране окружающей среды Пермской области (2006 г): гос. контракты № 6/2006 от 03.04.2006, № 90203 от 10.04.2006, № 90202 от 01.06.2006, № 90211 от 01.06.2006; а также Министерства градостроительства и развития инфраструктуры Пермского края: гос. контракты № 65-О от 20.06.2007, № 56/1-О от 13.06.2007, № 11-О от 18.02.2008, № 43-О от 17.03.2008.

Часть исследований проводились в связи с тематикой гранта РФФИа_2006урал № 07-04-96032 «Динамика генетического разнообразия и структуры популяционных систем ресурсных растений Пермского края при антропогенных воздействиях» (2006-2009 гг.), гранта РФФИа_2006урал №07-04-96016 «Влияние нефтяных загрязнений почв на популяции микроорганизмов и растений Пермского края» (2006-2009 гг.), гранта РФФИ АНФ_з №08-04-92673 «Участие в российско-австрийском семинаре «Молекулярно-генетические маркеры, филогеография и популяционная генетика для устойчивого лесного хозяйства: Евроазиатская перспектива» (2008-2009 гг.).

Личный вклад автора

Разработка подходов и программы молекулярно-генетических исследований; выбор типов молекулярных маркеров и объектов исследований; планирование, организация и проведение полевых и лабораторных исследований; обработка, обобщение и интерпретация представленных в диссертационной работе результатов, их сопоставление с литературными сведениями, разработка теоретических положений; подготовка практических рекомендаций и публикаций, написание и оформление текста диссертации проведены лично автором работы. Идея создания концепции идентификации генофондов, разработка методики молекулярно-генетической паспортизации, выявление мономорфных и полиморфных идентификационных фрагментов ДНК, а также составление молекулярно-генетической формулы и молекулярно-генетического паспорта единолично принадлежат автору диссертационной работы. Для гетерогенных природных популяций растений диссертантом предложена запись молекулярно-генетической формулы в виде штрих-кода. Автор диссертационной работы является инициатором и одним из соавторов обоснования внесения Adenophora lilifolia (L.) А.DC. в Красную книгу Пермского края (2008) с категорией угрожаемого состояния 3 (R) – редкий вид. Результаты части исследований, проведенных совместно с соискателями и аспирантами диссертанта, опубликованы. Ссылки на них приведены в соответствующих разделах работы.

Апробация работы

Материалы диссертации представлены и доложены на Втором республиканском совещании семинаре «Содержание и формы экологического образования в педвузе» (Пермь, 1990), IX Всесоюзном совещании по семеноведению интродуцентов «Репродуктивная биология интродуцированных растений» (Умань, 1991), межвузовской научной конференции «Охраняемые природные территории. Проблемы выявления, исследования, организации систем» (Пермь, 1994), 2 Международной научно-практической конференции «Экология и охрана окружающей среды» (Пермь, 1995), симпозиуме «Проблемы репродуктивной биологии растений» (Пермь, 1996), V научной конференции памяти проф. А.А.Уранова «Популяции и сообщества растений: экология, биоразнообразие, мониторинг» (Кострома, 1996), популяционном семинаре «Жизнь популяций в гетерогенной» (Йошкар-Ола, 1998), XI съезде Русского ботанического об-ва «Ботанические исследования в азиатской России» (Барнаул, 2003), Proceedings of the IV Balkan Botanical Congress (Sofia, 2006), YII Международном симпозиуме «Нетрадиционные и редкие растения, природные соединения и перспективы их использования» (Белгород, 2006), Всероссийской научной конференции «Ботанические исследования в Поволжье и на Урале» (Саратов, 2006), Международной конференции «Генетика в России и мире, посвященная 40-летию Института общей генетики им. Н.И.Вавилова РАН» (Москва, 2006), Международной научно-практической конференции «Антропогенная динамика природной среды» (Пермь, 2006), IY Международной научной конференции «Биотехнология – охране окружающей среды» (Москва, 2006), Четвертом Московском международном конгрессе «Биотехнология: состояние и перспективы развития» (Москва, 2007), Всероссийской конференции «Фундаментальные и прикладные проблемы ботаники в начале XXI века» (Петрозаводск, 2008), Международной научно-практической конференции «Нанобиотехнологии в сельском хозяйстве» (Москва, 2008), Пятом Московском международном конгрессе «Биотехнология: состояние и перспективы развития» (Москва, 2009),  V Съезде Вавиловского общества генетиков и селекционеров (Москва, 2009).

Публикации

Диссертантом по теме диссертации опубликовано 64 научные работы, в их числе 12 статей в ведущих рецензируемых журналах из перечня ВАК, 10  статей в других журналах,  29 статей в материалах  конференций, 1 учебно-методическое пособие и 2 монографии, в одной из которых диссертант является соавтором. Общий объем публикаций 562 страницы, из которых лично автору диссертационной работы принадлежат  349 страниц.

Структура и объем работы

Диссертационная работа состоит из введения, 7 глав – обзор проблемы, объекты и методы исследований, 5 глав результатов и их обсуждения, выводов. Список литературы включает 306 источников, в том числе 163 отечественных и 143 иностранных. Диссертационная работа изложена на 366 машинописных страницах, содержит 45 таблиц, 50 рисунков и приложения.

Благодарности

Автор выражает искреннюю признательность за помощь при обучении, повышении квалификации, освоении современных методов молекулярно-генетического анализа, подготовке диссертационной работы и консультации с.н.с. лаборатории гетерозиса растений ИЦиГ СО РАН В.И. Коваленко и зав. лабораторией академику РАН В.К. Шумному, академику  РАЕН, РАСХН (иностранный член) В.И. Глазко и проф. Т.Т. Глазко; проф. каф. ботаники и генетики растений ПГУ В.А.Верещагиной, Н.В. Москвиной, зав. кафедрой ботаники и генетики растений ПГУ проф. С.А. Овеснову; сотрудникам группы проф. С.А. Гостимского (особенно с.н.с. З.Г. Кокаевой) и всей кафедре генетики Московского государственного университета имени М.В. Ломоносова; зав. лабораторией растительной геномики Института биотехнологии университета Хельсинки (Финляндия) проф. А.Х. Шульману и доц. Р.Н. Календарю; зав. лабораторией популяционной генетики ИОГен имени Н.И.Вавилова РАН д.б.н. Д.В. Политову. Выражается искренняя благодарность соавторам по публикациям, а также всем, кто поддерживал и поддерживает развитие молекулярно-генетических исследований в ПГУ.

Основное СОДЕРЖАНИЕ РАБОТЫ

1. Состояние проблемы  охраны генофондов редких видов растений

Представлен обзор существующих проблем охраны генофондов редких, в том числе реликтовых видов растений. Показано значение генетического разнообразия как одного из основных компонентов  биологического разнообразия. Проанализировано использование изоферментных и ДНК-маркеров в популяционно-генетических исследованиях редких и исчезающих видов растений, при этом особое внимание уделено исследованиям  сохранения генофондов редких реликтовых травянистых видов растений. Проведен анализ проблемы выявления объектов сохранения генетического разнообразия и методик генетической паспортизации организмов. Особое внимание уделено штрих-кодированию живых организмов, включая подход, разработанный в Институте биохимии и генетики УНЦ РАН (Чемерис и др., 1999). На основании анализа литературных данных разработаны цель, основные задачи и программа исследований.

2. Объекты  и методы исследований

В качестве основных объектов исследований избраны 5 реликтовых редких видов растений, произрастающих в Пермском крае: адонис весенний Adonis vernalis L. и адонис сибирский Adonis sibirica Patrin ex Ledeb. из семейства Ranunculaceae, наперстянка крупноцветковая Digitalis grandiflora Mill. из семейства Scrophulariaceae, пион уклоняющийся Paeonia anomala L. из семейства Paeoniaceae, бубенчик лилиелистный Adenophora lilifolia (L.) A.DC. из семейства Campanulaceae с категорией угрожаемого состояния 3 (R) (Горчаковский и др., 1982; Красная книга Среднего Урала, 1996; Красная книга Пермского края, 2008). Эти виды являются реликтами (Белковская и др., 1988; Камелин и др., 1999). Проведены комплексные исследования 27 природных популяций (82 выборки) редких видов растений. Для изучения генетического разнообразия A. vernalis из разных частей Кунгурской островной лесостепи избраны 10 популяций, в том числе самая северная популяция Av2, расположенная на Спасской горе в Кунгурском районе. На территории Ординского района находятся 4 популяции: Av1, Av3, Av4 и Av10, в Уинском районе – одна (Av7). Южная группа представлена популяциями Октябрьского района: Av5, Av6, Av8 и Av9. Для анализа генетического разнообразия A. sibirica избраны 3 популяции из разных частей Пермского края: As1 из центральной (Добрянский район), As2 - из юго-западной (Кишертский район), а As3 - из северной части (Ильинский район). Первая популяция Ad. liilifolia (Ad.lil.1) приурочена к северному участку островной Кунгурской лесостепи. Вторая (Ad.lil.2)  и третья (Ad.lil.3) популяции находятся в юго-западной, а четвертая (Ad.lil.4) – в северной части края. Для изучения динамики численности и генетического разнообразия D. grandiflora были избраны 5 популяций в разных районах Пермского края: первая (Dg1) расположена в Кишертском районе, вторая (Dg2) – на Спасской горе Кунгурского района, 3 популяции  (Dg3, Dg4, Dg5) – в Октябрьском районе. Популяции P. anomala находятся в центральной части Пермского края: Ра1 в Чусовском, Ра2 в Добрянском, а Pa3 в Губахинском районах. Для апробации ISSR- и IRAP-методов анализа полиморфизма ДНК помимо редких видов растений были использованы широко распространенные как травянистые (зверобой продырявленный Hypericum perforatum L., зверобой пятнистый Hypericum  maculatum Crantz) так и древесные (тополь дрожащий или осина Populus tremula L.) виды растений.

Разработка методики молекулярно-генетической паспортизации редких видов растений с целью оптимизации сохранения их генофондов проведена на примере двух видов рода Adonis (A. vernalis, A. sibirica) (Боронникова, 2008), а ее апробация – на примере как редких так и широко распространенных видов растений рода Adenophora (бубенчик лилиелистный Adenophora lilifolia (L.) A.DC., бубенчик трехлистный Adenophora triphylla A.DC.), рода Digitalis  (наперстянка крупноцветковая Digitalis grandiflora Mill., наперстянка пурпуровая Digitalis purpurea L., наперстянка ресничатая Digitalis ciliata Trautv., наперстянка шерстистая Digitalis lanata Ehrh., наперстянка желтая Digitalis lutea L.).

Полевые исследования проводились с использованием традиционных методов, применяемых в ботанике, молекулярной и популяционной генетике. С 1988 по 2005 гг. проведены исследования биологических особенностей избранных для изучения редких видов растений, подсчет общей (Голубев и др., 1978; Денисова и др., 1986), и эффективной численности или эффективного размера их популяций (Вахрамеева, 1981; Хедрик, 2003; Алтухов, 2004) и его состава посредством определения семенной продуктивности особей разных возрастных групп генеративного периода (Работнов, 1960; Вайнагий, 1973), а с 1994 по 2009 гг. – молекулярно-генетический анализ генофондов (Chalmers, 1992; Алтухов, 1995, 2003; Хедрик, 2003; Артюкова и др., 2004; Динамика популяционных генофондов..., 2004). Определение степени антропогенного воздействия на изученные популяции редких видов растений проведено в соответствии с рекомендациями С.В. Боронниковой (2008). Для анализа молекулярно-генетического полиморфизма ДНК были собраны листья с 30 случайно выбранных растений в каждой популяции на расстоянии от 30 до 50 м друг от друга. Для выделения ДНК использовали методику A.M. Торрес (Torres et al., 1993) с незначительными модификациями. Навеска фрагментов свежесобранных листьев для одной пробы ДНК составляла 100 мг. С целью молекулярно-генетического анализа ДНК выделена из более 1520 образцов листьев редких видов растений, а так же с целью молекулярно-генетической паспортизации дополнительно из 1240 образцов проростков, почек возобновления и листьев. Анализ молекулярно-генетического полиморфизма ДНК, включая основные его стадии, проведен в молекулярно-генетической лаборатории кафедры ботаники и генетики растений ПГУ с использованием ISSR- (Inter Simple Sequence Repeats) (Zietkiewicz et al., 1994) и IRAP- (Inter-Retrotransposon Amplified Polymorphism) (Kalendar et al., 1999) методами с применением полимеразной цепной реакции (ПЦР). С целью разработки праймеров для IRAP-анализа полиморфизма ДНК в лаборатории растительной геномики Института биотехнологии университета Хельсинки (Финляндия) проведены клонирование и секвенирование последовательностей ДНК 5 редких реликтовых видов растений Пермского края. Клонирование последовательностей ретротранспозонов осуществляли с помощью нового универсального метода (Kalendar et al., 2008), основанного на использовании ПЦР с праймерами из консервативного участка связывания tRNA (PBS, Primer Binding Site), непосредственно прилегающего к левому прямому повтору LTR (Long Terminal Repeats) в центральной части ретротранспозона. Все ПЦР продукты амплификации с универсальными PBS праймерами были  клонированы в pGEM-T (Promega, США) плазмидный T-вектор после очистки в QIAGEN «MinElute PCR Purification Kit». Лигирование проводили при 16°C в течение 12 часов. Трансформацию плазмидной ДНК со вставками осуществляли с использованием компетентных клеток E.coli штамма JM109 (Promega). Клетки, несущие плазмиду со вставкой фрагмента чужеродной ДНК, были выявлены путем бело-синей селекции на среде с ампициллином в конечной концентрации 100мкг/мл, X-Gal (20мг/мл) и IPTG (200мг/мл). Проверка pGEM вектора на наличие клонированных ПЦР продуктов проведена с помощью ПЦР с универсальными pUC праймерами (M13 universal и reverse). Секвенирование последовательностей ДНК проведено с использованием капиллярного секвенатора ABI3700 (Biosystems, USA). В соответствии с консервативными участками LTR ретротранспозонов в различных ориентациях были разработаны праймеры с использованием программы «FastPCR» (Календарь и др., 2007). Для IRAP-анализа 5 редких видов Урала синтезированы 70 праймеров в MWG (Германия). Амплификация ДНК IRAP- и ISSR-методами была выполнена в термоциклерах «MJ Mini-Cycler» («Bio-Rad», USA) и «Терцик» (НПФ «ДНК-Технология», Москва) по типичным для IRAP- и ISSR-методов программам. Температура отжига в зависимости от G/C состава праймера варьировала при IRAP-анализе от 55° до 68°С, а при ISSR-анализе – от 56° до 60°С. Для проверки достоверности полученных спектров ДНК опыт повторяли не менее четырех раз. Амплифицированные продукты были подвергнуты электрофорезу на 1.7-2% агорозном геле в присутствии бромистого этидия. Гели были отсканированы в системе гель-документации «Gel-Doc XR» («Bio-Rad», USA). Для определения длины фрагментов ДНК использовали маркер молекулярной массы (100 bp +1.5 + 3 Кb DNA Ladder) («ООО-СибЭнзим-М», Москва) и программу «Quantity One» («Bio-Rad», USA). С целью разработки IRAP-метода проанализирован полиморфизм геномных участков 5 редких реликтовых видов растений с использованием 70 IRAP-праймеров. Эффективность выявления полиморфизма IRAP-праймерами рассчитана для A. vernalis, A. sibirica, Ad. lilifolia, D. grandiflora, P. anomala  в соответствии со  шкалой 1-5: от низкой (1) до высокой (5). У 4 –х редких реликтовых видов растений Пермского края проведен анализ полиморфизма 350 ISSR- и 450 IRAP-маркеров, том числе 219 IRAP-маркеров у 2 видов рода Adonis.

Для количественной оценки степени полиморфизма и определения уровня дивергенции между изученными популяциями, полученные данные были представлены в виде матрицы бинарных признаков, в которой наличие или отсутствие в ISSR- и IRAP-спектрах одинаковых по размеру фрагментов рассматривалось, соответственно, как состояние 1 или 0. При этом учитывали только воспроизводимые в повторных экспериментах фрагменты, изменчивость  по интенсивности не брали в расчет. Компьютерный анализ молекулярно-генетического полиморфизма ДНК проведен с помощью программы «PopGen32» и специализированного макроса «GenAlEx6» для «MS-Excel» с определением: доли полиморфных локусов (при ), общего числа аллелей (), эффективного числа аллелей () (Kimura еt al., 1964), ожидаемой гетерозиготности () (Nei, 1987). Уровень внутрипопуляционного разнообразия оценен через показатели среднее число морф () и доля редких морф () (Животовский, 1980). Объемы использованных выборок в среднем составляли 30 особей. Оценку отклонения наблюдаемых распределений генотипов от ожидаемых при равновесии Харди-Вайнберга проводили с использованием теста . Оценка генетического разнообразия внутри и между популяциями редких видов растений проведена с использованием информационной мера Шеннона (Schennon, 1949; Chalmers, 1992), которая не предусматривает существование в популяциях равновесия Харди-Вайнберга и традиционно применяется (Артюкова и др., 2004) при молекулярно-генетическом анализе редких видов растений. Индекс разнообразия Шеннона рассчитывали для каждой популяции (), среднее значение для популяций () и для суммарной выборки (), на основе этих значений определяли долю внутри- и межпопуляционного разнообразия. Для описания генетической структуры подразделенной популяции были использованы следующие параметры: ожидаемая доля гетерозиготных генотипов () во всей популяции, как мера общего генного разнообразия; ожидаемая доля гетерозиготных генотипов () в субпопуляции, как мера ее внутрипопуляционного разнообразия; доля межпопуляционного генетического разнообразия в общем разнообразии или показатель подразделенности популяций () (Nei, 1975). Генетическое расстояние между популяциями определяли по формулам M.Нея (Nei, 1978; Nei et al., 1979). На основе матриц бинарных признаков были рассчитаны матрицы генетических различий (Nei, 1972), на основании полученной матрицы невзвешенным парно-групповым методом (UPGMA – unweighed pair-grup method using arithmetic average) были построены дендрограммы, отражающие степень родства исследуемых популяций по ISSR- и IRAP-спектрам при помощи компьютерных программ «Treecon 1.3b» и «PopGen32». Молекулярно-генетическая паспортизация проведена по методике С.В.Боронниковой (2008). Проверка всех выявленных идентификационных молекулярных маркеров у всех исследованных видов проведена не менее 5 раз. Стандартные статистические анализы выполнены при помощи программ “STATISTICA 6.0” (версия 6.0.) и «MS EXCEL». Статистическая обработка данных молекулярно-генетического анализа проведена с использованием стандартных для популяционно-генетических исследований методов (Животовский, 1983, 1990; Лакин,  1990).

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

3. Биологические особенности редких реликтовых видов растений и характеристика избранных для изучения популяций

3.1. Adonis vernalis L.

В Пермском крае отмечено 19 местонахождений A. vernalis. За последние 15 лет общая численность этого вида сократилась на 20-25% (Боронникова, 2008). Показано, что основной вклад в семенное размножение A. vernalis вносят средневозрастные генеративные особи (), составляющие эффективную численность популяций. Установлено, что к популяциям с низкой общей численностью относятся Av3, Av6, Av7, Av8, Av10 (от 39 в Av7 до 184 особей в Av6), а к популяциям с высокой общей численностью – Av1,Av2, Av4, Av5, Av9 (от 248 в Av2 до 562 особей  в Av1). Нами установлено, что в изученных популяциях A. vernalis с низкой общей численностью эффективная численность варьировала от 8 (Av7) до 64 особей (Av6), а в популяциях с высокой общей численностью эффективная численность – от 99 (Av4) до 194 (Av9) особей. Популяции Av3 , Av6, Av7 и Av10 находятся под антропогенным воздействием сильной степени, популяции Av, Av2, Av5 и Av8 – средней, а Av4  и Av9 – слабой степени.

3.2. Adonis sibirica Patrin ex Ledeb.

В Пермском крае выявлено 16 местонахождений A. sibirica. Размножение этого вида в естественных условиях происходит только семенным путем. Установлено, что как и у A. vernalis, так и у A. sibirica принимают участие в семенном размножении преимущественно средневозрастные генеративные особи (). Общая численность в As1 составила 22 особи, в As2 – 246, в As3 – 257 особей. В As1 к настоящему времени эффективная численность равна 3 особям, в As2 и As3 – 89 и 77 особям соответственно. C 1994 по 2008 гг. из-за строительства горнолыжной трассы общая численность As1 сократилась на 75.00 %, а эффективная численность – на 85.71% (рис. 1). Исследованные популяции находятся под антропогенным воздействием As1 сильной, As2 средней и As3 слабой степени.

1.3. Paeonia anomala L.

В северной части Пермского края P. anomala представлен популяциями с большой стабильной численностью. В центральной части края из-за антропогенного воздействия численность популяций сокращается. Общая численность Pa2 в 1988 составляла 562 особи (Боронникова, 2002), а в 2008 году – 377 особей, то есть за 20 лет сократилась на 41.04%. Эффективная численность популяции за этот же период сократилась с 402 до 224 особей, то есть на 44.28% (рис. 1). Одной из причин сокращения показателей численности Pa2 является усиление антропогенного воздействия в связи со строительством новой автомобильной трассы в 1 км от Pa2. В Pa1 общая численность составила 957, а эффективная – 190 особей. В Pa3 общая численность составила 441 особь, а эффективная численность – 146 особей. По нашим данным в природе P. anomala размножается только семенным путем (Боронникова, 2002). Нами установлено, что в семенном размножении у P. anomala принимают участие особи g2 , редко g3. Изученные популяции находятся под антропогенным воздействием средней степени, кроме Pa2, которая испытывает антропогенное воздействие сильной степени.

As1

Pa2

Рис. 1. Динамика общей и эффективной численности первой популяции (As1)  A. sibirica и второй популяции (Pa2 ) P. anomala

1.4. Adenophora lilifolia (L.) A.DC.

Общая численность вида в крае сократилась за последние 10 лет в среднем на 15-20% (Боронникова, 2008). В изученных популяциях Ad. lilifolia этот показатель варьировал от 59 особей в Ad.lil.4 до 293 особей в Ad.lil.1, а эффективная численность – от 36 в в Ad.lil. 4 до 239 особей в Ad.lil.1. По нашим данным размножение вида в природе осуществляется и семенным и вегетативным, то есть  комбинированным способом (Боронникова, 1999). Наибольший вклад в семенную продуктивность вносят особи g2 и g3, которые и определяют эффективную численность популяций. Сильную степень антропогенного воздействия испытывает популяция Ad.lil.4, среднюю – Ad.lil.1, а слабую – Ad.lil.2 и Ad.lil.3.

1.5. Digitalis grandiflora Mill.

D. grandiflora на территории Пермского края встречается, в основном, в островной Кунгурской лесостепи, где и отмечено 12 местонахождений этого вида. Общая численность изученных популяций D. grandiflora варьировала от 56 (Dg3) до 487 особей (Dg1), а эффективная – от 40 до 304 особей соответственно. Для вида характерен комбинированный (семенной и вегетативный) способ размножения. При анализе показателей семенной продуктивности особей D. grandiflora разных возрастных групп генеративного периода было отмечено, что у средневозрастных особей показатели выше, чем у особей остальных групп (Боронникова, 2009б). Эффективная численность у данного вида представлена особями g2 и g3. Изученные популяции D. grandiflora находятся под антропогенным воздействием сильной (Dg3), средней (Dg1, Dg2) и слабой степени (Dg4, Dg5).

Таким образом, избранные для изучения 5 редких реликтовых видов представлены в Пермском крае, кроме P. anomala, небольшим числом сравнительно малых по численности популяций. Три из изученных видов (A. vernalis, A. sibirica, P. anomala) размножаются только семенным путем. Для Ad. lilifolia и D. grandiflora характерен комбинированный (и семенной и вегетативный) способ размножения. Эффективная численность популяций выявлена благодаря изучению участия в семенном размножении особей разных возрастных групп генеративного периода. Самые низкие значения данного показателя  характерны для видов рода Adonis (3 особи у A. sibirica и  8 особей у A. vernalis), а самые высокие – для P. anomala (от 146 до 224 особей).

4. Анализ генофондов редких видов растений на основании оценок полиморфизма фрагментов ДНК, фланкированных инвертированными микросателлитными повторами (ISSR-PCR маркеры)

4.1. Анализ генетического разнообразия популяций  двух видов рода Adonis

В изученных популяциях A. vernalis выявлено 109 амплифицированных ISSR-фрагментов ДНК, из которых 100 были полиморфными. Число амплифицированных фрагментов ДНК в общей выборке растений варьировало в зависимости от праймера от 19 (М9) до 29 (М12). В среднем при ISSR-анализе у A. vernalis один праймер инициировал синтез 22 фрагментов ДНК. Число полиморфных ISSR-фрагментов A. vernalis варьировало от 16 до 29, а их размеры – от 210 до 1900 пн (рис. 2).

Рис. 2. ISSR-спектр  популяции A.vernalis  (Аv1) c праймером М1: цифрами обозначены номера проб, М - молекулярный маркер, стрелками указаны некоторые полиморфные фрагменты ДНК

Доля полиморфных локусов в общей выборке в среднем (при ) составила 91.74%. В популяциях данный показатель варьировал от 34.86% в Av2 до 62.39% в Av6. Ожидаемая гетерозиготность A. vernalis по локусам равна 0.313. Этот показатель самый высокий в Av4 (0.242), а низкий – в Av2 (0.147) (Боронникова и др., 2007; Боронникова и др., 2008). Абсолютное число аллелей на локус (в нашем случае на фрагмент ДНК) на общую выборку составило 1.973, а эффективное число аллелей на локус () – 1.521. Число редких аллелей (фрагментов ДНК с частотой <=0,05) варьировало по популяциям от 0 (Av4) до 8 (Av6).

Генетическая структура изученных популяций A. vernalis: ожидаемая доля гетерозиготных генотипов в общей популяции выше (=0.313), чем в субпопуляциях (=0.184). Коэффициент подразделенности популяций () показывает, что на межпопуляционную компоненту генетического разнообразия A. vernalis приходится 41.22% разнообразия, то есть изученные популяции сильно дифференцированы (Боронникова и др., 2009г). Наименьшее генетическое расстояние между исследуемыми популяциями A. vernalis отмечено между Av2 и Av6 (0.109), а наиболее генетически удаленными являются популяции Av1 и Av4 (0.305). На дендрограмме (рис. 3) популяции A. vernalis сформировали 3 кластера по 2 выборки, соответствующие исследованным популяциям. Узлы ветвления имеют высокую поддержку (индекс бутстрепа >50%).

Рис. 3. UPGMA дендрограмма генетического сходства популяций, построенная на основании полиморфизма ISSR-маркеров A.vernalis. Шкала сверху – генетические дистанции. На дендрограмме указаны значения бутстрепа (в %)

Среднее значение индексов разнообразия Шеннона () в изученных популяциях A. vernalis, рассчитанные по ISSR-праймерам, составило 0.278. Выше этот показатель в Av4. Индекс разнообразия Шеннона, рассчитанный на общую популяцию A. vernalis, равен 0.477. На долю внутрипопуляционного генетического разнообразия A. vernalis приходится 58.40%, а на долю межпопуляционного – 42.60%. Итак, оба подхода к определению генетического разнообразия, то есть определение показателя подразделенности популяций () и коэффициента разнообразия Шеннона () у A. vernalis дали близкие результаты.

Таким образом, самые высокие показатели генетического разнообразия отмечены в популяциях Октябрского района (Av4, Av5, Av6), а самые низкие показатели – в самой северной популяции на Спасской горе (Av2). Высокое число редких аллелей в Av2 (=7) указывает на необходимость сохранения данной популяции в качестве генетически уникальной.

Полиморфизм структурных элементов генома A. sibirica был выявлен с использованием тех же ISSR-праймеров, что и у A. vernalis. В трех изученных популяциях A. sibirica ISSR-праймеры инициировали синтез меньшего, чем у A. vernalis, числа ампликонов, равного 74, из которых 66 были полиморфными ( =89.19%). Размеры ампликонов в A. sibirica варьировали от 270 до 1620 пн. В среднем при ISSR-анализе у A. sibirica один праймер инициировал синтез 14.8 фрагментов ДНК, что значительно меньше, чем у A. vernalis (22 ампликона). Высокий процент полиморфизма ISSR-маркеров отмечен в As3 (=81.08%), а самый низкий – в As1 (=35.13%). Низкие значения ожидаемой гетерозиготности () отмечены в As1 (0.142), а высокие – в As2 (0.243). В общей популяции A. sibirica ожидаемая гетерозиготность выше и составила 0.356. Абсолютное число аллелей на локус на общую выборку A. sibirica составило 1.914. Этот параметр выше в As2 и ниже в As1. Эффективное число аллелей на локус () на общую популяцию составило 1.608. Наибольшее значение данного показателя отмечено в As3 (1.409), а его резкое снижение – в As1 (1.257). Наибольшее число редких аллелей отмечено в As3 (=11). Редкие аллели отсутствуют в As1, что свидетельствует об обеднение генофонда этой популяции. Генетическая структура популяций A. sibirica такова: ожидаемая доля гетерозиготных генотипов выше в общей популяции (=0.334), чем в субпопуляциях (=0.214). Показатель генетической подразделенности популяций () A. sibirica равен 0.358. Генетически более гетерогенна As3 (=81.08%; =0.235; =1.409), а наименьшие основные показатели генетической изменчивости отмечены в As1 (=35.13%; =0.145; =1.257). Таким образом, на межпопуляционную изменчивость у A. sibirica приходится 35.77% генетического разнообразия. Наибольшее генетическое расстояние отмечено между As2 и As3 (0.290), а наименьшее между As1 и As2 (0.166). Кластерный анализ показал, что As1  генетически ближе к As2. Третья популяция (As3) находится на большем генетическом расстоянии от первых двух популяций и характеризуется наименьшей степенью родства с ними. Среднее значение индексов разнообразия Шеннона () в изученных популяциях A. sibirica, рассчитанные по ISSR-праймерам, составило 0.292. Выше этот показатель в As3. Индекс Шеннона, рассчитанный на общую популяцию A. sibirica, равен 0.504. На долю внутрипопуляционного генетического разнообразия A. sibirica приходится 59.55%, а на долю межпопуляционного – 40.45% разнообразия.

Таким образом, молекулярно-генетический анализ двух видов рода Adonis показал, что полиморфизм ISSR-маркеров высок у обоих видов (91.74% у A.vermalis и 89.19% у A. sibirica). У A. vernalis большая часть генетической изменчивости (по данным G-статистики) является внутрипопуляционной (58.78%), на межпопуляционную изменчивость приходится 41.22 % генетического разнообразия. У A. sibirica сохраняется та же тенденция: внутрипопуляционная изменчивость составляет большую часть (64.20%), на межпопуляционную изменчивость данного вида приходится 35.77% генетического разнообразия. Среди изученных популяций A. vernalis тенденция к обеднению генофонда отмечена в Av2 (=34.86%; =0.122; =1.199; =7) и Av3 (=40.37%; =0.139; =1.125). Среди изученных популяций A. sibirica деградация генофонда выявлена у As1 (=35.13%; =0.145; =1.257). Данная популяция находится в критическом состоянии и требует экстренных мер охраны.

4.2. Анализ генетической изменчивости Adenophora lilifolia (L.) A.DC.

У Ad. lilifolia, выявлено 56 амплифицированных ISSR-фрагментов ДНК, из которых 46 были полиморфными. Число амплифицированных фрагментов ДНК в общей выборке растений варьировало в зависимости от праймера от 9 (праймеры М8, Х10) до 15 (праймер М1), а их размеры – от 279 до 1370 пн. В среднем один праймер инициировал синтез 11 фрагментов ДНК. Доля полиморфных локусов в общей выборке в зависимости от ISSR-праймера колебалась от 75.00% до 90.91% и, в среднем, составила =82.14 %. Данный показатель выше в Ad.lil.1 и ниже в Ad.lil.4. Ожидаемая гетерозиготность по локусам Ad. lilifolia составила 0.228. Абсолютное число аллелей на локус равно 1.930, а эффективное число аллелей на локус () – 1.412. Ожидаемая гетерозиготность выше в Ad.lil.3 и значительно ниже в Ad.lil.4. Абсолютное число аллелей () на локус выше в Ad.lil.1, а эффективное число аллелей на локус () и ожидаемая гетерозиготность () выше в  Ad.lil.3. Наименьшие значения эти показатели имеют в Ad.lil.4. Ожидаемая доля гетерозиготных генотипов на общую популяцию Ad. lilifolia () составила 0.270; а ожидаемая доля гетерозиготных генотипов в субпопуляциях () равна 0.228. Итак, среднее выборочное генетическое разнообразие по популяциям ниже, чем общее генетическое разнообразие в общей популяции. Коэффициент подразделенности популяций () показал, что на межпопуляционную компоненту Ad. lilifolia приходится 15.51% разнообразия (Боронникова, 2009г).

Таким образом, при молекулярно-генетическом анализе Ad. lilifolia установлено, что доля полиморфных локусов и абсолютное число аллелей выше в Ad.lil.1, а эффективное число аллелей и ожидаемая гетерозиготность – в Ad.lil.3. Все выше перечисленные показатели генетического разнообразия достоверно ниже в Ad.lil.4.

4.3. Анализ генетической изменчивости популяций

Digitalis grandiflora Mill.

При ISSR-анализе структурных элементов генома D. grandiflora выявлено 111 амплифицированных фрагмента ДНК, из которых 90 были полиморфными (81.08%). Число амплифицированных фрагментов ДНК в общей выборке растений варьировало в зависимости от праймера от 15 (X10) до 24 (M9), а их размеры – от 200 до 2200 пн. В среднем, при ISSR-анализе D.grandiflora один праймер инициировал синтез 22.2 фрагментов ДНК. Число полиморфных фрагментов в общей выборке варьировало от 14 до 22. Доля полиморфных локусов и в Dg1 и в Dg2 составила 66.36%, а в Dg3 – 50.45%. Ожидаемая гетерозиготность () D. grandiflora равна 0.237. Данный показатель выше в Dg1 (0.207). Абсолютное число аллелей на локус () у D. grandiflora равно 1.991, а эффективное число аллелей на локус () – 1.394. Абсолютное число аллелей на локус ниже в Dg1, а эффективное число аллелей на локус ниже в Dg2 и Dg3. Число редких аллелей у D. grandiflora выше, чем у других изученных видов и равно 18. Наименьшее их число отмечено в Dg1 (=3), а наибольшее – в Dg3 (=17).

Анализ генетической структуры популяций показал, что ожидаемая доля гетерозиготных генотипов на всю подразделенную популяцию D. grandiflora () равна 0.261, а в субпопуляциях () – 0.190. Показатель генетической подразделенности популяций ()  D. grandiflora равен 0.272. Таким образом, на межпопуляционную изменчивость у данного вида приходится 27.22% генетического разнообразия. Среднее значение индексов разнообразия Шеннона () в изученных популяциях D. grandiflora, рассчитанные по ISSR-праймерам, составило 0.292. Кластерный анализ показал, что Dg2 генетически ближе к Dg3 (=0.076). Dg1 находится на большем генетическом расстоянии от Dg2 (=0.269) и Dg3 (=0.329). Среди изученных популяций D. grandiflora тенденция к обеднению генофонда отмечена в Dg3 (=50.45%; =0.181; =1.281).

Таким образом, ISSR-маркеры позволяют получить ценные сведения о генетическом полиморфизме участков генома, фланкированных микросателлитными повторами, определить основные параметры генетического разнообразия и дифференциации популяций, на основании которых установить основные характеристики генофондов редких и исчезающих видов растений.

5. Анализ генетического разнообразия редких видов растений с использованием оценки полиморфизма инвертированных повторов ретротранспозонов  (IRAP-PCR маркеры)

5.1. Использование ДНК-маркеров на основе ретротранспозонов для анализа полиморфизма ДНК редких видов растений

Для изучения генофондов редких реликтовых видов растений нами избран IRAP- (Inter-Retrotransposon Amplified Polymorphism) метод анализа полиморфизма ДНК как дающий стабильные, высоко полиморфные и четко воспроизводимые маркеры. Клонирование последовательностей ретротранспозонов осуществляли с помощью нового универсального метода (Kalendar et al., 2008), основанного на использовании ПЦР с праймерами из консервативного участка связывания tRNA  (PBS,  Primer Binding Site),

Таблица 1

Эффективность праймеров из LTR последовательностей ретротранспозонов

Нуклеотидная  последовательность LTR праймера (5'-3')

A. vernalis

A. sibirica

D. grandiflora

P. anomala

Ad. lilifolia

2156

acaagttgtccaagggctttcctc

2

1

5

2157

aggtgggcgccaaactgttttgg

2

4

2194

ctactgatcatgatgccgctg

1

2

2196

ccggcgagttcagcatgtcg

1

4

2175

ttagacccggaaccgccgtg

4

1

2

2209

aattggtcaagagtggagaggac

2

1

2211

gttggagtgtatagtcccacatcg

3

2149

gtagtttcgggttcggaattgca

2

1

2197

gaagtaccgatttacttccgtgta

4

2198

atccttcgcgtagatcaagcgcca

4

2200

atgtgacagtcgactaaccac

3

2201

cctaggtggttagtcgactgtcac

5

2202

tggcgcttgatctacgcgaagga

5

2203

atcccacaacttggacgtttgctg

3

1

2204

aacttgatccagatcatctcc

4

2155

agcttgatatcccgccccggtcaa

5

1

2158

ccatcgggtccgggcaatatcg

4

1

2159

agcgaatcaacaggggctgcccga

2

3

3

2183

ttgcaaataccagtggcgggtcgt

2

2

2185

aattccacaaccgctagtggcg

4

1

2186

cggtttagaacgccacaaatgg

4

2152

agtgagcatgggagcggacaagc

2

4

4

2153

atcttttgagaccaagcttccgtc

2

1

непосредственно прилегающего к левому прямому повтору LTR (Long Terminal Repeats) в центральной части ретротранспозона.

Для секвенирования были отобраны 96 клонов, со вставками разной длины. Для подбора праймеров с использованием программы «FastPCR» (http://www.biocenter.helsinki.fi/bi/ Programs/fastpcr.htm), секвенированные последовательности клонов были отсортированы по общей последовательности.

Выявлены уникальные последовательности концевых прямых повторов LTR-ретротранспозонов. С помощью выравнивания была определена консенсус последовательность для каждого кластера LTR-последовательностей. Праймеры были подобраны на консервативных участках последовательностей LTR в обоих направлениях. Для молекулярно-генетического анализа 5 редких видов растений Пермского края (табл. 1) разработаны 70 IRAP-праймеров (Календарь и др., 2007).

Нами установлено, что наиболее эффективно выявляют полиморфизм инвертированных повторов ретротранспозонов в геномах A. vernalis, A. sibirica, Ad. lilipholia, D. grandiflora, P. anomala  IRAP-праймеры, обозначенные номерами 2155, 2156, 2175, 2197, 2198, 2201, 2202, 2204 (табл. 1). Установлена видовая специфичность исследованных IRAP-праймеров (Календарь и др., 2007; Боронникова, 2008). С целью апробации IRAP-метода дана оценка полиморфизма структурных элементов геномов, фланкированных инвертированными повторами ретротранспозонов, широко распространенных травянистых видов растений рода Hypericum и древесного ресурсного вида растений Populus tremula L. (Боронникова и др., 2009а).

5.2. Анализ полиморфизма IRAP-маркеров A. vernalis

У A. vernalis выявлено 127 амплифицированных IRAP-методом фрагментов ДНК, из которых 118 были полиморфными (=92.91%). Число выявленных IRAP-маркеров в общей выборке растений варьировало в зависимости от праймера от 19 (праймер 2202) до 31 (праймер 2197). В среднем при IRAP-анализе один праймер инициировал у A. vernalis синтез 25 фрагментов ДНК (рис. 4).

Рис. 4. IRAP-спектр  популяции A. vernalis (Аv1) c праймером 2095: цифрами обозначены номера проб, М - молекулярный маркер, стрелками указаны некоторые полиморфные фрагменты ДНК

Число полиморфных фрагментов A. vernalis варьировало от 17 до 30, а их размеры – от 190 до 2900 пн. Ожидаемая гетерозиготность по локусам () составила 0.291. Эти показатели наиболее высоки в Av5, а минимальны – в Av1. Абсолютное число аллелей на локус () на общую выборку A. vernalis составило 1.992, эффективное число аллелей на локус () – 1.497. Число редких аллелей варьировало по популяциям от 2 (Av2) до 13 (Av4), а на общую выборку равно 8 (6.29%). Отмечены уникальные фрагменты ДНК, например, в Av2 – Avu1500IR75.

Ожидаемая доля гетерозиготных генотипов на всю подразделенную популяцию A. vernalis (), определенная на основании полиморфизма IRAP-маркеров, равна 0.305, а в субпопуляциях () – 0.225. Коэффициент подразделенности популяций () продемонстрировал, что на межпопуляционную компоненту генетического разнообразия A. vernalis приходится 26.13% разнообразия. Среднее значение индексов разнообразия Шеннона в изученных популяциях A. vernalis, рассчитанное по IRAP-праймерам, составило 33.83%. Выше этот показатель в Av5. На долю внутрипопуляционного генетического разнообразия A. vernalis приходится 72.15%, а на долю межпопуляционного – 27.85%. Итак, при IRAP-анализе оба подхода к определению генетического разнообразия (коэффициент подразделенности популяций () и индекс разнообразия Шеннона ()) у изученного вида дали близкие результаты.

Таким образом, самые низкие показатели генетического разнообразия, определенные на основании полиморфизма IRAP-маркеров, отмечены в первой популяции A. vernalis (Av1) (=58.26%; =0.177; =1.281), а самые высокие показатели –в Av5 (=77.16%; =0.270; =1.445).

5.3. Анализ полиморфизма IRAP-маркеров A. sibirica

При анализе фрагментов ДНК, амплифицированных в результате ПЦР с IRAP-праймерами, у A. sibirica выявлено 92 амплифицированный фрагмент ДНК, из которых 74 были полиморфными. Доля полиморфных локусов у A. sibirica  составила (при ) 80.43%. Число амплифицированных фрагментов ДНК варьировало в зависимости от праймера от 21 (праймер 2175) до 12 (праймер 2202), а их размеры – от 270 до 2980 пн. В среднем при IRAP-анализе у A. sibirica один праймер инициировал синтез 18.4 фрагментов ДНК. Наибольшую долю полиморфных локусов выявил праймер 2204 (93.33%), а наименьшую – праймер 2202 (66.66%). Высокий полиморфизм IRAP-маркеров характерен для As3 (61.96%). Резкое снижение данного показателя (34.78%) отмечено в As1 также как и при анализе полиморфизма ISSR-маркеров. Ожидаемая гетерозиготность () в общей выборке равна 0.360, выше данный показатель в As3 (0.235). Самое низкое значение отмечено в As1 (0.143). Абсолютное () и эффективное () число аллелей на локус выше также в As2 и As3, а самые низкие значения данного показателя отмечены (также как и при ISSR-анализе) в As1. Наибольшее число редких аллелей (=5) отмечено в As3.

Ожидаемая доля гетерозиготных генотипов на всю подразделенную популяцию A. sibirica (общее генное разнообразие ()) равна 0.336, а ожидаемая доля гетерозиготных генотипов в субпопуляциях (среднее выборочное генное разнообразия по всем локусам ()) – 0.207. Коэффициент подразделенности популяций () высок и составил 0.385. Изученные популяции сильно дифференцированы, так как 38.47% разнообразия приходится на межпопуляционную и 61.53% – на внутрипопуляционную изменчивость. Оценка генетического разнообразия посредством индекса Шеннона () дала сходные результаты – на долю внутрипопуляционного генетического разнообразия A. sibirica  приходится 58.30%, а на долю межпопуляционного – 41.70%. Наименьшее генетическое расстояние между исследуемыми популяциями A. sibirica, рассчитанное на основе IRAP-анализа,  отмечено между As1 и As2 (0.165), наиболее генетически удаленными являются As1 и As3 (0.345). Итак, генетико-популяционные исследования с использованием IRAP-метода анализа полиморфизма ДНК выявили неоднородность генофондов редкого реликтового вида A. sibirica. Самые высокие  показатели генетического разнообразия характерны для As3 (=62.50%; =0.350; =1,409). Деградация генофонда при снижении численности популяции и сильном антропогенном воздействии отмечена у As1 (=33.65%; =0.143; =1.253). Необходимо осуществление экстренных мер охраны данной популяции.

Таким образом, использование ДНК-фингерпринтинга на основе ретротранспозонов оказалось весьма эффективным для оценки внутри- и межпопуляционного генетического разнообразия популяций редких и исчезающих видов растений и определения характеристик их генофондов.

6. Молекулярно-генетическая паспортизация редких видов растений

6.1. Методика молекулярно-генетической паспортизации

Методика молекулярно-генетической паспортизации редких и исчезающих видов растений разработана нами на примере природных популяций двух видов растений A. vernalis и A. sibirica (Боронникова, 2008, 2009а). Она включает в себя 7 этапов: выбор эффективных методов анализа полиморфизма ДНК, сбор материала, подбор эффективных праймеров, молекулярно-генетический анализ с использованием ПЦР, выявление идентификационных (мономорфных и полиморфных) маркеров ДНК, составление молекулярно-генетической формулы, штрих-кода и генетического паспорта.

На первом этапе разработки методики была решена задача выбора эффективных стабильных молекулярных маркеров, позволяющих выявить высокий уровень полиморфизма ДНК, анализировать большую часть генома растений, получить четко воспроизводимые результаты. Всем этим требованиям отвечают ISSR- и IRAP-маркеры.

На втором этапе паспортизации в природных популяциях двух видов рода Adonis собраны фрагменты листьев и из них выделена ДНК.

На третьем этапе  были отобраны наиболее информативные 4 ISSR- и 5 IRAP-праймеров, с помощью которых выявлены ISSR- и IRAP-маркеры у двух видов рода Adonis. Проведен ПЦР анализ выделенных проб ДНК.

На четвертом этапе для двух видов рода Adonis выявлены 17 мономорфных и 20 полиморфных фрагментов ДНК. Четко воспроизводимые при амплификации у особей одного рода фрагменты ДНК названы нами «родовыми», а у особей одного вида – «видовыми». Как родовые, так и видовые фрагменты ДНК являются мономорфными и, в основном, установлены с использованием ISSR-метода. Полиморфные фрагменты ДНК (при их различных сочетаниях) позволили составить уникальную генетическую формулу популяции.

На пятом этапе маркеры ДНК, избранные для паспортизации, представили в виде молекулярно-генетической формулы. Нами предложена новая оригинальная запись фрагмента ДНК с указанием типа фрагмента (родовой, видовой, полиморфный), длины фрагмента и указания праймера нижним индексом, например, Asv1510IR75 (табл. 2).

Таблица 2

Молекулярно-генетическая паспортизация  популяций A. vernalis и A. sibirica

Обозначение популяции

Тип

фрагментов

ДНК

Молекулярно-генетическая формула

Av1

rod

AD r 550 X11;  AD r 850 IR98;  ADr 480M3;  ADr 380M1

vid

Av v  830 M12 ; Av v 710 IR04 ; Av v  630 M1; Av v 490 X11

polimorph

Av p 900 M12; Av p 620 IR02; Av p 440 IR97; Av p 350 IR75

Av3

rod

AD r 550 X11;  AD r 850 IR98;  AD r  480 M3;  AD r  380 M1

vid

Av v  830 M12 ; Av v 710 IR04 ; Av v  630 M1; Av v 490 X11

polimorph

Av p 1200 IR97 ; Av p 760 IR97 ; Av p 620 IR02  Av p 610 IR75

Av6

rod

AD r 550 X11;  AD r 850 IR98;  AD r  480 M3;  AD r  380 M1

vid

Av v  830 M12 ; Av v 710 IR04 ; Av v  630 M1; Av v 490 X11

polimorph

Av p 1100 IR98;Av p 880 IR97; Av p 750 IR02; Av p 650 IR75

As1

rod

AD r 550 X11;  AD r 850 IR98;  AD r  480 M3;  AD r  380 M1

vid

As v 1510 IR75; As v 930 IR97; As v 610 X11; As v 430 IR98

polimorph

As р 1370 IR75; As р 750 М12

As2

rod

AD r 550 X11;  AD r 850 IR98;  AD r  480 M3;  AD r  380 M1

vid

As v 1510 IR75; As v 930 IR97; As v 610 X11; As v 430 IR98

polimorph

As р 1170 IR04; As р 750 М12

As3

rod

AD r 550 X11;  AD r 850 IR98;  AD r  480 M3;  AD r  380 M1

vid

As v 1510 IR75; As v 930 IR97; As v 610 X11; As v 430 IR98

polimorph

As р 1020 IR75; As р 320 М12

Первыми буквами названия рода (AD) мы обозначили.  родовые идентификационные фрагменты ДНК с указателем «r» от «rod» нижним индексом, например, ADr550Х11. Видовые идентификационные фрагменты  обозначены как  Av и As с указанием «v» от «vid», например, Avv830M12. Полиморфные фрагменты ДНК предлагается обозначить индексом «p» от  «polimorph», например, Avp650IR75.. Для паспортизации популяций видов рода Adonis было отобрано по 4 родовых и видовых фрагментов ДНК, а также от 1 до 4 полиморфных фрагментов ДНК, сочетания которых специфичны для исследуемых популяций (табл. 2). Это минимальное число фрагментов ДНК, с помощью которых нам удалось провести паспортизацию. Гетерогенные природные популяции можно охарактеризовать разными сочетаниями полиморфных фрагментов ДНК, причем главную роль будут играть полиморфные фрагменты, амплифицированные IRAP-методом. Сочетания полиморфных фрагментов ДНК не совпадают ни у одной из изученных популяций.

Маркер

молек. веса,пн

Штрих-код

№ фрагмента

ДНК

Обозначение

фрагмента


1

Av p 900 M12

900

2

ADr 850 R98

3

Avv 830M12

800

4

Avv710IR04

700

5

6

Av 630 M1

Avp 620IR02

600

7

AD r 550X11

500

8

9

Avv 490X11

AD r  480M3

10

Avp 440IR97

400

11

AD r  380M1

12

Av p 350 IR75

На шестом этапе паспортизации предложена запись молекулярно-генетической формулы в виде штрих-кода (рис. 5).

Рис. 5. Молекулярно-генетический штрих-код  популяции A. vernalis (Av1) Ординского района: AD r – фрагменты ДНК, общие для видов A.vernalis и A. sibirica; Avv – фрагменты ДНК, характерные для A. vernalis;Avp полиморфные фрагменты ДНК

Родовые  фрагменты предлагается обозначить толстой линией, видовые – линией средней толщины, а полиморфные фрагменты – тонкой линией. Для штрих-кода предлагается использовать от 10 до 12 штрихов, из которых четыре характерны для рода, четыре – для вида, а от 1 до 4 – для популяции. Фрагменты ДНК в штрих-коде располагаются в зависимости от их длины от большего к меньшему. Как молекулярно-генетическая формула (табл. 2), так и штрих-код (рис. 5), позволят идентифицировать принадлежность как растительного сырья, так и отдельных особей не только к роду и виду, но и к определенной популяции изученных видов редких реликтовых растений. Генофонд популяции документируется в виде формул и штрих-кода, отражающих состав аллелей в отдельных локусах генома.

На седьмом этапе молекулярно-генетической паспортизации рекомендуется составление генетического паспорта популяции. Нами разработана форма генетического паспорта популяции редкого вида растений, избраны общепринятые показатели состояния популяций и генетического разнообразия (Боронникова, 2009е).

6.2. Молекулярно-генетическая паспортизация видов рода Digitalis

Для молекулярно-генетической паспортизации видов рода Digitalis выявлены четко воспроизводимые 11 мономорфных и 12 полиморфных маркеров ДНК (Боронникова, 2009е), которые обозначены первыми тремя буквами латинского названия рода, например – DIGr460M1. Мономорфные фрагменты ДНК, характерные для вида, обозначены как Dgv520X9, а полиморфные – Dgp650IR55. Основная характеристика молекулярного маркера – его длина указана большими буквами после указания типа фрагмента – Dpv750M12. В молекулярно-генетической формуле приведены тип и номер праймера нижним индексом. Например, Dgp810IR58 амплифицирован IRAP-методом посредством праймера под номером 2158. При ISSR-анализе праймер можно записать в виде короткой формулы, например, Dgр1210(АGС)6C. Для составления молекулярно-генетической формулы популяций видов рода Digitalis в соответствии с методикой отобрано традиционно по 4 родовых и видовых маркеров (табл. 3); а также от 1 до 4 маркеров, сочетания которых специфичны для исследуемых популяций.

Таблица 3

Молекулярно-генетическая паспортизация видов рода  Digitalis

Вид

Тип

фрагментов

ДНК

Молекулярно-генетическая формула

D. purpurea

rod

DIGr 260X9, DIGr640IR97, DIGr550X10, DIGr460M1

vid

Dpv 020 M12, Dpv900X9, Dpv750 M12, Dpv680X9

D. lutea

rod

DIGr1260X9, DIGr640IR97, DIGr550X10, DIGr460M1

vid

Dluv 1230 M1, Dluv1160 IR04, Dluv1020 X9, Dluv450 X9

D. ciliata

rod

DIGr 1260 X9, DIGr 640 IR97, DIGr 550 X10, DIGr 460 M1

vid

Dcv 2600 M1, Dcv 1020 X9, Dcv 970 X10, Dcv 610 X9

D.grandiflora

rod

DIGr 1260 X9, DIGr 640 IR97, DIGr 550 X10, DIGr 460 M1

vid

Dgv1020X9, Dgv1000IR01, Dgv950X10,  Dgv 520 X9

Для генетической паспортизации исследованных популяций использованы от 10 до 12 молекулярных маркеров. Молекулярно-генетическая формула популяции Dg2, к примеру, записывается следующим образом: DIGr1260X9; DIGr640IR97; DIGr550X10;  DIGr460M1; Dgv1020X9; Dgv1000IR01; Dgv950X10;  Dgv520X9; Dgp1110М9;  Dgp810IR58; Dgp650IR55; Dgp260IR59.

Результаты молекулярно-генетической паспортизации популяций D. grandiflora  представленные в виде молекулярно-генетической формулы и штрих-кода, внесены наряду с общепринятыми показателями состояния популяций и характеристиками их генофондов в генетические паспорта (Боронникова, 2009е).

6.3. Молекулярно-генетическая паспортизация видов рода Adenophora

Для паспортизации двух видов рода Adenophora (Ad. lilifolia и  Ad. triphylla) были выделены четко воспроизводимые 11 мономорфных и 11 полиморфных маркеров ДНК. В соответствии с разработанной методикой были отобраны по 4 фрагмента ДНК, общих и специфических для двух видов этого рода. Составлены молекулярно-генетические формулы и штрих-коды 4-х изученных популяций Ad. lilifolia. Например, запись молекулярно-генетической формулы первой популяции (Ad.lil.1)  такова: Adr1610IR59; Adr840X10; Adr400M8; Adr370IR96; Ad.lilv1220IR96;

Ad.lilv1050M8; Ad.lilv920X11; Ad.lilv440IR56; Ad.lilp1100IR57; Ad.lilp920M1; Ad.lilp760IR59; Ad.lilp670IR56.

Данные об изученных популяциях Ad. lilifolia и характеристики их генофондов внесены в генетические паспорта.

С использованием разработанной методики молекулярно-генетической паспортизации составлены молекулярно-генетические формулы и штрих-коды 22 популяций 12 видов растений (Боронникова, 2009в, 2009д).

7. Концепция идентификации и оценки состояния генофондов редких  и исчезающих видов растений

7.1. Характеристика генофондов на основании анализа полиморфизма ISSR- и IRAP-маркеров

Изучение генофондов редких видов растений с использованием молекулярных маркеров ДНК опирается на оценки количественных характеристик генетического разнообразия популяций. Одной из основных количественных характеристик является процент (или доля) полиморфных локусов. Избранные для анализа состояния генофондов ISSR- и IRAP-маркеры являются высоко полиморфными, так как в зависимости от вида выявляют от 56 до 111 ISSR-маркеров и от 92 до 127 IRAP маркеров. В среднем 1 праймер выявляет 17.6 при ISSR-анализе и 22.5 фрагментов ДНК при IRAP- анализе. Общее число выявленных у 4-х редких видов растений ISSR-маркеров составило 350, а IRAP-маркеров – 450. Для проведения молекулярно-генетического анализа 4-х редких видов растений проанализированы 88 978 ампликонов. Как следует из приведенных данных, IRAP-метод позволяет выявить большее число молекулярных маркеров. Стабильность избранных для изучения маркеров подтверждается их воспроизводимостью при повторных ПЦР. В совокупности избранные нами для изучения ISSR- и IRAP-маркеры позволяют характеризовать полиморфизм большей части геномов как широко распространенных так и избранных для изучения редких реликтовых видов растений и установить  основные показатели генетического разнообразия популяций, таких как процент полиморфных локусов (), ожидаемая гетерозиготность (), абсолютное () и эффективное () число аллелей, коэффициент внутрипопуляционного разнообразия (), число () и долю () редких аллелей.

Таким образом, нами на большом фактическом материале убедительно доказано, что для оценки генетического разнообразия популяций редких и исчезающих видов растений эффективным является использование ДНК- фингерпринтинга (полилокусных спектров) высоко полиморфных и стабильных ISSR- и IRAP-маркеров.

7.2. Принципы множественного молекулярно-генетического геномного маркирования

Изученные редкие реликтовые виды растений послужили моделью для разработки и создания концепции идентификации генофондов на основании оценок полилокусного сочетания моно- и полиморфных участков ДНК. Тандемно организованные повторяющиеся последовательности ДНК различных типов широко представлены в эукариотических геномах. Они варьируют по длине кластера и размеру повторяющегося звена. Среди них наиболее полиморфными являются минисателлитные и микросателлитные ДНК, а также ретротранспозоны.

Основные принципы множественного молекулярно-генетического маркирования таковы:

- использование высоко полиморфных молекулярных маркеров, основанных на широко представленных в геномах тандемных повторах;

- использование не менее двух типов молекулярных маркеров ДНК, основанных на различных структурных повторяющихся элементах генома;

- один из используемых молекулярных маркеров должен быть основан на вариабельных элементах генома, например, мобильных генетических элементах – ретротранспозонах;

- оценка полилокусного сочетания моно- и полиморфных участков ДНК;

- выявление общих (идентификационных) для рода и вида мономорфных фрагментов ДНК и характеристика популяционных генофондов посредством сочетание полиморфных  фрагментов ДНК;

- обобщение характеристик генофондов в виде молекулярно-генетической формулы, штрих-кода и генетического паспорта.

3. Оптимизация сохранения генофондов редких видов растений посредством их молекулярно-генетической паспортизации и идентификации

Методика молекулярно-генетической паспортизации на основе ISSR- и IRAP-маркеров имеет высокую разрешающую способность, дает стабильно воспроизводимые результаты, характеризуется высоким уровнем стандартизации, как набора маркеров, так и техники выполнения анализа. Именно использование IRAP- вместе с ISSR-маркерами позволило нам провести паспортизацию гетерогенных природных популяций редких реликтовых видов растений.

Разработанная методика молекулярно-генетической паспортизации популяций редких реликтовых видов растений предлагается в качестве ключевого звена технологии идентификации генофондов редких и исчезающих видов растений, которая позволит установить уровень и состав генетического разнообразия на популяционном уровне, выявить популяции с типичными и специфическими характеристиками генофондов, рекомендовать научно обоснованные меры их сохранения, то есть оптимизировать процедуру сохранения генофондов наиболее уязвимых в растительных сообществах редких и исчезающих видов растений. Эта технология является одним из подходов оптимизации сохранения генетической компоненты биоразнообразия растительных сообществ.

7.4. Показатели генетической дифференциации популяций

Специфической особенностью редких реликтовых видов растений являются низкие показатели численности их популяций. Влияние общей, репродуктивной и эффективной численности популяций на показатели генетического разнообразия изучено на примере 10 популяций A. vernalis, которые распределены по показателю общей численности в две группы: популяции с низкой (Av3, Av6, Av7, Av8, Av10) и высокой (Av1,Av2, Av4, Av5, Av9) общей численностью. Нами установлено, что эффективную численность или эффективный размер популяций данного вида составляют, в основном, средневозрастные генеративные особи ().

Высокая линейная корреляция достоверно установлена между долей средневозрастных генеративных особей () и индексом разнообразия Шеннона (=0.958; =0.0001), ожидаемой гетерозиготностью (=0.963 и =0.002) и числом эффективных аллелей (=0.970, и =0.001). Аналогичная картина наблюдается, если сравнить данные показатели отдельно в популяциях с низкой и высокой общей численностью.

При изучении генетической структуры подразделенной популяции  установлено, что в популяциях с высокой общей численностью коэффициент подразделеной популяции () составил 0.169, а в популяциях с низкой общей численностью – 0.371. Нами достоверно ( (1.77) > (1.39)) установлено, что популяции A. vernalis с низкой общей численностью дифференцированы в большей степени.

Таким образом, с учетом специфики редких реликтовых видов растений рекомендуемые нами генетико-статистические параметры позволяют установить характеристики их генофондов и дают адекватные и стабильные оценки генетической дифференциации популяций.

7.5. Отбор объектов для сохранения и меры охраны генофондов редких реликтовых видов растений

Для отбора в качестве объектов сохранения генофондов рекомендуются локальные группы популяций с наиболее типичными характеристиками генофондов, такие как популяции A. vernalis, расположенных в центральной части островной Кунгурской лесостепи: Av4 (=61.47%; =0.243; =1.423; =1.539; =0); Av5 (=57.80%; =0.222; =1.380; =1.527; =4); Av6 (=62.39%; =0.232; = 1.389;=1.580; =8). Кроме этого для сохранения генофондов в качестве генетически более гетерогенных рекомендуются отдельные популяции: A. sibirica – As3 Ильинского района (=81,08%;  =0,235; =1,409; =11), Ad. lilifolia – Ad.lil.3 Ординского района (=75.00%; =0,275; =1,462; =1.685; =0), D. grandiflora – Dg2 Кунгурского района (=66.36%;  =0,182; =1,784; =1.760; =14). К объектам сохранения со специфичными характеристиками генофондов, то есть со специфическими сочетаниями полиморфных локусов, относятся: самая северная (Av2) популяция A. vernalis на Спасской горе (=34.86%; =0.122; =1.199; =7), Av1 (=58.26%; =0.177; =1.281; =4) Dg3 (=50.45%; =0,1810; =1,2807; =17), расположенные в островной Кунгурской лесостепи, а также Ad.lil.1 (=80.36%; =0.250; =1.402; =0), и As1 (=35.13%; =0.141; =1,257 =0) из центральной части Пермского края.

На основании обобщения данных, представленных в данной диссертационной работе, рекомендуются следующие меры по сохранению генофондов изученных редких реликтовых видов растений:

1. Поддержание генетического разнообразия популяций изученных видов путем сохранения на уровне не ниже исторически сложившегося эффективного размера популяций за счет устранения или снижения антропогенного воздействия: прекращение строительства объектов туризма и зон отдыха на склонах, где обитает вид; изъятия щебня, снижение рекреационной нагрузки, сбора цветущих растений, пожаров.

2. Картирование избранных для сохранения генофондов популяций и строгое их сохранение и учет их уникальности при планировании и проведении строительных,  нефтедобывающих, хозяйственных и иных работ.

3. Мониторинг  популяционных характеристик и генетического разнообразия  избранных для сохранения популяций редких реликтовых видов растений.

4. Для сохранения генофонда природных популяций редких и исчезающих видов растений необходима их молекулярно-генетическая идентификация и паспортизация на популяционном уровне и выявление на ее основе объектов для сохранения генетического разнообразия.

5. Для  третьей и шестой популяций A. vernalis, второй популяции A. sibirica, для третьей популяции D. grandiflora  необходимы экстренные меры охраны, а именно снижение общей антропогенной нагрузки (запрет на разрушение склонов, на которых расположены популяции, ограничение выпаса скота и посещения людей путем создания ОППТ).

6. Для сохранения генофондов D. grandiflora  и  Ad. lilifolia помимо сохранения in situ рекомендуется отбор особей из популяций как с наибольшим типичными (Dg1) и (Ad.lil.1), так и со специфичными характеристиками генофондов  (Dg2; Ad.lil.3) для введения в культуру в ботанические сады  с последующей реинтродукцией.

7. В связи с ограниченной возможностью  разведения в культуре двух изученных видов рода Adonis необходимо охранять природные популяции этих видов. Кроме этого рекомендуется консервация в генетических банках полноценных семян, отобранных в связи с сильной генетической дифференциацией популяций на основе максимальной представленности генетического разнообразия каждой из немногочисленных  природных популяций этих видов.

8. При сильной дифференциации популяций рекомендуется создание промежуточных популяций с целью поддержания генетического разнообразия.

Выводы

1. Для оценки генетической изменчивости редких и исчезающих видов растений рекомендуется метод ДНК-фингерпринтинга с использованием высоко полиморфных стабильных ISSR- и IRAP-маркеров, позволяющий эффективно оценить полиморфизм локусов в геноме и выявить основные показатели генетического разнообразия популяций.

2. С целью оптимизации сохранения генетической компоненты биологического разнообразия разработаны принципы множественного молекулярно-генетического геномного маркирования, создана концепция идентификации генофондов редких и исчезающих видов растений на основании оценок полилокусного сочетания моно- и полиморфных участков ДНК модельных редких реликтовых видов растений Пермского края рода Adonis, Ad. lilifolia и D. grandiflora.

3. Показано, что изученные редкие реликтовые виды растений характеризуются высоким уровнем генетической изменчивости: на основании полиморфизма IRAP-маркеров установлены доля полиморфных локусов () в пределах от 81.08% до 91.74%, ожидаемая гетерозиготность () – от 0.228 до 0.356, а эффективное число аллелей () – от 1.394 до 1.608; на основании полиморфизма IRAP-маркеров – доля полиморфных локусов в пределах от 80.43% до 92.91%, ожидаемая гетерозиготность – от 0.291 до 0.432, а эффективное число аллелей – от 1.496 до 1.759.

4. Выявлено, что генетическая изменчивость у исследованных редких реликтовых видов растений варьирует в узких пределах (уровень полиморфизма ISSR-маркеров – от 81.08 % у D. grandiflora до 91.74 % у A. vernalis; уровень полиморфизма IRAP-маркеров – от 80.43% у A. sibirica до 92.91%  A. vernalis), не смотря на небольшую эффективную численность популяций, а также их дифференциацию и изолированность.

5. Установлено, что основные показатели генетического разнообразия изученных популяций A. vernalis достоверно (=0.963 и =0.002  для ожидаемой гетерозиготности; =0.970, и =0.001 для числа эффективных аллелей; =0.958 и =0.001 для индекса разнообразия Шеннона) и линейно коррелируют с долей средневозрастных генеративных особей (), составляющих эффективную численность изученных популяций.

6. Виды рода Adonis характеризуются высоким уровнем межпопуляционной дифференциации ( равен 41.22% у A. vernalis и 35.77% у A. sibirica). Величина параметра ниже у D. grandiflora (27.22 %) и Ad. lilifolia (15.51%).

7. Генофонд исследованных популяций D. grandiflora способен самовоспроизводиться без вмешательства извне при условии сохранения существующих популяций, их эффективной численности (как определено в работе, изменяющийся в популяциях от 40 до 304 особей) и существующего уровня семенной продуктивности (в среднем около 2350 полноценных семян на особь в год). Генофонд Ad. lilifolia обеднен из-за отсутствия редких аллелей, но также способен к самовоспроизводству при сохранении существующей эффективной численности популяций (от 36 до 239 особей) и при формировании на каждой особи около 570 полноценных семян в год.

8. Выявлено, что у A. vernalis и A. sibirica часть популяций находится на пороге деградации генофонда из-за антропогенных факторов, среди которых преобладает разрушение местонахождений из-за строительства горнолыжной трассы (As1), нефтепровода (Av7), дорог (Av10), а также вытаптывание вследствие выпаса скота и посещения людьми.

9. Для отбора в качестве объектов сохранения рекомендуются локальные группы популяций с наиболее типичными характеристиками генофондов, такие как популяции A. vernalis, расположенных в центральной части островной Кунгурской лесостепи (Av4, Av5, Av6), а также  отдельные популяции, такие как третья (As3) популяция A. sibirica из Ильинского района, третья (Ad.lil.3) популяция Ad. lilifolia  из Ординского района и вторая (Dg2) популяция D. grandiflora из Кунгурского района Пермского края.

10. Установлены специфические характеристики генофондов, то есть специфические сочетания аллелей многих локусов, для ряда популяций: самой северной популяции A. vernalis на Спасской горе (Av2); для первой популяции A. vernalis (Av1) и для третьей (Dg3) популяция D.grandiflora, расположенных в островной Кунгурской лесостепи; а также для первой (Ad.lil.1) популяции Ad. lilifolia, расположенной на горе Подкаменной, и первой (As1) популяции A. sibirica из центральной части Пермского края.

11. С помощью разработанной нами технологии идентификации генофондов редких видов растений и ее ключевой части (методики молекулярно-генетической паспортизации) на основании молекулярно-генетического анализа установлены уровень и состав генетического разнообразия популяций, выявлены популяции с типичными и специфическими характеристиками генофондов, даны научно обоснованные рекомендации по сохранению генофондов с учетом уровней внутри- и межпопуляционного генетического разнообразия, то есть разработана модельная система оптимизации сохранения генофондов редких и исчезающих видов растений.

Список основных работ, опубликованных  по теме диссертации

Статьи в научных журналах, рекомендованных ВАК РФ

  1. Боронникова С.В. Семенная продуктивность некоторых видов сем. Campanulaceae (Пермская обл.) // Раст. ресурсы. 1999. Вып.2. С.43–48.
  2. Боронникова С.В. Семенная продуктивность Lilium martagon L. subsp. pilosiusculum (Freyn) Miscz. Ex Iljin и Paeonia anomala L. (Пермская обл) // Раст. ресурсы. 2002. Вып.3. С. 50–53.
  3. Боронникова С.В., Кокаева З.Г., Гостимский С.А., Дрибноходова О.П., Тихомирова Н.Н. Анализ ДНК-полиморфизма реликтового вида Урала наперстянки крупноцветковой (Digitalis  grandiflora Mill.) с помощью RAPD и ISSR маркеров // Генетика. 2007. Т.43, №5. С.653–659.
  4. Боронникова С.В., Тихомирова Н.Н. Анализ генетической изменчивости популяций двух редких лекарственных видов рода Adonis с использованием ISSR-маркеров // Известия ТСХА. 2008. №1. С.86–94.
  5. Боронникова С.В. Молекулярное маркирование и генетическая паспортизация ресурсных и редких видов растений с целью оптимизации сохранения их генофондов // Аграрный вестник Урала. 2009а. №2 (56). С. 57–59.
  6. Боронникова С.В., Тихомирова Н.Н. Семенная продуктивность редкого лекарственного вида Digitalis grandiflora Mill. в Пермском крае // Раст. ресурсы. 2009б. №2. С.17-22.
  7. Боронникова С.В. Генетическая паспортизация популяций редких видов растений рода Adonis c использованием ISSR- и IRAP-маркеров // Известия ТСХА. 2009в. №1. С. 83–89.
  8. Боронникова С.В., Светлакова Т.Н.,  Бобошина И.В. Изучение генетического полиморфизма Populus tremula L. с использованием ISSR- и IRAP- маркеров // Аграрная Россия. 2009а. №2. С.20–22.
  9. Боронникова С.В., Тихомирова Н.Н., Кравченко. О.А. Характеристика генофондов редкого лекарственного вида Adonis vernalis L. с использованием ISSR-маркеров // Аграрный вестник Урала. 2009б. № 5 (59). С.67–70.
  10. Боронникова С.В. Исследование генетической изменчивости популяций редкого вида Урала Adenophora lilifolia (L.) A.DC. на основании анализа полиморфизма ISSR-маркеров // Генетика. 2009г. Т. 45, №5. С.652–655.
  11. Боронникова С.В. Молекулярно-генетическая паспортизация редких реликтовых видов растений // Вестник Новосибирского государственного университета. 2009е. Т.7, вып.3. С.3–8.
  12. Боронникова С.В. Генетическая паспортизация редких видов растений как основа оптимизации сохранения их генофондов // Вопросы современной науки и практики. Университет им. В.И.Вернадского. 2009д. №3 (17). С.8–15.

Монографии

1. Боронникова С.В. Молекулярно-генетическая идентификация и паспортизация редких и находящихся под угрозой уничтожения  видов растений. Перм. ун-т.  Пермь, 2008. 120 с.

2. Красная книга Пермского края / науч. ред. А.И. Шепель. Пермь: Книжный мир, 2008. 256 с. (Коллективная монография).

Учебно-методическое пособие

1. Молекулярная генетика: учебно-методическое пособие / под. ред С.В. Боронниковой; Перм. ун-т. Пермь, 2007. 150 с.

Публикации в других  изданиях

  1. Боронникова С.В. Изучение репродуктивной биологии редких видов растений Урала // Содержание и формы экологического образования в педвузе. Часть 2. Тезисы второго республиканского совещания-семинара. Пермь,1990. С.104–106.
  2. Верещагина В.А., Боронникова С.В. Охрана генофонда дикорастущих декоративных растений Предуралья // Охраняемые природные  территории. Проблемы выявления, исследования, организации систем: Тезисы докладов межвузовской научной конференции. Часть 2. Пермский университет. Пермь, 1994. С.8–10.
  3. Боронникова С.В. Репродуктивная биология колокольчиковых // Вестник Пермского университета. Биология. 1995. Вып. 1. С. 28–36.
  4. Боронникова С.В. Репродуктивная биология декоративных дикорастущих видов растений Предуралья. Тезисы докладов V научной конференции памяти проф. А.А.Уранова. // Популяции и сообщества растений: экология, биоразнообразие, мониторинг. Кострома, 1996. Ч. 2. С. 102–103.
  5. Боронникова С.В. Влияние антропогенного фактора на семенную продуктивность колокольчиковых // Жизнь популяций в гетерогенной среде. Ч.2. Йошкар-Ола: Периодика Марий Эл, 1998. С.151–152.
  6. Боронникова С.В. Репродуктивная биология некоторых охраняемых растений Предуралья // Флористические и геоботанические исследования в Европейской России: Материалы Всероссийской научной конференции, посвященной 100-летию со дня рождения проф. Фурсаева. Саратов, 2000. С.403–405.
  7. Боронникова С.В.,  Жуйкова Н.А., Матюшина М.А. Некоторые аспекты репродуктивной биологии колокольчиковых // Вестник Пермского университета. Заказник "Предуралье". Вып. 3. Пермь, 2000. С.164–167.
  8. Боронникова С.В., Куницына Е.Г. Оценка состояния двух ценопопуляций пиона уклоняющегося в Пермской области // Вестник Пермского университета. Биология. Вып.4. Пермь, 2001. С.17–21.
  9. Боронникова С.В., Бердникова Ю.В., Галиева Т.А Оценка состояния ценопопуляций некоторых редких видов растений в Пермской области // Фундаментальные и прикладные проблемы популяционной биологии. Сборник тезисов докладов VI Всероссийского популяционного семинара. Нижний Тагил, 2002. С.16–18.
  10. Боронникова С.В. Семенная продуктивность редких видов Пермской области // Ботанические исследования в азиатской России: Материлы XI съезда Русского ботанического об-ва. Барнаул: Изд-во АзБуки, 2003.Т.3. С.292–293.
  11. Боронникова С.В., Стамикова Е.И. К оценке состояния ценопопуляций некоторых редких видов растений // Растительный покров Пермской области и его охрана: межвузовский сборник научных трудов. Пермь, 2003. С.38–44.
  12. Боронникова С.В. Гетерогенность ценопопуляций двух видов рода Adonis L. // Вестник Пермского университета. Биология. Вып. 6. Пермь: ПГУ, 2005. С.22–36.
  13. Tihomirova N.N., Boronnikova S.V, Kokaeva Z.G., Gostimsky S.A. Molecular genetic investigations of medical plants // Proceedings of the IV Balkan Botanical Congress. (Sofia, 20–26 June 2006). Sofia, 2006. P.35.
  14. Кокаева З.Г., Боронникова С.В., Тихомирова Н.Н., Дрибноходова О.П. Анализ генетического разнообразия популяционных систем редких и ресурсных видов растений // IY Международная научная конференция «Биотехнология – охране окружающей среды». Доклады МОИП. Москва, 2006. С. 75–79.
  15. Кокаева З.Г., Гостимский С.А., Боронникова С.В. Анализ изменчивости природных популяций редкого вида растений Предуралья Digitalis grandiflora Mill. с помощью молекулярных маркеров // Материалы международной научно-практической конференции и YII Международного симпозиума «Нетрадиционные и редкие растения, природные соединения и перспективы их использования». Белгород, 2006. Т.2. С.12–16.
  16. Тихомирова Н.Н., Боронникова С.В. Структура ценопопуляций и семенная продуктивность Digitalis grandiflora Mill. в Предуралье // Бюллетень Ботанического сада Саратовского государственного университета. Вып.5. Материалы Всероссийской научной конференции «Ботанические исследования в Поволжье и на Урале», посвященные 50-летию Ботанического сада СГУ им. Чернышевского. Саратов, 2006. С.77–82.
  17. Тихомирова Н.Н., Боронникова С.В. ДНК-полиморфизм и демографические характеристики популяций некоторых редких видов растений Предуралья // Международная конференции «Генетика в России и мире, посвященная 40-летию Института общей генетики им. Н.И.Вавилова РАН». Москва, 2006. С.200.
  18. Боронникова С.В., Кокаева З.Г., Тихомирова Н.Н. Генетическое разнообразие популяций некоторых редких видов растений Пермского края при антропогенных воздействиях // Международная научно–практическая конференция «Антропогенная динамика природной среды»: Материалы международной научно–практической конференции. Пермь, 2006.Т. II. С.107–112.
  19. Календарь Р.Н, Боронникова С.В. Анализ молекулярно-генетического полиморфизма природных популяций редких видов растений Урала с помощью ретротранспозонов // Материалы Четвертого Московского международного конгресса «Биотехнология состояние и перспективы развития». М.: ЗАО «Экспо–биохим–технологии», РХТУ им. Д.И. Менделееева, 2007.Ч.2. С.121.
  20. Тихомирова Н.Н., Боронникова С.В., Кокаева З.Г., Гостимский С.А. Анализ генетического разнообразия популяций лекарственных и редких видов растений Урала // Материалы Четвертого Московского международного конгресса «Биотехнология: состояние и перспективы развития» М.: ЗАО «Экспо–биохим–технологии», РХТУ им. Д.И. Менделееева, 2007.Ч. 2. С. 122–123.
  21. Боронникова С.В. Популяционно–генетический мониторинг генофондов редких ресурсных видов растений Пермского края // Флора Урала в пределах бывшей Пермской губернии и ее охрана: материалы межрегиональной конференции, посвященной 140-летию со дня рождения П.В.Сюзева / под ред. Е.И.Демьяновой / С.А.Овеснова / Л.Г.Переведенцевой. Пермь, 2007. С.37– 43.
  22. Боронникова С.В., Дрибноходова О.П., Кокаева З.Г., Мандрица С.А., Суслонов А.В., Тихомирова Н.Н., Шибанова Н.Л. Динамика генетического разнообразия и структуры популяционных систем ресурсных растений Пермского края при антропогенных воздействиях // Региональный конкурс РФФИ-Урал: Результаты научных исследований, полученные в 2007 г. Пермь, Екатеринбург, 2008. Ч.2. С.60–63.
  23. Боронникова С.В. Анализ генетического разнообразия популяций редких видов растений как критерий оценки их состояния // Фундаментальные и прикладные проблемы ботаники в начале XXI века: Материалы всероссийской конференции. Петрозаводск: Карельский научный центр РАН, 2008. Ч.3. С.323–326.
  24. Боронникова С.В., Тихомирова Н.Н. Анализ генетической изменчивости некоторых редких лекарственных видов растений // Научное наследие Н.И.Вавилова – фундамент для развития отечественного и мирового сельского хозяйства.  M.: Изд-во РГАУ-МСХА имени К.А.Тимирязева, 2008. С. 222–229.
  25. Боронникова С.В., Календарь Р.Н. Ретротранспозоны в геномах лекарственных растений // Нанотехнологии в сельском хозяйстве: Доклады Международной научно-практической конференции. М.: Изд-во РГАУ-МСХА имени К.А.Тимирязева, 2008. С. 20–21.
  26. Боронникова С.В., Тихомирова Н.Н., Светлакова Т.Н., Смирнова А.В., Кравченко О.С., Королева Ю.А., Рудина М.Н. Использование микросателлитов для анализа геномов редких видов растений // Нанотехнологии в сельском хозяйстве: Доклады Международной научно-практической конференции. М.: Изд-во РГАУ-МСХА имени К.А.Тимирязева, 2008. С. 107–108.
  27. Светлакова Т.Н., Бобошина И.В., Королева Ю.А. Боронникова С.В. Использование ДНК-технологий для оценки состояния популяций ресурсных видов растений // Нанотехнологии в сельском хозяйстве: Доклады Международной научно-практической конференции. М.: Изд-во РГАУ-МСХА имени К.А.Тимирязева, 2008. С.109–110.
  28. Боронникова С.В. Адонис весенний – Adonis vernalis L. // Красная книга Пермского края. Пермь: Книжный мир, 2008. С.120.
  29. Боронникова С.В. Бубенчик лилиелистный – Adenophora lilifolia (L.) A.DC. // Красная книга Пермского края. Пермь: Книжный мир, 2008. С.157.
  30. Боронникова С.В., Р.Н. Календарь . Использование молекулярных маркеров на основе ретротранспозонов для анализа и сохранения генофондов редких видов растений // Материалы Пятого Московского международного конгресса «Биотехнология:состояние и перспективы развития» М.: ЗАО «Экспо–биохим–технологии», РХТУ им. Д.И. Менделееева, 2009. Ч.2. С.201.
  31. Боронникова С.В. Молекулярно-генетическая паспортизация и идентификация редких лекарственных растений // Материалы Пятого Московского международного конгресса «Биотехнология: состояние и перспективы развития». М.: ЗАО «Экспо–биохим–технологии», РХТУ им. Д.И.Менделееева, 2009. Ч. 1. С.269–270.
  32. Тихомирова Н.Н., Боронникова С.В. Анализ геномов лекарственных растений с использованием молекулярных маркеров // Материалы Пятого Московского международного конгресса «Биотехнология: состояние и перспективы развития». М.: ЗАО «Экспо–биохим–технологии», РХТУ им. Д.И.Менделееева, 2009. Ч1. С.213.
  33. Боронникова C.В. Генетическая паспортизация природных популяций редких видов растений с использованием ISSR- и IRAP-маркеров // Материалы Съезда генетиков и селекционеров, посвященный 200-летию со дня рождения Чарльза Дарвина, V Съезда Вавиловского общества генетиков и селекционеров. М., 2009 Ч.II. с.149.
 



© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.