WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

ГАРАНИНА Светлана Борисовна

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ МЕТОДЫ И КОМПЬЮТЕРНЫЕ ТЕХНОЛОГИИ В СИСТЕМЕ ЭПИДЕМИОЛОГИЧЕСКОГО НАДЗОРА

ЗА ХАНТАВИРУСНЫМИ ИНФЕКЦИЯМИ

14.00.30 – эпидемиология

03.00.06 - вирусология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук

Москва - 2009

Работа выполнена в Федеральном государственном учреждении науки «Центральный НИИ эпидемиологии» Роспотребнадзора.

Научные консультанты:

Доктор биологических наук  Платонов  Александр Евгеньевич

Член-корреспондент РАМН,

доктор медицинских наук, профессор Кутырев Владимир  Викторович

Официальные оппоненты:

Доктор медицинских наук, профессор Ющенко  Галина  Васильевна

Заслуженный деятель науки РФ,

доктор медицинских наук, профессор Самойлова Любовь Владимировна

Член-корреспондент РАМН,

доктор медицинских наук, профессор  Урываев  Леонид Викторович

Ведущая организация: Государственное учреждение Институт полиомиелита и вирусных энцефалитов им. М.П. Чумакова РАМН.

Защита диссертации состоится «_____» _______________ 2009 г. в 11 часов на заседании диссертационного совета Д 001.007.02 в Государственном учреждении научно-исследовательском Институте эпидемиологии и микробиологии им. Н.Ф. Гамалеи РАМН по адресу:123098, г. Москва, ул. Гамалеи, д.18.

С диссертацией можно ознакомиться в библиотеке ГУ НИИ эпидемиологии и микробиологии им. Н.Ф. Гамалеи РАМН

Автореферат диссертации разослан  "______" ________________________ 2009 г.

Ученый секретарь диссертационного совета

доктор медицинских наук, профессор Русакова Екатерина  Владимировна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Геморрагическая лихорадка с почечным синдромом (ГЛПС) является одним из наиболее распространенных вирусных, природно-очаговых инфекционных заболеваний человека на территории Российской Федерации. Этиологическими агентами ГЛПС являются хантавирусы - представители семейства Bunyaviridae, рода Hantavirus.

Официальная регистрация заболеваемости в стране введена в 1978 году. Начиная с этого времени и по 2007 г. было зарегистрировано более 184 тысяч случаев ГЛПС в 71 из 83 субъектов РФ. В последние годы отмечается высокая эпизоотическая активность природных очагов хантавирусов, при этом постоянно сохраняется потенциальная опасность заражения людей, находящихся на эндемичных территориях. В настоящее время на территории РФ выявлена циркуляция хантавирусов - Пуумала, Добрава, Хантаан, Сеул, Амур, Тула, Топографов и Хабаровск, которые определяют существование эндемичных природных очагов ГЛПС (Р.А. Слонова с соавт. 1996; Е.А. Ткаченко, С.Г. Дроздов 2002; Л.И. Иванов с соавт. 2003). Установлено, что динамика и интенсивность эпидемических проявлений ГЛПС, различная степень тяжести заболеваний и уровень летальности тесно связаны с инфицированием определенными гено-(серо) типами хантавирусов (Е.В. Лещинская с соавт. 1990).

Известно, что природными резервуарами хантавирусов и источниками заражения людей являются мышевидные грызуны. В отличие от других вирусов семейства Bunyaviridae хантавирусы не передаются членистоногими, инфицирование людей происходит преимущественно при контакте с выделениями зараженных грызунов (Е.А. Ткаченко с соавт. 2001).

Отсутствие тенденции к снижению заболеваемости ГЛПС, расширение ареала инфекции, участившиеся случаи возникновения непрогнозируемых вспышек ГЛПС, ассоциированных с новыми хантавирусами, свидетельствуют о несовершенстве действующей системы эпидемиологического надзора.

Слежение за эпизоотическим процессом является одним из основных компонентов эпиднадзора за ГЛПС. Своевременное выявление важных критериев напряжённости эпизоотического процесса, таких как численность грызунов, индексы доминирования основных носителей, уровень их инфицированности и т.д., нацелено на своевременное прогнозирование осложнения эпидситуации. Однако традиционно используемые методы в эпизоотологических исследованиях не позволяют оценить спектр циркулирующих вирусов, определить перечень их основных носителей, что снижает эффективность противоэпидемических мероприятий в целом. Знания об особенностях природных очагов, приуроченных к различным ландшафтно-географическим зонам, позволяют своевременно выявлять предвестники эпизоотической активности очагов и правильно определять тактику профилактических мероприятий (А.Д. Бернштейн с соавт. 2004).

Преимущества молекулярно-генетических методов в отношении диагностики (детекции, идентификации) хантавирусов приобретают особую значимость в связи с существующими трудностями при размножении этих вирусов в клеточных культурах и отсутствием удачной лабораторной модели инфекции. ПЦР является практически единственным методом, позволяющим дать прямое доказательство наличия хантавирусов в различных биологических материалах, полученных как от человека, так и от животных (А.Е. Деконенко, Е.А. Ткаченко 2004). Беспрецедентным в вирусологии является выделение 9-ти самостоятельных видов хантавирусов (Bayou, Laguna Negra, Isla Vista, Rio Mamore и др.), циркулирующих на Американском континенте, только на основании данных о нуклеотидных сиквенсах их геномов, без изоляции вирусной культуры (A. Plyusnin 2002).

Эпидемический процесс при ГЛПС чрезвычайно сложен и зависит от большого числа факторов – социально-экономических, экологических, природно-климатических, которые не всегда поддаются быстрому и объективному анализу. Оценивая пути оптимизации эпидемиологического надзора за хантавирусными инфекциями, следует признать важность практического внедрения информационно-аналитических технологий, позволяющих достоверно оценивать связь значимых эпидемиологических параметров с ландшафтно-географическими характеристиками изучаемых территорий. Использование в целях эпидемиологического надзора за природно-очаговыми инфекциями ГИС-технологии позволяет проводить ретроспективный и оперативный эпидемиологический анализ в режиме реального времени (Б.Л. Черкасский с соавт. 2005), оценивать эпидемическую активность природных очагов, и определять риск инфицирования людей (R.J. Eisen с соавт. 2007; C. Linard с соавт. 2007).

Актуальность проблем, изложенных выше, послужила основанием для проведения данной работы.

Цель работы разработка и адаптация молекулярно-генетических методов и современных компьютерных технологий для усовершенствования научно-теоретических и практических основ эпидемиологического надзора за хантавирусными инфекциями.

Основные задачи исследования.

  1. Провести анализ эпидемических проявлений ГЛПС на территории РФ
    и обосновать необходимость оптимизации эпидемиологического надзора за хантавирусными инфекциями.
  2. Усовершенствовать схемы лабораторно-диагностических и эпизоотологических исследований в системе эпиднадзора за ГЛПС на основе молекулярно-генетических методов.
  3. Разработать и адаптировать молекулярно-генетические методы для индикации и дифференциации вирусов комплекса ГЛПС. Оценить возможности молекулярных технологий (ПЦР-анализа, секвенирования РНК-изолятов) при изучении заболеваемости в очагах ГЛПС.
  4. Провести генотипирование и филогенетический анализ новых хантавирусов, выявить молекулярные маркёры для дифференциации штаммов на уровне подвида. Оценить гетерогенность популяций хантавирусов, формирующих природные очаги инфекции на Европейской части Российской Федерации.
  5. Определить структуру и сформировать информационную базу данных в электронном формате для картографического анализа эпидемиологически значимых параметров с помощью технологии географической информационной системы.
  6. Провести оценку эпидемического потенциала территории и определить степень риска заражения людей ГЛПС с использованием информации о молекулярно-эпидемиологических особенностях циркуляции хантавирусов на основе ГИС-технологии (на модели Липецкой области).
  7. Обосновать роль и значение современных методических подходов и технологий для оптимизации эпидемиологического надзора за ГЛПС.

Научная новизна и теоретическая значимость.

Сформированы основные положения молекулярно-эпидемиологического мониторинга, необходимые для оптимизации эпидемиологического надзора за ГЛПС на современном этапе.

Использование разработанных молекулярно-генетических методик (на основе ПЦР-анализа и секвенирования фрагментов генома) позволило впервые изучить генетическое разнообразие популяций вирусов комплекса ГЛПС и оценить эпидемиологический потенциал природно-очаговых территорий с учётом спектра циркулирующих хантавирусов. Впервые картографический анализ эпидемиологически значимых критериев, выполненный на основе ГИС-технологии с применением математических и статистических методов, позволил объективно провести эпидемиологическое районирование модельной территории  по уровню опасности инфицирования ГЛПС.

Показаны возможности использования ПЦР-анализа для решения ряда эпидемиологических задач, связанных с изучением заболеваемости ГЛПС, верификацией клинического диагноза, выявлением основных источников инфекции и определением границ природных очагов хантавирусов. Некоторые теоретические и практические вопросы вирусологии, касающиеся идентификации хантавирусов, определения их таксономической принадлежности, характеристики гетерогенности вирусных популяций, были решены с помощью разработанных молекулярно-генетических методик – ПЦР-анализа и  секвенирования выбранных фрагментов генома.

Впервые были сконструированы системы универсальных консенсусных праймеров на основе фрагментов кодирующей части генома хантавирусов – гена нуклеопротеина N (S-сегмента) и гена гликопротеина G2 (М-сегмента); на их основе разработаны ПЦР-методики для выявления широкого спектра штаммов хантавирусов комплекса ГЛПС (Пуумала, Добрава, Хантаан, Сеул, Тула), циркулирующих в природе.

Разработаны принципы генотипирования хантавирусов на основе секвенирования изолятов РНК, выявленных в ПЦР с помощью предложенных универсальных праймеров. Теоретически обоснована и экспериментально подтверждена пригодность выбранных фрагментов генома для их последующего филогенетического анализа.

В пределах, используемых для филогенетического анализа фрагментов аминокислотных последовательностей, обнаружены молекулярные маркёры, позволяющие различать штаммы хантавирусов комплекса ГЛПС из различных регионов РФ.

При проведении молекулярно-генетических исследований полевого и клинического материала, полученного из 9 регионов РФ, установлена высокая эффективность разработанных методик для лабораторной диагностики ГЛПС, в том числе при исследовании природных очагов - для выявления, идентификации и характеристики новых геновариантов хантавирусов. Получены новые данные о генетическом разнообразии и географической распространённости хантавирусов, формирующих природные очаги ГЛПС на территории Российской Федерации. Впервые с помощью молекулярных технологий выявлена циркуляция новых геновариантов вируса Добрава на территории Астраханской области и Республики Калмыкии, ранее считавшейся неэнзоотичной по ГЛПС.

Технологические возможности разработанных методик были продемонстрированы во время изучения вспышечной заболеваемости в Центральном Черноземье - для этиологической расшифровки и установления родства РНК-изолятов вируса Добрава, выявленных от больных ГЛПС и полевых мышей (A.agrarius), основных источников инфекции.

Впервые с использованием количественных вариантов ПЦР в режиме реального времени были получены данные по динамике вирусной нагрузки у больных ГЛПС, инфицированных вирусом Пуумала. Это позволило определить оптимальные сроки, в которые применение ПЦР-анализа для диагностики ГЛПС наиболее целесообразно.

Практическая значимость работы.

Предложена схема усовершенствования эпидемиологического надзора за хантавирусными инфекциями, предусматривающая использование молекулярно-генетических методов и ГИС-технологии. Разработанные методические подходы могут быть использованы в практике работы Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (Роспотребнадзор) с целью оптимизации прогнозирования и профилактики заболеваемости ГЛПС.

Показано, что включение молекулярно-генетического компонента в систему эпиднадзора обеспечивает: возможность верификации диагноза в ранние сроки заболевания, быструю дифференциацию возбудителя до вида и оценку уровня отличий новых вирусных РНК-изолятов от выявленных ранее штаммов хантавирусов, идентификацию места (области, региона), где произошло инфицирование человека ГЛПС, а также возможность более точной оценки эпидемического потенциала природных очагов хантавирусов.

Сконструированы диагностические тест-системы на основе ПЦР, позволяющие осуществлять прямую детекцию и дифференциацию хантавирусов в полевом и клиническом материале, а также оценивать количество вирусных частиц в исследуемых пробах.

Для анализа эпидемических проявлений хантавирусных инфекций на территории Липецкой области была сформирована электронная база данных в формате, совместимом с программой ГИС «КОМПАС» (разработанной в ГУ Институте проблем передачи информации РАН, Москва). База данных «ГЛПС в Липецкой области», включающая эпидемиологически значимую информацию, необходимую для определения эпидемического потенциала исследованных территорий и оценки риска заражения людей, используется на практике в работе региональных Управлений Роспотребнадзора.

Внедрение полученных результатов.

•        ПЦР-тест-система «АмплиСенс Хантавир» для детекции хантавирусов Пуумала, Добрава, Тула, Сеул, Хантаан разработана и передана вместе с необходимой нормативно-технической документацией на производство ЦНИИ эпидемиологии.

•        Депонированы в Международный компьютерный банк данных GenBank 226 фрагментов нуклеотидных последовательностей М- и S- сегментов геномов хантавирусов Добрава, Пуумала и Тула, выявленных на территории Российской Федерации в 2003-2008 гг. Нуклеотидные последовательности зарегистрированы в базе данных GenBank под следующими номерами - DQ064647-064689; DQ061255-DQ061272, EU549802-549815, EU562892-563018, EU652420 - EU652443.

•        Разработанный алгоритм программы ГИС «КОМПАС» для картографического анализа эпидемиологически значимых критериев вместе с приложением - электронной базой данных «ГЛПС в Липецкой области» используется в работе ФГУЗ Роспотребнадзора «Центр гигиены и эпидемиологии в Липецкой области».

•        Методические указания «Организация молекулярно-генетических исследований биологического материала из природных очагов ГЛПС» утверждены Федеральной службой по надзору в сфере защиты прав потребителей и благополучия человека РФ.

Материалы диссертации используются при чтении лекций на кафедре эпидемиологии ГОУ ДПО «Российская медицинская академия последипломного образования» Росздрава.

Апробация работы. Материалы диссертационной работы были представлены:

  • на Всероссийской научно-практической конференции «Генодиагностика инфекционных заболеваний» (Москва, 2002);
  • на Всероссийской научно-практической конференции «Генодиагностика инфекционных болезней» (Москва, 2004);
  • на научно-практической конференции «Генодиагностика инфекционных болезней» (Новосибирск, 2005);
  • на Международной конференции по инфекционным болезням (ICEID) (Атланта, США, 2006 г.);
  • на Международной научно-практической конференции «Геномные технологии в медицине и медицинское образование на рубеже веков» (Алматы, 2006);
  • на научно-практической конференции «Арбовирусы и арбовирусные инфекции» (Астрахань, 2006);
  • на Всероссийском научно-практическом съезде общества эпидемиологов, микробиологов и паразитологов (Москва, 2007);
  • на Международной научно-практической конференции «Молекулярная диагностика инфекционных болезней» (Минск, 2007);
  • на Всероссийской научно-практической конференции «Организация противоэпидемических мероприятий по профилактике геморрагической лихорадке с почечным синдромом» (Оренбург, 2007);
  • на межрегиональной научно-практической конференции «Состояние здоровья населения центрального федерального округа» (Липецк, 2007);
  • на Международной конференции по зоонозным инфекциям - «Emerging Zoonoses», (Лимассол, Кипр, 2007);
  • на Всероссийской научно-практической конференции «Молекулярная диагностика-2007» (Москва, 2007).

       Апробация диссертационной работы состоялась на Учёном совете ФГУН «Центральный НИИ эпидемиологии» Роспотребнадзора 15 октября 2008 года.

Публикации. Основные положения диссертации отражены в 36 опубликованных научных работах, в том числе 9 статей опубликованы в изданиях, рекомендованных ВАК Российской Федерации.

Объем и структура диссертации. Диссертация состоит из введения, обзора литературы, 8 глав собственных исследований, выводов, списка использованной литературы, включающего 277 зарубежных и 55 отечественных источников. Общий объем работы составляет 239 страниц компьютерного текста, иллюстрированного 27 таблицами и 51 рисунком.

СОБСТВЕННЫЕ ИССЛЕДОВАНИЯ

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЙ

Материалы. Для анализа эпидемических проявлений ГЛПС на территории России использовалась государственная статистическая отчётность Роспотребнадзора.

Для выполнения поставленных в ходе настоящей работы задач использовался полевой и клинический материал, исследование которого проводилось с помощью молекулярно-генетических и иммуносерологических методов (табл. 1). Методом ПЦР было исследовано 1728 проб (848 – от людей и 880 от грызунов), из которых 272 пробы были секвенированы. В ходе работы были использованы результаты иммунологических исследований 6435 образцов (5879 проб от мелких млекопитающих исследованы в ИФА; 482 пробы от людей и 74 от грызунов – в НМФА), из них 301 проба была серотипирована.

Исследование биологического материала иммуносерологическими методами проводили на базе федеральных государственных учреждений здравоохранения «Центров гигиены и эпидемиологии» РФ. Серотипирование сывороток крови от больных людей и проб от грызунов осуществлялось сотрудниками ФГУП ИПВЭ им. М.П.Чумакова РАМН на базе лаборатории геморрагических лихорадок.

Таблица 1.

Биологический материал, исследованный с помощью молекулярно-генетических  и иммуносерологических методов

Регион

исследования

(период)

Вид материала

Лабораторные методы исследования

ПЦР

ИФА

НМФА

Секвениро-

вание

Серотипи-

рование

Астраханская область,

(2004-2005)

Суспензии органов ММ*

389

74

74 (МФА)

18

4

Кровь от больных с различными диагнозами и доноров

200

н.и.**

н.и.

н.и.

н.и.

Республика

Башкортостан (2005)

Кровь от больных ГЛПС

50***

н.и.

5

5

н.и.

Самарская

область (2003)

Суспензии органов ММ

190

190

н.и.

10

н.и.

Липецкая область

(2002-2008)

Суспензии органов ММ

163

5477

н.и.

61

32

Кровь от больных с диагнозом ГЛПС

15

н.и.

335

9

265

Воронежская

область

(2006-2007)

Суспензии органов ММ

40

40

н.и.

38

н.и

Кровь от больных с диагнозом ГЛПС

21

н.и

21

3

н.и

Оренбургская

область

(2006-2007)

Суспензии органов ММ

33

33

н.и.

11

н.и.

Кровь от больных с диагнозом ГЛПС

42

н.и.

42

13

н.и.

Курская

область

(2007-2008)

Суспензии органов ММ

26

26

н.и.

15

н.и.

Кровь от больных с диагнозом ГЛПС

2

н.и

2

2

н.и

Тамбовская область (2007)

Суспензии органов

ММ

11

11

н.и.

6

н.и.

Тюменская область (2006)

Суспензии органов

ММ

18

18

н.и.

18

н.и.

Омская

область (2005)

Суспензии органов

ММ

10

10

н.и.

10

н.и.

Удмуртская

Республика

(2003-2005)

Кровь от больных с диагнозом ГЛПС

30

н.и.

30

6

н.и.

Кровь от больных ГЛПС

470***

н.и.

47

47

н.и.

Итого за

2002-2008 гг.

Образцов крови от людей

848

-

482

85

265

Образцов суспензий

органов ММ

880

5879

74

187

36

ММ* - мелкие млекопитающие

н.и.** - не исследовали

*** - образцы крови от больных ГЛПС взяты в динамике (10-кратно от каждого пациента)

Методы исследований. В работе были использованы эпидемиологические, молекулярно-генетические, иммуносерологические, вирусологические методы, а также методы статистического анализа.

Основой методологии нашего исследования был комплексный эпидемиологический подход, включающий эпизоотологическое и эпидемиологическое обследование природных и эпидемических очагов ГЛПС, молекулярно-генетическую характеристику выявленных изолятов хантавирусов, а также анализ полученных данных с помощью современных компьютерных программ и ГИС-технологии.

В работе использовали информационно-аналитическую систему «COMPASS» http://www.geo.iitp.ru, разработанную Институтом проблем передачи информации РАН (ИППИ РАН). Система «КОМПАС» реализована в виде программы на языке Java 1.5. Объектами анализа служили районы Липецкой области (картографические данные) и связанные с ними атрибутивные данные (эпидемиологические показатели). Информационная база данных «ГЛПС в Липецкой области» была сформирована в формате таблиц Microsoft Excel, в которые включены предварительно отобранные для анализа показатели. Перед началом работы в системе «КОМПАС» таблицы данных были преобразованы в формат базы данных – dbf, кроме этого были созданы дополнительные конфигурационные файлы, содержащие алгоритмы для работы с данными и их анализа.

Для проведения молекулярно-генетических исследований (экстракции РНК, обратной транскрипции, ПЦР-анализа и других этапов исследования) использовали отдельные реактивы и коммерческие наборы производства «АмплиСенсТМ» (ФГУН ЦНИИ эпидемиологии).

Тотальную РНК из легочных суспензий и цельной крови выделяли по модифицированному методу Хомчинского, используя для этого компоненты коммерческих наборов «РИБО-золь-В» и «РИБО-сорб» (производство ФГУН ЦНИИ эпидемиологии). РНК из плазмы крови больных ГЛПС и культуральной (вируссодержащей) жидкости выделяли методом нуклеосорбции в присутствии гуанидинтиоцианата, используя набор «РИБО-сорб». Обратную транскрипцию проводили со случайными праймерами с использованием набора «Реверта-L» (производство ФГУН ЦНИИ эпидемиологии). Для постановки ПЦР и секвенирования изолятов РНК использовались наборы специфичных и универсальных праймеров, разработанных в ходе настоящей работы. Для выбора праймеров и зондов использовали программы Oligo 330, Primer Premier 5, Vector NTI 9, ресурсы интернета и веб-сайты - http://eu.idtdna.com, http://frontend.bioinfo.rpi.edu и http://www.ncbi.nlm.nih.gov (BLAST, GenBank).

Выявление специфического антигена в материале от мелких млекопитающих осуществляли с использованием коммерческой диагностической тест-системы "Хантагност" (производство ФГУП ПИПВЭ им. М.П. Чумакова РАМН). Выявление специфических антител класса М и G у больных ГЛПС осуществляли с помощью непрямого метода флюоресцирующих антител, используя для этой цели коммерческую тест-систему «Культуральный поливалентный диагностикум ГЛПС для непрямого МФА» (производство ФГУП ПИПВЭ им. М.П.Чумакова РАМН).

ОСНОВНЫЕ ЭПИДЕМИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ГЛПС

В РОССИЙСКОЙ ФЕДЕРАЦИИ

Ежегодно на территории РФ регистрируется 5-7 тысяч случаев ГЛПС; средний многолетний показатель заболеваемости (за 1995-2007 гг.) составляет 5,35 на 100 тысяч населения, уровень летальности - 0,5 %. Наибольшая заболеваемость отмечалась в 1997 год, когда число заболевших достигало более 20000 человек (14,3 на 100 тыс.).

При анализе динамики ГЛПС в РФ становится очевидным отсутствие тенденции к снижению уровня заболеваемости, а также существование циклических подъёмов на фоне ежегодно регистрируемых случаев этой инфекции (рис. 1).

Наиболее активные природные очаги ГЛПС располагаются в лесной ландшафтной зоне в умеренных широтах Европейской части РФ (территория Приволжского федерального округа - ПФО), где ежегодные показатели заболеваемости составляют от 8 до 67 (в среднем - 32) на 100 тысяч населения.

Рисунок 1. Динамика заболеваемости ГЛПС в Российской Федерации.

Заболеваемость в субъектах ПФО ассоциирована преимущественно с хантавирусом Пуумала, основным резервуаром которого является рыжая полевка. Оптимум ареала этого вида, приуроченный к широколиственным и смешанным лесам умеренной зоны, территориально совпадает с расположением крупных населенных пунктов, что значительно увеличивает риск заражения людей и уровень заболеваемости в целом. За период с 1996 по 2006 гг. по сравнению с предыдущим 10-летием (с 1985 по 1995 гг.) заболеваемость в субъектах этого округа возросла в 1,5 раза. В этот период было зарегистрировано около 82000 случаев, что составляло почти 90% от общего числа случаев зарегистрированных в Российской Федерации.

В настоящее время второе место по заболеваемости занимает Центральный федеральный округ, при этом случаи ГЛПС регистрируются во всех 18 административных областях. За период с 1996 по 2006 гг. в регионах этого округа было зарегистрировано 4237 случаев, заболеваемость по сравнению с предыдущим десятилетием возросла почти в 2 раза. Обращает внимание тот факт, что в период с 1998 по 2004 гг. добавилось 5 новых субъектов (Курская, Брянская, Липецкая, Тамбовская и Белгородская области), входящих в ЦФО, в которых стали регулярно регистрироваться случаи ГЛПС, в том числе в виде вспышек.

Помимо заболеваемости, связанной с вирусом Пуумала, в Центральном федеральном округе наиболее часто регистрируются случаи ГЛПС, ассоциированные с вирусом Добрава. При этом зарегистрированные в последние годы резкие подъёмы заболеваемости в ряде областей были вызваны преимущественно этим вирусом.

Анализ заболеваемости ГЛПС в Уральском, Северо-Западном, Сибирском и Дальневосточном федеральных округах показал, что за период с 1996 по 2006 гг. по сравнению с предыдущим десятилетием число заболевших и показатель заболеваемости на 100 тысяч практически не изменились.

Проведенный статистический анализ динамики заболеваемости за последние восемь лет (1999 – 2007 гг.) не позволил выявить тенденцию к её снижению в большинстве федеральных округов и в РФ, в целом. Установлено, что динамика заболеваемости в ЦФО существенно отличается от таковой в других округах в связи с тем, что её рост стал наблюдаться только в последние годы.

Осуществление эпиднадзора за ГЛПС в современных условиях можно представить как комплекс мероприятий, разработанных в соответствии с иерархическими уровнями эпидемического процесса (В.Б. Коротков с соавт. 1996). Мониторинг за эпидемическим процессом включает регистрацию всех лабораторно подтверждённых с помощью серологических методов случаев ГЛПС, описание клинических форм инфекции, изучение иммунологической структуры населения, включая группы риска.

Слежение за эпизоотическим процессом является неотъемлемым компонентом эпиднадзора за ГЛПС. Параметры эпизоотического процесса включают данные о составе и численности основных носителей хантавирусов, их инфицированности. Традиционно используемые в эпизоотологических исследованиях иммунологические методы (ИФА) позволяют за короткий промежуток времени провести массовый скрининг популяций мелких млекопитающих на наличие хантавирусного антигена и оценить уровень их инфицированности. На основе данных эпидемиолого-эпизоотологического надзора прогнозируется заболеваемость, оценивается эпидобстановка, принимаются управленческие решения о проведении противоэпидемических мероприятий, оценивается эффективность профилактических мероприятий.

Очевидно, что неспецифическую профилактику, которая сводится преимущественно к мерам по сокращению численности диких грызунов в ходе осуществления широкомасштабных дератизационных мероприятий в конкретных природных очагах ГЛПС, следует проводить на основе информации о циркулирующих там типах хантавирусов, вызывающих заболевания у людей. Известно, например, что заражения, связанные с вирусом Пуумала, происходят преимущественно в летне-осенний период (июль-октябрь), тогда как случаи ГЛПС, ассоциированные с вирусом Добрава, отмечаются главным образом в зимний период (декабрь-февраль). Прежде всего, эти различия обусловлены биологическими особенностями (циклами размножения) рыжей полёвки и полевой мыши, являющимися основными носителями вирусов Пуумала и Добрава на территории России.

Широко применяемые в системе эпиднадзора иммуносерологические исследования не позволяют определить спектр циркулирующих в природных очагах хантавирусов, определить перечень основных носителей, являющихся главными источниками инфицирования людей. В настоящее время информация о разнообразии и таксономической принадлежности хантавирусов, являющихся потенциальными возбудителями ГЛПС, для большинства административных регионов РФ отсутствует. Дератизационные мероприятия в природных очагах, как правило, проводятся по единой схеме, без учёта популяционных особенностей и биологических циклов носителей хантавирусов, что значительно снижает их эффективность.

Очевидно, что сохраняющаяся напряжённая эпидобстановка по заболеваемости ГЛПС требует улучшения системы эпидемиологического надзора, что предусматривает, в частности, совершенствование информационно-аналитического компонента, в том числе оптимизации схемы лабораторной диагностики хантавирусных инфекций.

РАЗРАБОТКА МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МЕТОДОВ ДЛЯ ОПТИМИЗАЦИИ ЛАБОРАТОРНОЙ ДИАГНОСТИКИ ГЛПС

Существующая схема дифференциации видовой принадлежности хантавирусов на основе традиционных иммуносерологических и вирусологических методов является сложной, трудоёмкой и малоэффективной. С учётом установленной взаимосвязи тяжести заболевания ГЛПС у людей и инфицированием определённым серо-(гено) типом хантавирусов, идентификация инфекционного агента заболевания представляет определённую эпидемиологическую значимость. Молекулярно-генетические методы являются существенным подспорьем при проведении таких исследований.

В связи с отсутствием на отечественном рынке, как коммерческих тест-систем, так и стандартизованных ПЦР-методик, актуальной являлась задача по разработке диагностических наборов для детекции и идентификации хантавирусов.

В ходе работы были сконструированы системы видоспецифичных и универсальных (группоспецифичных) праймеров  для детекции широкого спектра штаммов хантавирусов комплекса ГЛПС – Пуумала, Добрава, Хантаан, Сеул и Тула (табл. 2). Кроме того, сконструированы количественные варианты ПЦР в режиме реального времени с зондами специфичными к вирусам Добрава и Пуумала (табл. 2), позволяющие оценивать количество вирусных копий в исследуемых биологических образцах.

Системы универсальных праймеров были сконструированы на основе кодирующей части генома – гена нуклеопротеина N (S-сегмент) и гена гликопротеина G2 (М-сегмент). Праймеры, расположенные в области двух различных локусов генома, были выбраны с целью повышения эффективности исследований, направленных на выявление как можно большего спектра вирусов комплекса ГЛПС, циркулирующих в природе, а также на обнаружение существующих в природе хантавирусов с возможной генетической вариабельностью в области выбранных мишеней. Системы видоспецифичных праймеров были разработаны на основе кодирующей области S-сегмента генома для дифференциации в ПЦР хантавирусов, наиболее широко распространённых на Европейской части РФ - Пуумала, Тула и Добрава (табл. 2).

Таблица 2.

Разработанные системы олигонуклеотидных праймеров и зондов для детекции и идентификации хантавирусов комплекса ГЛПС

Название

Последовательность 5-3

Позиции

генома

Штамм,

(сегмент)

Универсальные праймеры для детекции в ПЦР вирусов комплекса ГЛПС

(Пуумала, Добрава, Хантаан, Сеул, Тула)

Hant-new

(+) TT(C/T)AA(G/A)GATGACA(C/G)(A/T/C)TC(A/T/G)TTTGAGG

(517-541)

Baskiria AF442613

(S)

Hant-mod

(+) AA(G/A)GATGACA(C/G)(A/T/C)TC(A/T/G)TTTGAGGAT

(520-543)

Hant-kom

(+) TT(C/T)AA(G/A)GATGACA(C/G)(A/T/C)TC(A/T/G)TTTGAGGAT

(517-543)

Hant-R

(-)  C(T/A/G)GGTGC(A/T/C)C(A/C)(A/T/G)GCAAA(T/G/A)ACCCA

(991-970)

DobrM-F

(+) ATCAATAGAAGGTGCATGGGGТTCTG

2971-2996

SK/Aa AY961616

(М)

DobrM-alter

(+) CAATAGAAGGTGCATGGGGTTCTG

2973-2996

DobrM-R

(-) CCACATTGAGGTGCACCATCATCATA

3297-3272

Специфичные праймеры для идентификации в ПЦР вирусов Пуумала, Добрава и Тула

Tulа_S/F

(+) AAGTACACTACAGAGCAGACGGGC

123-146

AF442621, (S)

Puum_S/F

(+) TACAAGAGAAGAATGGCAGATGCTG

181-205

Baskiria AF442613

(S)

Pum/Tul/R

(-) TCAATGGCATTCACATCAAGGAC

323-301

inPUV_S/F

(+) CCCAGTCCACCATGAAAGCTGAAG

551-574

inPUV_S/R

(-) CTGTGCTGGTGTCCCTGGTTTAAC

774-751

DOBV_S/F

(+) AAGCTACTATCCGAGCCATCTCCAAC

768-793

Kurkino/98 AJ131673, (S)

DOBV_S/R

(-) GCAAAGACCCAGATTGATGATGGTGA

961-936

Зонды для идентификации вирусов Пуумала и Добрава в ПЦР РРВ

PUM_S-Z

JOE-ACTCCCATTACTGGACTCATGATGTTACGGGAGTG- BQH-1

666-637

Baskiria AF442613,

(S)

DBR_M-Z

FAM-TGTGCACCATAACAGATGGCCATATCACATGCTGCAC-BQH1

3096-3065

Saaremaa AJ009774

(М)

Диагностическая эффективность разработанных методик (одностадийной ПЦР и «Nested»-ПЦР) оценивалась при исследовании клинического материала от  больных. В исследование было включено 40 пациентов с предварительным клиническим диагнозом ГЛПС, поступивших в стационар в ранние сроки болезни (не позднее 4-го дня). Материал для анализа в ПЦР забирался у каждого больного в динамике (всего 10 раз) -  в день поступления пациента в больницу, а затем через определенные интервалы до 17 дня болезни включительно (табл. 3). Для выявления сероконверсии анализ антител методом НМФА проводили дважды – в день поступления больного в стационар и через 2 недели повторно.

Таблица 3.

Оценка диагностической эффективности ПЦР и НМФА у больных ГЛПС в динамике

День болезни

Положительные результаты в одностадийной ПЦР

число (%)

Положительные результаты в

Nested ПЦР

число (%)

Положительные результаты в НМФА

число (%)

4

39 (97,5)

40 (100)

32 (80)

6

37 (92,5)

40 (100)

н.и.*

7

34 (85)

39 (97,5)

н.и.

8

32 (80)

36 (90)

н.и.

9

28 (70)

31 (77,5)

н.и.

10

21 (52,5)

31 (77,5)

н.и.

11

19 (47,5)

29 (72,5)

н.и.

13

18 (45)

23 (57,5)

н.и.

15

14 (35)

17 (42,5)

н.и.

17

8 (20)

14 (35)

40 (100)

н.и.* - не исследовали

В результате исследования клинического материала в первый день госпитализации хантавирусная РНК была выявлена  методом «Nested» ПЦР у всех 40 больных ГЛПС (100%), в одностадийной ПЦР - у 39 из 40 больных (в 97,5%). Из полученных результатов, очевидно, что с высокой эффективностью (не менее 70%) можно выявлять РНК вируса в плазме крови у больных ГЛПС до 11-го дня болезни с помощью «Nested» ПЦР и до 9-го дня при использовании однораундовой ПЦР. С помощью НМФА антитела выявлялись у 32 (80%) больных в титрах (от 1/32 до 1/256) в день поступления в стационар. При повторном исследовании сывороток через 14 дней антитела были выявлены у 40 (100%) больных в титрах (от 1/64 до 1/8000). Несмотря на высокую чувствительность НМФА необходимость учета результатов по 4-х кратному нарастанию титров до некоторой степени ограничивает возможности данной методики для ранней диагностики ГЛПС.

Вирусная нагрузка при ГЛПС оценивалась в результате исследования с помощью ПЦР в режиме реального времени (ПЦР РРВ) и «Nested» ПЦР 120 образцов плазмы крови от 12 больных в динамике с 4 по 17 день болезни.

С помощью ПЦР РРВ было установлено, что на 4 день болезни у больных в крови присутствует РНК вируса в концентрациях от 4х104 до 1х106 копий/мл (табл. 4). За время наблюдения, то есть за 14 дней нахождения пациентов в стационаре, было выявлено постепенное снижение вирусной нагрузки в крови больных в 10-200 раз, в среднем – в 65 раз. Сравнимые результаты по чувствительности и динамике вирусной нагрузке были получены в «Nested» ПЦР при исследовании десятикратных разведений кДНК. Титры у большинства больных постепенно снижались с 1/1000 (4 день) до 1/10 (на 13-17 день); в среднем в 77 раз.

Таблица 4.

Оценка диагностической чувствительности ПЦР-методик и определение  вирусной нагрузки у больных ГЛПС на основе ПЦР РРВ

День болезни

Положительные результаты в ПЦР РРВ

число (%)

Положительные результаты в  Nested ПЦР

число (%)

Средняя вирусная нагрузка

копий/мл*

Вирусная нагрузка

max-min копий/мл**

4

12 (100)

12 (100)

410000

1118000-39000

6

12 (100)

12 (100)

147000

615000-5900

7

12 (100)

12 (100)

63000

382000-5000

8

12 (100)

12 (100)

27000

133000-3700

9

9 (75)

11 (91)

28000

231000-4000

10

9 (75)

11 (91)

8800

46000-6000

11

5 (42)

7 (58)

7200

85000-6700

13

5 (42)

6 (50)

14000

119000-4000

15

5 (42)

5 (42)

7200

56000-2600

17

4 (33)

4 (33)

2300

19600-2700

*- средняя величина, рассчитанная для всей исследуемой выборки образцов (12)

** - пределы вирусной нагрузки для позитивной выборки образцов

Установлено, что с 9 дня болезни вирусная нагрузка в крови больных ГЛПС начинает снижаться до уровня, соответствующего пределу детекции методики. К 17 дню болезни только у каждого третьего больного количество РНК в крови находится на уровне выше 1х103 копий/мл, что и ограничивает возможности ПЦР для диагностики ГЛПС на поздних сроках болезни (табл. 4).

Новые данные о длительности сохранения вируса в крови и концентрации вирусной РНК в клинических пробах, полученные с помощью количественных вариантов ПЦР, позволяют обосновать оптимальные сроки (период болезни), в которые наиболее целесообразно использовать молекулярно-генетических методы для мониторинга состояния больного (табл. 4). Кроме того, информация о количестве вирусной РНК в организме больного важна при назначении терапии и оценки её адекватности, особенно при тестировании новых средств специфичного лечения ГЛПС.

В ходе настоящей работы была установлена рациональность использования ПЦР-анализа для подтверждения диагноза ГЛПС в ранние сроки болезни. Диагностическая чувствительность разработанных методик (одностадийной ПЦР, «Nested» ПЦР, ПЦР РРВ) в первую неделю болезни составляет 85-100% (табл. 3, 4). В этот ранний период болезни дифференциальная клиническая диагностика вызывает, как правило, наибольшие затруднения. Использование ПЦР в более поздние сроки (на 2 неделе болезни), несмотря на снижение эффективности, является целесообразным и оправданным с целью генотипирования и определения видовой принадлежности возбудителей ГЛПС.

Таким образом, применение иммуносерологических методов, направленных на выявление сероконверсии специфических антител у больных, по-прежнему является основным подтверждающим тестом при ГЛПС («золотым стандартом диагностики»). Однако, в целях совершенствования лабораторной диагностики – для подтверждения клинического диагноза с 1 дня болезни, идентификации возбудителя, определения вирусной нагрузки у больных людей, необходимым компонентом в схеме диагностики является ПЦР-анализ.

СОВЕРШЕНСТВОВАНИЕ ЭПИЗООТОЛОГИЧЕСКОГО МОНИТОРИНГА ПРИРОДНЫХ ОЧАГОВ ГЛПС

Одна из задач исследования заключалась в оптимизации схемы эпизоотологических исследований путём включения в неё ПЦР-методик.

При исследовании около 500 проб от грызунов, отловленных в Самарской, Курской, Тамбовской, Воронежской, Липецкой, Тюменской и Омской областях методами ПЦР и ИФА выявлено, что ПЦР не уступает, а в некоторых случаях превосходит по своей диагностической эффективности иммуносерологические методы.

В связи с тем, что при проведении эпизоотологических исследований, как правило, в каждом субъекте РФ ежегодно исследуются на наличие хантавирусного антигена пробы от мелких млекопитающих в объёме от нескольких сотен до нескольких тысяч особей, не представляется целесообразным, в качестве альтернативы ИФА, использовать для этой цели молекулярно-генетические методы (из-за их более низкой производительности, высокой трудоёмкости и стоимости).

Однако, несмотря на то, что иммунологические методы являются оптимальными при эпизоотологическом мониторинге (позволяют проводить массовый скрининг проб за короткое время), их информативные возможности для дифференциации хантавирусов сильно ограничены. Настоящее исследование показало, что молекулярно-генетические методы являются наиболее эффективными и предпочтительными для идентификации и характеристики хантавирусов, циркулирующих в природе.

В этой связи оптимизированный алгоритм эпизоотологических исследований можно представить в виде следующей схемы. На первом этапе с применением ИФА осуществляется скрининг материала от грызунов на наличие антигена, проводится оценка уровня их инфицированности. На втором этапе отобранные для дальнейшего исследования положительные и сомнительные пробы изучаются с применением молекулярно-генетических методов, что позволяет определять спектр циркулирующих в данном регионе хантавирусов, а также оценивать уровень гетерогенности их популяций.

Исходя из гипотезы повсеместной географической распространённости хантавирусов (Е.А. Ткаченко с соавт. 2001), изучались возможности использования разработанных молекулярно-генетических методик для выявления «новых» природных очагов ГЛПС.

Астраханская область считалась до недавнего времени неэнзоотичным по ГЛПС регионом. Ландшафтно-географические характеристики области (50% территории занимают степи и полупустыни), отсутствие лесных массивов и низкая численность основных видов грызунов-носителей хантавирусов обусловливали отсутствие интереса к проведению исследований на наличие природных очагов хантавирусов.

В ходе работы изучались пробы от 389 мышевидных грызунов и мелких млекопитающих 9 видов, отловленных на территории Астраханской области, а также в пограничных с ней районах Калмыкии. Точки забора материала были приурочены к степной и полупустынной зонам, а также к интразональным стациям Волго-Ахтубинской поймы.

В результате проведенных молекулярно-генетических исследований в 35 пробах была выявлена РНК хантавирусов. Положительными были пробы от гребенщиковых песчанок (8), полевых мышей (22), обыкновенных полевок (4) и от 1 домовой мыши.

В результате секвенирования 18 положительных образцов была установлена их таксономическая принадлежность к виду Добрава. Все новые геноварианты характеризовались, независимо от источника выделения (вида грызуна), высокой генетической однородностью, уровень их различий варьировал в пределах от 0,4 до 2,7%. При этом выявлена значительная генетическая удалённость новых РНК-изолятов от всех известных штаммов вируса Добрава, зарегистрированных в базе данных GenBank.

Часть материала (74 пробы) были исследованы с помощью иммунологических методов в лаборатории геморрагических лихорадок Института полиомиелита и вирусных энцефалитов под руководством профессора Е.А.Ткаченко. В 4-х образцах с помощью МФА были выявлены специфические антитела к хантавирусам. В ходе дальнейших исследований по серотипированию положительных проб были определены максимальные диагностические титры антител к вирусу Добрава.

Таким образом, с использованием молекулярных технологий впервые было установлено, а затем с помощью иммунологических методов подтверждено, что на территории Астраханской области (в Енотаевском, Харабалинском, Красноярском и Лиманском районах) и в Республике Калмыкия (Юстинском районе) существуют природные очаги ГЛПС, ассоциированные с хантавирусом Добрава. При этом циркуляция новых геновариантов этого вируса была выявлена в степной, полупустынной и пойменной ландшафтно-географических зонах данного региона.

ПРИМЕНЕНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МЕТОДОВ ДЛЯ ИЗУЧЕНИЯ ЗАБОЛЕВАЕМОСТИ ГЛПС

С целью оценки информационных возможностей молекулярно-генетических методов при этиологической расшифровке заболевания, дифференциации возбудителя, идентификации источника инфицирования, эти методы применялись при исследовании биологического материала во время подъёмов заболеваемости ГЛПС в отдельных регионах РФ.

Изучение заболеваемости ГЛПС в Удмуртской Республике. Удмуртия занимает одно из первых мест по заболеваемости ГЛПС в РФ. В 2004 г. в Республике был зарегистрирован очередной подъём заболеваемости - заболело около 2 тысяч человек, при этом интенсивный показатель составлял 127 на 100 тысяч.

Методом ПЦР был исследован материал от 67 человек, госпитализированных в Республиканскую инфекционную больницу г. Ижевска с предварительным клиническим диагнозом ГЛПС. В результате лабораторных исследований методом ПЦР диагноз ГЛПС был подтвержден у 53 человек, НМФА – у 52 больных. У 14 пациентов первичный диагноз ГЛПС был признан ошибочным и впоследствии был снят на основании отсутствия сероконверсии и отрицательных результатов ПЦР.

Все 53 положительные пробы, полученные в ПЦР, были секвенированы. В результате филогенетического анализа было установлено, что заболеваемость ГЛПС в Удмуртской Республике в 2004-2005 гг. была обусловлена геновариантами вируса Пуумала, большая часть которых (48 РНК-изолятов) представляла собой монофилитическую группу со средним уровнем нуклеотидных отличий 1,8%.

Было обнаружено, что 5 образцов выбивались из общей когорты новых «Удмуртских» геновариантов. При этом 3 РНК-изолята отличались от большинства в среднем на 7%, кластеризовались в одну подгруппу вместе со штаммами, выявленными ранее в Республике Башкортостан. Один РНК-изолят был дистанцирован от общей группы на 12,5 % и был близок к геновариантами из Липецкой и Воронежской областей, от которых отличался всего на 0,5%. Ещё один РНК-изолят отличался от остальных на 20,5%, при этом была выявлена его генетическая близость к группе «Омско-Тюменских» штаммов, от которых он отличался в среднем на 0,4 %.

Основываясь на данные филогенетического анализа можно предполагать, что заражение 5 человек, постоянно проживающих в Удмуртии, произошло на территории других регионов, скорее всего 3 человека заразились во время выезда в Республику Башкортостан, 1 человек во время визита в Тюменскую область и 1 во время посещения Центральной полосы России.

Изучение заболеваемости ГЛПС в Оренбургской области. ГЛПС является чрезвычайно актуальной инфекцией для населения Оренбургской области. По уровню заболеваемости за последние 10 лет область занимает 4-е место среди субъектов Приволжского федерального округа. До 1995 года на территории области выделяли активные природные очаги ГЛПС лесного типа (Бугурусланский плакорно-лесной, Бузулукский пойменно-боровой и Зилаирско-Сакмарский пойменно-лесной), характерные для вируса Пуумала.

В 2005 году в области произошёл очередной подъём заболеваемости (1288 случаев, с показателем на 100 тыс. населения - 59,7), при этом случаи ГЛПС были зарегистрированы в тех районах, которые ранее считались эпидемиологически благополучными по данной инфекции. Учитывая участившиеся в последние годы случаи ГЛПС, ассоциированные с вирусом Добрава, не исключалась гипотеза, что заболевания ГЛПС, зарегистрированные на остепнённых территориях области, могут быть связаны с этим вирусом.

Для получения дополнительной информации о хантавирусах, циркулирующих на территории Оренбургской области, были проведены  молекулярно-генетические исследования полевого и клинического материала, полученного из эпидемически активных очагов ГЛПС в 2006-2007 гг.

Методом ПЦР были исследованы клинические пробы от больных ГЛПС и пробы от грызунов, отловленных на территории 6 районов области.

В ходе анализа 42 клинических проб методом ПЦР было выявлено 14 положительных результатов. При исследовании 33 образцов полевого материала РНК хантавирусов была выявлена в 14 случаях. В результате секвенирования положительных проб определена принадлежность новых РНК-изолятов к вирусу Пуумала. В результате филогенетического анализа была установлена высокая гомогенность новых геновариантов вируса Пуумала, выявленных как в полевом, так и в клиническом материале из 6 исследованных районов. Средний уровень отличий РНК-изолятов, полученных от людей и грызунов из этих районов, составил 0,3%.

Исключением являлся образец № 33, отличавшийся от всех остальных в среднем на 6,5%. РНК-изолят, полученный из этого клинического образца, кластеризовался в одну группу вместе со штаммами вируса Пуумала из Башкирии. Проведённое в этой связи ретроспективное эпидемиологическое расследование показало, что больной (№33) является по профессии вахтовым рабочим и более 20 дней в месяц проводит в Республике Башкортостан, в связи с чем мог легко заразиться ГЛПС именно в том регионе.

Судя по всему, формирование новых активных очагов в остепнённых районах области происходит за счёт расширения ареала вируса Пуумала, локализация которого ранее была тесно связана с лесными провинциями. Активизация Бузулукского пойменно-борового и Зилаирско-Сакмарского пойменно-лесного очагов обусловливают расширение их границ и приводят к увеличению заболеваемости ГЛПС в районах, ранее считавшихся благополучными по данной инфекции.

Предположение об участии вируса Добрава, в качестве дополнительного этиологического агента вызывающего заболеваемость ГЛПС в Оренбургской области, в ходе молекулярно-генетических исследований не подтвердилось.

Изучение вспышки ГЛПС в Центральном Черноземье. По данным Роспотребнадзора РФ в последние годы наблюдается активизация природных очагов ГЛПС и устойчивая тенденция роста заболеваемости практически во всех субъектах Центрального федерального округа.

В декабре 2006 года произошло резкое обострение эпизоото-эпидемиологической обстановки по ГЛПС в Центральном Черноземье. Наибольшее количество заболевших отмечалось в Воронежской и в Липецкой областях, где с декабря по март было зарегистрировано 442 случая ГЛПС. При этом пик интенсивности эпидемического процесса (90% заболевших) был отмечен в декабре-январе (2006-2007 гг.).

В ходе расследования вспышки были выявлены характерные особенности, обусловленные её смешанной этиологией. Было установлено, что зарегистрированные в этот период случаи ГЛПС были связаны с вирусами Добрава и Пуумала, при этом 88,5 % заболеваний были обусловлены вирусом Добрава. Среди заболевших доминировало сельское население и лица трудоспособного населения. Заражение людей происходило преимущественно воздушно-пылевым путём, при уборке сена, загрязнённых экскрементами грызунов помещений, а также в ходе выполнения сельскохозяйственных работ. Заболеваемость мужчин и женщин не имела статистически достоверной разницы.

Очевидные различия были выявлены в соотношении городских и сельских жителей, инфицированных разными вирусами. Среди заболевших ГЛПС, заразившихся вирусом Пуумала, наблюдалось практически одинаковое соотношение городских и сельских жителей, тогда как среди заболевших, инфицированных вирусом Добрава, превалировало сельское население (90%).

На долю сельскохозяйственного и бытового эпидемиологических типов заражения, обусловленных вирусом Пуумала, приходилось 58%, также значительное число случаев инфицирования людей (42%) происходило во время во время охоты и посещения леса. В структуре заболеваемости ГЛПС, связанной с вирусом Добрава, было выявлено явное преобладание бытового и сельскохозяйственного эпидемиологических типов заражения (94%), остальные случаи заражения людей (6%) были связаны с посещением леса, охотой или производственной деятельностью.

В результате проведённых молекулярно-генетических и эпидемиологических исследований было сделано заключение, что основными носителями патогенного вируса Добрава и источниками хантавирусной инфекции, вызвавшей вспышку ГЛПС, явились преимущественно полевые мыши. Об этом свидетельствовали высокий уровень их инфицированности (до 67%), а также высокое генетическое сходство РНК-изолятов Добрава, выявленных от полевых мышей и больных людей.

Таким образом, в ходе выполнения данного этапа работы была показана эффективность использования молекулярных методов, с высокой результативностью выявляющих возбудителей ГЛПС как в полевом, так и клиническом материале, а также продемонстрированы информативные возможности разработанных методик для решения ряда эпидемиологических задач. К разряду наиболее важных проблем, возникающих в ходе изучения заболеваемости ГЛПС, относятся этиологическая расшифровка, дифференциация хантавирусов, постановка и верификация диагноза, происхождение возбудителя и предполагаемый регион (область) заражения. Как было показано, в ходе настоящей работы все перечисленные задачи успешно решались с помощью разработанных молекулярно-генетических методик.

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ ШТАММОВ ХАНТАВИРУСОВ КОМПЛЕКСА ГЛПС, ФОРМИРУЮЩИХ ПРИРОДНЫЕ ОЧАГИ ИНФЕКЦИИ НА ТЕРРИТОРИИ РОССИЙСКОЙ ФЕДЕРАЦИИ

Для изучения генетической гетерогенности популяций хантавирусов нами была использована технология прямого секвенирования ампликонов, полученных в результате ПЦР с универсальными S- и М- праймерами. Информативность выбранных фрагментов генома для последующего филогенетического анализа была оценена в результате теоретических и экспериментальных исследований.

В ходе работы из клинического и полевого материала были выявлены около 300 новых РНК-изолятов хантавирусов, отнесенных к видам Добрава, Пуумала и Тула.

Характеристика популяций вируса Пуумала, циркулирующих на территории РФ. С использованием молекулярно-генетических методов нами были выявлены и генетически охарактеризованы новые геноварианты вируса Пуумала из природных очагов, расположенных в Самарской, Оренбургской, Воронежской, Тюменской, Омской областей, в Республиках Удмуртии и Башкортостан. В ходе филогенетического анализа новых РНК-изолятов Пуумала, а также на основе информации о штаммах этого вируса, изолированных ранее на территории РФ и зарегистрированных в базе данных GenBank, были выделены четыре самостоятельные группы – «Волго-Уральская», «Центральная», «Сибирская» и «Карельская»  (рис. 2).

В «Волго-Уральскую» группу вошли геноварианты, выявленные нами в в Самарской и Оренбургской областях, в Республиках Башкортостан и Удмуртия (рис. 2). Уровень различий между РНК-изолятами из этих регионов варьировал в пределах от 3,6 до 7%, тогда как внутри каждого региона они отличались в среднем на 0,7-2,5%. Вирусные штаммы, относящиеся к «Волго-Уральской» группе, характеризуются широкой областью распространения на территории РФ. Можно сказать, что почти 90% всех зарегистрированных случаев ГЛПС в России, связаны с геновариантами именно этой группы.

Рисунок 2. Филогенетический анализ новых геновариантов вируса Пуумала по фрагменту гена N (426 н.) с помощью программы Mega, метода сравнения Neighbor-Joining. Новые РНК-изоляты, выявленные нами в различных регионах РФ, отмечены маркёрами

Между тем, заболеваемость ГЛПС, связанная с вирусом Пуумала, отмечаемая в Центральном, Сибирском и Северо-Западном федеральных округах РФ, по всей вероятности, связана с геновариантами, которые ходе филогенетического анализа были отнесены к «Центральной», «Сибирской» и «Карельской» группам. Недостаточная изученность этих штаммов не позволяет оценивать эпидемический потенциал природных очагов, в которых они циркулируют.

Средний уровень нуклеотидных отличий между геновариантами перечисленных выше 4 групп варьировал в пределах от 14 до 22 %.

В ходе анализа фрагментов аминокислотных последовательностей N гена были обнаружены гипервариабельные регионы, которые могут выступать в качестве молекулярных маркёров для внутривидовой дифференциации штаммов Пуумала.

Для большинства штаммов из Республики Башкортостан, Самарской и Оренбургской областей маркёрной является аминокислотная последовательность (позиции 258- 274) – QEVEFLKRNRVYFMTRQ. Анализ этого фрагмента показал наличие от 1 до 6 замен у штаммов из других регионов: для «Удмуртских» штаммов - QEIEFLKRNRVYFMTRQ, для «Тюменских» штаммов - QEVEMLKKNKIYFMHRQ, для «Омских» штаммов - QEIEMLKKNKIYFMHRQ, для «Воронежских» – QEVEFLKRNRVYFMNRQ.

Дополнительными маркерами для внутривидовой дифференциации штаммов Пуумала могут служить аминокислотные последовательности в позиции 299-307. Для штаммов, отнесённых к «Волго-Уральской» группе, маркёрной является SPDDIESPN; для «Омско-Тюменских» штаммов характерна SPDNIDSPN последовательность. Обнаружено, что фрагмент аминокислотной последовательности PERIREFMEK (позиции 232-241), консервативный для большинства штаммов Пуумала, позволяет дифферецировать штаммы внутри «Волго-Уральской» группы. Для штаммов из Республики Башкортостан маркёрной служит последовательность PEKIREFMEK, для «Удмуртских» штаммов – PERIRDFMEK; для «Самарских» и «Оренбургских» штаммов характерна последовательность PERIREFMER.

В ряде случаев для геновариантов, выявленных из клинических проб, была отмечена значительная генетическая дистанцированность от общей массы РНК-изолятов, обнаруженных в конкретном регионе. В результате филогенетического анализа РНК-изолятов для некоторых больных из Удмуртской Республики и Оренбургской области были предварительно определены возможные места их инфицирования, которые характеризовались удалённостью от постоянных мест проживания этих людей.

Очевидно, что обнаруженные молекулярные маркёры могут быть также использованы для эпидемиологического анализа. Например, вирусный РНК-изолят, полученный от больного № 33 из Оренбургской области, имел маркёрную последовательность характерную для «Башкирских» штаммов – PEKIREFMEK. В 3 РНК-изолятах (Izh/508-Hs/04, Izh/542-Hs/04, Izh/566-Hs/05), выявленных от больных из Удмуртской Республики, был обнаружен маркёр QEVEFLKRNRVYFMTRQ вместо характерного для большинства «Удмуртских» штаммов - QEIEFLKRNRVYFMTRQ.

Характеристика популяций вируса Добрава, циркулирующих на территории РФ. Проведённый филогенетический анализ позволил выделить генетически и географически отличающиеся группы – «Центральную», «Южную» и «Западно-Сибирскую», в которые вошли новые РНК-изоляты вируса Добрава (рис. 3). В «Центральную» группу были отнесены РНК-изоляты, выявленные нами в Липецкой, Воронежской, Курской и Тамбовской областях. С геновариантами этой группы были ассоциированы недавние вспышки ГЛПС в Центральном Черноземье. В ходе филогенетического анализа внутри «Центральной» группы были определены 3 самостоятельные субгруппы – «Воронежско-Липецкая», «Липецко-Тамбовская» и «Курская» (рис. 3). Несмотря на географическую близость штаммов этой группы, обнаружена их значительная генетическая дистанцированность - средний уровень межгрупповых отличий составлял 10,5 %. При этом уровень различий между геновариантами внутри каждой субгруппы варьировал в диапазоне 0,5-1,5 %.

Рисунок 3. Филогенетический анализ новых геновариантов вируса Добрава по фрагменту гена G2 (275 н.) с помощью программы Mega, метода сравнения Neighbor-Joining. Новые РНК-изоляты, выявленные нами в различных регионах РФ, отмечены маркёрами

В «Южную» группу вошли РНК-изоляты выявленные от грызунов, обитающих на территории Астраханской области и в Республике Калмыкия. К «Западно-Сибирской» группе были отнесены вирусные РНК-изоляты, обнаруженные нами в грызунах на территории Омской области. Недостаточная изученность геновариантов Добрава, циркулирующих в этих регионах, не позволяет сделать заключение о границах ареала и эпидемическом потенциале природных очагов этих вирусов.

Уровень нуклеотидных различий между геновариантами «Центральной», «Южной» и «Западно-Сибирской» групп в среднем составляет 9,5-11%. Установлена значительная дистанцированность всех РНК-изолятов, входящих в эти группы, от российских штаммов Добрава, циркулирующих в Краснодарском крае; при этом средний уровень отличий от них составляет 19-22%.

Анализ фрагментов аминокислотных последовательностей G2 гена позволил выявить молекулярный маркёр для внутривидовой дифференциации штаммов Добрава. Для «Астраханских» РНК-изолятов в позиции 421-427 маркёрной служит последовательность AEQESTQ, которая отличается от последовательности VEQESTQ, являющейся характерной для большинства новых геновариантов Добрава, выявленных нами. Кроме того, установлено, что аминокислотные замены в этой области VEQDSEQ являются характерными для классических штаммов Dobrava-Belgrade.

Таким образом, информацию, полученную в результате генотипирования хантавирусов, можно считать эпидемиологически значимой. Данные о гетерогенности популяций вирусов Добрава и Пуумала представляют особую важность при определении эпидемического потенциала природных очагов ГЛПС и оценки уровня опасности новых штаммов для человека.

СОВЕРШЕНСТВОВАНИЕ ЭПИДЕМИОЛОГИЧЕСКОГО НАДЗОРА

ЗА ПРИРОДНЫМИ ОЧАГАМИ ГЛПС НА ОСНОВЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ И ИНФОРМАЦИОННО-АНАЛИТИЧЕСКИХ ТЕХНОЛОГИЙ

Изучение циркуляции хантавирусов на территории Липецкой области началось в 2002 году сразу после возникновения первой зарегистрированной вспышки ГЛПС. Ретроспективно было установлено, что с ноября 2001 г. по март 2002 г. заболели 65 человек (в 8 районах области), при этом средний показатель варьировал от 2,7 до 57 на 100 тысяч (рис. 4). В течение последующих 4-х лет заболеваемость в этом регионе носила спорадический характер с ежегодной регистрацией от 2 до 10 случаев в год. В конце 2006 года эпидемическая ситуация по ГЛПС вновь осложнилась. Всего с декабря 2006 г. по март 2007 г. было зарегистрировано 243 подтвержденных случаев ГЛПС в 9 из 18 районов области; показатель заболеваемости варьировал в пределах от 5,5 до 448 на 100 тысяч населения (рис. 4). Максимальные уровни заболеваемости отмечались в двух районах области – Добринском и Усманском.

Рисунок 4. Показатели заболеваемости на 100 тыс. населения во время вспышек ГЛПС в Липецкой области

С целью изучения особенностей циркуляции хантавирусов исследовались пробы от людей и грызунов из различных районов Липецкой области.

С помощью молекулярных технологий была выявлена генетическая неоднородность популяций вируса Добрава, циркулирующих на территории Липецкой области. Установлено, что геноварианты из Добринского и Усманского районов формируют 2 хорошо выделенные на филогенетическом дереве субгруппы – «Добринск-Тамбов» и «Усмань-Воронеж» (рис. 5). 

Рисунок 5. Гетерогенность популяций вируса Добрава, циркулирующих на территории Липецкой области

Уровень различий между РНК-изолятами этих групп в среднем составлял 9%. В то же время геноварианты, выявленные от грызунов и людей в пределах одного и того же района, не отличались между собой более чем на 0,5-2%.

Дальнейший анализ показал, что «Усманские» РНК-изоляты из Липецкой области кластеризовались вместе с геновариантами, изолированными от больных людей и грызунов из Воронежской области (рис. 5). РНК-изоляты из Добринского района Липецкой области были генетически близки к геновариантам вируса Добрава, выявленными от грызунов, обитающих на территории Тамбовской области (рис. 5).

Кроме того установлено, что в районах, расположенных в южной части области, преимущественно на территории Усманского района, одновременно циркулируют два патогенных хантавируса – Добрава и Пуумала.

На основе проанализированной информации можно сделать заключение - в настоящее время на территории области сформировались автономные природные очаги ГЛПС, имеющие свои характерные особенности, что необходимо учитывать при дальнейшем мониторинге, прогнозировании заболеваемости и проведении профилактических мероприятий.

В ходе работы была сформирована база данных «ГЛПС в Липецкой области», предназначенная для картографического анализа накопленной информации с помощью ГИС-технологии. Одна из поставленных задач заключалась в определении эпидемического потенциала природных очагов и проведении эпидемиологического районирования территории Липецкой области. Для этой цели впервые была адаптирована и апробирована аналитическая программа ГИС «КОМПАС».

Картограммы, полученные в ходе анализа отобранных информационных показателей таких как – показатели заболеваемости на 100 тысяч, уровень инфицированности грызунов, количество населённых пунктов в каждом районе, в которых регистрировались случаи ГЛПС, и число лет регистрации заболеваемости в каждом районе, наглядно отражают проявления эпидемической активности природных очагов ГЛПС в Липецкой области в течение анализируемого периода с 2002 по 2007 гг. (рис. 6).

Для оценки интенсивности эпидемических проявлений (ИЭП) ГЛПС в каждом районе за анализируемый период (2002-2007 гг.) использовали показатель, рассчитанный нами с помощью формулы:

ИЭП = N P : Z,

где N – сумма лет регистрации случаев ГЛПС у людей, P – количество поражённых населённых пунктов, Z - число календарных лет анализируемого периода.

По показателю ИЭП все районы области были ранжированы по шкале (от 0 до 25,5). В результате проведённого группирования с учётом сходства показателей, была получена картограмма, отражающая разделение территории в соответствии с уровнем интенсивности эпидемических проявлений (рис. 7).

Рисунок 6. Анализ эпидемических проявлений ГЛПС в районах Липецкой области в течение 2002-2007 гг.

На основе данных, полученных в ходе молекулярно-эпидемиологических исследований, а также результатов анализа значимых критериев с помощью программы ГИС, было проведено эпидемиологическое районирование территории Липецкой области. В итоге все районы области были ранжированы по категориям - высокого, среднего и низкого риска заражения ГЛПС.

Добринский и Усманский районы, на территории которых с помощью молекулярно-генетических и иммунологических методов была установлена интенсивная циркуляция геновариантов хантавирусов Добрава и Пуумала, а также отмечались максимальные показатели ИЭП, были отнесены к зоне высокого риска заражения (рис. 7).

Рисунок 7. Дифференциация районов Липецкой области по интенсивности эпидемических проявлений

В зону среднего риска вошли территории Липецкого, Хлевенского, Добровского, Грязинского, Данковского, Тербунского, Измалковского, Краснинского, Елецкого, Чаплыгинского и Задонского районов. Показатель ИЭП для этих районов варьировал от 0,16 до 4,5 (рис. 7). В этих районах, прежде всего, необходимо осуществление постоянного целенаправленного мониторинга за численностью грызунов (рыжих полёвок и полевых мышей), являющихся основными носителями хантавирусов, их инфицированностью, с целью своевременного прогнозирования осложнения эпидемиологической ситуации. При распределении средств, выделяемых областным бюджетом на проведение профилактических мероприятий, необходимо учитывать приоритет территорий высокого риска заражения.

Остальная территория области (5 районов - Воловский, Долгоруковский, Лев-Толстовский, Лебедянский и Становлянский) характеризуется относительно благоприятной эпидемиологической обстановкой и может быть отнесена к зоне низкого риска заражения ГЛПС.

Таким образом, на модели Липецкой области были продемонстрированы современные методические подходы к мониторингу природных очагов ГЛПС, а также возможность быстрого и объективного анализа эпидемиологически значимой информации с помощью программы ГИС «КОМПАС». Обоснованные в ходе настоящей работы подходы к сбору и анализу информации могут служить научно-методической основой для дальнейшей оптимизации эпидемиологического надзора за хантавирусными инфекциями на современном этапе.

ЗАКЛЮЧЕНИЕ

В ходе настоящей работы была научно обоснована необходимость совершенствования эпидемиологического надзора за ГЛПС и определены пути преодоления существующих трудностей, связанных с информационной неопределённостью – незнанием основных типов хантавирусов, циркулирующих на территории большинства регионов нашей страны.

С разработкой молекулярно-генетических методов открываются новые возможности получения важной информации о хантавирусах – степени их генетического родства, уровне гетерогенности вирусных популяций. Одним из важнейших направлений в эпидемиологии, имеющим прикладное значение, является изучение географической распространённости генетических вариантов хантавирусов во взаимосвязи с заболеваемостью ГЛПС, в том числе возникновением вспышек.

Полученные в ходе молекулярно-генетических исследований данные о видовой принадлежности выявленных изолятов могут служить основой для разработки значимых критериев, позволяющих проводить оценку эпизоотической активности природных очагов ГЛПС. Несомненно, что молекулярно-генетические методики являются необходимым и важным звеном, дополняющим традиционные иммунологические методы, в существующей схеме лабораторной диагностики.

Разработанная технология генотипирования позволила не только осуществлять непосредственную идентификацию новых изолятов хантавирусов в полевом и клиническом материале, но и оценивать их отличия от ранее изолированных штаммов. В рамках накопленной информации о существовании дистанцированных популяций вирусов Добрава и Пуумала, можно говорить о перспективах расследования случаев ГЛПС у людей, заразившихся вне места своего постоянного проживания.

Анализируя результаты, полученные в ходе настоящей работы, можно сделать следующее заключение. Активное использование молекулярно-генетических методов при проведении эпидемиологических исследований позволяет оптимизировать мониторинг за ГЛПС. Включение молекулярно-генетического компонента в систему эпиднадзора обеспечивает: возможность верификации диагноза в ранние сроки заболевания;  подтверждение диагноза в спорных случаях (при наличии клинических симптомов ГЛПС и отсутствии серопозитивных результатов); быструю дифференциацию возбудителя до вида и оценку уровня отличий новых вирусных изолятов от выявленных ранее штаммов хантавирусов; идентификацию места, где произошло инфицирование человека; возможность более точной оценки эпидемического потенциала природных очагов хантавирусов.

Оценивая дальнейшие пути оптимизации эпидемиологического надзора за природными очагами хантавирусов, следует признать необходимость более широкого применения молекулярно-генетических методов, а также важность внедрения в эпидемиологическую практику ГИС-технологии.

ВЫВОДЫ

  1. Анализ эпидемиологической ситуации показал, что в большинстве административных регионов РФ сохраняется высокий уровень заболеваемости ГЛПС. Во многих субъектах Центрального федерального округа в последние годы наблюдается обострение эпидемиологической ситуации, что связано с расширением ареала инфекции и возникновением вспышек, ассоциированных с хантавирусом Добрава. Сохраняющаяся напряжённая эпидобстановка по ГЛПС требует оптимизации системы эпидемиологического надзора, что предусматривает, в частности, совершенствование её информационно-аналитического компонента, в том числе улучшения качества лабораторной диагностики.
  2. Разработаны молекулярно-генетические методики, основанные на полимеразной цепной реакции и секвенировании ампликонов, позволяющие решать эпидемиологические задачи, связанные с этиологической расшифровкой, дифференциацией возбудителя заболевания, выявлением источника и места (административной территориии) инфицирования людей, что было продемонстрировано при изучении заболеваемости ГЛПС в различных ландшафтно-географических регионах РФ.
  3. Установлено, что данные молекулярно-генетических исследований и картографический анализ значимых эпидемиологических параметров с помощью программы ГИС «КОМПАС» позволяют осуществлять эпидемиологическое районирование территорий по ГЛПС с оценкой риска инфицирования людей. Преимущества современных информационно-аналитических подходов были продемонстрированы на модели Липецкой области, все районы которой были объективно ранжированы и отнесены к зонам высокого, среднего и низкого риска заражения ГЛПС. Выявленные на территории Липецкой области природные очаги ГЛПС, значительно различающиеся по своей структуре и эпидемической активности, позволили обосновать необходимость дифференцированных подходов к проведению профилактических дератизационных мероприятий в каждом районе области.
  4. Показано, что использование ПЦР-анализа в системе лабораторной диагностики ГЛПС упрощает верификацию и снижает процент ошибочных диагнозов в ранние сроки болезни. Разработанные методики («Nested»-ПЦР и ПЦР РРВ), предназначенные для исследования клинического материала от больных ГЛПС, характеризуются 100% специфичностью, имеют 97,5-100% диагностическую чувствительность в первую неделю болезни и позволяют определять видовую принадлежность вируса.
  5. Применение методик, разработанных на основе ПЦР в режиме реального времени, позволяет оценивать количество копий РНК хантавирусов в биологических пробах. С помощью ПЦР РРВ определена динамика вирусной нагрузки в крови больных и обоснованы оптимальные сроки, в пределах которых использование ПЦР для лабораторной диагностики ГЛПС является целесообразным. С 9 дня болезни, вирусная нагрузка в крови больных начинает снижаться до уровня, соответствующего пределу детекции методик, что и ограничивает возможности ПЦР для диагностики ГЛПС на более поздних сроках болезни.
  6. Разработана технология генотипирования, основанная на секвенировании фрагментов РНК полученных в ПЦР с помощью универсальных (группоспецифичных) праймеров, которая позволяет изучать генетическое разнообразие хантавирусов, циркулирующих на территории РФ. С помощью филогенетического анализа новых изолятов РНК выявлены генетически и географически близкие группы хантавирусов; определён средний уровень внутригрупповых нуклеотидных различий, составляющий 1-2%. Уровень межгрупповых отличий, варьирующий в пределах от 4 до 22%, свидетельствует о существовании генетически дистанцированных популяций вирусов Добрава и Пуумала, формирующих природные очаги ГЛПС на территории РФ. Молекулярные маркёры, обнаруженные в пределах, используемых для филогенетического анализа фрагментов аминокислотных последовательностей, позволяют различать геноварианты вирусов Добрава и Пуумала, полученные из различных субъектов РФ.
  7. Показано, что важным компонентом эпидемиологического надзора за хантавирусными инфекциями являются молекулярно-генетические методы, основанные на ПЦР и секвенировании изолятов РНК, которые обеспечивают необходимую информационную составляющую, как при изучении структуры природных очагов, так и при осуществлении мониторинга за заболеваемостью ГЛПС. Картографический анализ эпидемиологически значимой информации на основе ГИС-технологии является необходимым звеном, позволяющим повысить эффективность эпидемиологического мониторинга за ГЛПС.

Перечень сокращений

ГИС – географическая информационная система

ГЛПС – геморрагическая лихорадка с почечным синдромом

ИФА – иммуноферментный анализ

кДНК – комплементарная ДНК

НМФА – непрямой метод иммунофлуоресцирующих антител

н.п. – нуклеотидная последовательность

п.н. – пара нуклеотидов

ПЦР - полимеразная цепная реакция

ПЦР РРВ – полимеразная цепная реакция в режиме реального времени

Роспотребнадзор – Федеральная служба по надзору и защите прав потребителей и благополучия человека

ЦГиЭ – Центр гигиены и эпидемиологии

DOBV- Добрава вирус

PUUV- Пуумала вирус

Список научных работ, опубликованных по теме диссертации

  1. Касьян И.А., Гаранина С.Б., Тучков И.В., Майоров Н.В., Куличенко А.Н., Казакова Е.С. Применение ПЦР для индикации микроорганизмов I-II групп патогенности // Проблемы особо опасных инфекций. – Саратов. – 1998. – С. 82-84.
  2. Куличенко А.Н., Гаранина С.Б., Майоров Н.В., Дентовская С.В. Внедрение современных методов генной диагностики в практику здравоохранения Саратовской области // В кн: Фундаментальные и прикладные исследования Саратовских учёных для процветания России и Саратовской губернии. – Саратов. – 1999. – С.202-205.
  3. Головинская О.Н., Клюева Е..В., Щербакова С.А., Гаранина С.Б., Савицкая Л.В., Чекашов В.Н., Тарасов М.А., Удовиков А.И., Шилов М.М., Князева Т.В., Колнобрицкая Н.В., Попов Н.В., Куклев Е.В., Куличенко А.Н. Изучение природной очаговости ГЛПС на территории Саратовской области // Материалы VIII съезда Всероссийского общества эпидемиологов, микробиологов и паразитологов. – Москва. - 2002 . – Т. 1. - С. 307-308.
  4. Гаранина С.Б., Яшечкин Ю.И., Щербакова С.А., Куличенко А.Н. Создание ПЦР-тест-системы для детекции и дифференциации вирусов комплекса ГЛПС // Тезисы 4 Всероссийской научно-практической конференции «Генодиагностика инфекционных заболеваний».- Москва. - 2002.- С. 272-274.
  5. Журавлев В.И., Гаранина С.Б., Щербакова С.А., Рогаткин А.К., Куличенко А.Н. Совершенствование схемы идентификации арбовирусов с использованием молекулярно-генетических методов // Тезисы 4 Всероссийской научно-практической конференции «Генодиагностика инфекционных заболеваний». - Москва. - 2002. - С. 274-275.
  6. Куличенко А.Н., Гаранина С.Б., Билько Е.А., Щербакова С.А., Яшечкин Ю.И. Применение ПЦР для молекулярно-эпидемиологического мониторинга ГЛПС в Саратовской области // Материалы Российской научно-практической конференции. Эпидемиологический надзор и социально-гигиенический мониторинг. - Москва. – 2002. С.51
  7. Гаранина С.Б., Шипулин Г.А., Журавлев В.И., Симак С.В., Ларичев В.Ф., Карань Л.С., Платонов А.Е. Разработка системы консенсусных праймеров для детекции методом ОТ-ПЦР хантавирусов, циркулирующих на территории РФ, оценка ее эффективности при работе с полевым и клиническим материалом // Сборник трудов 5-ой Всероссийской научно-практической конференции «Генодиагностика инфекционных болезней». - Москва. – 2004. - Т.2. – С.168-171.
  8. Гаранина С.Б., Журавлев В.И., Шипулин Г.А., Платонов А.Е Выявление природных очагов хантавирусов на территории Астраханской области // Материалы Российской научно-практической конференции «Генодиагностика инфекционных болезней». - Новосибирск. – 2005. – С. 98-102.
  9. Гаранина С.Б., Шипулин Г.А., Малинин О.В., Афсари Ж.В., Журавлев В.И., Платонов А.Е. Молекулярно-генетические подходы к изучению вспышки ГЛПС в Удмуртии // Материалы Российской научно-практической конференции «Генодиагностика инфекционных болезней». - Новосибирск. – 2005. – С.103-107.
  10. Гаранина С.Б., Журавлев В.И, Шипулин Г.А. Симак С.В., Малинин О.В., Афсари Ж.В., Бутенко А.М., Ларичев В.Ф., Платонов А.Е. Перспективы использования молекулярно-генетических методов для ранней диагностики геморрагической лихорадки с почечным синдромом и оценки эпизоотической активности природных очагов хантавирусов // Эпидемиология и инфекционные болезни. – 2005. - № 6. – С. 37-41.
  11. Garanina S.B., Malinin O.V., Zhuravlev V.I., Nikolaev M.K., Shipulin G.A., Platonov A.E. Investigation of hemorrhagic fever with renal syndrome outbreak in Udmurtia, Russia // International Conference on Emerging Infectious Diseases. 2006. - Atlanta, Georgia, USA. P.131.
  12. Zhuravlev V.I., Garanina S.B., Nikolaev M.K., Platonov A.E. Revealing of the new natural foci of Hantaviruses in arid zone of the Southern Russia // International Conference on Emerging Infectious Diseases. 2006. - Atlanta, Georgia, USA. P.143.
  13. Гаранина С.Б., Шипулин Г.А., Платонов А.Е. Оптимизация алгоритма лабораторной диагностики ГЛПС и повышение эффективности эпидемиологического надзора за хантавирусными инфекциями // Материалы IX съезда Всероссийского научно-практического общества эпидемиологов, микробиологов и паразитологов. - Москва, Санэпидмедиа. - 2007. - T.3. - C. 20.
  14. Журавлев В.И., Гаранина С.Б., Кабин В.В., Платонов А.Е. Изучение эколого-эпидемиологических особенностей циркуляции хантавирусов в аридной зоне Астраханской области // Материалы IX съезда Всероссийского научно-практического общества эпидемиологов, микробиологов и паразитологов. - Москва, Санэпидмедиа. - 2007.- T.3. - C. 173.
  15. Гаранина С.Б., Ходякова И. А., Щукина И.А., Монастырский А.А., Савельев С.И., Журавлев В.И., Мурашкина А.Н., Браславская С.И., Шипулин Г.А., Платонов А.Е. Молекулярно-эпидемиологическое расследование вспышки ГЛПС в Центральном Черноземье в зимний сезон 2007 г. // Международная научно-практическая конференция. Молекулярная диагностика инфекционных болезней. – Минск. – 2007, С. 185-186.
  16. Гаранина С.Б., Шипулин Г.А., Журавлев В.И., Платонов А.Е. Перспективы использования ПЦР в режиме реального времени для ранней диагностики ГЛПС и определения динамики вирусной нагрузки в клинических пробах // Материалы научно-практической конференции «Арбовирусы и арбовирусные инфекции». - Астрахань. – 2006. - С. 100-103.
  17. Журавлев В.И., Гаранина С.Б., Платонов А.Е. Выявление природных очагов хантавирусов на территории Астраханской области с использованием молекулярно-генетических методов // Материалы научно-практической конференции «Арбовирусы и арбовирусные инфекции». - Астрахань.– 2006.- С. 104-105.
  18. Гаранина С.Б., Шипулин Г.А., Журавлев В.И., Платонов А.Е Определение вирусной нагрузки у больных геморрагической лихорадкой с почечным синдромом (ГЛПС) с использованием ПЦР в режиме реального времени // ЖМЭИ. - 2007. - № 3. - С. 66-69.
  19. Корнеев А.Г., Гаранина С.Б., Нехаева Е.Л. Геморрагическая лихорадка с почечным синдромом: природные очаги Оренбуржья. // Информационный архив (медицина, биология, образование). - 2007. – Т.1. - №1 . - С.54-55.
  20. Мурашкина А.Н., Савельев С.И., Ходякова И.А., Щукина И.А.,  Зубчонок Н.В., Дроздова В.Ф., Зубова Н.Ю., Гаранина С.Б. Вспышка геморрагической лихорадки с почечным синдромом в Липецкой области // Материалы VIII Межгосударственной научно-практической конференции государств-участников СНГ. «Международные медико-санитарные правила и реализация глобальной стратегии борьбы с инфекционными болезнями в государствах-участниках СНГ». – Саратов. – 2007. - С.85-88.
  21. Корнеев А.Г., Шестакова С.Ю., Гаранина С.Б. Особенности формирования степных природных очагов ГЛПС в Оренбургской области // Материалы Всероссийской научно-практической конференции «Организация противоэпидемических мероприятий по профилактике геморрагической лихорадке с почечным синдромом». – Оренбург. – 2007.- С. 65-67.
  22. Ходякова И.А., Мурашкина А.Н., Щукина И.А., Дзагурова Т.К., Бондарев В.А., Савельев С.И., Башкирцев В.Н., Седова Н.С., Коротина Н.А., Гаранина С.Б., Ткаченко Е.А. Некоторые эпидемиологические особенности вспышки геморрагической лихорадки с почечным синдромом 2006-2007 гг в Липецкой области // Материалы Всероссийской научно-практической конференции «Организация противоэпидемических мероприятий по профилактике геморрагической лихорадке с почечным синдромом». – Оренбург. – 2007.- С. 115-120.
  23. Garanina S.B., Zhuravlev V.I., Shipulin G.A., Platonov A.E. Monitoring of hantaviral natural foci in Russia by using nucleic acid-based techniques // 5th International conference on Emerging Zoonoses. – Limassol, Cyprus. - 2007. - P.102.
  24. Garanina S.B., Shipulin G.A., Platonov A.E. The effectiveness of PCR-based diagnostics for clinical cases of hantaviral hemorrahagic fever with renal syndrome (HFRS) / 5th International conference on Emerging Zoonoses. – Limassol, Cyprus. - 2007. - P.103.
  25. Гаранина С.Б. Применение молекулярно-генетических методов в диагностике геморрагической лихорадки с почечным синдромом и изучение природных очагов хантавирусов // Научные труды Федерального научного центра гигиены им. Ф.Ф. Эрисмана «Региональные гигиенические проблемы сохранения здоровья населения». - Липецк. - 2007. – Вып.19. - С. 380-383.
  26. Ходякова И. А., Мурашкина А.Н., Дзагурова Т.К., Зубова, Н.Ю., Дроздова В.Ф., Щукина И.А., Коротков В.В., Зубчонок Н.В., Денисова И.И., Паневина Е.Н., Савельев С.И., Башкирцев В.Н., Седова Н.С., Коротина Н.А., Гаранина С.Б., Ткаченко Е.А. Вспышка геморрагической лихорадки с почечным синдромом в области // Научные труды Федерального научного центра гигиены им. Ф.Ф. Эрисмана «Региональные гигиенические проблемы сохранения здоровья населения». - Липецк.- 2007. – Вып. 19. - С. 479-483.
  27. Ходякова И.А., Мурашкина А.Н., Щукина И.А., Дзагурова Т.К., Зубова Н.Ю., Савельев С.И, Башкирцев В.Н., Седова Н.С., Коротина Н.А., Гаранина С.Б., Ткаченко Е.А. Вспышка геморрагической лихорадки с почечным синдромом 2006-2007 гг. в Липецкой области, вызванная двумя хантавирусами // Материалы XX Межрегиональной научно-практической конференции «Состояние здоровья населения центрального федерального округа». - Липецк. – 2007. - С. 395-399.
  28. Гаранина С.Б., Мурашкина А.Н., Ходякова И.А., Шипулин Г.А., Журавлев В.И., Платонов А.Е. Молекулярно-эпидемиологический анализ вспышек ГЛПС на Европейской части России // Сборник трудов VI Всероссийской научно-практической конференции «Молекулярная диагностика -2007». - Москва. – 2007. – Т.2. – С 294-297.
  29. Гаранина С.Б., Корнеев А.Г., Журавлев В.И., Якименко В.В.,  Шипулин Г.А., Платонов А.Е. Применение молекулярно-генетических методов для эпидемиологического и эпизоотологического мониторинга очагов геморрагической лихорадки с почечным синдромом (ГЛПС) // Сборник трудов VI Всероссийской научно-практической конференции «Молекулярная диагностика -2007». - Москва. – 2007.– Т. 1. – С 365-369.
  30. Корнеев А.Г., Гаранина С.Б., Яковлев А.Г., Скачков М.В, Нехаева Е.Л. Формирование новых природных очагов геморрагической лихорадки с почечным синдромом в Оренбургской области // Дезинфекционное дело. - 2007. - № 4. - С. 43-48.
  31. Ходякова И.А., Щукина И.А., Зубчонок Н.В., Дроздова В.Ф., Зубова Н.Ю., Денисова И.И., Паневина Е.Н., Мурашкина А.Н., Савельев С.И., Дзагурова Т.К., Седова Н.С., Коротина Н.А., Гаранина С.Б., Ткаченко Е.А. Геморрагическая лихорадка с почечным синдромом в Липецкой области // Труды Института полиомиелита и вирусных энцефалитов им М.П. Чумакова. Москва. - 2007. - Том. XXIV. - С. 157-160.
  32. Журавлев В. И., Гаранина С. Б., Кабин В. В., Шипулин Г. А., Платонов А. Е. Выявление нового природного очага вируса Добрава в Астраханской области // Вопросы Вирусологии. – 2008. – Т. 54. - №2 - С. 37-40.
  33. Гаранина С.Б., А.Н. Мурашкина, И.А. Ходякова, И.А.Щукина, В.И. Журавлев, М.М.Бернштейн, С.И. Савельев, А.Е.Платонов. Молекулярно-эпидемиологические аспекты циркуляции хантавирусов на территории Липецкой области // Эпидемиология и вакцинопрофилактика. - 2008. - №2. С. 21-24.
  34. Гаранина С.Б. Разработка молекулярно-генетического компонента системы эпидемиологического надзора за хантавирусными инфекциями // Вестник Военно-медицинской академии. Приложение. – 2008. – 22(2). – Часть I. – С. 207.
  35. Гаранина С.Б., Журавлев В.И., Бернштейн М.М., Платонов А.Е. Актуальность создания информационной базы данных для эпидемиологического генотипирования вирусов комплекса ГЛПС // Вестник Военно-медицинской академии. Приложение. – 2008. – 22(2). – Часть I. – С. 208-209.
  36. Мурашкина А.Н., Ходякова И.А., Щукина И.А., Гаранина С.Б., Ткаченко Е.А. Эпидемиологические особенности геморрагической лихорадки с почечным синдромом на территории Липецкой области // Вестник Военно-медицинской академии. Приложение. – 2008. – 22(2). – Часть II. – С. 609-611.





© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.