WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

Викторов Дмитрий Викторович

Молекулярные механизмы формирования множественной лекарственной резистентности у Burkholderia pseudomallei и близкородственных видов микроорганизмов

03.00.07 – микробиология

03.00.15 – генетика

Автореферат

диссертации на соискание ученой степени

доктора биологических  наук

Волгоград – 2009

Работа выполнена в ФГУЗ «Волгоградский научно-исследовательский противочумный институт» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека

Научные консультанты:

доктор медицинских наук, профессор

Алексеев Владимир Валерьевич

доктор медицинских наук, профессор

Меринова Людмила Константиновна

Официальные оппоненты:

доктор биологических наук, профессор

Щербаков Анатолий Анисимович

доктор биологических наук, старший научный сотрудник

Антонюк Людмила Петровна

доктор медицинских наук, профессор

Шемякин Игорь Георгиевич

Ведущая организация:

ФГУ «48 Центральный научно-исследовательский институт Минобороны России»

Защита состоится «___»___________2009 г. в ___ часов на заседании диссертационного совета Д.208.078.01 по защите докторских и кандидатских диссертаций при ФГУЗ «Российский научно-исследовательский противочумный институт «Микроб» (410005, г. Саратов, ул. Университетская, 46).

С диссертацией можно ознакомиться в научной библиотеке ФГУЗ «Российский научно-исследовательский противочумный институт «Микроб»

Автореферат разослан «___»____________2009 г.

Учёный секретарь диссертационного совета

доктор биологических наук,

старший научный сотрудник                                                Слудский А.А.

Общая характеристика работы

Актуальность работы. Характерным и важным биологическим свойством патогенных буркхольдерий и близких им микроорганизмов является высокая природная резистентность к широкому спектру антимикробных соединений. Наличие этого свойства создает значительные трудности для успешного лечения вызываемых ими заболеваний. Необходимо отметить, что биологические основы полирезистентности у большинства видов Burkholderia на сегодняшний день являются мало исследованными.

К настоящему времени накоплен довольно обширный материал об индивидуальной устойчивости различных видов буркхольдерий к антибактериальным агентам (Антонов и др., 1991; Desai et al., 1998; Kenny et al., 1999; Vorachit et al., 2000; Moore et al., 2001; Jenney et al., 2001; Nzula et al., 2002). Показано, что с одной стороны, препараты тетрациклинового, фторхинолонового, цефалоспоринового, карбапенемового рядов и некоторые другие соединения в опытах in vitro проявляют выраженное ингибирующее действие на клетки патогенных и условно-патогенных видов данной группы микроорганизмов, культивируемых на искусственных питательных средах,  с другой - применение этих антибактериальных агентов в условиях персистенции бактерий в организме-хозяине нередко оказывается малоэффективным (Haussler et al., 1999; Inglis et al., 2004; Azizi et al., 2005). Кроме того, известно, что буркхольдерии как при культивировании на питательных средах в селективных условиях, так и в процессе лечения быстро приобретают резистентность к различным антибактериальным препаратам, и нередко резистентность носит множественный характер (Rajyaguru, Muszynski, 1997; Ho et al., 2002). Сложность генетической организации (Cheng, Lessie, 1994; Rodley et al., 1995; Songsivilai, Dharakul, 2000; Nierman et al., 2004; Holden et al., 2004) позволяет говорить о высокой адаптивной «емкости» их геномов и предполагать наличие различных молекулярно-генетических механизмов, посредством которых реализуется множественная лекарственная резистентность. Последнее является основанием к тому, чтобы обозначает в качестве одного из приоритетных направлений в исследовании микроорганизмов рода Burkholderia изучение фундаментальных основ их устойчивости к антибактериальным агентам, в первую очередь, касающихся молекулярно-генетических механизмов формирования резистентности

Развитие исследований в этом направлении будет способствовать пониманию основных генетических особенностей буркхольдерий, предопределяющих их повышенную метаболическую пластичность, приспособляемость к воздействию специфических и неспецифических ингибиторов и защитных факторов макроорганизма. Следует отметить, что знание молекулярных механизмов развития резистентности к антимикробным соединениям имеет не только фундаментальное значение. Речь идет также о возможности получения важных с точки зрения современной теоретической и практической медицины фактов, которые могут быть положены в основу новых подходов к антибиотикотерапии инфекций, вызываемых микроорганизмами рода Burkholderia.

На сегодняшний день довольно детально изучены некоторые из молекулярно-генетических механизмов множественной лекарственной резистентности бактерий: аккумуляция и стабильное наследование отдельных R-детерминант генных кассет в составе интегронов (Ильина, 2003; Fluit, Schmitz, 2004), активный энергозависимый выброс антимикробных соединений из бактериальных клеток (multidrug efflux) (Putman et al., 2000; Poole 2001; Paulsen, Lewis 2001), снижение общей проницаемости клеточной оболочки за счет изменения экспрессии поринов наружной мембраны (Poole, 2002). В рассматриваемом аспекте патогенные и филогенетически близкие им Burkholderia представляют собой весьма интересные объекты исследований, позволяющие анализировать особенности молекулярных механизмов, определяющих тот или иной тип устойчивости к ингибиторам, у близкородственных видов, эволюционирующих в различных экологических нишах.

Возможности современного изучения лекарственной резистентности определяются наличием молекулярно-биологических методов и модельных систем, позволяющих идентифицировать и осуществлять анализ последовательностей генома, детерминирующих резистентность. Необходимыми элементами здесь являются специальные штаммы, несущие генетические детерминанты измененной чувствительности, а также методы молекулярного анализа R-детерминант – элементов транспортных систем клеток, ферментов инактивации/модификации, генов внутриклеточных мишеней действия антибиотиков и других. Клонирование генетических последовательностей буркхольдерий, определяющих различные спектры лекарственной резистентности, анализ их экспрессии в гетерологичных видах, а также разработка подходов, направленных на идентификацию дифференциально экспрессирующихся последовательностей генома в различных физиологических состояниях микроорганизма (Rivera-Marrero et al., 1998; Fleming et al., 1998; Benson et al., 2000), также входят в спектр необходимых методологических приемов при изучении генетических механизмов множественной лекарственной резистентности патогенных буркхольдерий и идентификации последовательностей геномов, маркирующих тот или иной спектр лекарственной резистентности.

Настоящая диссертация содержит обобщенные материалы исследований в этих направлениях, выполненных в лаборатории функциональной геномики ФГУЗ ВолгоградНИПЧИ в рамках государственных НИР и исследовательских проектов, поддержанных грантами РФФИ 07-04-01568 и 07-04-08660. Результаты, отраженные в диссертации, получены как лично соискателем, так и в соавторстве с сотрудниками лаборатории, работавшими под его руководством, а также с сотрудниками лабораторий генетики и молекулярной биологии ФГУЗ ВолгоградНИПЧИ.

Цель настоящей работы заключалась в комплексном изучении основных закономерностей формирования множественной устойчивости к антибактериальным препаратам у буркхольдерий группы «pseudomallei» (B. pseudomallei, B. mallei, B. thailandensis), идентификации и анализе ведущих молекулярных механизмов, ответственных за развитие полирезистентности.

Задачи исследования:

  1. Создать коллекцию изогенных штаммов B. pseudomallei, B. mallei и B. thailandensis, отличающихся по спектру устойчивости и инсерционных мутантов со сниженным уровнем резистентности для использования в качестве моделей для изучения множественной лекарственной резистентности.
  2. Изучить динамику формирования и стабильность наследования различных типов антибиотикорезистентности у B. pseudomallei и близкородственных видов. Исследовать у мутантных штаммов спектры перекрестной устойчивости к антимикробным препаратам различных классов.
  3. Выявить закономерности развития множественной резистентности Burkholderia к антибиотикам на уровне транспортных мембранных систем, идентифицировать и охарактеризовать мембранные протеины, участвующие в формировании тех или иных типов устойчивости.
  4. Разработать методические основы изучения транскрипционных профилей буркхольдерий и провести сравнительный анализ дифференциально экспрессирующихся последовательностей эффлюкс-детерминант различных типов при развитии множественной антибиотикоустойчивости у B. pseudomallei, B. mallei и B. thailandensis.
  5. Клонировать в E. coli последовательности генома B. pseudomallei, кодирующие компоненты мембранных транспортных систем активного энергозависимого выброса антимикробных соединений из клеток и провести анализ их экспрессии в гетерологичной системе.
  6. Исследовать геномный полиморфизм и вариации в структуре детерминант мишеней действия лекарственных препаратов при формировании резистентности к антибиотикам множественного характера, провести первичный структурный анализ элементов генома, способных к включению в свой состав генов антибиоткорезистентности, оценить перспективы молекулярного маркирования различных фенотипов антибиотикорезистентности у бактерий группы «pseudomallei».

Научная новизна

В настоящей работе на основе полученной коллекции мутантных полирезистентных штаммов с различными спектрами лекарственной устойчивости и  мутантов со сниженным уровнем резистентности впервые проведено изучение особенностей формирования устойчивости множественного типа к антибиотикам у B. pseudomallei и родственных ей видов B. mallei и B. thailandensis.

Впервые изучены закономерности формирования и наследования резистентности к антибиотикам классов цефалоспоринов и фторхинолонов у B. pseudomallei, B. mallei и B. thailandensis с последующим развитием у них множественной устойчивости к препаратам ряда аминогликозидов, -лактамов и хлорамфеникола. Показано, что устойчивость к антимикробным препаратам различных классов у В. pseudomallei, B. mallei и В. thailandensis обусловлена как возрастанием экспрессии аппарата активного выброса антибиотиков (multidrug efflux), так и снижением проницаемости клеточной оболочки за счет утраты либо пониженной экспрессии отдельных поринов.

Изучены основные механизмы формирования резистентности Burkholderia к антибиотикам, реализующиеся на уровне транспортных мембранных систем; впервые продемонстрирована роль в развитии множественной резистентности транспортного типа мембранных белков 110, 71, 48, 39, 27 и 21 kDa. Разработана технология выделения и очистки порообразующих мембранных белков B. pseudomallei и получен патент на изобретение № 2208445 «Способ выделения белка 39 кДа наружной мембраны возбудителя мелиоидоза» (зарегистрирован в Государственном реестре изобретений РФ 20.07.2003).

Исследовано соотношение изменения проницаемости клеточных мембран и активного энергозависимого транспорта лекарственных препаратов при развитии множественной резистентности у возбудителя мелиоидоза. У полирезистентных мутантов B. pseudomallei выявлено существенное снижение мембранной проницаемости для ряда соединений различной химической природы и физико-химических свойств – жирных кислот, солей желчных кислот, анионных и неионных детергентов, красителей. В экспериментах по оценке влияния соединения, блокирующего мембранные транспортеры, показана важная роль процессов энергозависимого выброса антимикробных соединений при формировании у B. pseudomallei резистентности множественного характера.

Охарактеризованы изменения биохимической активности, вирулентности и продукции поверхностных и внеклеточных биополимеров, имеющих значение факторов патогенности, в связи с развитием у B. pseudomallei полирезистентности. Показано, что приобретение фенотипа множественной резистентности к антибиотикам сопровождается существенной функциональной модификацией секреторных систем клеток возбудителя, выражающейся в структурных модификациях ЛПС, изменениях способности микроорганизма к секреции экзополисахарида и комплекса внеклеточных ферментов. Приоритетность исследований поверхностных и секреторных биополимеров B. pseudomallei, имеющих значение факторов патогенности, подтверждена патентами № 96111507 «Способ получения протективного гликопротеина возбудителя мелиоидоза» (зарегистрирован Российским агентством по патентам и товарным знакам 27.04.1998), № 2231364 «Способ получения капсульного вещества возбудителя мелиоидоза» (зарегистрирован в Государственном реестре изобретений РФ 27.06.2004), № 2255762 «Способ получения капсульного антигена возбудителя мелиоидоза, обладающего антифагоцитарной активностью» (зарегистрирован в Государственном реестре изобретений РФ 10.07.2005).

Впервые на основе известных последовательностей геномов буркхольдерий проведен сравнительный анализ in silico нуклеотидных последовательностей идентифицированных и предполагаемых генов лекарственного эффлюкса B. pseudomallei, B. mallei и B. thailandensis; обозначены группы детерминант множественной антибиотикорезистентности и подобраны олигонуклеотидные праймеры для амплификации консервативных фрагментов генов лекарственных транспортеров MFS (QacA/EmrB), SMR (QacE) и RND (AcrB/AcrD/AcrF) типов.

Осуществлена разработка методических подходов к изучению транскрипционных профилей исследуемых видов Burkholderia методом дифференциального дисплея мРНК с использованием генспецифических праймеров и проведено сравнительное исследование дифференциально экспрессирующихся генов эффлюкс-протеинов различных функциональных семейств у исходных штаммов и полирезистентных мутантов буркхольдерий, культивируемых в неселектвных условиях и при воздействии антибиотиков групп фторхинолонов и цефалоспоринов. Впервые показано сочетанное участие AcrB/AcrD/AcrF, QacA/EmrB и QacE детерминант в формировании антибиотикорезистентности множественного типа у видов группы «pseudomallei» и выявлен повышенный конститутивный уровень экспрессии QacA/EmrE и AcrB/AcrD/AcrF эффлюкс-транспортеров у части полирезистентных мутантов.

Впервые в Escherichia coli клонированы последовательности хромосомной ДНК полирезистентного мутанта B. pseudomallei 56770 SMCP, несущие детерминанты  AcrB/AcrD/AcrF и QacE эффлюкс-транспортеров и показано, что их экспрессия приводит к развитию резистентности рекомбинантных клонов к препаратам фторхинолоновой и аминогликозидной  групп. Рекомбинантный штамм E. coli ZV1 (KM167), несущий клонированные последовательности эффлюкс-систем B. pseudomallei, защищен патентом на изобретение № 2280688 «Рекомбинантный штамм Escherichia coli ZV1 – носитель клонированной последовательности ДНК Burkholderia pseudomallei, детерминирующей синтез белка 32 kDa и резистентность к пефлоксацину и стрептомицину» (зарегистрирован в Государственном реестре изобретений РФ 27.07.2006).

Впервые исследованы генетические вариации структуры (аллельного полиморфизма) гена ДНК-гиразы А у мутантных штаммов буркхольдерий с различными спектрами устойчивости к антибиотикам. Показано, что полирезистентные мутанты B. pseudomallei и B. mallei с высоким уровнем устойчивости к антибиотикам фторхинолонового ряда несут точечные мутации в регионе гена ДНК-гиразы А, детерминирующем резистентность к фторхинолоновым соединениям (QRDR), приводящие к нескольким типам аминокислотных замен в последовательности белка (Thr83→Ile, Gly81→Cys и Asp87→Tyr). Секвенированные нуклеотидные последовательности QRDR диких и мутантных штаммов B. pseudomallei и B. mallei депонированы в Genbank NCBI (access.  EU541544, EU541545, EU541546, EU541547, EU541548, EU541549, published 29.03.2008).

C использованием ПЦР-анализа и секвенирования установлено, что геномы исследуемых штаммов B. pseudomallei и B. thailandensis несут последовательности, структурно сходные с интегронами - генетическими элементами, способными включать в свой состав индивидуальные генные кассеты по механизму сайт-специфической рекомбинации. Анализ геномных регионов буркхольдерий, имеющих максимальные показатели сходства с секвенированными ампликонами, продемонстрировал наличие структур, включающих ген транспозазы/интегразы и кодирующие последовательности, аннотированные как детерминанты лекарственной устойчивости - гены эффлюкс-транспортеров MFS и RND типов. Секвенированные нуклеотидные последовательности фрагментов обнаруженных структур депонированы в Genbank NCBI (access. AY772715, published 7.11.2004).

Впервые апробированы техники молекулярного типирования, основанные на амплификации полиморфных ДНК и фрагментов генома, содержащих гены интегразы, для анализа геномного полиморфизма штаммов B. pseudomallei дикого типа, селекционированных вариантов, высокорезистентных к цефтазидиму, пефлоксацину и офлоксацину, и транспозонных мутантов, характеризующихся сниженной устойчивостью к отдельным классам антимикробных соединений. Полученные результаты указывают на заметные геномные перестройки при развитии различных типов резистентности у B. pseudomallei и близкородственных бактерий, и демонстрируют возможность определения дополнительных молекулярных маркеров, ассоциированных с различными типами лекарственной резистентности у патогенных буркхольдерий.

При выполнении исследования разработана электронная библиографическая компьютерная база данных рег. № 2006620082 «Потенциальные агенты биотерроризма: возбудители особо опасных инфекций и биологические токсины», зарегистрированная в Государственном реестре баз данных Российской Федерации в 2006 г.

Разработанные в ходе выполнения работы методологические подходы легли в основу исследовательских проектов 07-04-01568 и 07-04-08660,получивших финансовую поддержку Российского фонда фундаментальных исследований.

Практическая ценность

Создана коллекция, представленная 14 мутантными штаммами B. pseudomallei, B. mallei и B. thailandensis с различными спектрами множественной лекарственной устойчивости и 10 инсерционными мутантами, недостаточными по продукции отдельных мембранных белков и имеющими сниженный уровень резистентности к препаратам классов фторхинолонов и цефалоспоринов. Полученный набор штаммов предназначен для изучения молекулярных механизмов формирования лекарственной резистентности и структурно-функционального анализа поверхностных биополимеров патогенных буркхольдерий. Отдельные полирезистентные варианты и инсерционные мутанты со сниженным уровнем устойчивости депонированы в Государственной Коллекции Патогенных Бактерий РосНИПЧИ «Микроб» (ГКПБ «М»).

Получены рекомбинантные штаммы E. coli, несущие клонированные последовательности хромосомной ДНК B. pseudomallei - детерминанты резистентности транспортного типа к соединениям фторхинолоновой и аминогликозидной  групп, предназначенные для структурно-функционального анализа эффлюкс-систем возбудителя мелиоидоза. Рекомбинантный штамм E. coli ZV1 (KM167) депонирован в Государственной Коллекции Патогенных Бактерий (ГКПБ «М») РосНИПЧИ «Микроб».

В ходе анализа адаптивных модификаций поверхностных и секреторных систем клеток возбудителя мелиоидоза разработаны технологические приемы очистки, идентификации и детекции поверхностных и секреторных биополимеров B. pseudomallei, имеющих значение основных факторов патогенности микроба. По результатам исследований составлены методические рекомендации «Оценка иммунотропных и иммуногенных свойств поверхностных антигенов Burkholderia pseudomallei» (утверждены директором ВолгНИПЧИ 29.12.1998), методические рекомендации «Выделение, очистка и изучение некоторых иммунобиологических свойств белков клеточных мембран возбудителя мелиоидоза» (утверждены директором ВолгНИПЧИ 28.02.2001).

Предложен набор из 11 олигонуклеотидных праймеров, специфичных последовательностям сайтов связывания с рибосомой мРНК и консервативным фрагментам генов лекарственного эффлюкса буркхольдерий и осуществлена разработка способов анализа транскрипционных профилей патогенных Burkholderia в RT-PCR для выявления дифференциально экспрессирующихся последовательностей геномов при формировании различных фенотипов лекарственной устойчивости у B. pseudomallei, B. mallei и B. thailandensis.

Подобраны праймеры для амплификации участка гена ДНК-гиразы А буркхольдерий, включающего регион, детерминирующий устойчивость к хинолонам. Осуществлена разработка техники анализа аллельного полиморфизма gyrA, включающая этапы амплификации QRDR, анализа конформационного полиморфизма однонитевых цепей ампликонов (SSCP) и отбора вариантов с атипичными SSCP-профилями, секвенирования «кандидатных» мутантных последовательностей и определения характера и типа мутаций.

Результаты исследований, проведенных в рамках настоящей работы, вошли в материалы руководств «Практическое пособие для подготовки врачей-бактериологов и эпидемиологов по вопросам противодействия биотерроризму» (Волгоград, 2004), «Опасные инфекционные заболевания. Учебное пособие» (Волгоград, 2006), «Методическое пособие для проведения практических занятий по лабораторной диагностике мелиоидоза с использованием штамма-имитатора Burkholderia thailandensis KM-161» (утверждены Главным государственным санитарным врачом РФ Г.Г. Онищенко 16.07.2008).

Материалы диссертации используются при проведении лекционных и практических занятий в ВолгоградНИПЧИ в рамках учебных программ по первичной специализации и усовершенствованию специалистов: «Программы курсов повышения квалификации бактериологов и эпидемиологов по противодействию биотерроризму» (утверждена Главным государственным санитарным врачом Российской Федерации Г. Г. Онищенко 01.02.2001), «Программы курсов повышения квалификации врачей-бактериологов общей медицинской сети, центров госсанэпиднадзора и противочумных учреждений по специфической индикации и лабораторной диагностике особо опасных инфекций, санитарной охране территории и противоэпидемической защите населения» (утверждена Главным государственным санитарным врачом Российской Федерации Г. Г. Онищенко 28.09.1999), а также при чтении лекций и проведении практических занятий учебных курсов «Молекулярная биология» и «Современные аспекты генодиагностики и биотехнологии» кафедры молекулярной биологии и генетики медико-биологического факультета Волгоградского государственного медицинского университета.

Положения, выносимые на защиту

  1. Штаммы B. pseudomallei, B. mallei и B. thailandensis обладают выраженной способностью к формировнию резистентности высокого уровня к антибиотикам фторхинолоновой и цефалоспориновой групп при культивировании на питательных средах с повышающимися концентрациями антибатериальных агентов.
  2. Устойчивые к фторхинолоновым и цефалоспориновым соединениям мутанты буркхольдерий отличаются стабильным сохранением приобретенного фенотипа резистентности и развитием перекрестной устойчивости к отдельным β-лактамам, аминогликозидам, макролидам, хлорамфениколу и ряду неспецифических ингибиторов.
  3. Формирование резистентности множественного типа у микроорганизмов группы «pseudomallei» сопровождается изменениями белкового состава клеточных мембран, являющимися показателем модификации транспортных функций и проницаемости поверхностных структур клеток. Гиперпродукция мажорных мембранных белков Mr 27, 39, 48, 71 и 110 kDa и значительное снижением синтеза протеинов Mr 45 и 49 kDa у мутантов B. pseudomallei и B. thailandensis ассоциирована с высоким уровнем устойчивости к фторхинолоновым и цефалоспориновым антибиотикам.
  4. Развитие резистентности множественного типа обусловливает комплексные адаптивные перестройки процессов мембранного транспорта и синтеза поверхностных структур клеток буркхольдерий,  выражающиеся в структурных модификациях ЛПС,  изменении продукции экзополисахарида и способности секретировать комплекс экстрацеллюлярных ферментов.
  5. Включение Tn9 и Тn5 в хромосомные локусы детерминант мембранных протеинов 21, 27, 48, 71, 110 kDa B. pseudomallei приводит к снижению устойчивости инсерционных мутантов к препаратам цефалоспоринового и фторхинолонового ряда. Инсерционный мутагенез полирезистентного варианта B. pseudomallei демонстрирует связь утраты устойчивости к цефтазидиму с дефектами продукции мажорных мембранных протеинов 27 и 71 kDa.
  6. Ведущая роль в формировании множественной антибиотикорезистентности B. pseudomallei принадлежит механизмам эффлюкса, что демонстрирует анализ динамики накопления и выброса стуктурных аналогов антимикробных соединений клетками штамма дикого типа и полирезистентных мутантов, а также снижением устойчивости исходных и мутантных штаммов B. pseudomallei к антибиотикам различных классов в присутствии соединений - блокаторов мембранного транспорта.
  7. Сравнительный анализ in silico известных и предполагаемых генов лекарственного эффлюкса B. pseudomallei, B. mallei и B. thailandensis является эффективным инструментом выбора последовательностей-мишеней и подбора олигонуклеотидных праймеров для оценки уровня экпрессии генов лекарственных транспортеров MFS, SMR и RND типов.
  8. Участие AcrB/AcrD/AcrF, QacA/EmrB и QacE эффлюкс-детерминант в формировании антибиотикорезистентности множественного типа у видов группы «pseudomallei» подтверждается индукцией и возрастанием экспрессии данных лекарственных транспортеров у исходных штаммов и полирезистентных мутантов, культивируемых в присутствии антибиотиков фторхинолонового и цефалоспоринового рядов. Экспрессия клонированных последовательностей AcrB/AcrD/AcrF и QacE эффлюкс-транспортеров возбудителя мелиоидоза в Escherichia coli приводит к появлению резистентности рекомбинантных клонов к препаратам фторхинолоновой и аминогликозидной  групп.
  9. Мутационные изменения ДНК-гиразы А, наряду со снижением проницаемости оболочки и активацией эффлюкс-систем, определяют развитие высокого уровня резистентности к соединениям фторхинолоновой группы у B. pseudomallei и B. mallei. Нуклеотидные замены в QRDR gyrA у мутантных штаммов приводят к нескольким типам аминокислотных замен в последовательности белка (Thr83→Ile, Gly81→Cys и Asp87→Tyr).
  10. Геномы штаммов B. pseudomallei и B. thailandensis несут участки, структурно сходные с интегронами и представленные генами транспозаз/интеграз и кодирующими последовательностями детерминант лекарственной устойчивости - эффлюкс-транспортеров MFS и RND семейств. Наличие интегроноподобных структур свидетельствует о потенциальной возможности формирования множественной устойчивости у данных микроорганизмов за счет аккумуляции и горизонтального переноса R-детерминант различных типов.

Апробация работы

Диссертация выполнена на основе 14 государственных плановых тем НИР, в 3 из которых соискатель являлся ответственным исполнителем, и в 3 – научным руководителем. Основные результаты исследований изложены в 62 опубликованных работах, в том числе в пяти патентах на изобретение и трех учебных пособиях.

Результаты исследований по теме диссертационной работы были представлены на международном конгрессе «Vaccine & Immunization» (Manchester, 1999), международной конференции «Problems of biological and ecological safety» (Оболенск, 2000), международных конференциях «Natural infectious diseases» (Ulaan Baator, 2001, 2002, 2003), IV и V межгосударственных научно-практической конференций «Современные технологии в диагностике особо опасных инфекционных болезней» (Саратов, 2003; Саратов, 2004), VI Межгосударственной научно-практической конференции государств-участников СНГ «Санитарная охрана территорий государств-участников СНГ: проблемы биологической безопасности и противодействия биотерроризму в современных условиях» (Волгоград, 2005), VIII Межгосударственной научно-практической конференции государств-участников СНГ «Международные медико-санитарные правила и реализация глобальной стратегии борьбы с инфекционными болезнями в государствах-участниках СНГ» (Саратов, 2007), VI Всероссийской научно-практическая конференции с международным участием «Генодиагностика инфекционных болезней – 2007» (Москва, 2007), II, IV и VI всемирных конгрессах по мелиоидозу (The 2nd World Melioidosis Congress, Bangkok, Thailand, 1998; The 4th World Melioidosis Congress, Perth, Australia, 2001; The 6th World Melioidosis Congress, Khon Kaen, Thailand, 2007), IХ Межгосударственной научно-практической конференции государств-участников СНГ «Современные технологии в реализации глобальной стратегии борьбы с инфекционными болезнями на территории государств-участников Содружества Независимых Государств» (Волгоград, 2008).

Объем и структура работы

       Диссертация изложена в форме монографии на 266 листах компьютерного текста, состоит из введения, 5 глав, содержащих необходимые литературные справки, теоретические и экспериментальные разделы и иллюстрации в виде 28 таблиц и 83 рисунков, заключения и выводов. Указатель литературы включает 515 источников.

СОДЕРЖАНИЕ РАБОТЫ

Анализ особенностей формирования множественной лекарственной резистентности у Burkholderia pseudomallei и близкородственных микроорганизмов

Получение и характеристика мутантов B. pseudomallei, B. mallei и B. thailandensis с фенотипом множественной антибиотикорезистентности. Приступая к выполнению данной работы, мы должны были, в первую очередь, сформировать определенный набор штаммов исследуемых видов микроорганизмов, несущих генетические детерминанты измененной чувствительности к тем или иным группам антибактериальных препаратов. При этом необходимо было учитывать то обстоятельство, что большинство микроорганизмов рода (в том числе, виды, относящиеся к группе «pseudomallei») характеризуются высокой природной устойчивостью к антибиотикам различным групп, являясь, по сути дела, природно полирезистентными. Таким образом, основными задачами начального этапа исследований мы считали подбор фенотипических маркеров устойчивости, анализ появления и наследования которых не был бы затруднителен в силу исходно высокого уровня резистентности штаммов микроорганизмов к соответствующему антибактериальному препарату, и селекцию клонов со стабильно сохраняющимися фенотипами резистентности. Исследования по получению коллекции полирезистентных вариантов B. pseudomallei, B. mallei и B. thailandensis включали в себя этапы оценки уровней устойчивости исходных штаммов микроорганизмов к антибиотикам различных групп, выбора подходящих селективных маркеров и схем получения резистентных вариантов, анализа динамики формирования и стабильности наследования новых фенотипов устойчивости, а также изучения перекрестной резистентности полученных вариантов к антимикробным соединениям других классов.

В качестве селективных агентов при анализе особенностей формирования различных профилей лекарственной резистентности у B. pseudomallei, B. thailandensis и B. mallei нами были избраны препараты групп цефалоспоринов III поколения (цефтазидим) и фторхинолонов (пефлоксацин, офлоксацин), отличающиеся высокой активностью в отношении всех имеющихся в нашем распоряжении штаммов B. pseudomallei, B. mallei и B. thailandensis. Препараты этих классов антимикробных соединений стандартно используются в существующих схемах экстренной и пролонгированной терапии мелиоидоза (Inglis et al., 2006; Wuthiekanun, Peacock, 2006), наряду с этим, неоднократно были описаны случаи развития резистентности возбудителя к ним в ходе лечения (White et al., 1989; Dance et al., 1989; Dance et al., 1991; Chaowagul et al., 1997). Кроме того, установлено, что развитие устойчивости к отдельным группам антибиотиков довольно часто сопровождается формированием множественной резистентности. Это, в частности, отмечено для антибиотиков фторхинолонового ряда  (Deguchi et al., 1997; Jalal, Wretlind, 1998; Zhang et al., 2001; Jellen-Ritter, Kern, 2001; Join-Lambert et al., 2001; Baucheron et al., 2002; Dewi et al., 2004; Wolter et al., 2004).

Первоначальные попытки получения резистентных к фторхинолонам и цефтазидиму мутантов исследуемых видов буркхольдерий на плотных и жидких питательных средах с двукратным приращением концентрации антибиотиков начиная с ингибирующей не увенчались успехом, что в конечном счете привело нас к выбору схемы селекции, предусматривающей постепенное плавное повышение концентраций антибактериальных агентов, начиная с субъингибирующих. Клоны B. pseudomallei, B. mallei и B. thailandensis, стабильно сохраняющие фенотип устойчивости к фторхинолонам или цефтазидиму, были использованы для селекции вариантов с множественной устойчивостью, при этом, для сохранения первичного фенотипического маркера резистентности применялась поочередная смена селектирующих агентов. В результате были отобраны PfxR CazR, CazR PfxR,  CazR OfxR и OfxR CazR мутанты штаммов B. pseudomallei, PfxR CazR варианты B. thailandensis, тогда как селекционировать мутанты B. mallei, резистентные одновременно к антимикробным соединениям обеих групп (фторхинолоны и цефалоспорины) не удалось.

Анализ сохранения фенотипов резистентности мутантов при культивировании либо длительном хранении (6 и более месяцев) в неселективных условиях продемонстрировал, что наибольшей стабильностью отличается устойчивость к препаратам фторхинолонового ряда, тогда как устойчивость к цефтазидиму имела тенденцию к снижению при культивировании резистентных вариантов вне селективного давления. Исследования спектров перекрестной устойчивости полученных мутантов показали, что у B. pseudomallei и B. thailandensis резистентность, первично индуцированная препаратами фторхинолонового ряда, а затем цефтазидимом, сопровождается возрастанием устойчивости к другим фторхинолонам, гентамицину, эритромицину, ампициллину и хлорамфениколу, тогда как индукция устойчивости в направлении «цефтазидим-фторхинолоны» приводила к более выраженному возрастанию резистентности к препаратам β-лактамной и аминогликозидной групп. Интересно, что в работе Rajyaguru J.M. и Muszynski M. J. был получен во многом аналогичный результат на модели B. cepacia – резистентные мутанты, селекционированные хлорамфениколом, имели значительно возросший уровень устойчивости к антибиотикам фторхинолоновой группы и цефтазидиму (Rajyaguru, Muszynski, 1997).

Несмотря на то, что не удалось выделить мутанты B. mallei с высоким уровнем устойчивости к обеим группам антимикробных соединений, тем не менее, отдельные резистентные к пефлоксацину варианты B. mallei имели отчетливо возросшую устойчивость к другим фторхинолоновым антибиотикам и незначительно увеличенную резистентность к отдельным аминогликозидам и хлорамфениколу. Данные о фенотипах резистентности исходных и полученных штаммов приведены в таблице 1.

Табл. 1.

Резистентность исходных штаммов и селекционированных мутантов буркхольдерий к антибиотикам различных классов

Штамм

МПК антибиотиков (мкг/мл)

PFX

OFX

CIP

CAZ

AMP

GEN

ERY

DOX

CML

B. pseudomallei 56770

8

8

4

10

64

64

64

4

16

B. pseudomallei 56770 SMCP

128

>64

64

>256

>512

>128

>128

4

32

B. pseudomallei 56770 SMPC

>128

>128

64

>64

256

128

>128

4

>256

B. pseudomallei 56770 SMOC

>128

>128

>64

>64

>128

>128

>128

2.5

>256

B. mallei Ц-5

2

2

1

4

32

2

32

0.5

8

B. mallei Ц-5 SMC

2

2

1

>128

256

2

>64

1

8

B. mallei Ц-5 SMP-150-2

>128

64

16

4

32

2

32

1

16

B. mallei Ц-5 SMP-150-3

>128

32

32

4

32

2

32

0.5

8

B. thailandensis E264

10

12

8

10

64

32

32

4

32

B. thailandensis E264 SMPC

>128

>128

>64

64

>128

>128

256

4

256

Обозначения: PFX – пефлоксацин, OFX – офлоксацин, CIP – ципрофлоксацин, CAZ – цефтазидим, AMP – ампициллин, GEN – гентамицин, ERY – эритромицин, DOX – доксициклин, CML – хлорамфеникол.

Важно отметить, что варианты B. pseudomallei и B. mallei с измененной экспрессией эффлюкс-белков и компонентов секреторных систем оказались существенно аттенуированными для различных биологических моделей. Так, их вирулентность для золотистых хомячков оказалась снижена на 5-6 порядков (LD50 > 106 ж.м.к.), для белых мышей – практически утрачена (отсутствие гибели животных, инфицированных дозами 108 ж.м.к.).

Изменение проницаемости и транспортных систем клеточных мембран при развитии множественной резистентности Burkholderia

Экспрессия мембранных белков у мутантов B. pseudomallei, B. mallei и B. thailandensis с различными фенотипами резистентности. Определенные характеристики полученных мутантных штаммов, а именно их перекрестная устойчивость к антимикробным соединениям, которые не использовались при селекции, позволили нам сделать предположение о возможной роли процессов снижения проникновения антибиотиков, либо их активного выброса в формировании наблюдаемых фенотипов резистентности и исследовать характер изменений систем мембранного транспорта у полученных полирезистентных вариантов буркхольдерий. Анализ изменений белкового состава клеточных мембран был начальным этапом исследований в данном направлении.

Сравнительное исследование в SDS-PAGE белков наружных мембран штаммов B. pseudomallei дикого типа и их резистентных к отдельным антибактериальным препаратам мутантов показало, что мутантные штаммы, в целом, характеризовались снижением уровня продукции мажорных мембранных протеинов и прекращением продукции отдельных белков с молекулярными весами в диапазонах 39 – 70 kDa и 27 – 30 kDa. Совершенно иной, по сравнению с «монорезистентными» вариантами, характер изменений экспрессии белков наружных мембран был обнаружен у мутантов B. pseudomallei со стабильно сохранямыми PfxR CazR, CazR PfxR,  CazR OfxR и OfxR CazR фенотипами резистентности. У всех полирезистентных вариантов наблюдалась гиперпродукция мажорных белков 27, 39, 48, 71 и 110 kDa и, вместе с тем, прекращение синтеза протеина 45 kDa, а также некоторое снижение продукции белка 49 kDa (рис. 1).

Рис. 1. SDS-PAGE (A) и иммуноблоттинг (B) белков наружных мембран исходного штамма B. pseudomallei 56770 и его полирезистентных мутантов. Штаммы: 1 – дикий тип; 2 - 56770 SMPC; 3 - 56770 SMCP; 4 - 56770 SMOC.

Характер изменений в продукции мембранных протеинов, сходный с выявленным у полирезистентных мутантов B. pseudomallei, наблюдался также у полирезистентных производных B. thailandensis и, в меньшей степени, у B. mallei, чьи мутанты, резистентные к фторхинолоновым антибиотикам, характеризовались прежде всего снижением количества мажорных мембранных белков 21, 42, 45 kDa и группы минорных протеинов 70 - 100 kDa. Проведенные исследования, таким образом, обозначили определенную закономерность в изменении экспрессии протеинов наружных мембран у видов Burkholderia при формировании полирезистентных фенотипов, выражающуюся, наряду с дефектами по отдельным белкам, в возрастании экспрессии группы мембранных протеинов - 110, 71, 48, 39, 27 и 21 kDa.

Известно, что снижение экспрессии или утрата поринов мембран является одной из общих, закономерных черт адаптивного ответа бактерий на воздействие антимикробных соединений (Livermore, 1984; Nikaido, 1989), имеющей, вместе с тем, свои отличительные особенности, как в зависимости от таксономической принадлежности микроорганизма, так и от физико-химических свойств и механизмов действия антибиотика (Guymon et al., 1978; Irvin et al., 1981; Angus et al., 1982; Parr et al., 1987; Bakken et al., 1987; Aronoff, 1988). Вместе с тем, анализ механизмов устойчивости к антибиотикам различных классов, в том числе хинолонам и их фторированным производным, у различных грамнегативных бактерий показывает, что ограничение поступления антибиотиков вследствие изменения экспрессии поринов наружной мембраны является первичным этапом процесса формирования резистентности, опосредованно приводящим к увеличению частоты мутаций по различным геномным локусам в целом, и дальнейшей селекции клонов с модифицированными мишенями действия препаратов (Cohen et al., 1989; Chamberland et al., 1989b), либо активированными системами выведения антибиотиков из клеток (Sabath, 1984; Ishii et al., 1991).

Суммируя полученные результаты и известные данные литературы, можно было предположить, что формирование устойчивости к антимикробным препаратам различных классов у В. pseudomallei, B. mallei и В. thailandensis обусловлено как возрастанием экспрессии аппарата активного выброса антибиотиков (multidrug efflux), так и снижением проницаемости клеточной оболочки за счет утраты, либо пониженной экспрессии отдельных поринов.

Получение и характеристика мутантов Burkholderia, дефектных по продукции мембранных белков. Для подтверждения выдвинутого предположения и более детальной оценки роли мембранных протеинов в реализации резистентности к антимикробным соединениям мы поставили перед собой задачу, используя техники мутагенеза, разработанные ранее для возбудителей мелиоидоза и сапа (Меринова и др., 1997; Меринова, 1998), получить мутанты исследуемых видов буркхольдерий, дефектные по продукции отдельных мембранных белков и провести анализ влияния утраты, либо снижения продукции мембранных протеинов на резистентность к отдельным группам антибиотиков. Кроме того, представлялось интересным получить мутанты со сниженной устойчивостью к тем или иным антибиотикам, используя в качестве исходных штаммов селекционированные полирезистентные мутанты, и исследовать возможные реаранжировки белковых спектров наружных мембран при утрате какого-либо фенотипического маркера резистентности

Мутанты патогенных буркхольдерий, недостаточные по продукции мембранных протеинов (Bop-), были индуцированы включением в хромосому транспозонов Tn9 и Тn5. Полученные мутанты B. pseudomallei и B. mallei отличались дефектами, либо сниженной продукцией ряда мембранных белков (21, 27, 48, 71, 110 kDa) и уменьшением устойчивости к цефалоспориновым и фторхинолоновым антибиотикам (рис. 2, табл. 2). Естественно, приведенные данные не являются достаточными для оценки, как таковой, функциональной роли отдельных мембранных протеинов, тем не менее, они обозначают ряд мембранных белков, изменения в продукции которых оказывают влияние на уровень резистентности бактерий к антибиотикам различных групп. Для подтверждения связи экспрессии отдельных мембранных протеинов и резистентности исследуемых микроорганизмов к антибактериальным препаратам мы предприняли попытку получения мутантов со сниженной устойчивостью к антибиотикам на основе полирезистентных мутантных штаммов.

Рис. 2. Белки наружных мембран клеток исходного штамма и инсерционных мутантов B. pseudomallei. Обозначения: 1 - B. pseudomallei 57576, 2 - B. pseudomallei 57576 TTM6, 3 - B. pseudomallei 57576 TTM7, 4 - B. pseudomallei 57576 TTM9.

Табл.2.

Устойчивость Tn5-индуцированных Bop- мутантов B. pseudomallei к антибиотикам фторхинолоновой и цефалоспориновой групп

МПК препаратов*

CAZ, мкг/мл

PFX, мкг/мл

OFX, мкг/мл

B. pseudomallei 57576

12

8

8

B. pseudomallei 57576 T4

12

8

6

B. pseudomallei 57576 TTM6

5

2.5

3

B. pseudomallei 57576 TTM7

5

3

3

B. pseudomallei 57576 TTM9

10

5

5

Плазмида RP1::Tn9 Rep ts была передана в клетки мутанта B. pseudomallei 57576 SMCP CazR PfxR OfxR. Трансконъюганты от скрещивания тестировали на средах с цефтазидимом и пефлоксацином, отбирая клоны cо сниженной резистентностью. Удалось выделить клон (B. pseudomallei 57576 SMRT21), утративший резистентность только к цефтазидиму (CazS PfxR OfxR); МПК антибиотика для него составила 12 мкг/мл, что соответствовало уровню штамма дикого типа. Анализ в SDS-PAGE белков наружных мембран B. pseudomallei 57576 SMRT21 демонстрировал, что утрата устойчивости к цефтазидиму сопровождается дефектами продукции мажорных мембранных протеинов 27 и 71 kDa (рис. 3).

 

Рис. 3. SDS-PAGE белков наружных мембран клеток B. pseudomallei 57576 SMCP (1) и B. pseudomallei 57576 SMRТ21 (2).

Таким образом, результаты серии экспериментов по получению и первичной характеристике инсерционных Bop- мутантов показали, что  отдельные протеины наружной мембраны (110, 71, 48, 27 и 21 kDa) могут непосредственно участвовать в процессах формирования у патогенных видов Burkholderia резистентности высокого уровня к антибиотикам фторхинолоновой и цефалоспориновой групп.

В целом, полученные результаты свидетельствовали в пользу того, что мембранные протеины, уровень продукции которых был ассоциирован с измененной чувствительностью к антибиотикам, являются компонентами транспортных систем, участвующих в активном выбросе антибатериальных препаратов из клеток во внешнюю среду либо обеспечивающих селективное проникновение антибиотиков в клетку извне.

Проницаемость клеточных мембран и эффлюкс антимикробных соединений у полирезистентных вариантов Burkholderia. Для дальнейшей оценки роли систем мембранного транспорта в развитии множественной антибиотикорезистентности мы провели сравнительные исследования проницаемости клеточных оболочек, процессов энергозависимого эффлюкса антимикробных соединений и их аналогов, и изменений в продукции и транспорте отдельных внеклеточных и поверхностных биополимеров у штаммов буркхольдерий, отличающихся чувствительностью к антибиотикам.

Известно, что наружные мембраны клеток грамотрицательных бактерий служат эффективным барьером, ограничивающим поступление из внешней среды различных соединений, ограничивающих жизнеспособность микроорганизмов (Nikaido, Vaara,1985; Vaara, 1992). Исходно низкая проницаемость поверхностных структур клетки для ряда антимикробных соединений является одной из составляющих внутренней, природной лекарственной резистентности (intrinsic resistance) у ряда видов бактерий. Активация эффлюкс-систем клетки также вносит свой вклад в реализацию резистентности к токсичным для микроба соединениям. Имея в своем распоряжении ряд штаммов с измененной чувствительностью к антибиотикам, мы попытались оценить соотношение снижения проницаемости мембран и процессов эффлюкса в феномене развития множественной лекарственной устойчивости у возбудителя мелиоидоза.

Изучение уровня устойчивости исходных и мутантных штаммов к ряду неспецифических ингибиторов, способных к эффективному проникновению через мембраны бактериальных клеток (жирные кислоты, соли желчных кислот, детергенты и красители) показали существенное снижение мембранной проницаемости полирезистентных мутантов B. pseudomallei для целого ряда соединений различной химической природы и физико-химических свойств. Для оценки составляющей активного эффлюкса в реализации резистентности к антибиотикам и неспецифическим ингибиторам мы исследовали влияние блокаторов мембранного транспорта на уровень устойчивости мутантов и штамма дикого типа к отдельным антибиотикам, а также процессы аккумуляции и выведения из клеток микроорганизмов бромистого этидия (EtBr), часто используемого в анализе транспортных мембранных систем в качестве структурного аналога антимикробных соединений фторхинолонового ряда (Kumar, Worobec, 2002; Godreuil et al., 2003; Brenwald et al., 2003; Xu et al., 2003; Rouquette-Loughlin et al., 2003; Li et al., 2004; Rafii et al., 2005; Martins et al., 2006).

Полученные нами результаты выявили существенную разницу в скорости накопления и количестве аккумулированного красителя в клетках штамма дикого типа и мутантов с высоким уровнем устойчивости к фторхинолоновым и цефалоспориновым антибиотикам, при этом мутантные штаммы с преобладающей устойчивостью к фторхинолоновым соединениям характеризовались отчетливо меньшей проницаемостью мембран для данного соединения (рис. 4). Анализ процессов эффлюкса EtBr показал, что максимальная скорость выброса ингибитора была у клеток полирезистентных мутантов (рис. 4).

Энергозависимый характер процесса выброса бромистого этидия клетками мутантного штамма B. pseudomallei был продемонстрирован в серии дальнейших экспериментов при исследовании влияния температуры и наличия источника энергии в среде на кинетику эффлюкса EtBr (рис. 5).

Рис. 4. Динамика накопления (А) и выброса (В) бромистого этидия клетками B. pseudomallei 56770 и мутантов с множественной антибиотикорезистентностью.

Рис. 5. Динамика выброса бромистого этидия клетками B. pseudomallei 56770 SMOC при различных температурах (А) и наличии источника энергии (В).

Взятые вместе, результаты проведенных исследований подтверждали значимую роль эффлюкса антимикробных соединений при формировании резистентности множественного характера, в связи с чем нами был проведен ряд дополнительных экспериментов по оценке влияния верапамила - соединения, блокирующего мембранные транспортеры (Ng et al., 1994; Banerjee et al., 1996; Choudhuri et al., 2002; Lee et al., 2003), на уровень резистентности исходного и мутантных штаммов B. pseudomallei к антибиотикам различных групп (рис. 6).

Как показал проведенный анализ, присутствие верапамила в целом приводило к снижению устойчивости исходных и мутантных штаммов к антимикробным соединениям, однако характер снижения отличался в каждом конкретном случае. Так, исследование динамики выживания клеток штамма дикого типа и мутантов под воздействием гентамицина продемонстрировала тенденцию к снижению числа жизнеспособных клеток в присутствии фиксированных концентраций верапамила, при этом у мутантных штаммов снижение выживаемости инокулума наблюдали лишь в определенных диапазонах концентраций антибиотика. Оценка влияния верапамила на выживаемость бактериального инокулума в присутствии фиксированных концентраций (субМПК по отношению к штамму дикого типа) антибактериальных препаратов различных групп в большинстве случаев также показала снижение количества жизнеспособных клеток, при этом угнетающее воздействие верапамила на рост культур полирезистентных мутантов хорошо прослеживалось на средах, содержащих препараты фторхинолоновой группы, тетрациклины и аминогликозиды. Отметим, однако, что набор антибиотиков, устойчивость к которым подавлялась верапамилом, для мутантных штаммов оказался существенно уже, чем для штамма дикого типа (рис. 6).

Рис. 6. Устойчивость штамма дикого типа B. pseudomallei 56770 (A) и его полирезистентныз производных B. pseudomallei 56770 SMPC PfxR CazR (B), B. pseudomallei 56770 SMCP CazR PfxR (C), B. pseudomallei 56770 SMOC OfxR CazR (D) к антибиотикам различных групп при воздействии блокатора мембранных каналов.

Изменения экспрессии поверхностных полисахаридов и систем секреции экзоферментов. Анализируя роль систем мембранного транспорта и изменения проницаемости клеточных оболочек в формировании антибиотикорезистентности у возбудителя мелиоидоза и близких ему видов Burkholderia, мы ставили перед собой в качестве одной из задач как можно более многоплановую оценку полирезистентных фенотипов у данной группы бактерий, в связи с чем нами были проведены исследования изменчивости некоторых поверхностных и внеклеточных биополимеров  у полирезистентных мутантов B. pseudomallei, а именно изменений в структуре ЛПС, способности продуцировать экзополисахарид и внеклеточные ферменты «агрессии»,  то есть анализ модификации клеточных компонентов, причисляемых к факторам патогенности микроорганизма (Алексеев и др., 1984; Алексеев и др., 1994; Пивень, Илюхин, 2000; Brett, Woods, 2000).

Роль ЛПС, как внешнего барьера для различных антимикробных соединений, обусловлена его определенными физико-химическими характеристиками – анионными свойствами, числом межмолекулярных связей в коровом регионе и плотностью упаковки жирнокислотных цепей липида А (Snyder et al., 1999; Wiese et al., 1999). Барьерная функция ЛПС многократно подтверждена многочисленными исследованиями свойств мутантов различных видов бактерий, дефектных по продукции отдельных структурных компонентов ЛПС (Sukupolvi, Vaara, 1989; Plesiat, Nikaido, 1992; Vuorio, Vaara 1992; Helander et al., 1994; Helander et al., 1995; Plesiat et al., 1997; Plesiat, Vaara 1999; Nesper et al., 2001). Выявление возможных модификаций ЛПС при селективном воздействии антимикробных соединений, по нашему мнению, давало возможность более широко обозначить вероятные механизмы, лежащие в основе феноменологии множественной антибиотикорезистентности возбудителя мелиоидоза.

По данным SDS-PAGE, ЛПС-профили мутантов B. pseudomallei PfxR OfxR фенотипов отличались от исходного штамма числом и количественной выраженностью отдельных ЛПС-паттернов практически во всех диапазонах профиля - наблюдалась реаранжировка высокомолекулярных ( > 150 kDa) паттернов и существенная редукция числа низкомолекулярных (25 kDa и менее) фрагментов, что мы рассматриваем как свидетельство наличия структурных модификаций биополимера, сопряженных с возрастанием устойчивости к антибиотикам фторхинолоновой группы (рис. 7).

Рис. 7. SDS-PAGE ЛПС исходного штамма и полирезистентных мутантов B. pseudomallei. Окраска серебром. Штаммы: 1 – 56770; 2 – 56770 SMCP; 3 – 56770 SMPC; 4 – 56770 SMOC.

Логично предполагать, что изменения структуры ЛПС вносят свой вклад в изменение проницаемости клеточных оболочек мутантов B. pseudomallei и формирование устойчивости к отдельным антимикробным соединениям. Как было отмечено выше, структурные модификации ЛПС встречаются у мутантов различных видов бактерий с фенотипом множественной антибиотикорезистентности, часто, однако, изменения структуры ЛПС не являются ведущим фактором формирования резистентности, а скорее следствием комплексных адаптивных реакций клеток, тем не менее, дающим микроорганизмам дополнительные селективные преимущества (Chamberland et al., 1989; Rajyaguru, Muszynski, 1997; Ishikawa et al., 2002; Poole, 2002).

Экзополисахарид (капсульный полисахарид), продуцируемый многими видами грамотрицательных и грамположительных бактерий, является одним из важнейших факторов вирулентности (Pier et al., 1987; Cabral et al., 1987; May et al., 1991; Yu et al., 1995; Pier et al., 2001; Yu, Head 2002; Vuong et al., 2004), вместе с тем, неоднократно была показана роль экзополисахарида как экранирующего барьера в защите клеток бактерий от воздействия антибиотиков и антисептических соединений (Nickel et al., 1985; Morris et al., 1996; Vandenbroucke-Grauls, 1996; Desai et al., 1998; Ali et al., 2000; Hentzer et al., 2001; Campanac et al., 2002; Drenkard, Ausubel, 2002; Cunha et al., 2004; Arciola et al., 2005; Cerca et al., 2005). Подчеркнем также, что утрата способности продуцировать экзополисахарид также в отдельных случаях сопровождается повышением устойчивости микробов к некоторым группам антимикробных соединений, в частности, подобные особенности формирования резистентности к полипептидным антибиотикам были описаны у X. campestris, Sphingomonas spp. и E. coli (Pollock et al., 1994).

Исследования изменений продукции экзополисахарида у полирезистентных  мутантов различных видов Burkholderia мы проводили с использованием двух методических подходов. Качественно способность продуцировать экзополисахарид оценивали методом, основанным на избирательном окрашивании экзополисахарид-негативных колоний микроорганизмов липофильным красителем судан черным В (Liu et al., 1998); для количественного соотнесения экзополисахарид-продуцирующей активности мутантных штаммов буркхольдерий за основу был взят метод окрашивания биопленок, формируемых бактериями на твердых субстратах (Ngwai et al., 2006). Результаты данной серии экспериментов приведены в таблице 3.

Табл. 3.

Продукция экзополисахарида исходными штаммами и полирезистентными мутантами различных видов Burkholderia

Штамм

Окрашивание

Судан черным В

Формирование

биопленок, А600 (р)

B. pseudomallei 56770

-

0.32 (0.01)

B. pseudomallei 56770 SMP

+

0.14 (0.05)

B. pseudomallei 56770 SMC

-

0.37 (0.01)

B. pseudomallei 56770 SMO

+

0.13 (0.01)

B. pseudomallei 56770 SMPC

+

0.17 (0.03)

B. pseudomallei 56770 SMCP

-

0.37 (0.02)

B. pseudomallei 56770 SMOC

-

0.29 (0.01)

B. mallei 10230

-

0.30 (0.01)

B. mallei 10230 SMP

+

0.11 (0.02)

B. mallei 10230 SMC

-

0.29 (0.02)

B. thailandensis E264

-

0.39 (0.03)

B. thailandensis E264 SMP

+

0.17 (0.01)

B. thailandensis E264 SMO

-

0.24 (0.07)

B. thailandensis E264 SMPC

-

0.27 (0.01)

B. cepacia 8235

-

0.36 (0.02)

B. cepacia 8235 SMPC

+

0.15 (0.02)

B. cepacia 8235 SMCP

-

0.39 (0.01)

B. cepacia 25416

-

0.34 (0.02)

B. cepacia 25416 SMPC

-

0.30 (0.03)

B. cepacia 25416 SMCP

-

0.35 (0.02)

При анализе данных, полученных в этой серии экспериментов, можно видеть, что дефекты в продукции экзополисахарида отмечались, прежде всего, у мутантных штаммов B. pseudomallei и B. mallei, имеющих высокий уровень устойчивости к препаратам фторхинолоновой группы, тогда как у мутантов, при получении которых в качестве селективных факторов первыми были использованы препараты группы цефалоспоринов, вообще не было выявлено вариантов со сниженной продукцией экзополисахарида, напротив, все штаммы этой группы обладали даже несколько более высокими показателями формирования биопленок (табл. 3).

Характер варьирования продукции экзополисахарида у мутантов буркхольдерий, принадлежащих к различным фенотипическим классам резистентности, по-видимому, является отражением изменений в экспрессии различных секреторных систем бактерий, в том числе, задействованных в транспорте компонентов данной поверхностной структуры. В пользу этого свидетельствуют также результаты изучения спектров внеклеточных ферментов полирезистентных мутантов.

Приобретение фенотипа множественной антибиотикорезистентности в ряде случаев может сопровождаться функциональной модификацией секреторных систем клеток I, II и IV типа (Poole, 2001; Poole, 2002; Poole, 2004; Poole, 2005; Marquez, 2005), что, как правило, приводит к значительным изменениям отдельных фенотипических свойств микроорганизмов. Как отмечалось ранее, некоторые из таких полирезистентных вариантов обладают повышенным уровнем продукции экзополисахарида и большей биофильм-формирующей способностью. Модификации спектров секретируемых белков, вызванные изменениями экспрессии секреторных аппаратов I, II (gsp, general secretory pathway) и IV типов, также является характерной особенностью изолятов с множественной антибиотикорезистентностью (Poole et al., 1993; Schlor et al., 1997; Hayashi et al., 2000; Peng et al., 2005; Linares et al., 2005; Gil et al., 2006; Zhu et al., 2006; Posadas et al., 2007).

Для оценки возможных модификаций секреторной активности полирезистентных мутантов B. pseudomallei мы исследовали спектры их экстрацеллюлярных протеинов и вариабельности ферментативной активности культуральных супернатантов бактерий. Полученные результаты обозначили определенную закономерность в изменении специфической экстрацеллюлярной энзимной активности у штаммов B. pseudomallei с различными фенотипами резистентности (рис. 8).

Мутанты, имеющие фенотип множественной резистентности, в целом, характеризовались снижением энзимной активности культуральных фильтратов, по сравнению с исходными штаммами и «монорезистентными» производными. Отметим, что полирезистентные варианты с высоким уровнем устойчивости к препаратам фторхинолонового ряда не продуцировали внеклеточных липаз и лецитиназ, кроме того, PfxR CazR фенотип практически полностью утрачивал экстрацеллюлярную протеолитическую активность (рис. 8).

Рис. 8. Ферментативная активность культурального супернатанта исходного штамма B. pseudomallei и мутантов, селекционированных в последовательности OfxR - CazR (A), PfxR - CazR и CazR - PfxR. Показаны средние значения диаметров зон гидролиза субстратов.

Таким образом, наряду со сведениями о характерных перестройках белкового спектра наружных мембран клеток, результаты анализа экспрессии поверхностных углеводсодержащих биополимеров и секреторной активности полирезистентных вариантов буркхольдерий, приведенные в данном разделе работы, являются еще одним подтверждением комплексного изменения процессов клеточного транспорта у исследуемых микроорганизмов при формировании устойчивости к антимикробным соединениям множественного типа. Судя по всему, эти изменения выражаются в модификации проницаемости клеточных оболочек и активации механизмов активного выведения антимикробных соединений из клеток во внешнюю среду. В число последних, по-видимому, вовлечены и sec-зависимые секреторные системы, ответственные за транспорт полипептидов и полисахаридных компонентов.

Эффлюкс-системы и развитие множественной   антибиотикорезистентности Burkholderia

Системы лекарственного эффлюкса патогенных Burkholderia. В последнее время у грамотрицательных и грамположительных бактерий интенсивно изучается один из механизмов множественной лекарственной устойчивости, представленный системами активного энергозависимого транспорта и выброса антимикробных соединений из клеток во внешнюю среду (multidrug efflux) (Ma et al., 1994; Nikaido, 1994; Nikaido et al., 1998; Kohler et al., 1999; Van et al., 2000; Borges-Walmsley, Walmsley, 2001; Markham, Neyfakh, 2001; Poole, 2001; Poole, 2004; Saidijam et al., 2006). Большинство из выявленных транспортных систем резистентности специфичны для довольно узкого ряда структурно сходных субстратов, однако идентифицированы и мультиэкспортеры (multidrug efflux pumps), «оперирующие» с широким набором даже структурно различных антибиотических соединений (Nikaido, 1998; Zgurskaya, Nikaido, 2000). Известные на сегодня бактериальные лекарственные мультитранспортеры принадлежат к 6 различным функциональным семействам транспортных протеинов: ABC (ATP binding cassette), MFS (Major Facilitator Superfamily), RND (Resistance / Nodulation / Division), SMR (Small Multidrug Resistance), MATE (Multidrug and Toxic Compound Extrusion), MET (Multidrug Endosomal Transporter) (Paulsen et al., 2001).

Мы использовали технику дифференциального дисплея мРНК для исследования экспрессии последовательностей геномов, гомологичных некоторым известным на сегодняшний день efflux-детерминантам MFS, SMR и RND семейств транспортных протеинов, у исходных и мутантных штаммов B. pseudomallei, B. mallei и B. thailandensis в процессе селективного воздействия антимикробными препаратами фторхинолоновой и цефалоспориновой групп. Первичным этапом этого раздела исследований был сравнительный анализ in silico нуклеотидных последовательностей известных и предполагаемых генов лекарственного эффлюкса B. pseudomallei, B. mallei и B. thailandensis, выполненный с использованием биоинформационного программного обеспечения на основе опубликованных в Genbank последовательностей геномов буркхольдерий группы «pseudomallei».

Исследование представленных в Genbank геномных сиквенсов штаммов B. pseudomallei K96243, B. pseudomallei 1710b, B. mallei ATCC23344 и B. thailandensis E264 показали наличие большого числа кодирующих последовательностей, гомологичных детерминантам лекарственных транспортеров MFS типа. Группирование кодируемых обозначенными генами протеинов по числу точных соответствий в участках их аминокислотных последовательностей с использованием алгоритма Clustal W (Thompson et al., 1994) и оценка их гомологии известным MFS-протеинам показала, что около половины MFS эффлюкс-транспортеров B. pseudomallei, B. mallei и B. thailandensis принадлежит к DHA2 (Drug/Hydrogen Antiport) семейству вторичных транспортеров, при этом большая часть из них высокогомологична лекарственным мультитранспортерам QacA/EmrB субсемейства, а небольшую группу составляют гомологи Bcr/CflA субсемейства (рис. 9).

Принадлежащие к данным группам транспортные белки различных бактериальных видов, как сообщалось, осуществляют энергозависимый выброс структурно разнородных антимикробных соединений из клеток во внешнюю среду (Putman et al., 2000; Saidijam et al., 2006).

Несомненный интерес представляет также характер локализации детерминант MFS-транспортеров в геномах B. pseudomallei, B. mallei и B. thailandensis. Кодирующие последовательности MFS-протеинов расположены в области генных кластеров тРНК, транскрипционных регуляторов систем транспорта компонентов полисахарида, флагеллярных генов, генов консервативного метаболизма, генных кластеров секреторных систем II и III типов. Отметим также наличие последовательностей IS-элементов и генов транспозаз в непосредственной близости от локусов многих MFS-транспортеров, что позволяет  предполагать важную роль транспозиционных событий в формировании этих фрагментов геномов.

Рис. 9. ClustalW дендрограмма соответствия аминокислотных последовательностей MFS-транспортеров B. pseudomallei K96243, B. pseudomallei 1710b, B. mallei ATCC23344 и B. thailandensis E264. Указано количество TMS белков и их принадлежность к отдельным семействам и субсемействам MFS.

Последовательности геномов B. pseudomallei, B. mallei и B. thailandensis, гомологичные SMR транспортерам EmrE/QacE группы, как показал проведенный анализ, расположены на хромосоме 1 у всех трех видов буркхольдерий и локализованы в области генных кластеров, кодирующих компоненты консервативных метаболических путей и АТФ-зависимых секреторных систем. Сравнение аминокислотных последовательностей EmrE микроорганизмов группы «pseudomallei», других буркхольдерий и видов отдаленой гетерологии продемонстрировало полную идентичность этих протеинов у B. pseudomallei и B. mallei и отличия от них по 9 аминокислотам у соответствующего белка B. thailandensis. Оказалось также, что белок EmrE B. pseudomallei, B. mallei и B. thailandensis структурно более сходен c SMR-транспортерами B. phymatum, B. phytofirmans, B. xenovorans, видов Ralstonia, Serracia и Klebsiella, чем с EmrE B. cenocepacia и некоторых других видов буркхольдерий (рис. 10).

Рис. 10. Аминокислотные последовательности EmrE различных видов Burkholderia и гетерологичных микроорганизмов. Оттенками выделены фрагменты с различной степенью идентичности аминокислотных последовательностей.

В отношении эффлюкс-детерминант, кодирующих транспортеры RND суперсемейства, анализ геномных сиквенсов B. pseudomallei, B. mallei и B. thailandensis показал, что большинство из трехкомпонентных RND эффлюкс-систем у данных видов буркхольдерий локализовано на хромосоме 1 в областях генных кластеров транспортных систем аминокислот и азотистых оснований, генов синтеза и транспорта фимбриальных структур, систем секреции сидерофоров и гемолизинов (гомологов HlyB-HlyD), генов пуринового и липидного обмена, генов контроля клеточного цикла. В большинстве случаев, последовательности RND эффлюкс-систем представлены оперонами, состоящими из дивергентно транскрибируемого гена транскрипционного регулятора, гена вспомогательного белка MFP семейства, гена транспортера и гена порина наружной мембраны.

Проведенный анализ гомологии аминокислотных последовательностей обозначенных RND транспортеров буркхольдерий и протеинов - представителей различных групп RND суперсемейства (рис. 11)  показал прнадлежность большинства предполагаемых эффлюкс-белков данной категории к  HAE1 (Hydrophobe/amphiphile efflux-1) семейству транспортеров и максимальную степень сходства с лекарственными мультиэкспортерами AcrB/AcrD/AcrF и YegO/YegN типов (Tseng et al., 1999).

Рис. 11. Clustal W дендрограмма гомологии аминокислотных последовательностей RND-транспортеров B. pseudomallei, B. mallei и B. thailandensis и эффлюкс-протеинов различных семейств суперсемейства RND.

In silico исследование предполагаемых детерминант антибиотикорезистентности транспортного типа B. pseudomallei, B. mallei и B. thailandensis с использованием биоинформационных технологий продемонстрировало разнообразие генетических механизмов, посредством которых у них может реализовываться множественная устойчивость к антимикробным соединениям, а обозначенные по результатам анализа группы детерминант множественной резистентности были использованы при подборе олигонуклеотидных праймеров для детекции генов лекарственного эффлюкса в ПЦР и изучении их экспрессии в неселективных условиях и при воздействии антибиотиков.

Набор праймеров  для амплификации последовательностей эффлюкс-детерминант включал олигонуклеотиды, специфичные консервативным фрагментам CDS транспортеров MFS (QacA/EmrB группа гомологии), SMR (QacE) и RND (AcrB/AcrD/AcrF группа) типов (таб. 4). В последнем случае были использованы три пары праймеров для детекции участков кодирующих последовательностей, гомологичных идентифицированным ранее генам эффлюкс-транспортеров B. pseudomallei AmrB (Moore et al., 1999) и BpeB (Chan et al., 2004a), а также предполагаемых RND эффлюкс-транспортеров (BPSS1119/BMAA1045), структурно сходных с MexF P. aeruginosa (Kohler et al., 1997).

Табл. 4.

Характеристика олигонуклеотидных праймеров, использованных для анализа дифференциальной экспрессии генов лекарственного эффлюкса Burkholderia

Праймер

Последовательность

(5-3)

Т отжига, C

Мишени

ПЦР-

фрагмент

Ампликон (пн)

AcrB/AcrD/AcrF эффлюкс-транспортеры

mxBs

GATCTCCGCGCAGAACGT

57

BPSL0815 (bpeB)

BMA0316

618 - 1211

594

mxBas

AGGCCGATCGCGAGCACG

mxYs

TTCATGCAGAACTTCCGC

57

BPSL1803 (amrB)

1069 - 1371

303

mxYas

GAACGCCATCGGCACGAA

mxFs

CGTCGTGATTTTCCTGTT

55

BPSS1119

BMAA1045

BTH_I2867

1026 - 1381

1080 - 1435

1050 - 1380

356

mxFas

ACGCGAACTCCTTGAACA

QacA/EmrB эффлюкс-транспортеры

qcAs

GACAACTTCTCGTGGCCGTG

62

BMA_1058

BMA_A0922

BURPS1710b_A2077

BTH_I2561

BTH_II1077

507 - 935

449

qcAas

GACGCCATCACCAGCCCCGC

SMR (QacE) эффлюкс-транспортеры

qcEs

ATGCAACTTCCAGGTTACGC

59

BMA1245

BPSL1861

BURPS1710b_1984

1 - 339

339

qcEas

TCAATGCGCCTGCATTTTCG

Дифференциальная экспрессия эффлюкс-детерминант при формировании множественной резистентности Burkholderia. Участие эффлюкс-транспортеров AcrB/AcrD/AcrF, QacA/EmrB и QacE групп в формировании антибиотикорезистентности множественного типа оценивали по результатам RT-PCR анализа мРНК транспортеров у исходных штаммов и полирезистентных мутантов, культивируемых в неселектвных условиях и на средах с субъингибирующими концентрациями антибиотиков фторхинолонового и цефалоспоринового рядов (рис. 12).

В неселективных условиях исходные штаммы и большинство резистентных мутантов имели невысокий уровень конститутивной экспрессии AcrB/AcrD/AcrF транспортеров AmrB и BpeB, за исключением двух мутантов B. pseudomallei OfxR CazR и CazR PfxR фенотипов, у которых уровень экспрессии AmrB был существенно выше. Экспрессия BPSS1119/BMAA1045 в неселективных условиях была отмечена только у CazR PfxR мутанта B. pseudomallei. Рост в присутствии антибиотиков вызывал заметное возрастания количества мРНК BpeB, AmrB и BPSS1119/BMAA1045 и у диких, и у мутантных штаммов, при этом все же более выраженное возрастание экспрессии RND эффлюкс-детерминант наблюдалось у полирезистентных производных.

Уровень экспрессии эффлюкс-транспортеров QacA/EmrB был приблизительно одинаковым у исходных и мутантных штаммов при росте на средах, не содержащих антимикробных соединений; заметное увеличение мРНК данных эффлюкс-генов мы наблюдали у мутантных штаммов буркхольдерий с высоким уровнем устойчивости к препаратам фторхинолоновой группы  при культивировании на средах с пефлоксацином. Уровень мРНК QacE также оказался приблизительно одинаковым у большинства штаммов буркхольдерий, выращенных на неселективных средах. В селективных условиях мы отмечали увеличение экспрессии QacE, более выраженное у мутантных штаммов B. pseudomallei и B. thailandensis.

Рис. 12. RT-PCR анализ экспрессии эффлюкс-генов у исходных штаммов и полирезистентных мутантов буркхольдерий, выращенных в неселективных (A) и селективных (B) условиях. Треки 1 – 10: B. pseudomallei 56770, B. pseudomallei 56770 SMPC, B. pseudomallei 56770 SMCP, B. pseudomallei 56770 SMOC, B. mallei C-5, B. mallei C-5 SMP-150-2, B. mallei C-5 SMP-150-3, B. mallei C-5 SMC, B. thailandensis E264, и B. thailandensis E264 SMPC. Трек C: контроль, транскрипт gyrA.

Полученные результаты, таким образом, указывают на участие эффлюкс-систем различных типов в реализации множественной устойчивости буркхольдерий группы «pseudomallei» к антибиотикам фторхинолонового ряда, цефалоспоринам и другим антимикробным соединениям. Отметим, что факты сочетанного действия эффлюкс-систем различных типов при развитии множественной устойчивости известны для ряда бактериальных видов, в том числе природнорезистентных (Germ et al., 1999; Lee et al., 2000). Повышенный уровень экспрессии гомологов QacA/EmrE и AcrB/AcrD/AcrF в отсутствии селективного воздействия, наблюдаемый нами у части мутантов, возможно, свидетельствует о генетически закрепленных нарушениях механизмов регуляции последовательностей, что, например, было показано в отношении гиперэкспрессии эффлюкс-оперона mexAB-oprM P. aeruginosa (Adewoye et al., 2002).

Экспрессия эффлюкс-последовательностей B. pseudomallei в гетерологичных системах. Еще одно подтверждение участия QacE и AcrB/AcrD/AcrF эффлюкс-систем B. pseudomallei в формировании устойчивости к антимикробным соединениям различных групп было получено в экспериментах по shotgun-клонированию в составе вектора pUC19 ДНК CazR PfxR мутанта B. pseudomallei. В качестве источника хромосомной ДНК был использован штамм B. pseudomallei 56770 SMCP, имеющий высокий уровень резистентности к цефалоспоринам, фторхинолонам, аминогликозидам и некоторым β-лактамам, и отличающийся стабильным сохранением маркеров резистентности при длительном культивировании в неселективных условиях. Полученные рекомбинантные штаммы E. coli характеризовались резистентностью к пефлоксацину, имипенему и аминогликозидам (таб. 5).

Табл. 5.

Рекомбинантные штаммы E. coli

Штамм

Фенотип резистентности

E. coli JM107 (pLKp1)

PfxR StrR

E. coli JM107 (pJla1)

PfxR StrR

E. coli JM107 (pJla3)

PfxR StrR

E. coli JM107 (pLKp3)

PfxR StrR KanR

E. coli DH1 (pLKp2)

PfxR StrR

E. coli DH1 (pLKp4)

PfxR ImpR

E. coli DH1 (pDla3)

PfxR StrR ImpR

Анализ спектра резистентности полученных рекомбинантных штаммов к антимикробным соединениям различных классов и снижение уровня их устойчивости в присутствии соединений – блокаторов мембранных каналов (верапамил) (рис. 13) указывали на ведущую роль механизмов лекарственного эффлюкса в формировании наблюдаемых фенотипов антибиотикорезистентности.

Рис. 13. Устойчивость рекомбинантного штамма E. coli DH1 LKp4 к пефлоксацину при воздействии блокатора мембранных каналов. Прерывистой линией показана выживаемость микробных клеток в присутствии верапамила (40 мкг/мл)

Продукты экспрессии клонированных последовательностей хромосомной ДНК B. pseudomallei - белки 32 и 48 kDa - были идентифицированы в иммуноблоттинге с иммуноглобулинами к общеклеточным антигенам B. pseudomallei (рис. 14).

Рис. 14. Иммуноблоттинг общеклеточных (A) и мембранных белков (B) полирезистентных мутантов B. pseudomallei и рекомбинантных штаммов E. coli.

Учитывая тот факт, что штамм B. pseudomallei 56770 SMCP отличается  возрастанием уровня экспрессии эффлюкс-детерминант AcrB/AcrD/AcrF, QacA/EmrB и QacE типов, было проведено исследование экспрессии этих последовательностей у отобранных в результате скрининга рекомбинантных клонов методом дифференциального дисплея мРНК с ген-специфичными праймерами (рис. 15).

AB 

Рис.15. Детекция мРНК эффлюкс-последовательностей B. pseudomallei amrB (A) и emrE (B) в рекомбинантных штаммах E. coli. Обозначения: М – маркерная ДНК (517, 460, 396, 350 п.н.); 1 – E. coli JM107 LKp1; 2 – E. coli DH1 LKp2; 3 – E. coli JM107 LKp3b; 4 – E. coli JM107 LKp3y; 5 – E. coli JM107.

Результаты секвенирования транскриптов и данные их сравнительного анализа с известными генами B. pseudomallei (рис. 16) подтвердили принадлежность клонированных последовательностей к эффлюкс-детерминантам  AcrB/AcrD/AcrF и QacE типов.

223  272

B.pseudomallei amrB gene  (223) CTGCTGTACACGTCGGCGACGAGCAGCGCCGGCCAGGCGTCGCTGTCGCT

  amrB_LKp2 (1) --------------------------------------------------

amrB_LKp3b (1) -------------------------------GCCAGGCGTCGCTGGCGCT

  273  322

B.pseudomallei amrB gene  (273) CACGTTCAAGCAGGGCGTGAGCGCCGATCTCGCGGCCGTCGACGT-GCAG

  amrB_LKp2 (1) ----------------------------------------GACGA-GCAG

amrB_LKp3b  (20) CACGTTCAAGCAGGCCGTGAGCCCTCTTCTCGCGGCCGTCGACGCTGCAG

  323  372

B.pseudomallei amrB gene  (322) AACCGCCTGAAAATCGTCGAGGCGCGGCTGCCCGAGC-CCGTGCGGCGCG

  amrB_LKp2  (10) AACCGCCTTGAAATCGTTGTCTCTTGGCTGCCCTAGCGCCGTTCGGCACC

amrB_LKp3b  (70) AACCGCCTGTAAATCGT--GCTGGGGGCTGCCCTAGCCCCGTTCGGCACC

  373  422

B.pseudomallei amrB gene  (371) ACGGCATCTCGATCGAGAAGGCGGCC--GACAACGCGCAGATCATCGTGT

  amrB_LKp2  (60) ACGCCAGCTCGATCGAGAAGGCAGCC--GAGAACGCGCAGATCATC-TGT

amrB_LKp3b (118) ACGCGTGTTCGATCGAGAAGGCCGCCTCGAGGTCGCGCAGATCATCCTGT

  423  472

B.pseudomallei amrB gene  (419) CGCTCACGTCGGAGGACGGACGGATATCGGGC-GTGGAGCTCGGCGAATA

  amrB_LKp2 (107) CGCTGACGTCGGAGGATCGACGGATATCGGGCAGTGGAGCTCGCAGGATA

amrB_LKp3b (168) CGCTCACGTCGGAGGGCCGACGGATATCGGGCATGGGAGCTCGCAGGATA

  473  522

B.pseudomallei amrB gene  (468) CGCGTCGGCGAACGTGTTGCAGGCGCTGCGGCGCGTCGAGGGCGTCGGCA

  amrB_LKp2 (148) CGCGTCGGCGAACGTGTTGCAGGCGCTGCGGCGCGTCGAGGGCGTCGTTG

amrB_LKp3b (209) CGCGTCGGCGAACGTGTTGCAGGCGCTGCGGCGCGTCGAGGGCGTCTTGG

  523  572

B.pseudomallei amrB gene  (518) AGGTGCAGTTCTGGGGCGCCGAGTATGCGATGCGGATCTGGCCGGACCCC

  amrB_LKp2 (194) AGGTGCAGTGGCGGGGCGCCGAGTATGCGAACTGGATCTCGCCGAAA---

amrB_LKp3b (256) AGGTGCAGTGGCGGGGCGCCGAGTATGCGAACTGGATCTCGCCGAAAATT

  573 585

B.pseudomallei amrB gene  (568) GTGAAGATGGCGG

  amrB_LKp2 (241) -------------

amrB_LKp3b (304) T------------

1 50

qacE (BPSL1861)  (1) ----ATGCAACTTCCAGGTTACGCATG-GCTCGCGATCGCG----ATCGT

  emrE_LKp3b (1) GGGGATGCAACTTCCAGGTTACGCAGAAGCTCGCGATCGCGCACAATCGT

51 100

qacE (BPSL1861) (42) CGCCGAGGTGGTCGGCACGTCGGCGCTGCGCGCAGCCGAAGGTTTCACGC

  emrE_LKp3b  (51) CGCCCAGGTGGTC--CACGCCGGCGCTCAGCGCAGCCGAAGGTTTCA---

101  150

qacE (BPSL1861) (92) GGCTCTGGCCGACGCTCGTCGTCGCCCTCGGCTACGGCACCGCGTTCTAC

  emrE_LKp3b  (96) -GCTCTGGCCGACGCTCCACGTCGCCC-CGGCTACGGCACCGCGTTCTAC

151  200

qacE (BPSL1861)  (142) TGCCTGTCGCTCACGCTCAAGAGCATGCCCGTCGGCATCGTGTACGCGAT

  emrE_LKp3b (140) TGCTGGTCGCTCACCCTCAAGAGCATGCCAGTCGGCACCGTGTACGCGAT

201  250

qacE (BPSL1861)  (192) CTGGTCGGGCGCGGGCATCGTGCTCATCACGCTC-GTCGCGCTCGTGCTC

  emrE_LKp3b (187) CTGGTCAGGCAAGGACATTC-GCTCATCACGCTCCGTCACAGTCGTGCTC

251  300

qacE (BPSL1861)  (241) TATCGGCAGGTGCCGGACTGGCCCGCGGTCGTCGGGCTCGCGCTCATCGT

  emrE_LKp3b (236) TATAGGCAGGTGACGGACTGCCCCGCGGTCGTCGGGCTCGCGCCCCTCGT

301  350

qacE (BPSL1861)  (291) CGCGGGCGTCGTGGTGCTCAATCTCTTTTCGAAAATGCAGGCGCATTGA-

  emrE_LKp3b (284) CGCGGGCGTCGTGGTGCTCGATGT-TTGTCGACG--GCAGGCACTTTGAT

Рис. 16.  Сравнительный анализ генов amrB и qacE B. pseudomallei и секвенированных последовательности транскриптов рекомбинантного штамма E. coli JM107 LKp3b.

Изменчивость детерминант устойчивости к отдельным группам антимикробных соединений и геномная вариабельность полирезистентных штаммов буркхольдерий

Мутационные изменения ДНК-гиразы А у мутантов Burkholderia с высоким уровнем устойчивости к препаратам фторхинолоновой группы. Исследования механизмов резистентности к хинолоновым антибиотикам и их фторированным производным у различных бактериальных видов демонстрируют значимую роль точечных мутаций  в особом участке генов ДНК-гиразы и топоизомеразы IV, определяющем высокую резистентность к фторхинолонам – регионе QRDR (quinolone resistance determining region) (Baranwal et al., 2002; Ruiz, 2003). Мы провели анализ возможных мутационных изменений в QRDR ДНК-гиразы для оценки их значения в формировании резистентности исследуемых видов Burkholderia к препаратам фторхинолонового ряда.

Регион последовательности ДНК-гиразы А, мутационные изменения в котором определяют соответствующие аминокслотные замены во взаимодействующих с антибиотиком участках молекулы белка (QRDR), был предварительно определен нами путем поиска участка gyrA буркхольдерий, гомологичного известным QRDR ДНК-гираз, представленных в Genbank NCBI (www.ncbi.nlm.nih.gov). По результатам анализа аннотированных последовательностей gyrA B. pseudomallei, B. mallei и B. thailandensis и известных последовательностей QRDR gyrA нами были подобраны праймеры для амплификации фрагмента гена, включающего предполагаемый QRDR (табл. 6).

Табл. 6.

Характеристика олигонуклеотидных праймеров, использованных для амплификации фрагмента gyrA видов Burkholderia, предположительно включающего QRDR

Праймер

Последовательность

(5-3)

Т отжига, C

Мишени

ПЦР-

фрагмент

Ампликон (пн)

gyrAs

CTTCCGGATGTCCGCGATGG

60

BMA_0435

BPSL2521

BTH_I1632

100 - 571

472

gyrAas

CGACCTCGTTCAGGTTGTGC

Поиск возможных мутационных изменений в предполагаемом QRDR ДНК-гиразы А буркхольдерий включал в себя несколько технологических этапов: амплификацию исследуемого фрагмента гена в ПЦР, анализ конформационного полиморфизма однонитевых цепей ампликонов (SSCP, single strand conformation polymorphism) и отбор вариантов с атипичными SSCP-профилями, секвенирование и сопоставление нуклеотидных последовательностей QRDR исходных штаммов и «кандидатных» мутантных последовательностей.

Изменения в SSCP-профиле QRDR gyrA были обнаружены у мутантных штаммов PfxR CazR и OfxR CazR мутантов B. pseudomallei и резистентных к фторхинолонам мутантов B. mallei (рис. 17). Секвенирование  QRDR ампликонов из этих штаммов показало наличие единичных и двойных нуклеотидных замен в регионе gyrA 240 – 260 п.н., а трансляция in silico мутантных последовательностей gyrA позволила определить несколько типов аминокислотных замен в QRDR-области фермента (рис. 18).

Аминокислотная замена Thr83→Ile была общей для всех исследованных мутантных штаммов. Замены Gly81→Cys и Asp87→Tyr были обнаружены только у PfxRCazR и OfxRCazR мутантов B. pseudomallei, соответственно. Кроме того, у одного из мутантов B. mallei была выявлена нуклеотидная замена C→T в 250 нуклеотидной позиции гена, не приводящая к аминокислотной замене, и классифицированная нами как silence-мутация. Интересно, что описанные в работе Maeda Y. et al., аминокислотные замены QRDR GyrA у резистентных к хинолонам природных изолятов B. glumae также затрагивают позицию 83 последовательности белка (Maeda et al., 2004).

Рис. 17. ПЦР-SSCP анализ амплифицированных фрагментов QRDR gyrA исходных штаммов и полирезистентных мутантов буркхольдерий. Электрофорез в 10 % полиакриламидном геле. Треки 1 – 9: B. pseudomallei 56770, B. pseudomallei 56770 SMCP, B. pseudomallei 56770 SMPC, B. pseudomallei 56770 SMOC, B. mallei C-5, B. mallei C-5 SMP-150-2, B. mallei C-5 SMP-150-3, B. thailandensis E264, и B. thailandensis E264 SMPC.

Рис. 18. Нуклеотидные (А) и соответствующие аминокислотные (В) замены в области QRDR ДНК-гиразы А у мутантов буркхольдерий с высоким уровнем устойчивости к антибиотикам фторхинолонового ряда.

Таким образом, полученные нами результаты демонстрируют, что мутационные изменения мишеней действия антимикробных соединений (в данном случае, ДНК гиразы А), наряду с активацией систем лекарственного эффлюкса, также вносят свой вклад в формирование наблюдаемых фенотипов множественной антибиотикоустойчивости у B. pseudomallei и B. mallei. Отметим, что сочетание мутаций gyrA и механизмов активного выведения фторхинолонов из клеток неоднократно показано у различных бактериальных патогенов (Chen, Lo, 2003; Dewi et al., 2004; Ricci et al., 2004; Payot et al., 2004).

Детекция интегроноподобных последовательностей в штаммах B. pseudomallei, B. mallei и B. thailandensis. Исследования систем генетического обмена возбудителей мелиоидоза и сапа (Меринова и др., 1990; Меринова и др., 1997; Меринова и др., 1998; Меринова и др., 2000) доказали возможность горизонтального переноса и приобретения данными микроорганизмами R-детерминант в составе мобильных генетических элементов. В настоящей работе определенное внимание было уделено поиску и первичной характеристике интегронов – генетических элементов, способных включать в свой состав индивидуальные генные кассеты (в том числе детерминанты антибиотикорезистентности) по механизму сайт-специфической рекомбинации (Hall, Collis, 1995; Rowe-Magnus, Mazel, 2001; Fluit, Schmitz, 2004; Nogrady et al., 2005).

Для скрининга сходных с интегронами последовательностей B. pseudomallei, B. mallei и B. thailandensis был использован ПЦР-анализ с праймерами, специфичными фрагментам гена интегразы IntI1 и фланкирующим последовательностям области вставки генных кассет (Bass et al., 1999). Последующий электрофоретический анализ продуктов реакции показал наличие ампликонов размерами от 100 п.н. до 1200 п.н. у отдельных штаммов B. pseudomallei и B. thailandensis (рис. 19).

Рис. 19. (А, В) - Амплификация интегроноподобных последовательностей из штаммов различных видов Burkholderia и гетерологичных микроорганизмов. Обозначения: 1 – штаммы B. pseudomallei; 2 – штаммы B. mallei; 3 – штаммы B. thailandensis; 4 – штаммы B. cepacia; 5 – штаммы P. aeruginosa. (С) - Реамплификация очищенных ампликонов. Обозначения: М – маркерная ДНК (pGEM DNA Marker, Promega); 1 – B. pseudomallei 140; 2, 3, 4, 5 – B. thailandensis Е2996 6, 7 – B. cepacia 25416; 8 – B. cepacia 3189.

Секвенирование  и поиск гомологов в Genbank показали, что продукты амплификации ДНК из штамма B. thailandensis E299 представляют собой фрагменты последовательностей транспозаз/интеграз (рис. 20), а анализ геномных регионов буркхольдерий, имеющих максимальные показатели сходства с секвенированными ампликонами продемонстрировал наличие интегроноподобных структур, включающих ген транспозазы/интегразы и гены различной функциональной направленности, в том числе CDS, аннотированные как детерминанты лекарственной устойчивости (гены эффлюкс-транспортеров MFS и RND типов) (рис. 21).

Рис. 20. Нуклеотидная последовательность ампликона 640 п.н. B. thailandensis E299 (A) и гомологичные ей последовательности геномов представителей Burkholderiaceae (B).

Рис. 21. Фрагмент генома B. thailandensis E264 (NC_007651), содержащий полностью идентичный секвенированной последовательности ампликона 640 п.н. штамма B. thailandensis E299 участок ДНК (помечен прямоугольником).

Генетическая гетерогенность штаммов B. pseudomallei и родственных видов с различной чувствительностью к антимикробным соединениям. Заключительная часть нашего исследования была посвящена анализу перспектив молекулярного типирования штаммов буркхольдерий с различными спектрами антибиотикорезистентности. Мы апробировали техники типирования, основанные на амплификации полиморфных ДНК с произвольным праймером (RAPD) и ПЦР-анализе с праймером, специфичным консервативному региону интеграз intI1, для дифференциации штаммов B. pseudomallei дикого типа, селекционированных полирезистентных вариантов и транспозонных мутантов со сниженной устойчивостью к отдельным классам антибиотиков.

Типирование с использованием произвольного праймера (рис. 22) показало заметную межвидовую вариабельность RAPD-паттернов и их более консервативный характер у производных того или иного штамма. Транспозонные мутанты B. pseudomallei со сниженной резистентностью к фторхинолонам и цефтазидиму были распределены в три достаточно обособленные друг от друга группы сходства RAPD-профилей, что может свидетельствовать о сходном характере генетических перестроек, вызванных инсерциями Tn5, внутри каждой из групп сходства. Интересно также, что две отдельные группы сходства RAPD-паттернов были образованы штаммами B. pseudomallei с преобладающей резистентностью к пефлоксацину, офлоксацину и цефтазидиму.

Также удалось обнаружить заметные различия в фингерпринтах содержащих интегразу фрагментов ДНК (рис. 23). Два из трех проанализированных мутантов B. pseudomallei, высокорезистентных к CAZ, PFX и OFX, оказались фактически идентичны по спектру ампликонов, тогда как один мутантный штамм оказался более сходен с исходным. Как и в случае RAPD-анализа, различные виды буркхольдерий формировали достаточно обособленные группы сходства ДНК-профилей. Полученные результаты, по нашему мнению, говорят о заметных геномных перестройках при развитии различных типов резистентности у B. pseudomallei и близкородственных бактерий, и, что может быть важно для дальнейшей разработки молекулярной эпидемиологии данных бактерий, свидетельствуют о возможности определения дополнительных молекулярных маркеров, ассоциированных с различными типами лекарственной резистентности.

Рис. 22. Дендрограмма сходства RAPD-профилей штаммов Burkholderia с различным уровнем устойчивости к антибиотикам.. UPGMA группирование матрицы дистанций несоответствия (dd). Штаммы B. pseudomallei: 1 – 57576 SMP; 2 – 57576 SMO; 3 – 57576 SMPC, 4 – 57576 SMCO; 5 – 57576 SMCP; 6 – 57576 SMRT21; 8 – 56770; 9 – 56770 SMPC; 10 – 56770 SMCP; 11 – 56770 SMOC; 17 – 57576; 18 – 57576 TTM6-1; 19 – 57576 TTM6-3; 20 – 57576 TTM7-1; 21 – 57576 TTM7-2; 22 – 57576 TTM9-1; 23 – 57576 TTM9-2; 24 – 57576 TTM9-3. Штаммы B. thailandensis: 12 – E264; 13 – E264 SMPO. Штаммы B. cepacia: 14 – 25416; 15 – 25416 SMPC.

Рис. 23. Дендрограмма сходства интегразосодержащих ДНК-профилей. UPGMA группирование матрицы дистанций несоответствия (dd). Штаммы B. pseudomallei: 2 – 57576; 3 – 57576 SMCO; 4 – 56770; 5 – 56770 SMCP; 6 – 56770 SMOC. Штаммы B. thailandensis: 7 – E264; 8 – E264 SMPO. Штаммы B. cepacia: 9 – 25416; 10 – 25416 SMPC.

Таким образом, настоящие исследования по интересующей нас проблеме позволили идентифицировать основные группы молекулярных механизмов, ответственных за реализацию множественной устойчивости бактерий группы «pseudomallei» к антимикробным соединениям и разработать комплекс методических подходов для их дальнейшего более детального анализа. На основе модельной системы, включающей штаммы с измененной чувствительностью к антибиотикам, а также технологий молекулярно-генетического анализа факторов резистентности проведено комплексное исследование механизмов множественной устойчивости патогенных буркхольдерий и показаны принципиальное участие в формировании резистентности множественного типа у B. pseudomallei, B. mallei и B. thailandensis процессов снижения проницаемости клеточных мембран, экспрессии систем активного выведения ингибиторов из клеток и мутационных изменений генов внутриклеточных мишеней антимикробных соединений, а также особенности развития полирезистентности, заключающиеся в сочетанном проявлении перечисленных механизмов.

Все это дает возможность наметить ближайшие перспективы работ в области функциональной и сравнительной геномики лекарственной резистентности патогенных буркхольдерий – изучение механизмов индукции и регуляции экспрессии отдельных эффлюкс-транспортеров, получение коллекций мутантов буркхольдерий с инактивированными генами лекарственного эффлюкса, сравнительный анализ экспрессии белков клеточных мембран штаммов с измененной чувствительностью к антибиотикам с использованием техники протеомных исследований, разработка систем анализа экспрессии детерминант антибиотикорезистентности на основе технологии cDNA-чипов.

ВЫВОДЫ

  1. На основе модельной системы, включающей штаммы с измененной чувствительностью к антибиотикам, а также технологии молекулярно-генетического анализа факторов резистентности проведено комплексное исследование механизмов множественной устойчивости патогенных буркхольдерий. Показано сочетанное участие в формировании резистентности множественного типа у B. pseudomallei, B. mallei и B. thailandensis процессов снижения проницаемости клеточных мембран, экспрессии систем активного выведения ингибиторов из клеток и мутационных изменений генов внутриклеточных мишеней антимикробных соединений.
  2. Развитие у штаммов B. pseudomallei, B. mallei и B. thailandensis высокого уровня устойчивости к антибиотикам фторхинолоновой и цефалоспориновой групп сопровождается приобретением резистентности к антимикробным соединениям других классов (β-лактамам, аминогликозидам, макролидам, хлорамфениколу), ряду неспецифических ингибиторов (жирным кислотам, солям желчных кислот, детергентам, красителям), а также заметным снижением вирулентности полирезистентных вариантов для экспериментальных животных.
  3. Установлено, что развитие лекарственной резистентности множественного типа у исследуемых видов буркхольдерий сопровождается существенными изменениями белкового состава мембран, являющимися показателем модификации их транспортных функций и проницаемости. В сравнении с исходными штаммами, у полирезистентных производных B. pseudomallei и B. thailandensis наблюдалась гиперпродукция мажорных мембранных белков 27, 39, 48, 71 и 110 kDa и значительное снижение синтеза протеинов 45 и 49 kDa. Резистентные мутанты  B. mallei характеризовались снижением продукции группы мембранных белков 21, 42, 45 и 70 - 100 kDa.
  4. Показано, что инсерционные мутанты B. pseudomallei Bop- с дефектами в продукции мембранных протеинов 21, 27, 48, 71, 110 kDa, индуцированными включением в хромосому транспозонов Tn9 и Тn5, отличаются снижением устойчивости к препаратам цефалоспоринового и фторхинолонового ряда. Инсерционный мутант с фенотипом CazS PfxR OfxR, чувствительный к цефтазидиму, полученный на основе полирезистентного варианта B. pseudomallei 57576 SMCP CazR PfxR OfxR, демонстрирует связь утраты устойчивости к антибиотику с изменением в продукции мажорных мембранных протеинов 27 и 71 kDa.
  5. Структурные модификации ЛПС, выражающиеся в вариации высокомолекулярных ( > 150 kDa) и редукции низкомолекулярных (25 kDa и менее) фрагментов биополимера, снижение уровня продукции экзополисахарида и секреции экстрацеллюлярных ферментов с липазной, лецитиназной и протеолитической активностью указывают на комплексные адаптивные перестройки проницаемости клеточной оболочки и систем мембранного транспорта при развитии у буркхольдерий высокого уровня устойчивости к антибиотикам фторхинолоновой и цефалоспориновой групп.
  6. Выявлены существенные различия в скорости накопления и количестве аккумулированного клетками штамма дикого типа и полирезистентных мутантов B. pseudomallei бромистого этидия (стуктурного аналога фторхинолоновых соединений). Установлено, что мутантные штаммы с преобладающей устойчивостью к препаратам фторхинолоновой группы обладают отчетливо меньшей проницаемостью мембран для ингибитора и максимальной скоростью его эффлюкса. Интенсивность выведения ингибитора из клеток возбудителя возрастает при повышении температуры инкубации и наличии в среде соединения - источника углерода, что свидетельствует об энергозависимом характере изученных процессов.
  7. Установлено, что в присутствии верапамила - блокатора мембранного транспорта наблюдается снижение устойчивости исходных и мутантных штаммов B. pseudomallei к антимикробным соединениям фторхинолоновой группы, отдельным β-лактамам, аминогликозидам, макролидам и хлорамфениколу, что подтверждает значимость механизмов эффлюкса в формировании множественной антибиотикорезистентности у возбудителя мелиоидоза.
  8. При проведении сравнительного анализа in silico нуклеотидных последовательностей известных и предполагаемых генов лекарственного эффлюкса B. pseudomallei, B. mallei и B. thailandensis, выполненного с использованием биоинформационного программного обеспечения на основе опубликованных в Genbank последовательностей геномов буркхольдерий, были обозначены группы детерминант множественной резистентности и подобраны олигонуклеотидные праймеры для амплификации консервативных фрагментов генов лекарственных транспортеров MFS (QacA/EmrB), SMR (QacE) и RND (AcrB/AcrD/AcrF) групп.
  9. На основе анализа дифференциально экспрессирующихся последовательностей эффлюкс-транспортеров у исходных штаммов и полирезистентных мутантов, культивируемых в неселектвных условиях и на средах с субъингибирующими концентрациями антибиотиков фторхинолонового и цефалоспоринового рядов, установлено участие AcrB/AcrD/AcrF, QacA/EmrB и QacE детерминант в формировании антибиотикорезистентности множественного типа у видов группы «pseudomallei». Повышенный конститутивный уровень экспрессии QacA/EmrE и AcrB/AcrD/AcrF эффлюкс-транспортеров у части полирезистентных мутантов позволяет предполагать наличие генетически закрепленных нарушениий в механизмах регуляции данных последовательностей.
  10. Проведенное клонирование в E. coli на векторе pUC19 AcrB/AcrD/AcrF и QacE эффлюкс-транспортеров возбудителя мелиоидоза и анализ их экспрессии в рекомбинантных клонах выявили участие этих детерминант в развитии резистентности у B. pseudomallei к препаратам фторхинолоновой и аминогликозидной  групп.
  11. Установлено, что полирезистентные мутанты B. pseudomallei и B. mallei с высоким уровнем устойчивости к антибиотикам фторхинолонового ряда несут точечные мутации в QRDR ДНК-гиразы А, приводящие к нескольким типам аминокислотных замен в последовательности белка. Показано, что замена Thr83→Ile является общей для всех исследованных мутантных штаммов, тогда как замены Gly81→Cys и Asp87→Tyr обнаружены только у PfxRCazR и OfxRCazR мутантов B. pseudomallei. Нуклеотидная замена C→T в позиции 250 gyrA, выявленная у одного из мутантов B. mallei, не приводит к аминокислотной замене в последовательности белка и может быть классифицирована как silence-мутация.
  12. В результате ПЦР-анализа с использованием специфических праймеров, последующего секвенирования ампликонов и исследования гомологичных фрагментов хромосом буркхольдерий in silico установлено, что геномы штаммов B. pseudomallei и B. thailandensis несут участки, структурно сходные с интегронами и представленные генами транспозаз/интеграз и кодирующими последовательностями детерминант лекарственной устойчивости - эффлюкс-транспортеров MFS и RND семейств. Наличие интегроноподобных структур свидетельствует о потенциальной возможности формирования множественной устойчивости у данных микроорганизмов за счет аккумуляции и горизонтального переноса R-детерминант различных типов.

Список основных публикаций по теме диссертации

  1. Антонов В.А., Меринова Л.К., Замараев В.С, Викторов Д.В. Анализ фенотипических свойств штаммов  возбудителя сапа, несущих криптические плазмиды Pseudomonas pseudomallei // Материалы научно-практической конференции, посвященной 100-летию образования противочумной службы России, 16-18 сентября 1997, Саратов, 1997. - C.6-7
  2. Викторов Д.В., Пивень Н.Н., Плеханова Н.Г. Особенности белкового состава наружных мембран штаммов Pseudomonas (Burkholderia) pseudomallei различной вирулентности // Материалы научно-практической конференции, посвященной 100-летию образования противочумной службы России, 16-18 сентября 1997, Саратов, 1997. - С.19-20
  3. Попов С.Ф., Викторов Д.В., Пивень Н.Н., Вязьмина Т.Н., Бакулина Н.Г., Курилов В.Я. Изучение состава капсульного вещества у возбудителей сапа и мелиоидоза // Материалы научно-практической конференции, посвященной 100-летию образования противочумной службы России, 16-18 сентября 1997, Саратов, 1997. - С.104-105.
  4. Пивень Н.Н., Смирнова В.И., Викторов Д.В., Тихонов Н.Г., Коваленко А.А  Патент на изобретение № 96111507 «Способ получения протективного гликопротеина возбудителя мелиоидоза» (зарегистрирован Российским агентством по патентам и товарным знакам 27.04.1998)
  5. Тихонов Н.Г., Пивень Н.Н., Викторов Д.В., Плеханова Н.Г., Попов С.Ф. Внеклеточные и поверхностные антигены Pseudomonas (Burkholderia) pseudomallei как потенциальные факторы вирулентности // Диагностика, лечение и профилактика опасных инфекционных заболеваний. Биотехнология.Ветеринария. Материалы юбилейной научной конференции, посвященной 70-летию НИИ микробиологии МО РФ. - Киров, 1998. - С.191
  6. Антонов В..А., Меринова Л.К., Викторов Д.В., Замараев В.С., Захарова И.Б., Ткаченко Г.А. Влияние R-плазмид на отдельные фенотипические признаки штаммов возбудителя сапа и мелиоидоза // Диагностика, лечение и профилактика опасных инфекционных заболеваний. Биотехнология.Ветеринария. Материалы юбилейной научной конференции, посвященной 70-летию НИИ микробиологии МО РФ. - Киров, 1998. - C.48-49
  7. Викторов Д.В., Пивень Н.Н., Плеханова Н.Г., Меринова О.А., Попов С.Ф. Физико-химические и иммунобиологические свойства белков наружной мембраны Burkholderia pseudomallei // Диагностика, лечение и профилактика опасных инфекционных заболеваний. Биотехнология.Ветеринария. Материалы юбилейной научной конференции, посвященной 70-летию НИИ микробиологии МО РФ. - Киров, 1998. - С.67-68
  8. Захарова И.Б., Викторов Д.В., Замараев В.С., Попов С.Ф. Анализ продуктов экспрессии фрагментов плазмиды pPM1 возбудителя мелиоидоза, клонированных в E.coli // Диагностика, лечение и профилактика опасных инфекционных заболеваний. Биотехнология.Ветеринария. Материалы юбилейной научной конференции, посвященной 70-летию НИИ микробиологии МО РФ. - Киров, 1998. - С.100-101
  9. Ilyukhin V.I., Merinova L.K., Kislichkin N.N., Tikhonov N.G., Farber S.M., Viktorov D.V., Denissov I.I. Specific and crossed immunity to melioidosis // The 2th International Congress on Melioidosis Proceeding. – Bangkok, 1998. – P. 112
  10. Пивень Н.Н., Викторов Д.В., Тихонов Н.Г., Плеханова Н.Г., Попов С.Ф., Меринова О.А. Факторы вирулентности Burkholderia pseudomallei  и  Burkholderia mallei // Проблемы особо опасных инфекций. - 1999. – вып. 79. - С.175-180.
  11. Плеханова Н.Г., Пивень Н.Н., Викторов Д.В., Демедюк Е.А. Экзопротеазы Burkholderia pseudomallei и их значение в патогенезе мелиоидозной инфекции // Проблемы особо опасных инфекций. - 1999. – вып. 79. - С. 181-186
  12. Викторов Д.В., Пивень Н.Н., Плеханова Н.Г., Попов С.Ф., Меринова О.А. Идентификация и характеристика некоторых компонентов системы мембранного транспорта Burkholderia pseudomallei // Проблемы особо опасных инфекций. - 1999. – вып. 79. - С. 144-148
  13. Viktorov D.V., Piven N.N., Zakharova I.B., Antonov V.A. Melioidosis vaccine: some approaches to development // First Global Conference on Vaccines & Immunization Proceeding. - Manchester, 1999. - P. 45-46
  14. Денисов И.И., Тихонов Н.Г., Илюхин В.И., Викторов Д.В., Каплиев В. И. О генетической природе факторов патогенности возбудителя мелиоидоза // Волгогр. науч.-исслед. противочум. ин-т. - Волгоград, 1999. - 13 с. - депон. в ВИНИТИ, № 1991-В99
  15. Меринова Л.К., Антонов В.А., Замараев В.С., Викторов Д.В. Мобилизация криптических плазмид возбудителя мелиоидоза в гетерологичные виды микроорганизмов // Мол. генет., микробиол., вирусол. - 2000. - № 2. - С. 43-47
  16. Viktorov D.V., Seimova I.K., Zakharova I.B., Merinova L.K.. Merinova O.A. Burkholderia pseudomallei adaptive resistance to fluoroquinolones and cephalosporins // Problems on biological and ecological safety. International Conference Proceeding. – Obolensk, 2000. – P. 25-26
  17. Антонов В.А., Замараев В.С., Захарова И.Б., Меринова Л.К., Викторов Д.В., Попов С.Ф. Изучение плазмид патогенных буркхолдерий // Природно-очаговые инфекции в Нижнем Поволжье : сб.науч. тр. под ред. Н.Г. Тихонова. - Волгоград: изд. «Принт» ВолГУ, 2000. - С.41-46
  18. Илюхин В.И., Кисличкин Н.Н., Тихонов Н.Г., Плеханова Н.Г., Денисов И.И., Кисличкина И., Антонов В.А., Пивень Н.Н., Викторов Д.В., Фарбер С.М. Перспективы применения Francisella tularensis 15 (LVS) для гетерологичной иммунизации и создания поливалентных рекомбинантных вакцин // // Природно-очаговые инфекции в Нижнем Поволжье : сб.науч. тр. под ред. Н.Г. Тихонова. - Волгоград: изд. «Принт» ВолГУ, 2000. - С.100-106
  19. Попов С.Ф., Тихонов Н.Г., Пивень Н.Н., Викторов Д.В., Авророва И.В. Иммунобиологические свойства капсульного вещества Burkholderia pseudomallei // Журн. микробиол. эпидемиол. иммунол. - 2000. - № 6. - С.60-64
  20. Пивень Н.Н., Рыбкин В. С., Плеханова Н. Г., Жукова С. И., Викторов Д. В., Авророва И. В., Демедюк Е. А., Дрефс Н. М., Попов С. Ф. Иммунотропные и иммуногенные свойства поверхностных и мембранных антигенов Burkholderia pseudomallei // Журн. микробиол. эпидемиол. иммунол. - 2001. - №1. - С.29-33
  21. Викторов Д.В., Пивень Н.Н. Активный мембранный транспорт и множественная антибиотикорезистентность бактерий // Мол. генет. микробиол. вирусол. – 2001. - № 3. – С.3-8
  22. Viktorov D.V., Merinova L.K., Seimova I.K., Zakharova I.B. Burkholderia pseudomallei drug resistance and membrane proteins alterations // The 4th World Melioidosis Congress Proceeding. – Perth, 2001. – P.60-61
  23. Viktorov D.V., Zakharova I.B., Merinova L.K., Seimova I.K. Virulence and stability of Burkholderia pseudomallei spontaneous mutants with multi-drug resistance phenotype // Sci. J. Centr. Nat. Infect. Dis. – Ulaanbaatar, 2001. – P. 75-77
  24. Avrorova I.V., Piven N.N., Zhukova S.I., Khrapova N.P.,Victorov D.V. Immunoreactivity of macroorganism by vaccination with Burkholderia pseudomallei protective antigens // Sci. J. Centr. Nat. Infect. Dis. – Ulaanbaatar, 2001. - P.17-20
  25. Захарова И.Б., Викторов Д.В., Замараев В.С. Клонирование и экспрессия 7.55 т.п.н. KpnI фрагмента плазмиды pPM1 Burkholderia pseudomallei в Escherichia coli // Мол. генет. микробиол. вирусол. – 2002. - №2. – С.19-22
  26. Викторов Д.В., Пивень Н.Н., Захарова И.Б., Меринова О.А., Попов С.Ф. Патент на изобретение № 2208445 «Способ выделения белка 39 кДа наружной мембраны возбудителя мелиоидоза» (зарегистрирован в Государственном реестре изобретений РФ 20.07.2003)
  27. Викторов Д.В., Пивень Н.Н., Меринова Л.К., Алексеев В.В., Илюхин В.И., Захарова И.Б., Замараев В.С. Исследование структурных компонентов микробной клетки в аспекте совершенствования диагностики патогеных буркхольдерий // Современные технологии в диагностике особо опасных инфекционных болезней: Материалы 4 Межгосударственной научно-практической конференции государств-участников СНГ / под ред. В. В.  Кутырева. – Саратов, 2003. – С. 36-38
  28. Авророва И.В., Пивень Н.Н., Жукова С.И., Викторов Д.В., Храпова Н.П. Иммунный ответ экспериментальных животных при иммунизации поверхностными антигенами Burkholderia pseudomallei // Журн. микробиол. эпидемиол. иммунол. - 2004. - №5. - С.85-89
  29. Плеханова Н.Г., Алексеев В.В., Пивень Н.Н., Храпова Н.П., Викторов Д.В., Тихонов С.Н., Кивокурцева Т.Ю., Перепелицына С.В., Вязьмина Т.Н. Оценка продукции капсульного гликопротеинового комплекса Burkholderia pseudomallei при мелиоидозной инфекции // Проблемы особо опасных инфекций. - 2004. - вып. 87. - С.65-66
  30. Викторов Д. В., Захарова И. Б., Меринова Л. К., Меринова О. А., Акимов Р. А. Анализ молекулярных механизмов множественной лекарственной резистентности патогенных и условно-патогенных видов Burkholderia // «Медицинская микробиология – XXI век». Материалы Всеросс. научно-практ. конф. – Саратов, 2004 – С. 56 – 58
  31. Пивень Н.Н., Попов С.Ф., Тихонов Н.Г., Авророва И.В., Викторов Д.В., Курилов В.Я. Патент на изобретение № 2231364 «Способ получения капсульного вещества возбудителя мелиоидоза» (зарегистрирован в Государственном реестре изобретений РФ 27.06.2004)
  32. Практическое пособие для подготовки врачей-бактериологов и эпидемиологов по вопросам противодействия биотерроризму / Онищенко Г.Г., Федоров Ю.М., Жилина Н.Я., Субботин В.Г., Алексеев В.В., Липницкий А.В., Метлин В.Н., Прохватилова Е.В., Храпова Н.П., Лобанов А.Н.. Пашанина Т.П., Илюхин В.И., Батманов В.П., Лозовая Н.А., Лесовой В.С., Пучков В.С., Погасий Н.И., Кулаков М.Я., Андрус В.Н., Сухов В.В., Савченко С.Т., Замараев В.С., Антонов В.А., Тихонов С.Н., Плеханова Н.Г., Алтухова В.В., Перепелицына С.В., Кивокурцева Т.Ю., Попов С.Ф., Быкова О.И., Плешакова Т.В., Новицкая И.В., Викторов Д.В., Захарова И.Б., Сенина Т.В., Шумилов П.К., Жуков А.Н., Чайка А.Н. - Волгоград: изд-во «Радуга», 2004. - 236 с.
  33. Акимов Р.И., Захарова И.Б., Викторов Д.В., Меринова О.А. Обнаружение интегронов у патогенных и условно-патогенных представителей рода Burkholderia // Проблемы особо опасных инфекций. - 2004. - вып. 88. - С. 27-29
  34. Будченко А.А., Илюхин В.И., Викторов Д.В. Сравнительный анализ электрофореграмм суммарных клеточных белков патогенных буркхольдерий // Мол. генет. микробиол. вирусол. - 2005. - №2. - С. 24-28
  35. Пивень Н.Н., Илюхин В.И., Тимошин В.Б., Викторов Д.В., Абраменко А.В. Перекрестнореагирующие антигены патогенных буркхольдерий и некоторых опасных возбудителей инфекционных болезней. // Журн. микробиол. эпидемиол. иммунол. - 2005. - № 2. - С.14-19
  36. Пивень Н.Н., Алексеев В.В., Попов С.Ф., Храпова Н.П., Прохватилова Е.В., Викторов Д.В., Плеханова Н.Г., Каплиев В.И., Авророва И.В. Ультраструктурно-иммунохимическое изучение капсулы патогенных буркхольдерий // Журн. микробиол. эпидемиол. иммунол. - 2005. - № 5. - С.19-24
  37. Агеева Н.П., Меринова Л.К., Викторов Д.В., Плеханова Н.Г. Фенотипическая характеристиска мутантов Burkholderia mallei, дефектных по синтезу внеклеточных протеолитических ферментов // Вестник Волгоградского государственного медицинского университета. - 2005. - № 2. - С.11-15
  38. Будченко А.А., Илюхин В.И., Викторов Д.В., Мазурова И.Ю. Сравнительный анализ электрофореграмм суммарных клеточных белков в идентификации и типировании патогенных буркхолдерий / Санитарная охрана территорий государств участников содружества независимых государств: проблемы биологической безопасности и противодействия биотерроризму в современных условиях // Материалы VI Межгосударственной науч.- практ. конф. государств-участников СНГ. – Волгоград, 2005. - С.126 - 128
  39. Викторов Д.В., Захарова И.Б., Меринова О.А., Меринова Л.К., Алексеев В.В. Молекулярное типирование штаммов Burkholderia pseudomallei с различной чувствительностью к антибиотикам / Санитарная охрана территорий государств участников содружества независимых государств: проблемы биологической безопасности и противодействия биотерроризму в современных условиях // Материалы VI Межгосударственной науч.- практ. конф. государств-участников СНГ. – Волгоград, 2005. - С.135-136
  40. Захарова И.Б., Викторов Д.В., Меринова О.А., Меринова Л.К., Алексеев В.В. Дифференциальная экспрессия эффлюкс-генов при формировании множественной лекарственной резистентности у Burkholderia pseudomallei / Санитарная охрана территорий государств участников содружества независимых государств: проблемы биологической безопасности и противодействия биотерроризму в современных условиях // Материалы VI Межгосударственной науч.- практ. конф. государств-участников СНГ. – Волгоград, 2005. - С.149-151
  41. Калинкина Е.В., Викторов Д.В., Меринова Л.К. Характеристика штаммов Burkholderia cepacia и B. pseudomallei, резистентных к цефалоспоринам и фторхинолонам  / Санитарная охрана территорий государств участников содружества независимых государств: проблемы биологической безопасности и противодействия биотерроризму в современных условиях // Материалы VI Межгосударственной науч.- практ. конф. государств-участников СНГ. – Волгоград, 2005. - С.154 – 155
  42. Пивень Н.Н., Попов С.Ф., Авророва И.В., Викторов Д.В. Патент на изобретение № 2255762 «Способ получения капсульного антигена возбудителя мелиоидоза, обладающего антифагоцитарной активностью» (зарегистрирован в Государственном реестре изобретений РФ 10.07.2005)
  43. Викторов Д.В., Меринова Л.К., Алексеев В.В., Пивень Н.Н., Меринова О.А., Сеимова И.К., Тимошин В.Б., Захарова И.Б. Свойства инсерционных мутантов Burkholderia pseudomallei, дефектных по продукции белков клеточных мембран // Мол. генет. микробиол. вирусол. - 2005. - № 4. - С.17-20
  44. Морозова М.В., Меринова Л.К., Сеимова И.К., Викторов Д.В. Конъюгационная передача плазмид P1 группы несовместимости в Burkholderia cepacia // Бюлл. ВНЦ РАМН. - 2006. - № 1. - С.38-40
  45. Захарова И.Б., Викторов Д.В., Меринова Л.К., Алексеев В.В. Дифференциальная экспрессия drug-efflux генов у полирезистентных мутантов Burkholderia pseudomallei // Проблемы особо опасных инфекций. - 2006. - вып. 91. - С.35-38
  46. Викторов Д.В., Захарова И.Б., Меринова Л.К., Алексеев В.В. Молекулярное типирование штаммов Burkholderia pseudomallei с различной чувствительностью к антибиотикам // Мол. генет. микробиол. вирусол. - 2006. - № 1. - С.7-11
  47. Антонов В.А., Меринова Л.К., Викторов Д.В., Агеева Н.П., Замараев В.С.,  Илюхин В.И. Влияние плазмид на вирулентность и чувствительность клеток сапного микроба к мелиоидозному бактериофагу // Вестник Волгоградского государственного медицинского университета. - 2006. - №3. - С.63-66
  48. Захарова И.Б., Викторов Д.В., Морозова М.В., Меринова О.А., Замараев В.С., Меринова Л.К., Алексеев В.В. Анализ молекулярных механизмов антибиотикорезистентности Burkholderia pseudomallei и близкородственных видов // Материалы VII Межгосударственной научно-практической конференции «Чрезвычайные ситуации международного значения в общественном здравоохранении в решениях Санкт-Петербургского саммита «Группы восьми» и санитарная охрана территорий государств-участников Содружества Независимых Государств. – Оболенск, 2006. - С. 106-107
  49. Захарова И.Б., Викторов Д.В., Алексеев В.В., Меринова Л.К., Замараев В.С. Патент на изобретение № 2280688 «Рекомбинантный штамм Escherichia coli ZV1 – носитель клонированной последовательности ДНК Burkholderia pseudomallei, детерминирующей синтез белка 32 kDa и резистентность к пефлоксацину и стрептомицину» (зарегистрирован в Государственном реестре изобретений РФ 27.07.2006)
  50. Калинкина Е.В., Сеимова И.К., Меринова О.А., Викторов Д.В., Меринова Л.К. Мутанты Burkholderia cepacia с множественной резистентностью к антибиотикам. // Бюлл. Волгоградского Научного Центра РАМН - 2006. - №3. - С. 25-27
  51. Калинкина Е.В., Сеимова И.К., Меринова О.А., Викторов Д.В., Меринова Л.К. Мутанты Burkholderia cepacia резистентные к антибиотикам // Актуальные вопросы клин. и эсперимент. медицины. Материалы научно-практической конф. - Санкт-Петербург, 2006. - С.277-278
  52. Алексеев В.В., Липницкий А.В., Викторов Д.В., Пашанина Т.П., Жиркова И.Н., Замарин А.Е. Библиографическая база данных № 2006620082 «Потенциальные агенты биотерроризма: возбудители особо опасных инфекций и биологические токсины» (Зарегистрирована в Реестре электронных баз данных РФ 06.03.2006)
  53. Калинкина Е.В, Сеимова И.К., Меринова О.А., Агеева Н.П., Викторов Д.В., Лобойко А.Д., Меринова Л.К. Применение модели простейших для определения вирулентности штаммов патогенных Burkholderia с множественной резистентностью к антибиотикам // Международные медико-санитарные правила и реализация глобальной стратегии борьбы с инфекционными болезнями в государствах-участниках СНГ. Материалы VIII Межгосударственной научно-практической конференции государств-участников СНГ, 25-26 сентября 2007, Саратов - С.212-214
  54. Антонов В.А., Викторов Д.В., Алтухова В.В, Савченко С.С., Захарова И.Б., Меринова Л.К., Замараев В.С. Анализ штаммов буркхольдерий с помощью амплификации с использованием произвольных праймеров // Международные медико-санитарные правила и реализация глобальной стратегии борьбы с инфекционными болезнями в государствах-участниках СНГ. Материалы VIII Межгосударственной научно-практической конференции государств-участников СНГ, 25-26 сентября 2007, Саратов - С.155 -157
  55. Викторов Д.В., Захарова И.Б., Агеева Н.П., Меринова Л.К., Алексеев В.В. Мутационные изменения ДНК-гиразы у штаммов Burkholderia pseudomallei и B. mallei с высоким уровнем резистентности к фторхинолоновым антибиотикам // Международные медико-санитарные правила и реализация глобальной стратегии борьбы с инфекционными болезнями в государствах-участниках СНГ. Материалы VIII Межгосударственной научно-практической конференции государств-участников СНГ, 25-26 сентября 2007,  Саратов - С.185-187
  56. Antonov V.A., Alekseev V.V., Tkachenko G.A., Altukhova V.V., Zamaraev V.S., Zinchenko O.V., Viktorov D.V., Ilyukhin V.I., Trofimov D.Yu. Mobile PCR Laboratory for Burkholderia pseudomallei and Burkholderia mallei detection // The 5th World melioidosis congress, November 21-23 2007, Khon Kaen, Thailand, 2007. - P.88.
  57. Viktorov D.V., Alekseev V.V., Zakharova I.B., Antonov V.A., Merinova L.K. High-level resistance to fluoroquinolones and cephalosporins in Burkholderia pseudomallei and closely related species // The 5th World melioidosis congress, November 21-23 2007, Khon Kaen, Thailand, 2007.- P.247.
  58. Викторов Д.В., Алексеев В.В., Захарова И.Б., Антонов В.А., Меринова Л.К. Резистентность высокого уровня к фторхинолонам и цефалоспоринам у Burkholderia pseudomallei и близкородственных видов / Молекулярная диагностика // Сб. трудов VI Всероссийской научно-практической конференции c международным участием, 28-30 ноября, Москва,  2007. - Т.I. - С.355-357
  59. Викторов Д.В., Захарова И.Б., Агеева Н.П., Подшивалова М.В., Меринова Л.К., Алексеев В.В. Мутации ДНК-гиразы у штаммов патогенных Burkholderia, высокорезистентных к антибиотикам фторхинолонового ряда // Современные технологии в реализации глобальной стратегии борьбы с инфекционными болезнями на территории государств-участников Содружества Независимых Государств. Материалы IХ Межгосударственной научно-практической конференции государств-участников СНГ. - Волгоград, 2008. – С.45-47
  60. Методическое пособие для проведения практических занятий по лабораторной диагностике мелиоидоза с использованием штамма-имитатора Burkholderia thailandensis KM-161. Утверждено Главным государственным санитарным врачом РФ Г.Г. Онищенко 16.07.2008 / ред. проф. Алексеев В.В., авт. Илюхин В.И., Меринова Л.К., Плеханова Н.Г., Прохватилова Е.В., Сенина Т.В., Алтухова В.В., Викторов Д.В., Антонов В.А., Кулаков М.Я., Перепелицына С.В., Меринова О.А., Подшивалова М.В. - Волгоград,: «Здоровье и экология». - 2008. – 75 с.
  61. Antonov V.A., Tkachenko G.A., Altukhova V.V., Savchenko S.S., Zinchenko O.V., Viktorov D.V., Zamaraev V.S., Ilyukhin V.I., Alekseev V.V. Molecular identification and typing of Burkholderia pseudomallei and Burkholderia mallei: when is enough enough? // Trans. R. Soc. Trop. Med. Hyg. – 2008. – Vol. 102:S1. – P. S63 - S68
  62. Viktorov D.V., Zakharova I.B., Podshivalova M.V., Kalinkina E.V., Merinova O.A., Ageeva N.P., Antonov V.A., Merinova L.K., Alekseev V.V. High-level resistance to fluoroquinolones and cephalosporins in Burkholderia pseudomallei and closely related species // Trans. R. Soc. Trop. Med. Hyg. – 2008. – Vol. 102:S1. – P. S44 - S51.



© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.