WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

Агеева Елизавета Сергеевна

молекулярные и клеточные основы

иммунопатогенеза HELICOBACTER PYLORI-АССОЦИИРОВАННЫХ  ЗАБОЛЕВАНИЙ

У НАСЕЛЕНИЯ РЕСПУБЛИКИ ХАКАСИЯ

14.03.03 – патологическая физиология

03.03.04 – клеточная биология, гистология, цитология

Автореферат

диссертации на соискание ученой степени

доктора медицинских наук

Томск – 2012

Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Сибирский государственный университет Министерства и здравоохранения и социального развития Российской Федерации, Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Хакасский государственный университет им. Н.Ф. Катанова»

Научные консультанты:

доктор медицинских наук,                                        Рязанцева

профессор                                                                Наталья Владимировна

доктор медицинских наук,                                        Штыгашева

профессор                                                                Ольга Владимировна

Официальные оппоненты:

доктор медицинских наук,                                        Агафонов

профессор                                                                Владимир Иванович

доктор медицинских наук,                                        Савченко



профессор                                                                Андрей Анатольевич

доктор медицинских наук,                                        Плешко

профессор                                                                Раиса Ивановна

Ведущая организация:

Учреждение Российской академии медицинских наук Научно-исследовательский институт терапии Сибирского отделения Российской академии медицинских наук (г. Новосибирск).

Защита состоится «___» __________2012 г. в ______часов на заседании диссертационного совета Д 208.096.01 при Сибирском государственном медицинском университете (643050, г. Томск, ул. Московский тракт, 2)

С диссертацией можно ознакомиться в научно-медицинской библиотеке Сибирского государственного медицинского университета

Автореферат разослан «___» __________ 2012 г.

Ученый секретарь

диссертационного совета                                        Петрова И.В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность. Helicobacter pylori является ведущим этиологическим фактором язвенной болезни и хронического гастрита [Konturek P.C., 2006; Хомерики С.Г., 2008]. Результаты широкомасштабных исследований показали, что на долю язвенной болезни, ассоциированной с инфекцией Helicobacter pylori, приходится 70–80% случаев выявления дуоденальных язв и 50–60% язв желудка [Suerbaum S., 2002]. Появляется все больше доказательств той роли, которую играет инфекция Helicobacter pylori в возникновении и развитии рака желудка [Malekzadeh R., 2004; Hansen S., 2007; Янкин А.В., 2010]. Исследователи связывают с инфекцированием Helicobacter pylori 100% случаев выявления проксимального рака желудка у японцев [Uedo N., 2003].

Ключевым звеном в развитии гастродуоденальной патологии является не только длительная инфекция Helicobacter pylori в макроорганизме, но и непосредственное участие в этом процессе клеток иммунной системы. Механизмы дизрегуляции иммунного ответа макроорганизма при длительном инфицировании Helicobacter pylori связаны с прямым цитопатическим действием патогена, приводящим к поляризации иммунного ответа по Тh1-пути и выработке соответствующего спектра цитокинов (IFNγ, TNF, IL-1, IL-2, IL-8, IL-10). Детерминация иммунного ответа по Тh1-клеточному типу оказывает решающую роль в иммунопатогенезе заболеваний, связанных с Helicobacter pylori-инфекцией [Lohoff M., 2000; Кондрашина Э.А., 2002]. Действие цитокинов, с одной стороны, вызывает неадекватную активацию иммунной системы: усиление апоптоза иммунных клеток с их последующей элиминацией [Correa P., 1997; Suares G., 2006], а, с другой, - дисбаланс между процессами программированной гибели желудочных эпителиоцитов и их пролиферацией [Васильев Ю.В., 2006; Хомерики С.Г., 2006]. Усиление гибели эпителиоцитов приводит к усугублению язвенных дефектов слизистой оболочки желудка. И, наоборот, преобладание пролиферативных процессов при хроническом воспалении эпителия слизистой оболочки желудка увеличивает риск развития рака [Нургалиева Б.К., 2005].

Характер взаимодействия Helicobacter pylori и организма человека имеет популяционные отличия. В литературе описаны феномены «африканская загадка», «азиатская загадка», «северная загадка», сущность которых заключается в «консервации» макроорганизмом патогенных штаммов Helicobacter pylori при хронической инфекции [Mitchell H., 2002; Hellmig S., 2003; Perez-Perez G.I., 2004; Цуканов В.В., 2007, 2011]. Подобные результаты были выявлены при эпидемиологическом исследовании распространенности язвенной болезни у населения Республики Хакасия [Штыгашева О.В., 2004, 2005]. Было установлено, что распределение цитотоксических штаммов Helicobacter pylori и ассоциация бактерии с язвенной болезнью имеют выраженные этнические особенности. При равной частоте инфицированности Helicobacter pylori у хакасов и европеоидов заболеваемость язвенной болезнью у них существенно различается. Кроме того, у хакасов и европеоидов были установлены различия в соотношении процессов пролиферативной и апоптотической активности эпителия слизистой оболочки желудка, а также в дифференциации локального иммунитета по Тh1/Тh2-пути [Штыгашева О.В., 2005]. Данный факт предполагает существование генетически-детерминированных особенностей иммунного ответа и является основой разнообразия Helicobacter pylori-ассоциированных заболеваний.

Приоритетным является изучение ассоциированности заболеваний с рядом аллельных вариантов генов цитокинов и их рецепторов. Накоплено и обобщено значительное число данных о вовлеченности различных полиморфных генов в формирование предрасположенности ко многим социально-значимым заболеваниям, в том числе – инфекциям и связанными с длительной персистенцией патогена осложнениями [Пузырев В.П., 2003; Рязанцева Н.В., 2008; Кононов А.В., 2010]. Отдельные аллельные варианты приводят к изменению продукции соответствующих цитокинов и их рецепторов, что также оказывает влияние на характер течения заболевания и возникновение определенных осложнений, формирует популяционные различия в структуре заболеваемости у европеоидов и монголоидов. Вместе с тем фактические данные о роли конкретных полиморфизмов генов  цитокинов и их рецепторов в развитии Helicobacter pylori-ассоциированных язвенной болезни и хронического гастрита носят противоречивый характер, в пределах, даже, одной популяции [Amieva M.R., 2008; Маев И.В., 2008; Кононов А.В., 2010]. Выявление генетических особенностей течения Helicobacter pylori-ассоциированных заболеваний необходимо для разработки персонализированных технологий профилактики, диагностики и лечения гастродуоденальной патологии и сопряженных с вызванной персистенцией патогена осложнений.

Таким образом, представляется актуальным и перспективным изучение популяционных различий молекулярных механизмов дизрегуляции иммунного ответа, вызванных инфицированием Helicobacter pylori, у хакасов и европеоидов.

Цель исследования: установить молекулярно-генетические и клеточные основы иммунопатогенеза Helicobacter pylori-ассоциированных заболеваний (язвенная болезнь, хронический гастрит) у населения Республики Хакасия (хакасы, европеоиды).

Задачи исследования:
  1. Установить распространенность субтипов VacA и CagA Helicobacter pylori у хакасов и европеоидов с хроническим гастритом и язвенной болезнью, ассоциированными с инфицированием Helicobacter pylori; оценить взаимосвязь между генетическими особенностями Helicobacter pylori и клиническим течением сопряженной с инфекцией гастродуоденальной патологии.
  2. Выявить общие закономерности и особенности нарушений локального и системного иммунитета у хакасов и европеоидов с гастродуоденальной патологией, ассоциированной с Helicobacter pylori-инфекцией (хронический гастрит, язвенная болезнь). 
  3. Оценить роль нарушений системы цитокинов (IL-2, IL-4, IL-6, IL-8, IL-10, TNF) в иммунопатогенезе Helicobacter pylori-ассоциированных заболеваний гастродуоденальной зоны у хакасов и европеоидов.
  4. Установить распространенность полиморфизмов генов цитокинов С+3953Т IL-1, IL1-Ra VNTR, –330 T/G IL-2, -174 G/C IL-6, -251 T/A IL-8  у европеоидов и хакасов, страдающих ассоциированной с Helicobacter pylori гастродуоденальной патологией.
  5. Выявить критические иммуногенетические факторы предрасположенности и резистентности у коренного и пришлого населения Республики Хакасия к развитию сопряженных с Helicobacter pylori хронического гастрита и язвенной болезни.

Научная новизна. Впервые представлены знания фундаментального характера о роли генетически-детерминированных механизмов развития Helicobacter pylori-ассоциированной гастродуоденальной патологии (хронического гастрита и язвенной болезни), имеющих популяционно-зависимые закономерности.

Установлена причина взаимосвязи между генетическими особенностями инфекта у хакасов и европеоидов с Helicobacter pylori-ассоциированной гастродуоденальной патологией и клиническими фенотипами заболеваний. У европеоидов при язвенной болезни частым является субтип s1s2 vacA Helicobacter pylori, у больных хроническим гастритом - m1 vacA Helicobacter pylori. У хакасов s1s2 vacA штаммы Helicobacter pylori чаще встречаются при язвенной болезни, m2 vacA Helicobacter pylori - при хроническом гастрите. CagA штаммы Helicobacter pylori и у европеоидов и хакасов чаще встречаются при язвенной болезни, чем при хроническом гастрите.

Установлены общие закономерности и особенности нарушений локального иммунитета у хакасов и европеоидов при Helicobacter pylori-ассоциированной гастродуоденальной патологии. Показана роль нарушения баланса цитокинов в сыворотке крови (IL-4, IL-10, TNF) в иммунопатогенезе Helicobacter pylori-ассоциированных заболеваний гастродуоденальной зоны у хакасов и европеоидов. Выявлены особенности спонтанной и ФГА-индуцированной продукции интерлейкинов мононуклеарными лейкоцитами крови у пациентов с Helicobacter pylori-сопряженными хроническим гастритом и язвенной болезнью, характеризующиеся снижением базальной и резервной продукции IL-2 у хакасов и увеличением продукции IL-4, IL-10 - у европеоидов. Выявлены нарушения реализации спонтанного и индуцированного перекисью водорода in vitro апоптоза лимфоцитов крови, полученных у хакасов и европеоидов, больных Helicobacter pylori-ассоциированными хроническим гастритом и язвенной болезнью. Показано, что иммунофенотипический состав лимфоцитов крови характеризуется снижением числа CD3+-, CD4+- и CD8+-лимфоцитов у хакасов как при хроническом гастрите, так и при язвенной болезни. У европеоидов изменения субпопуляционного состава лимфоцитов характеризуются увеличением количества CD4+- и CD8+-лимфоцитов крови у пациентов с хроническим гастритом и язвенной болезнью.

Впервые проведено исследование распределения частоты полиморфизма генов цитокинов (C+3953T IL-1, IL-1Ra VNTR, -330 T/G IL-2, -174 G>C IL-6, -251 Т>А IL-8) у коренных и пришлых жителей Республики Хакасия. Установлена связь между предрасположенностью к Helicobacter pylori-ассоциированным язвенной болезни и хроническому гастриту и носительством полиморфизмов генов C+3953T IL-1, IL-1Ra VNTR, -330 T/G IL-2, -174 G>C IL-6, -251 Т>А IL-8 у хакасов и европеоидов. Впервые выявлены ассоциации между носительством полиморфизма генов интерлейкинов и инфицированием этиологически-значимыми для развития язвенной болезни генотипами возбудителя (cagA Helicobacter pylori – у хакасов и vacA s1s2 Helicobacter pylori – у европеоидов).

Теоретическая и практическая значимость. Результаты проведенного исследования позволили выявить взаимосвязь между генетическими особенностями патогена и ДНК-маркеров вовлеченности полиморфных вариантов генов цитокинов, их роль в иммунопатогенезе Helicobacter pylori-ассоциированных хронического гастрита и язвенной болезни с учетом этно-популяционных различий у коренного и пришлого населения Республики Хакасия.

Полученные фундаментальные знания об иммуногенетических факторах, обладающих протективным эффектом и определяющих риск прогрессированиия и хронизации язвенной болезни и хронического гастрита представляют основу для разработки новых подходов к прогнозированию клинического течения Helicobacter pylori-ассоциированных заболеваний, у хакасов и европеоидов, а также технологии персонализированной терапии иммунных нарушений. Идентификация полиморфизмов генов позволит в дальнейшем обоснованно определить показания для назначения эрадикационной терапии, что является достаточно важным фактором в условиях возрастающей резистентности к антибиотикам.

Положения, выносимые на защиту:

1. Различия гастродуоденальной патологии (хронического гастрита, язвенной болезни) у европеоидов и хакасов обусловлены генетическими особенностями Helicobacter pylori. У хакасов при язвенной болезни превалируют cagA, при хроническом гастрите - m2 vacA штаммы Helicobacter pylori. У европеоидов при язвенной болезни чаще встречаются s1s2 vacA, при хроническом гастрите –  m1 vacA штаммы Helicobacter pylori.

2. Нарушения функциональных свойств компонентов локального (на уровне органа-мишени) и системного иммунитета у пациентов с хроническим гастритом и язвенной болезнью, ассоциированными с Helicobacter pylori,  носят однонаправленный характер и различаются у представителей разных этнических групп (хакасы, европеоиды).

3. Распространенность полиморфизмов генов цитокинов у коренного и пришлого населения Республики Хакасия различается. У хакасов риск развития язвенной болезни ассоциирован с полиморфизмами -330 T/G IL-2 (генотип GG) и -251 Т>А IL-8 (генотип АА); у европеоидов - с С+3953Т IL-1 (генотип СС), IL-1Ra VNTR (генотип R2R3) и -174 G>C IL-6 (генотип СС). Предикторами хронического гастрита у хакасов являются полиморфизм гена - С+3953Т IL-1 (генотип СТ); у европеоидов - IL-1Ra VNTR (генотип R2R3) и -330 T/G IL-2 (генотип GТ).

Апробация и реализация работы. Результаты проведенного исследования докладывались и обсуждались на межрегиональной научно-практической конференции «Этносы развивающейся России: проблемы и перспективы» (Абакан, 2008, 2011), научной конференции с международным участием, посвященной 100-летию со дня рождения профессора Е.Ф. Ларина «Нейрогуморальные механизмы регуляции органов пищеварительной системы в норме и патологии» (Томск, 2007), международной конференции «Генетика человека и патология» (Томск, 2007), VIII, IX, X, XI  Восточно-Сибирских гастроэнтерологических конференциях с международным участием «Клинико-эпидемиологические и этно-экологические проблемы заболеваний органов пищеварения (Красноярск, 2008; Иркутск, 2009; Абакан, 2010, Иркутск, Чита, 2011), Всероссийской научной конференции «Современные эпидемиологические и профилактические аспекты инфекционных и массовых неинфекционных заболеваний» (Санкт-Петербург, 2008), XI, XII, XIII, XIV научно-практических конференциях «Актуальные проблемы медицины» (Абакан, 2008; 2009; 2010, 2011), итоговой научно-практической конференции ГУ НИИ медицинских проблем Севера СО РАМН «Вопросы сохранения и развития здоровья населения Севера и Сибири» (Кызыл, 2008; Абакан, 2009; Красноярск 2010), XXIth, XXIIth, XXIIIth, XXIVth International Workshop on Helicobacter and related bacteria in chronic digestive inflammation and gastric cancer (Рига, 2008; Порто, 2009; Роттердам, 2010, Дублин, 2011), XIV и XV Российских Гастроэнтерологических Неделях (Москва, 2008; 2009), Всероссийской научно-практической конференции «Вопросы патогенеза типовых патологических процессов» (Новосибирск, 2009, 2010), Всероссийской конференции «Компенсаторно-приспособительные процессы: фундаментальные экологические и клинические аспекты» (Новосибирск, 2009), Всероссийской научно-практической конференции «Дни иммунологии в Сибири» (Красноярск, 2010; Абакан, 2011), Третьем съезде военных врачей медико-профилактического профиля Вооруженных сил Российской Федерации (Санкт-Петербург, 2010), Международной конференции «3-е тысячелетие: Взгляд молодых ученых» (Санкт-Петербург, 2010), XII International Euroasian Congress of Surgery and Gastroenterology (Баку, 2011).

Исследование выполнено в рамках проекта ФЦП «Научные и научно-педагогические кадры инновационной России» на 2009-2013 годы (проект «Разработка технологической платформы молекулярной диагностики и лечения социально значимых заболеваний и подготовка на ее основе научно-исследовательских кадров для молекулярной медицины», ГК № 02.740.11.0311; гранта РФФИ № 09-04-98011 р_сибирь_а - Региональный конкурс Сибирь «Исследование роли патогенных факторов Helicobacter pylori для превенции язвенной болезни и рака желудка у коренного и пришлого населения Хакасии» (2009-2010).

Основные положения и выводы диссертационной работы используются в учебном процессе кафедры фундаментальной медицины и гигиены в курсе «Патофизиология», в курсе «Микробиологии, иммунологии и вирусологии», кафедры внутренних болезней для студентов, обучающихся по специальности «Лечебное дело» Медико-психолого-социального института ФГБОУ ВПО «ХГУ им. Н.Ф. Катанова»; внедрены в учебный процесс кафедры фундаментальных основ клинической медицины ГБОУ ВПО СибГМУ Минздравсоцразвития России в разделах «Современные проблемы медико-биологической науки» и «Молекулярные основы патологии».

Публикации. По теме диссертации опубликованы 64 работы, из них 15 статей в ведущих рецензируемых журналах и изданиях, определенных ВАК РФ, монография «Гены и болезни хакасов» и 45 статей и тезисов в материалах конференций, конгрессов и съездов.

Личный вклад автора. Автором были выполнены следующие этапы работ: анализ данных отечественной и зарубежной литературы по теме диссертации, выделение и культивирование лимфоцитов крови, оценка содержания TNF, IL-2, IL-4, IL-6, IL-8, IL-10 в сыворотке крови и в супернатантах клеточных культур методом иммуноферментного анализа, оценка апоптотической гибели лимфоцитов крови (спонтанного и индуцированного перекисью водорода), выделение ДНК и проведение рестрикционного анализа полиморфизма генов интерлейкинов С+3953Т IL-1, IL1-Ra VNTR, –330 T/G IL-2, -174 G/C IL-6, -251 T/A IL-8, выделение ДНК из биоптатов слизистой оболочки желудка и определение субтипов cagA, s1s2 и m1m2 vacA Helicobacter pylori методом полимеразной цепной реакции, статистический анализ результатов, написание диссертации.

Структура и объем диссертации. Диссертация изложена на 256 страницах машинописного текста и состоит из введения, четырех глав, выводов и библиографического списка. Работа содержит 63 рисунка и 51 таблицу. Библиографический указатель включает 363 источника (98 - отечественных и 265 - иностранных).

ХАРАКТЕРИСТИКА КЛИНИЧЕСКОГО МАТЕРИАЛА

И МЕТОДЫ ИССЛЕДОВАНИЯ

В основу работы положены результаты комплексного клинико-лабораторного обследования 201 (102 мужчин и 99 женщин) больного хроническим гастритом и язвенной болезнью, в возрасте от 18 до 55 лет (средний возраст - 42,0±4,1 года). Обследованный контингент представлен двумя популяциями: хакасы (монголоиды или коренное население) и остальные жители Республики Хакасия. С учетом того, что во второй популяции более 95% составляли русские, украинцы и белорусы, мы обозначили данную группу как «европеоиды». В качестве синонима мы применяли термин «пришлое население».

Набор клинического материала осуществлялся при непосредственном участии врачей ГУЗ «Хакасская Республиканская больница им. Г.Я. Ремишевской»: д-ра мед. наук, врача высшей категории, заведующей III терапевтическим отделением (1993-2009 гг.) О.В. Штыгашевой, врача этого же отделения Н.А. Россовой, канд. мед. наук, врача высшей категории, заведующего эндоскопическим отделением Н.Н. Буторина, врача высшей категории, заведующего клинико-диагностической лабораторией В.М. Иптышева.

Ряд обследованых пациентов находились на стационарном лечении в III терапевтическом отделении ГУЗ «Хакасская Республиканская больница им. Г.Я. Ремишевской» (главный врач - В.Ф. Костюш). Также были обследованы жители Таштыпского (Матур, Анчуль, Таштып), Аскизского (Усть-Есь, Есино, Усть-Чуль, Отты, Нижняя и Верхняя Тея, Иммыш, Кызлас) и Ширинского (Шира, малый Спирин, Топаново) районов Республики Хакасия в ходе научно-медицинских экспедиций (ноябрь 2007 г., март 2008 г.).

Исследование  проводилось  на кафедре  фундаментальной  медицины  и гигиены  ФГБОУ  ВПО  «ХГУ  им. Н.Ф.  Катанова»  (ректор – д-р мед. наук О.В. Штыгашева, г. Абакан), в Научно-образовательном центре молекулярной медицины ГБОУ ВПО СибГМУ Минздравсоцразвития России (ректор – академик РАМН, д-р мед. наук, профессор В.В. Новицкий, г. Томск). Иммуногистохимическое исследование выполнено под руководством заведующего кафедрой патологической анатомии с курсом клинической патологии д-ра мед. наук, профессора А.В. Кононова ГБОУ ВПО ОмГМА Минздравсоцразвития России (ректор – д-р мед. наук, профессор А.И. Новиков,  г. Омск). Рестрикционный анализ был выполнен на базе лаборатории популяционной генетики НИИ медицинской генетики СО РАМН под руководством д-ра биол. наук В.А. Степанова (директор – академик РАМН, д-р мед. наук, профессор В.П. Пузырев, г. Томск) и на кафедре фундаментальной медицины и гигиены ФГБОУ ВПО «ХГУ им. Н. Ф. Катанова».

В I группу обследованных был включен 71 пациент (36 хакасов и 35 европеоидов) с диагнозом язвенная болезнь двенадцатиперстной кишки (ЯБ), во II группу – 130 пациентов (61 хакас и 69 европеоидов) с хроническим поверхностным антральным гастритом (ХГ).

Диагноз ЯБ устанавливался в период обострения заболевания на основании клинических, эндоскопических и морфологических данных. Материал для морфологического исследования забирался во время ЭФГДС с прицельной биопсией из пилорического отдела, большой кривизны и малой кривизны (области угла) тела желудка аппаратом «Olympus-10» (Япония). Для исследования брали 3 биоптата из антрального отдела и тела желудка в каждой контрольной точке на границе здоровой и пораженной ткани.

Диагноз ХГ в острый период заболевания устанавливался при морфологическом исследовании биоптатов слизистой из трех отделов желудка (пилорический отдел, малая кривизна, большая кривизна) в соответствии с классификацией, разработанной на основе Сиднейской системы [Dixon M.F., 2005].

Обязательным критерием включения в группу исследования было наличие у пациентов Helicobacter pylori (НР). Больным, включенным в группы исследования, не должна была проводиться эрадикационная терапия, а также лечение следующими препаратами: антибактериальными, нестероидными противовоспалительными, ингибиторами протонной помпы, кортикостероидами (в течение 6-ти предшествующих месяцев). Обязательным было информированное согласие на участие в исследовании.

Контрольной группой служили 60 здоровых доноров-добровольцев (30 хакасов и 30 европеоидов), сопоставимых по полу и возрасту.

Материалом для исследования являлась венозная кровь и биоптаты слизистой оболочки желудка. Кровь забирали утром натощак из локтевой вены в количестве 10 мл в пробирку, содержащую 2,5% раствор ЭДТА. Биоптаты для выделения ДНК помещали в сухой эппендорф и затем замораживали при температуре -20 оС. Для гистологического исследования биопсийный материал фиксировали в 10% нейтральном формалине, забуференном по Р. Лилли.

На первом этапе исследования проводили идентификацию НР. Присутствие бактерий должно было быть подтверждено с помощью хотя бы одного из четырех методов: быстрого уреазного теста, серологического – определение специфических IgG HP в сыворотке крови («Им-Ди Спектр», г. Новосибирск), бактериоскопического исследования биоптатов слизистой оболочки желудка и/или определения видов и субтипов НР cagA, vacA s1, vacA s2, vacA m1, vacA m2 в биоптатах слизистой оболочки желудка методом ПЦР («Хеликопол» НПФ «Литех», г. Москва) (табл. 1).

На втором этапе исследования проводили оценку наличия  маркеров CD4+ (клон RTU–CD4–1F6 «Novocastra», Великобритания), СD8+ (клон RTU–CD8–295 «Novocastra», Великобритания), CD20+ (клон L26 «DAKO», Дания), Ki-67 (клон «MIB-1 DAKO», Дания), Bcl-2 (клон 124 «DAKO», Дания), СРР-32 (клон JHM62 «Novocastra», Великобритания) в лимфоцитах клеточного инфильтрата слизистой оболочки желудка в биоптатах иммуногистохимическим методом.  Ядра клеток докрашивали гематоксилином Майера в течение 15 сек-1 мин. Учет содержания маркеров в мононуклеарных клетках собственной пластинки слизистой оболочки желудка проводили определением процента положительно окрашенных клеток (с ядерной и цитоплазматической метками в зависимости от использованного маркера) (табл. 1).

В крови оценивали иммунофенотипический состав лимфоцитов (CD3+, CD4+, CD8+) методом проточной лазерной цитофлуориметрии с применением моноклональных антител («R&D Systems», США). Параметры напряжения для регистрации показателей на проточном цитометре задавали согласно указаниям в инструкции к набору. Результаты выражали в относительных (%) и абсолютных (тыс./мкл) значениях.

Содержание цитокинов (TNF, IL-2, IL-4, IL-6, IL-8, IL-10) в сыворотке крови определяли методом ИФА согласно приложенной инструкции («Procon», г. Санкт-Петербург). Затем проводили оценку содержания цитокинов (IL-2, IL-4, IL-10) в супернатантах культур мононуклеарных лейкоцитов крови (без добавления митогена для определения спонтанной продукции цитокинов и с добавлением 10 мкг/мл фитогемагглютинина (ФГА) («Difco», Германия) для активации лимфоцитов при определении индуцированной продукции цитокинов [Хаитов Р.М., 2005]). Учет результатов проводили с использованием спектрофотометра Immunochem 2100 («ThermoLabSistems», Финляндия). Результаты выражали в пкг/мл.

Оценивали спонтанный и индуцированный апоптоз лимфоцитов крови. Для индукции апоптотической гибели использовали неспецифический индуктор апоптотической гибели – перекись водорода в концентрации 0,01 %. Учет апоптотической гибели лимфоцитов крови проводили с использованием световой микроскопии и окрашивания гематоксилин-эозином [Меньшиков В.В., 1997]. При анализе использовали критерии, характеризующие кариопатологические и цитопатологические изменения в клетках.

Таблица 1

Распределение здоровых доноров и пациентов в зависимости

от методов исследования

Методы исследования

Европеоиды

Хакасы

Здоровые  доноры

Больные

Здоровые  доноры

Больные

ХГ

ЯБ

ХГ

ЯБ

I. Идентификация Helicobacter pylori

Быстрый уреазный тест

Не проводилось

69

35

Не проводилось

61

36

Цитологический метод определения НР в мазках-отпечатках биоптатов слизистой оболочки желудка

Не проводилось

20

20

Не проводилось

20

20

Определение специфических IgG к НР в сыворотке крови методом ИФА





30

69

35

30

61

36

Определение видов и субтипов НР в биоптатах слизистой оболочки желудка методом полимеразной цепной реакции

Не проводилось

29

18

Не проводилось

27

21

II. Оценка морфо-функциональных свойств слизистой оболочки желудка

Морфометрия структурных элементов слизистой оболочки желудка

Не проводилось

30

19

Не проводилось

28

22

Определение маркеров апоптоза (Bcl-2, CPP-32) и пролиферации (Ki-67) в биоптатах  методом иммуногистохимии

Не проводилось

20

20

Не проводилось

20

20

Определение CD-маркеров (CD4+, CD8+, CD20+) в биоптатах слизистой оболочки желудка  методом иммуногистохимии

Не проводилось

20

20

Не проводилось

20

20

III. Оценка клеточных и молекулярно-генетических показателей иммунитета

Определение общего количества лимфоцитов крови

30

60

35

30

60

36

Оценка CD-маркеров (CD3+, CD4+, CD8+) в лимфоцитах крови методом проточной цитофлуориметрии

20

25

20

20

24

21

Определение уровней IL-1,IL-2, IL-4, IL-6, IL-8, IL-10, TNF в сыворотке крови методом иммуноферментного анализа

20

60

35

30

60

35

Определение спонтанной и индуцированной (ФГА) цитокинпродуцирующей способности лимфоцитов IL-2, IL-4, IL-10 в супернатантах методом иммуноферментного анализа

20

20

20

20

20

20

Оценка спонтанного и индуцированного (перекись водорода) апоптоза лимфоцитов крови методом световой микроскопии

30

60

35

30

60

36

Анализ полиморфизма генов интерлейкинов IL-1, IL-1Ra, IL-2, IL-4, IL-6, IL-8 методом рестрикционного анализа

50

60

35

50

60

36

Морфологически апоптоз проявляется в конденсации и маргинации хроматина, уменьшении объема клетки, пузырчатости и фрагментации клеточного ядра [Allen R.T., 1997; Kroemer G., 2009]. Подсчитывали не менее 200 клеток, учет результатов проводили путем определения процента клеток с апоптотической морфологией (табл. 1). Для сравнительного анализа степени прироста индуцированного апоптоза в разных группах определяли апоптотический индекс (АИ) как отношение между разницей спонтанного и индуцированного апоптоза к спонтанному, выраженное в процентах.

Полученные показатели подвергали статистическому анализу. Результаты измерений представлены в виде медианы (Me) и интерквартильного размаха в виде 25 и 75 процентилей (Q25 и Q75). Для проверки нормальности распределения данных использовали критерий Колмагорова–Смирнова. Для выявления статистической значимости различий показателей в сравниваемых группах использовали непараметрические критерии: W-критерий Вилкоксона для независимых выборок и Т-критерий Вилкоксона - для зависимых выборок. Различия считались достоверными при уровне значимости р<0,05.

На третьем этапе исследования был проведен анализ полиморфизма генов цитокинов (IL-1, IL-1Rа, IL-2, IL-6, IL-8) методом рестрикционного анализа продуктов амплификации специфических участков генома (табл. 1). ДНК из клеток крови выделяли фенольным методом. Смесь для амплификации содержала: по 0,5 мкл R- и F-праймера (С+3953Т IL-1 F: gttgtcatcagactttgacc и R: ttcagttcatatggaccaga; IL-1Ra VNTR F: ctcagcaacactcctat и R: tcctggtctgcaggtaa; –330 T/G IL-2 F: cacaatatgctattcacatgttcagttagtcata и R: taccttcatttttcctcttctgatg; -174 G>C IL-6 F : tgacttcagctttactctttgt и R : ctgattggaaaccttattaag; -251 Т>А IL-8 F: tgttctaacacctgccactctagta и R : ttatgcaccctcatcttttcattat) («Сибэнзим», г. Новосибирск). К амплификату добавляли смесь для рестрикции, содержащую фермент (Taq I для С+3953Т IL-1, FauND I для –330 T/G IL-2, SfaNI для -174 G>C IL-6, Mfe I для -251 Т>А IL-8), 0,15 мкл BSA, 1,5 мкл буфера из расчета на одну пробу. Инкубировали в зависимости от температурного оптимума фермента при 37  или 56С в течение 12 ч.

Детекцию продуктов амплификации проводили в 4% агарозном геле, в качестве маркера размера ДНК использовали плазмиду pUC19, расщепленную рестриктазой MspI («Сибэнзим», г. Новосибирск). Распределение генотипов по исследованным полиморфным локусам проверяли на соответствие равновесию Харди-Вайнберга (РХВ) с помощью критерия 2. Для проверки значимости общей меры связи использовали критерий 2 Мантела-Ханзела, для оценки значения критерия отношения шансов (OR – Odds Ratio) с расчетом для него 95% доверительного интервала (CI - Confidence Intervals) [McHugh M.L., 2009].

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ

1. Генетические особенности Helicobacter pylori у хакасов и европеоидов,

страдающих хроническим гастритом и язвенной болезнью

В России инфицированность НР взрослого населения колеблется в пределах 50–80%, а в некоторых регионах приближается к 100%. Показатели распространенности инфекции у детей не отличаются от таковых у взрослого населения [Лазебник Л.Б., 2006; Хомерики С.Г., 2006]. В Республики Хакасия этот показатель составляет 96,2% для европеоидов и 96,4% для хакасов [Штыгашева О.В., 2005].

Разную географическую распространенность имеют и субтипы НР (рис. 1).

Рис. 1. Распространенность аллельных вариантов vacA субтипов Helicobacter pylori в мире (по данным R. Morales-Espinosa, 1999; L. J. A van Doorn, 1999; X.-J. Chen, 2001)

Изучение распределения генотипов НР показало, что у европеоидов cagA штаммы достоверно чаще встречались у больных ЯБ, чем при ХГ (94,4 и 79,3 %, соответственно, 2=9,6; р<0,05). VacA штаммы встречались у 100,0% больных ЯБ и ХГ. У европеоидов, больных ЯБ и ХГ, содержание vacA s1 штаммов HP не имело различий. Частота субтипов s2 и m1  vacA штаммов НР преобладала у больных ХГ, а при ЯБ - vacA s1s2 и  m2, различия носили статистически значимый характер. Смешанные изоляты vacA m1m2 достоверно чаще встречались у больных ЯБ, по сравнению с их содержанием у больных ХГ (2=20,7; p<0,05).

У хакасов, больных ЯБ, доминировали cagA штаммы HP (рис. 2). VacA штаммы НР были одинаково высоко распространены у хакасов как с ЯБ, так и с ХГ. Однако соотношение распределения vacA штаммов в обследованных популяциях различалось. Большая часть больных (как ЯБ, так и ХГ) были инфицированы смешанными изолятами НР - s1s2 vacA. Однако встречались больные, инфицированные только s1 или только s2 vacA  НР. При этом, если частота vacA s2 штаммов не различалась у больных ЯБ и ХГ, то s1 чаще диагностировались у больных ХГ, чем у больных с ЯБ. Распространенность vacA m1 не имела статистически значимых различий у больных ЯБ по сравнению с больными ХГ. Содержание vacA m2 у хакасов с ЯБ было достоверно ниже, по сравнению с больными ХГ (2=12,5; р<0,05). Содержание сразу же двух видов штаммов НР – vacA m1m2 – не имело статистически значимого увеличения значений показателей у больных ЯБ, по сравнению с их содержанием у больных ХГ.

При межпопуляционном сравнении нами было выявлено, что cagA штаммы HP при ХГ чаще встречались у европеоидов, чем у хакасов (2=36,2; р<0,05; рис. 2). При ЯБ частота встречаемости cagA штаммов HP не имела статистически значимых различий между европеоидами и хакасами.

а

б

Рис. 2. Распределение генов cagA и vacA Helicobacter pylori  у больных язвенной болезнью (а) и хроническим гастритом (б) среди хакасов и европеоидов. * – р<0,05 - достоверность различий при сравнении значений показателей у хакасов и европеоидов

При ХГ нами было выявлено достоверное увеличение частоты генотипа vacA m1 у европеоидов, по сравнению с его встречаемостью у хакасов [2=66,9 (р<0,05)], и, наоборот, достоверное снижение частоты генотипов vacA m2 и m1m2 у европеоидов, по сравнению с хакасами [2=60,6 (р<0,05) и 2=11,1 (р<0,05), соответственно]. При ЯБ у хакасов и европеоидов подобных закономерностей выявлено не было (рис. 2).

Значения критерия отношения шансов OR=5,2 при 95% CI (2,3–11,6) и OR=3,3 при 95% CI (1,7–6,2) позволили предположить о наличии положительной ассоциации между инфицированием m1m2 и s1s2 субтипами vacA НР и риском развития ЯБ у европеоидов.

У хакасов, учитывая значения критерия отношения шансов, нами было высказано предположение о взаимосвязи инфицирования cagA штаммами НР и риске развития язвенной болезни – OR=32,3 при 95% CI (11,3–99,6). Риск развития ХГ у хакасов, предположительно, был связан с vacA m2 штаммами НР (OR=2,8 при 95% CI (1,5-5,1)).

В настоящее время доказано, что между штаммами cagA и vacA s1 НР существует четкая корреляция, то есть большинство vacA s1 позитивных штаммов НР являются носителями cagA-гена – штаммы I типа (цитотоксические). Для них характерно более агрессивное воздействие на макроорганизм (высокая вирулентность, адгезия и внутриклеточная инвазия). Интерес представляет тот факт, что штаммы I типа НР стимулируют наибольшую секрецию IL-8 эпителиоцитами слизистой оболочки желудка по сравнению со штаммами II типа НР (VacA+/CagA-). Цитотоксические штаммы вызывают выраженное воспаление в слизистой оболочке желудка, способствуют развитию деструктивных процессов – язвообразованию, за счет увеличения инфильтрации нейтрофилами, выделения ими свободного кислорода и развития окислительного стресса. Показано, что vacA s1m1 в присутствии гена cagA НР увеличивает риск развития ЯБ [Bindayana K.M., 2010]. В отличие от них штаммы II типа (VacA+/CagA-) очень быстро фагоцитируются, что снижает их патогенное воздействие на организм.

Сопоставляя полученные нами результаты с данными литературы, можно отметить, что при обследовании хакасов было выявлено сходство с распространенностью инфекции в других азиатских странах [Dabiri H., 2009; Liao Y.L., 2009]. Так, например, во Вьетнаме CagA штаммы НР встречаются у 96,2% жителей Ханоя, в то же время, риск развития ЯБ связан с vacA m1 генотипом НР [Nguyen T.L., 2010]. Китайские ученые показали в своем исследовании ассоциацию ЯБ с аллелем vacA c s1a НР [Liao Y.L., 2009].

Генетические различия этиологического фактора ЯБ и ХГ у хакасов и европеоидов имели отражение и в клиническом течении заболеваний. При ретроспективной оценке жалоб и анамнеза нами были показаны различия в частоте обострений и длительности заболевания. Так, в ходе опроса больные ЯБ предъявляли жалобы на голодные боли и ночные боли – язвенноподобная форма диспепсии (европеоиды – 22,6% и хакасы – 12,3%, р<0,05); тошноту и отрыжку  – дискинетическая форма диспепсии (европеоиды – 44,9% и хакасы – 48,3%); боль в эпигастрии – неспецифическая форма диспепсии (европеоиды – 32,5% и хакасы – 39,4%). Пациенты  с ХГ в ходе опроса предъявляли жалобы на быструю утомляемость, раздражительность (43% хакасов и 52% европеоидов), слабость, головную боль (18% хакасов и 24% европеоидов), боль в области эпигастрия (72% - хакасов и 81% европеоидов), диспепсические расстройства (92% хакасов и 95% европеоидов).

В целом, анализ клинических проявлений НР-ассоциированных заболеваний у европеоидов и хакасов продемонстрировал выраженные этнические различия в структуре ЯБ. У европеоидов ЯБ чаще регистрировалась с более тяжелым характером течения, что может быть связано с присутствием гена vacA s1s2. У хакасов более легкое течение ЯБ ассоциировано с наличием гена cagA НР. Таким образом, мы еще раз подтвердили тезис о взаимосвязи между генетическими особенностями инфекта у хакасов и европеоидов, страдающих Helicobacter pylori-ассоциированной гастродуоденальной патологией, и клиническими фенотипами заболеваний.

2. Закономерности и особенности изменения локального и системного

иммунитета у хакасов и европеоидов, страдающих Helicobacter pylori-

ассоциированными хроническим гастритом и язвенной болезнью

Инициация антибактериальной защиты организма связана с выделением НР в окружающую его среду продуктов микробного происхождения, что приводит к выработке Th1-цитокинов (IL-1, IL-8, TNF, IFN)  [Meyer F., 2000; Taguchi A., 2005; D’Ellios M.M., 2007]. Одновременно иницируется запуск Th2-пути иммунного ответа, сопряженный с экспрессией лимфопоэтина эпителиальными клетками, хемокина MIP-3 и фактора активации В-клеток дендритными клетками [Kido M., 2010]. По мнению R. Goll et al. (2005), различия Т-клеточного ответа можно рассматривать как различия в активации иммунной защиты при НР-ассоциированных ХГ и ЯБ. Вместе с тем некоторые авторы считают, что инициация воспалительного процесса при ХГ и ЯБ имеет выраженные различия только в раннем периоде инфицирования, а соответствующий цитокиновый профиль предопределяет различия позднего периода инфекции [Царегородцева Т.М., 2003].

В результате CD-типирования лимфоцитов слизистой оболочки желудка было выявлено, что у европеоидов с ЯБ значения количества CD4+- и CD8+-лимфоцитов в биоптатах слизистой оболочки антрального отдела желудка составили 26,0±0,8 и 19,3±0,7%, соответственно. Их количество было выше, чем у больных ХГ (17,8±0,9 и 16,5±0,4%, соответственно). Увеличение числа CD4+-лимфоцитов у пациентов с ЯБ носило достоверный характер (р<0,05). Доля CD20+-лимфоцитов у пациентов c ЯБ была ниже, чем у больных ХГ (32,4±0,7 и 36,4±0,8%, соответственно, р<0,05).

У хакасов с ЯБ отмечалось увеличение числа CD4+- и CD8+-лимфоцитов (33,6±0,9 и 16,3±0,5%), по сравнению с их количеством у пациентов с ХГ (24,1±0,4 и 12,1±0,2%, соответственно, р<0,05) (рис. 3). Количество CD20+-лимфоцитов у пациентов с ЯБ составило 38,8±0,9 %, что было выше относительно данного показателя у пациентов с ХГ (34,4±0,7 %).

                       а                                                        б

Рис. 3. Микрофотография препарата слизистой оболочки желудка антрального отдела больного Б., хакаса, 41 год, диагноз: язвенная болезнь. На препаратах клетки, содержащие маркеры CD4+-лимфоцитов (1) и CD8+-лимфоцитов (2). Иммуногистохимический метод с докраской гематоксилином, ув. х 400 (а), х 900 (б)

При межпопуляционном анализе было показано, что у хакасов, больных ЯБ и ХГ, доля CD4+-лимфоцитов в слизистой оболочке желудка была достоверно выше, чем у европеоидов (р<0,05). Относительное количество CD20+-лимфоцитов было статистически значимо выше у хакасов с ЯБ, по сравнению с европеоидами (р<0,05). Среди пациентов с ХГ у европеоидов число CD8+- и CD20+-лимфоцитов было достоверно выше, чем у хакасов (р<0,05).

Тh1-ответ играет наиболее значимую роль в антибактериальной защите, так как препятствует колонизации НР в слизистой оболочке. Однако при длительном воспалительном процессе вместо ограничения роста патогена происходит гибель собственных клеток, в то время как детерминация Тh2-пути протекает без выраженного повреждения слизистой [Кондрашина Э.А., 2002; Ивашкин В.Т., 2008; Кононов А.В., 2009]. В связи с этим увеличение численности популяции CD20+-лимфоцитов у хакасов больных ЯБ может рассматриваться как протективная форма антихеликобактерной защиты.

Факторами, объясняющими выявленные нами различия иммунного реагирования у хакасов и европеоидов, больных ЯБ и ХГ, может быть недостаточное активирующее либо депрессивное действие НР на иммунную систему (низкая иммуногенность мембранных антигенов и продуктов жизнедеятельности НР, явление бактериальной мимикрии). После инвазии НР в эпителиоциты микроорганизм становится недоступным для антител. В этот момент наибольшее значение приобретает Th1-путь иммунного ответа, в результате которого возможно уничтожение эпителиальных клеток вместе с внутриклеточными патогенами. Трансформация Th-ответа сопровождается изменением содержания цитокинов в крови и слизистой оболочке желудочно-кишечного тракта. Соответственно, развивается цитокин-опосредованная поляризация иммунного ответа по Th1-пути. Определенную роль в изменении численности CD4+-лимфоцитов в слизистой оболочке желудка играет TGF-, вырабатываемый эпителиальными клетками в ответ на инфекцию НР [Beswick E.J., 2011].

Фундаментальным механизмом, регулирующим постоянство клеточного состава иммунной системы, является апоптоз. Модуляция программированной гибели, индуцированная НР, детерминирует прогрессию ХГ и ЯБ [Labb K., 2008; Chattopadhyay R., 2010].

Исследование содержания про- и антиапоптических белков (СРР-32 и Bcl-2, соответственно), а также антигена пролиферации (Ki-67) в лимфоцитах слизистой оболочки желудка у хакасов и европеоидов с ЯБ и ХГ позволили зарегистрировать различия значений данных показателей в зависимости от клинических форм заболевания. У хакасов и у европеоидов уровень Ki-67 имел тенденцию к увеличению у пациентов с ЯБ (1,6±0,2 и 1,3±0,7%, соответственно) по сравнению с таковыми у больных ХГ (1,1±0,2 и 0,8±0,2%, соответственно).

Содержание Bcl-2 в лимфоцитах собственной пластинки слизистой оболочки желудка было наибольшим при ЯБ (28,7±1,2% - у хакасов, 30,9±1,6% - у европеоидов) по сравнению с его уровнем в лимфоцитарных клетках у больных ХГ (21,4±1,3% - у хакасов, 24,3±1,8% - у европеоидов, р<0,05). Необходимо отметить, что частота встречаемости молекул Bcl-2 в лимфоцитах была выше у европеоидов, по сравнению с хакасами.

Более значимая частота встречаемости СРР-32 (каспаза–3) была отмечена у европеоидов больных ХГ (52,1±1,9%) по сравнению с таковыми у пациентов с ЯБ (38,3±2,7%, р<0,05). Такая закономерность была характерна для обеих этнических популяций. У хакасов больных ХГ частота встречаемости СРР-32 составила 55,5±2,1%, у пациентов с ЯБ - 40,0±1,8% (р<0,05).

Факторами, модифицирующими апоптоз лимфоцитов клеточного инфильтрата слизистой оболочки желудка, выступают НР, интерлейкины и окислительный стресс [Rolig A.S., 2011]. При этом в ранний период инфицирования НР происходит угнетение апоптоза за счет стимуляции экспрессии ингибиторов апоптоза cIAP2, в более позднем периоде – VacA НР-зависимое усиление апоптоза [Kim J.M., 2010]. Эффекты CagA- и VacA-белков сопряжены с транслокацией цитоплазматического белка Bax в митохондрию, высвобождением цитохрома с и активацией каспазы-3. Вероятно, что выявленное нами увеличение содержания антиапоптотического белка Bcl-2 в слизистой оболочке желудка ассоциировано со способностью VacA НР активировать транскрипционный фактор NF-kB. Кроме того, VacA модулирует трансдукцию сигнального пути: активирует p38 MAPK, запускает синтез IL-8, PGE2 и PI3K/Akt, супрессирует активность GSK-3 [Isomoto H., 2010]. CagA штаммы усиливают Fas-опосредованный апоптоз CD4+-лимфоцитов [Souza H., 2006; Wisniewski P., 2008]. В низких концентрациях происходит стимуляция клеточного роста и угнетение апоптоза за счет активации антиапоптотического белка Bcl-2, MAP-киназы и NF-kB. В больших концентрациях CagA+, наоборот, приводит к увеличению апоптотической гибели за счет активации iNOS, р53, Bax и каспазы-3 и -8 [Boonyanugomol W., 2010].

При исследовании системного иммунитета нами было выявлено, что ряд показателей у хакасов и европеоидов также различались. У европеоидов, страдающих ЯБ и ХГ, имело место увеличение относительного и абсолютного числа лимфоцитов крови, по сравнению со здоровыми донорами. Кроме того, при ЯБ количество лимфоцитов было ниже, чем при ХГ. У хакасов, наоборот, отмечалось увеличение относительного и абсолютного количества лимфоцитов крови у больных ЯБ, по сравнению с таковыми у здоровых доноров и больных ХГ.

У больных ЯБ, относящихся к европеоидной популяции, было выявлено увеличение числа CD3+ и CD4+-лимфоцитов, по сравнению со здоровыми донорами. У больных ХГ было установлено увеличение абсолютных значений количества CD3+- и CD8+-лимфоцитов крови, по сравнению с ЯБ. У хакасов, наряду с увеличением числа лимфоцитов крови, нами было выявлено выраженное снижение численности CD3+-, CD4+-, CD8+-субпопуляций лимфоцитов, по сравнению с аналогичными показателями у здоровых лиц, причем, при ЯБ указанные изменения были более выражены, чем при ХГ.

Одной из важных причин снижения количества лимфоцитов и/или их субпопуляций может служить угнетение процессов лимфопролиферации, связанные с недостаточностью активирующего сигнала (низкая концентрация активирующих цитокинов либо с гиперпродукция ингибирующих цитокинов) [Царегородцева Т.М., 2003]. Это может быть обусловлено многими факторами, среди которых: соотношение рецепторов-агонистов и антагонистов, инактивация циркулирующих цитокинов, величина рН, антиоксидантный потенциал клетки, истощение цитокин-продуцирующей способности клеток при длительной антигенной стимуляции [Ивашкин В.Т., 2008]. Имеет значение и локализация патологического процесса. При локализации язвы в желудке уровень продукции цитокинов ниже, чем при локализации в двенадцатиперстной кишке [Барановский А.Ю., 2001; Звягинцева Т.Д., 2002; Царегородцева Т.М., 2003].

Собственные результаты исследования показали, что содержание IL-8 в сыворотке крови у европеоидов, больных ХГ и ЯБ [210,0 (150,0–527,5) и 225,0 (121,0–390,0) пкг/мл, соответственно], выше, чем у здоровых доноров [169,0 (100,0–198,5) пкг/мл]; при этом наиболее значимое увеличение отмечалось при ЯБ. У хакасов при ХГ уровень IL-8 в сыворотке крови был выше, чем при ЯБ [400,0 (76,3–912,5) и 118,0 (52,5–337,5) пкг/мл, соответственно] (рис. 4).

а

б

Рис. 4. Содержание интерлейкинов в сыворотке крови у хакасов и европеоидов, больных язвенной болезнью (а) и хроническим гастритом (б), * – р<0,05 – достоверность различий при сравнении значений показателей у хакасов и европеоидов

Оба показателя были выше по сравнению с содержанием IL-8 в сыворотке крови у здоровых доноров [167,5 (44,3–530,0) пкг/мл].

IL-8 идентифицируется как маркер «адаптивного иммунитета» на персистенцию HP в организме [Rieder G., 2001]. Этот цитокин является ключевым медиатором Th1-пути иммунного ответа, фактором дифференцировки и рекрутирования клеток-эффекторов воспаления, а, следовательно, и выраженности иммунной защиты. При НР-инфекции увеличение концентрации IL-8 стимулирует хемотаксис нейтрофилов. Синтез IL-8 может быть вызван воздействием провоспалительных медиаторов (IL-1, TNF). В свою очередь, IL-8 стимулирует продукцию TNF, IFN и IL-1.

В проведенном нами исследовании было выявлено, что у европеоидов и хакасов уровень TNF в сыворотке крови был значительно выше у больных, чем у здоровых доноров (р<0,05). У больных ХГ увеличение более значимо у хакасов [1350,0 (400,0–2250,0) пкг/мл], чем у европеоидов [1200,0 (760,0–1900,0) пкг/мл]. При ЯБ концентрация цитокина также была выше у хакасов, чем у европеоидов [1400,0 (520,0–2160,0) и 1000,0 (439,0–1585,0) пкг/мл, соответственно] (рис. 4). Считается, что максимальное содержание TNF отмечается на пике обострения заболевания, при этом стойкое увеличение продукции TNF свидетельствует о деструктивно-воспалительных процессах, замедлении репарации, рубцевании язвенных дефектов, усилении апоптотической гибели клеток [Царегородцева Т.М., 2003; Sugimoto M., 2010].

Вероятно, что выявленная нами прямая корреляционная взаимосвязь между увеличением уровня продукции TNF и снижением численности субпопуляций лимфоцитов (CD3+, CD4+, CD8+) у хакасов, больных ХГ, можно объяснить цитотоксическим влиянием TNF на иммунные клетки либо снижением активационного сигнала в результате TNF-зависимой гибели эпителиоцитов.

Концентрация IL-6 в сыворотке крови у европеоидов была выше у больных ХГ и ЯБ [75,0 (54,0–113,5) и 69,0 (36,0–105,5) пкг/мл, соответственно], чем у здоровых доноров [34,0 (19,5–104,5) пкг/мл]. У хакасов различий между больными [32,0 (20,0–44,0) пкг/мл при ХГ и 20,0 (8,3–60,0) пкг/мл при ЯБ] и здоровыми донорами [19,0 (10,0–50,0) пкг/мл] выявлено не было. Вместе с тем у хакасов, больных ХГ была обнаружена обратно пропорциональная зависимость между уровнем IL-6 и числом CD8+-лимфоцитов у больных.

Считается, что при запуске специфического иммунитета в ответ на инфекционный агент активно увеличивается продукция IL-2, происходит дифференцировка Th1-лимфоцитов. Снижение продукции IL-2 может свидетельствовать о развитии вторичной иммунологической недостаточности [Rudnicka K., 2011]. Основным фактором в определении дифференцировки стимулированных антигеном наивных CD4+-Т-клеток в Th2 является IL-4 [Nasta F., 2006; Khaled W.T., 2007]. Физиологическим антагонистом и ингибитором Th1-ответа также является IL-10, увеличение которого приводит к снижению противоинфекционной защиты и развитию хронического воспаления [Jung M., 2004; Ивашкин В.Т., 2008].

У европеоидов с ЯБ содержание IL-2 в сыворотке крови составило 139,0 (67,0–256,0) пкг/мл, у больных ХГ – 110,0 (29,5–189,5) пкг/мл, что статистически не отличались от такового у здоровых доноров - 197,0 (120,0–225,0) пкг/мл. У хакасов наименьшие значения регистрировались у больных ЯБ – 15,0 (3,5–40,5) пкг/мл (по сравнению с контролем – 140,0 (28,5–500,0) пкг/мл, р<0,05). У больных ХГ содержание цитокина в сыворотке крови составило 28,0 (8,5–50,0) пкг/мл, что также было статистически ниже, чем в контроле (р<0,05). Межпопуляционное сравнение показало, что содержание IL-2 при ЯБ и ХГ было достоверно выше у европеоидов, по сравнению с хакасами (р<0,05) (рис. 4).

Содержание IL-4 в сыворотке крови у европеоидов составило при ХГ и ЯБ 350,0 (175,0–568,0) и 241,0 (168,0–370,0) пкг/мл, соответственно, что было достоверно выше, чем в группе здоровых доноров [37,0 (20,5–56,0) пкг/мл, р<0,05]. Среди хакасов было выявлено достоверное увеличение содержания данного интерлейкина при ХГ и ЯБ [262,5 (150,0–410,0) и 220,0 (100,0–400,0) пкг/мл, соответственно], по сравнению с группой здоровых доноров [32,5 (19,0–101,0) пкг/мл, р<0,05]. У европеоидов выше, чем у хакасов, однако, различия не были статистически значимы (рис. 4).

Значения уровней IL-10 в сыворотке крови у европеоидов при ХГ были достоверно выше, по сравнению с таковым у здоровых доноров [425,0 (210,0–1145,0) и 60,0 (26,0–215,5) пкг/мл, р<0,05, соответственно], в то время как при ЯБ концентрация IL-10 составила 181,0 (90,0–312,0) пкг/мл (р>0,05). У хакасов, больных ХГ, величина содержания в сыворотке крови IL-10 была достоверно выше по сравнению с уровнем цитокина в контрольной группе [307,5 (175,5–600,0) и 32,0 (10,0–250,0) пкг/мл, соответственно, р<0,05]. При ЯБ значения показателя не отличались от такового в контрольной группе [42,5 (7,3–125,0) пкг/мл] и были достоверно ниже, чем у больных ХГ (р<0,05). Сравнительный анализ уровня IL-10 между хакасами и европеоидами показал, что концентрация IL-10 у европеоидов была выше, чем у хакасов; при этом при ЯБ различия носили достоверный характер (р<0,05) (рис. 4).

Более полная информация о направлении процесса дифференцировки мононуклеарных лейкоцитов была нами получена при определении спонтанной и стимулированной продукции IL-2, IL-4 и IL-10 лимфоцитами крови. У здоровых лиц спонтанный синтез цитокинов низок, а при индуцированном действии различных стимуляторов (LPS, ФГА и др.) многократно возрастает [Фрейдлин И.С., 1998]. Индуцированная секреция цитокинов характеризует потенциальную (резервную) способность клеток иммунной системы отвечать на стимуляцию различными антигенами [Ржавичева О.С., 2006].

Нами было показано, что у европеоидов, больных ЯБ и ХГ, базальная продукция IL-2 не имела статистически значимых различий с таковой в контрольной группе, в то время как резервная была выше, чем в контрольной группе (табл. 2).

Таблица 2

Спонтанная и ФГА-стимулированная продукция IL-2, IL-4 и IL-10

мононуклеарными лейкоцитами крови у европеоидов, больных с Helicobacter pylori-ассоциированными хроническим гастритом и язвенной болезнью

Продукция (пкг/мл)

Здоровые доноры

Больные ЯБ

Больные ХГ

IL-2

спонтанная

124,4

(89,4–167,0)

169,0

(118,6–205,6)

113,4

(84,6–237,5)

ФГА-стимулированная

218,9

(189,6–280,0) 2

290,0

(234,6–312,9) 2

289,5

(210,2–425,1)

IL-4

спонтанная

50,1

(24,8–79,3)

34,9

(20,7–45,8)

69,2

(45,2–89,5) 1

ФГА-стимулированная

99,3

(78,9–123,6) 2

78,0

(64,0–91,8) 2

108,6

(75,0–211,7) 2

IL-10

спонтанная

5,0

(3,0–6,9)

10,8 

(3,9–15,9)

8,5

(4,1–16,4)

ФГА-стимулированная

9,0

(6,5–15,4) 2

15,8

(7,8–21,8)

11,3

(7,6–14,0)

Примечание: 1 – р<0,05 – достоверность различий по сравнению с язвенной болезнью, 2 – р<0,05 – достоверность различий при сравнении спонтанной и ФГА-стимулированной продукции цитокина.

Таблица 3

Спонтанная и ФГА-стимулированная продукция IL-2, IL-4 и IL-10

мононуклеарными лейкоцитами крови у хакасов, больных Helicobacter pylori-

ассоциированными хроническим гастритом и язвенной болезнью

Продукция (пкг/мл)

Здоровые доноры

Больные ЯБ

Больные ХГ

IL-2

cпонтанная

141,7

(39,0–220,0)

45,0

(30,0–112,0)

89,0

(75,1–93,0)

ФГА-стимулированная

190,0

(70,0–279,0)

119,0

(90,0–205,9)

139,0

(112,0–164,9) 2

IL-4

cпонтанная

35,0

(16,0–44,3)

98,0

(84,0–131,6) 1

101,0

(89,0–109,5) 1

ФГА-стимулированная

123,3

(69,0–147,6) 2

197,0

(176,0–342,7)  1,2

189,0

(167,0–262,0) 1,2

IL-10

cпонтанная

57,3

(32,0–78,2)

342,9

(289,0–402,0) 1

309,0

(239,0–369,8) 1

ФГА-стимулированная

128,0

(90,0–134,0) 2

509,0

(470,0–549,0) 1,2

443,5

(397,0–535,0) 1,2

Примечание: 1 – р<0,05 – по сравнению с показателями у здоровых доноров, 2 – р<0,05 – достоверность различий при сравнении спонтанной и ФГА-стимулированной продукции цитокина.

Возможными причинами низкой концентрации IL-2 у хакасов, больных ЯБ и ХГ, может служить высокая рецепторная активность клеток-мишеней (эндотелиоцитов, эпителиоцитов, париетальных клеток и др.) в очаге воспаления, наличие растворимых рецепторов в кровотоке, эффективно связывающих циркулирующие цитокины. Подтверждением этому служит увеличение ФГА-стимулированной продукции IL-2 у хакасов, больных ЯБ и ХГ (табл. 3).

Нами было установлено, что у хакасов и европеоидов повышена спонтанная и ФГА-стимулированная концентрация цитокинов IL-4 и IL-10 в супернатантах мононуклеарных лейкоцитов при ХГ и ЯБ (табл. 2, 3). Данный факт можно рассматривать как фактор, способствующий хронизации заболеваний, связанных с НР-инфекцией.

Определенное значение в дизрегуляции иммунитета при длительной персистенции бактериальных патогенов имеет повышение интенсивности апоптоза клеток иммунной системы. При этом в зависимости от концентрации, интерлейкины могут оказывать проапоптотический или антиапоптотический эффект. Под действием IL-2 усиливается индукция клеточных рецепторов и образование FasL и TNF – рецепторный механизм активации апоптоза. IL-2–индуцированный апоптоз может происходить при участии митохондрий [Чечина О.Е., 2009]. В высоких концентрациях IL-2 обеспечивает устойчивость клеток к апоптотической гибели, особенно - CD4+-лимфоцитов. Инфицирование vacA штаммами НР оказывает иммуносупрессирующее действие на Т-лимфоциты через ингибирующее влияние на клеточную пролиферацию и IL-2 [Sewald X., 2011].

Проведенный нами анализ апоптотической гибели лимфоцитов крови (рис. 5) показал, что у больных ЯБ и ХГ, европеоидов, имеет место достоверное увеличение апоптотически измененных лимфоцитов крови [21,4 (19,4–23,6)  и 24,3 (21,8–27,1) %, соответственно], по сравнению со здоровыми донорами [17,9 (16,5–19,0) %, р<0,05]. Число лимфоцитарных клеток крови, подвергшихся индуцированному апоптозу, у европеоидов больных ЯБ составил 26,4 (22,0–28,6) %, у больных ХГ - 29,6 (27,8–33,8) %. Значения обоих показателей были ниже таковых в контроле - 31,6 (27,1–34,8) %, р<0,05.

а

б

в

г

Рис. 5. Микрофотографии лимфоцитов крови, полученных у больных, диагноз: язвенная болезнь. Представлены нормальный лимфоцит (а), клетки с признаками спонтанного (б-в) и индуцированного перекисью водорода (г) апоптоза. Световая микроскопия, окрашивание гематоксилин–эозином, ув. х 1500

У больных ЯБ, хакасов, значения числа лимфоцитов крови с морфологическими признаками апоптоза составили 18,5 (16,7–20,0) % и были достоверно выше, чем количество апоптотически измененных клеток крови у лиц контрольной группы [15,7 (13,6–16,4) % (р<0,05)]. У больных ХГ апоптоз лимфоцитов соответствовал 14,8 (11,2–21,0) %. Анализ числа клеток, вступивших в индуцированный апоптоз у хакасов, страдающих ЯБ, соответствовал 23,7 (21,9–27,6) %, у больных ХГ – 22,9 (19,8–25,6) %. Оба показателя статистически не отличались от такового у здоровых доноров [27,9 (23,0–30,1) % (р>0,05)].

Для оценки степени прироста индуцированного апоптоза нами был рассчитан апоптотический индекс (АИ): при ЯБ АИ у хакасов соответствовал 36,4 %, в то время как у европеоидов – 16,7 % (р<0,05). У хакасов, больных ХГ, АИ составил 63,8 %, у европеоидов – 33,3 % (р<0,05). У здоровых доноров АИ не имел достоверных отличий у хакасов, по сравнению со значениями указанных параметров у европеоидов (85,0 и 79,1 %, соответственно).

Безусловно, что процесс индукции апоптоза клеток локального иммунитета связан с непосредственным взаимодействием эффекторов воспаления с НР, развитием окислительного стресса, в то время как апоптоз лимфоцитов крови является результатом воздействия других апоптозмодифицирующих факторов.

В частности, апоптоз клеток иммунной системы может быть инициирован не только самим возбудителем, но и нарушениями метаболических процессов макроорганизма. Необходимо отметить, что в ряде случаев Th1-лимфоциты более чувствительны к апоптозу, чем Th2-клетки. Возможно, это следует рассматривать как дополнительный механизм ограничения возможных патологических последствий Th1-опосредованного иммунного ответа [Morris S.C., 2009] и формирования различий в реализации апоптоза у больных ЯБ и ХГ коренного и пришлого населения Хакасии.

3. Распределение аллельных вариантов и генотипов генов цитокинов

у хакасов и европеоидов, страдающих Helicobacter pylori-

ассоциированными хроническим гастритом и язвенной болезнью

Известно, что способность реализовывать адекватный иммунный ответ является отражением генетической структуры макроорганизма [Frodham A.J., 2004]. Наиболее распространенным вариантом наследственной предрасположенности является сочетание у индивида аллелей генов, совокупный эффект которых определяет особенности иммунитета, повышающих риск развития инфекционных заболеваний [Casanova J.-L., 2002; Гончарова И.А., 2006]. В литературе данные касательно частоты встречаемости определенных полиморфизмов генов и их ассоциации с НР-зависимыми заболеваниями довольно противоречивы. Одни авторы не обнаружили статистически значимой связи между IL-1 (–511 C/T и –31 T/C), IL-6 (–174 G/C), IL-8 (–251 T/A, +396 T/G и +781 C/T), IL-10 (–819 C/T, –592 C/A, –1082 A/G), и TNFA (–308 G/A, -238 G/A) и риском развития НР-ассоциированной гастродуоденальной патологии [Kamangar F., 2006; Kim N., 2006; Shin W. G., 2008]. Другие, наоборот, придают большое значение в развитии НР-индуцированных заболеваний наличию определенных полиморфизмов генов цитокинов [Rad R., 2004; Wu M.S., 2003; Lu C.C., 2005; Lu W., 2005; Zambon C.F., 2005; Hollegaard M.V., 2006].

Оценка распределения полиморфизмов С+3953Т гена IL-1 показала, что у европеоидов наиболее частый генотип СС +3953 IL-1. Его доля была достоверно выше у больных ЯБ по сравнению с контролем (2=10,9; р<0,05). Доля гетерозигот СТ +3953 IL-1 и гомозигот ТТ +3953 IL-1 у больных ЯБ и ХГ - у представителей европеоидной популяции – была ниже, чем у здоровых доноров. В группе ЯБ различия по сравнению с контролем носили статистически значимый характер (2=4,3; р<0,05 и 2=3,9; р<0,05, соответственно).

У хакасов больных ЯБ количество гомозигот СС +3953 IL-1 было выше, чем у пациентов с ХГ и здоровых доноров (р<0,05). Генотип СТ +3953 IL-1 статистически значимо чаще встречался при ХГ, по сравнению с группами больных ЯБ (2=11,3; р<0,05) и здоровых доноров (2=4,7; р<0,05). Гомозиготы ТТ +3953 IL-1 среди хакасов были редким генотипом и выявлялись только у здоровых доноров.

Анализ полиморфизма гена IL-1Rа VNTR показал, что у хакасов и европеоидов наиболее распространенным генотипом являлся R4R4 IL-1Ra. Однако частота R4R4 у европеоидов была значительно ниже, чем у хакасов. В отношении R3R4 нами были получены совершенно противоположные результаты. Доля генотипа была выше у европеоидов, по сравнению с хакасами. Редкими были генотипы R2R2 IL-1Ra и R2R3 IL-1Ra, которые чаще встречались у европеоидов, чем у хакасов. Межпопуляционный анализ показал, что у европеоидов с ЯБ была увеличена частота R2R2, R2R3, R2R4 и R3R3 (2=8,9; р<0,05) и снижена частота R3R4 и R4R4 (2=65,0; р<0,05) по сравнению со встречаемостью данных генотипов у хакасов. У европеоидов, больных ХГ, по сравнению с аналогичной группой хакасов повышена частота встречаемости R2R2 (2=5,7; р<0,05), R2R3, R2R4 (2=9,8; р<0,05), R3R4 и снижена - R4R4 (2=35,5; р<0,05) 

Полученные нами результаты распределения полиморфных вариантов гена подтверждаются и данными литературы. Исследования, проведенные в китайской популяции, показали, что только 16 % здоровых доноров были носителями R2 IL-1Ra, в то время как в Швеции и Польше – 56,0 %, в Португалии – 47,3 % [El-Omar E.M., 2000; Machado J.C., 2001; Shin W.G., 2008].

Представляют интерес результаты анализа распределения частот аллельных вариантов полиморфизма –330 T/G гена IL-2. Необходимо отметить, что роль полиморфизма –330 T/G гена IL-2 рассматривается в НР-ассоциированных заболеваниях не только с позиций регуляции иммунного ответа, но и одной из причин развития атрофии слизистой оболочки желудка при НР-индуцированном воспалении [Кондрашина Э.А., 2002]. Эффекты потенцируются при генетически-детерминированной продукции цитокина. Известно, что замена аллеля Т в позиции –330 промоторной зоны гена IL-2 на G приводит к увеличению экспрессии интерлейкина [Hoffmann S.C., 2001].

Среди европеоидов больных ХГ нами зарегистрировано увеличение частоты GТ и снижение ТТ -330 IL-2. У хакасов больных ХГ и ЯБ увеличивалось содержание высокопродуцирующего варианта GG -330 IL-2. В тоже время генотип ТТ -330 IL-2 встречался значительно реже у больных ХГ и ЯБ по сравнению с группой здоровых доноров. Изменения частот генотипов у хакасов больных ХГ и ЯБ не были одинаковыми.

Ранее другими исследователями  были получены фактические данные частоты встречаемости данного полиморфизма в разных этнических группах. Так, W.G. Shin et al. (2008) показали, что в японской популяции генотип TT -330 IL-2 встречался у 72,0 % обследованных в контрольной группе, в то время как у корейцев, по данным S. Togawa (2005), только у 39,6 %. В корейской популяции аллель Т -330 IL-2 встречался у 76,2 % обследованных контрольной группы [Pyo C.W., 2003]. По результатам двух независимых исследований W.G. Shin et al. (2008) и J. Wu et al. (2009), среди китайцев, больных ХГ и ЯБ, доминирующим генотипом также был ТТ -330 гена IL-2, хотя, различия, по сравнению с генотипами GT и TT, в этих же группах больных ХГ и ЯБ не были статистически значимыми [Shin W.G., 2008; Wu J., 2009].

Различия касались и роли генотипа в риске развития заболевания. S. Togawa et al. (2005) продемонстрировали связь между генотипом TT -330 IL-2 и риском развития атрофии слизистой оболочки желудка. По результатам исследования проведенными научной группой D.M. Queiroz и соавторами (2009) показано, что у носителей аллеля G полиморфизма -330 T/G гена IL-2 снижен риск развития НР-ассоциированной гастродуоденальной патологии.

Анализ полиморфизма -174 G>C гена IL-6 показал, что у европеоидов при ЯБ доля GG 174 IL-6 снижалась с одновременным увеличением СC –174 IL-6 (2=3,90; р<0,05). У больных ХГ достоверных различий частот генотипов относительно контроля выявлено не было. У хакасов, больных ХГ и ЯБ, не было выявлено статистически значимых отличий по сравнению с группой здоровых доноров. Генотип CC -174 IL-6 в группе пациентов с ХГ выявлен не был. Однако у коренного и пришлого населения частота встречаемости возможных генотипов имеет существенные различия.

Роль аллельных вариантов гена IL-8 в патогенезе НР-ассоциированной ЯБ не является однозначной [Kamali-Sarvestani E., 2006]. Аллель А -251 IL-8 связан с прогрессией атрофических изменений в слизистой оболочке желудка у пациентов с НР и увеличивает риск развития ЯБ в японской популяции [Taguchi A., 2005; Ohyauchi M., 2005]. Z. Gyulai et al. показали взаимосвязь между носительством генотипа ТТ -251 IL-8 и риском развития дуоденальной язвы. B.D. Ye et al. (2009) показали, что аллель А полиморфизма T-251 A гена IL-8 ассоциирован с высокой продукцией IL-8, тяжелой степенью воспаления, атрофией слизистой, по сравнению с генотипом ТТ -251 IL-8.

В нашем исследовании среди европеоидов частота встречаемости генотипа АА -251 IL-8 не различалась у больных с ХГ и ЯБ. У хакасов при ЯБ была высокой частота встречаемости высокопродуцирующего генотипа АА -251 IL-8, доля ТА значительно снижалась относительно контроля. При ХГ такой закономерности не отмечалось.

Данный факт имеет подтверждение и в работах других исследователей. Генотип АА -251 IL-8 ассоциирован с риском развития ЯБ двенадцатиперстной кишки [Hofner P., 2007]. J.M. Kang et al. (2009) также показали, что, хотя при ЯБ преобладающим генотипом был ТА и ТТ -257 IL-8, риск развития заболевания связан с генотипом АА -257 IL-8. Исследование, проведенные E. Garza-Gonzalez et al. (2007), P. Canedo et al. (2008) продемонстрировали преобладание гетерозиготного генотипа ТА -257 IL-8 при ХГ.

Для дополнительного анализа мы рассчитывали значения критерия отношения шансов, на основании чего сделали вывод о положительной ассоциации генотипов и риске развития НР-ассоциированных ЯБ и ХГ. У европеоидов генотип GТ –330 IL-2 (OR=2,35) положительно ассоциирован с риском развития ХГ. Риск развития ЯБ ассоциирован с генотипом СС +3953 IL-1 (OR=2,63), R2R3 IL-1Ra (OR=8,08), CC -174 С>C IL-6 (OR=2,25). С учетом значений показателей критерия отношения шансов, можно заключить что полиморфный вариант ТТ –330 IL-2 (OR=0,28) является протективным в отношении риска развития ХГ у европеоидов. Генотипами снижающими риск развития ЯБ у европеоидов являются СТ и ТТ +3953 IL-1 гена IL-1 (OR=0,51 и OR=0,44, соответственно), R4R4 IL-1Ra и R3R4 IL-1Ra (OR=0,51 и OR=0,30, соответственно) (рис. 6).

У хакасов возможное влияние на риск развития ХГ связан с наличием генотипа СТ +3953 IL-1 (OR=1,97), протективный эффект у хакасов оказывает генотип ТТ –330 IL-2 (OR=0,42). Фактором, ассоциированным с риском развития ЯБ, является GG –330 IL-2 (OR=1,91) и АА –251 IL-8 (OR=3,15). Протективный эффект в отношении развития ЯБ в данной популяции был ассоциирован с ТА –251 IL-8 (OR=0,40) (рис. 7).

Резистентность  Предрасположенность 


C+3953T IL-1







IL-1Rа VNTR


 

 

 

4,41

R2R3

TT

0,28

–330 T/G IL-2


2,35

GT




-174 С>C IL-6







-251 Т>А IL-8






  0,5 1 2 3  5  8

а

Резистентность  Предрасположенность

TT

0,44

C+3953T IL-1

 

 2,63

CC

R4R4

0,51

IL-1Rа VNTR

 

 

 

 

 

8,08  R2R3

–330 T/G IL-2

 

 

-174 С>C IL-6

 

2,25

CC

-251 Т>А IL-8

  0,5 1 2 3  5 8

б

Рис. 6. Показатели критериев отношения шансов (OR) риска развития Helicobacter pylori-ассоциированных хронического гастрита (а) и язвенной болезни (б) у европеоидов

Для определения взаимосвязи различных полиморфных вариантов гена с развитием ХГ или ЯБ нужно обратить внимание на системы межгенного взаимодействия. Известно, что полиморфный вариант R2R3 гена IL-1Ra ассоциирован с высоким уровнем продукции цитокина. Его физиологическое действие направлено на конкурентное связывание рецептора для IL-1, тем самым, приводя к подавлению эффектов цитокина. Однако гиперпродукция антагониста рецептора IL-1Ra оказывает парадоксальный эффект: по принципу обратной связи происходит усиление синтеза IL-1. В результате воспалительная реакция приобретает затяжной характер.

На основании выявленной нами ассоциации риска развития ЯБ у европеоидов и комбинации генотипов СС +3953 IL-1 и R2R3 гена IL-1Ra можно предположить, что именно этот эффект имеет место в патогенезе ЯБ у европеоидов. В то же время у хакасов наиболее распространенными вариантами были СС +3953 IL-1 и R4R4 IL-1Ra. Данные генотипы не характеризуются высоким уровнем экспрессии гена. Вероятно, эта особенность обеспечивает мягкий провоспалительный эффект, следовательно, и низкую, по сравнению с европеоидами, заболеваемость ЯБ.

Резистентность Предрасположенность 

C+3953T IL-1

1,97

СТ




IL-1Rа VNTR




ТТ

0,42

–330 T/G IL-2




-174 С>C IL-6




-251 Т>А IL-8




  0,5 1  2  3 5  8

а

Резистентность Предрасположенность 

C+3953T IL-1


IL-1Rа VNTR


–330 T/G IL-2

 

1,91

GG

-174 С>C IL-6


TA

0,40

-251 Т>А IL-8

 

 

 

3,15

AA

  0,5  1  2  3 5 8

б

Рис. 7. Показатели критериев отношения шансов (OR) риска развития Helicobacter pylori-ассоциированных хронического гастрита (а) и язвенной болезни (б) у хакасов

Необходимо отметить, что инфицирование CagA+ штаммами НР также может влиять на изменение концентрации IL-8 [Audibert C., 2000; Fischer W., 2001; Rieder G., 2001; Kim N., 2010]. Важную роль в запуске и стимуляции продукции IL-8 играет липополисахарид клеточной стенки НР, причем, разные штаммы НР оказывают разное стимулирующее влияние. Считается, что CagA+ штаммы увеличивают продукцию цитокина. В результате анализа внутриклеточных сигнальных механизмов было показано, что НР индуцирует транскрипцию гена IL-8 через активацию NF-B p65 [Ritter B., 2011]. В то же время L.I. Shu-Ping et al. (2010) показали, что при CagA НР-зависимой активации PI3K/Akt1 сигнального пути происходит супрессия синтеза IL-8 эпителиоцитами.

Таким образом, можно сделать вывод, что у хакасов фактическим риском развития ЯБ является наличие генотипа АА -251 IL-8. Другим фактором является установленная нами взаимосвязь между генетическими особенностями инфекта (cagA+ НР) и носительством генотипа ТА -251 IL-8 у хакасов, больных ЯБ. Анализ содержания IL-8 в сыворотке крови в зависимости от генотипа показал, что уровень IL-8 у носителей АА -251 продукции был наибольшим, по сравнению с уровнем интерлейкина у носителей генотипов ТА и ТТ -251 IL-8. Следовательно, сочетание CagA и TА -251 IL-8 сопряжено с более выраженным воспалением в слизистой оболочке желудка и двенадцатиперстной кишки. Однако штаммы HP, не экспрессирующие CagA, не являются комменсалами, так как обнаруживаются и у больных язвенной болезнью, и у больных раком желудка, хотя, значительно реже. Это связано с тем, что подверженность к ЯБ, ХГ является полигенной.

Заключение

Исследование иммунопатогенеза НР-ассоциированной гастродуоденальной патологии, проведенное у двух популяций – хакасов и европеоидов, проживающих на одной территории – Республики Хакасия, позволило выявить ряд клинико-патогенетических особенностей ХГ и ЯБ (рис. 8).

У европеоидов чаще регистрировался более тяжелый характер течения ЯБ (степень тяжести, частота обострений, наличие осложнений), что может быть связано с присутствием гена vacA s1s2 (OR=3,3). У хакасов более легкое течение ЯБ ассоциировано с наличием гена cagA НР (OR=32,3).

Изменения характеристик локального и системного иммунитета у пациентов с НР-ассоциированной патологией коррелировали со степенью выраженности инфекционного процесса и популяционными особенностями обследованных. НР является длительно протекающей инфекцией, в результате которой возникает гиперактивация локальной иммунной системы с последующей декомпенсацией по количественным и качественным признакам, соответственно, а также снижение эффективности иммунного ответа. Свидетельством этого является факт выявления нарушения баланса цитокинов в сыворотке крови (IL-4, IL-10, TNF) у хакасов и европеоидов, страдающих Helicobacter pylori-ассоциированными хроническим гастритом и язвенной болезнью, а также особенности спонтанной и ФГА-индуцированной продукции интерлейкинов мононуклеарными лейкоцитами крови. Важное значение имеет иммунофенотипический состав лимфоцитов крови. У хакасов при хроническом гастрите и язвенной болезни наблюдалось снижение числа CD3+-, CD4+- и CD8+-лимфоцитов крови, у европеоидов увеличение численности субпопуляций CD4+- и CD8+-лимфоцитов крови.

Обнаруженные изменения закономерностей реализации апоптотической гибели иммунных клеток являются важным звеном нарушения иммунореактивности макроорганизма в патогенезе НР-ассоциированных заболеваний, так как уменьшение количества клеток иммунной системы сопряжено с изменениями соотношения субпопуляций лимфоцитов и является одним из проявлений иммунореактивности.

Рис. 8.  Молекулярно-клеточные механизмы нарушения локального и системного иммунитета при инфекции Helicobacter pylori. СОЖ – слизистая оболочка желудка, ПК – периферическая кровь, по данным результатам собственных исследований (выделено цветом)

Очевидно, что выявленные изменения, с одной стороны, являются следствием нарушения иммунологического равновесия, обеспечивающего адекватное реагирование макроорганизма на НР-инфекцию. С другой стороны, являются результатом молекулярно-генетической детерминации функционирования иммунной системы.

Выводы

1. Различные клинические фенотипы язвенной болезни, ассоциированной с Helicobacter pylori, у коренного и пришлого населения Республики Хакасии сопровождаются доминированием в различных этнических популяциях  разных, по генетическим характеристикам, патогенов. У хакасов язвенная болезнь ассоциирована с cagA штаммами Helicobacter pylori (95,2 %), у европеоидов -  s1s2 vacA штаммами Helicobacter pylori (55,6%).  Helicobacter pylori-ассоциированный хронический гастрит также характеризуется молекулярно-генетической дифференцированностью возбудителя: у хакасов хронический гастрит ассоциирован с m2 vacA штаммами (62,9 %), у европеоидов – с m1 vacA штаммами Helicobacter pylori (62,1%).

2. Изменения субпопуляционного состава клеточного инфильтрата в слизистой оболочке желудка у хакасов и европеоидов с Helicobacter pylori-ассоциированной гастродуоденальной патологией характеризуются активацией гуморального (увеличение числа CD20+-лимфоцитов) и клеточного звеньев иммунитета (возрастание количества CD4+- и CD8+-лимфоциты).

3. Дисбаланс между апоптозом (CPP-32 и Bcl-2) и пролиферацией (Ki67) лимфоцитов слизистой оболочки желудка у хакасов и европеоидов с хроническим гастритом и язвенной болезнью, ассоциированных с  Helicobacter pylori, имеет одинаковую направленность, но разную интенсивность: активность апоптоза лимфоцитов (отношение показателей CPP-32 и Bcl-2) выше при хроническом гастрите, чем при язвенной болезни; у хакасов более выражено, по сравнению с европеоидами.

4. Изменения численности субпопуляций лимфоцитов крови при гастродуоденальной патологии, ассоциированной с инфекцией Helicobacter pylori, у коренного и пришлого населения Республики Хакасия, характеризуются снижением числа CD3+-, CD4+- и CD8+-лимфоцитов у хакасов, как при хроническом гастрите, так и при язвенной болезни, и увеличением количества CD4+- и CD8+-лимфоцитов у европеоидов, больных хроническим гастритом и язвенной болезнью, по сравнению с аналогичными показателями у здоровых доноров.

5. Течение Helicobacter pylori-ассоциированной гастродуоденальной патологии  у больных, относящихся к разным этническим группам и проживающим на территории Республики Хакасия, сопровождается изменением числа лимфоцитов крови, вступивших в апоптоз, наиболее выраженным у хакасов, по сравнению с европеоидами.

6. Чувствительность лимфоцитов, полученных у пациентов с гастродуоденальной патологией, ассоциированной с инфекцией Helicobacter pylori, к действию неспецифического модулятора апоптоза (0,01 % раствора перекиси водорода) in vitro снижена, по сравнению с лимфоцитарными клетками крови у здоровых доноров; выраженность указанных изменений наиболее значима у европеоидов, чем у хакасов. При язвенной болезни апоптотический индекс снижен, что свидетельствует о снижении функционального потенциала иммунокомпетентных клеток при длительной инфекции Helicobacter pylori.

7. Дисбаланс интерлейкинов сыворотки крови у хакасов и европеоидов, страдающих Helicobacter pylori-ассоциированной гастродуоденальной патологией, характеризуется увеличением концентрации TNF, IL-4 и IL-10. Особенности спонтанной и ФГА-индуцированной продукции интерлейкинов мононуклеарными лейкоцитами крови у пациентов с Helicobacter pylori-сопряженными хроническим гастритом и язвенной болезнью характеризуются снижением базальной и резервной продукции IL-2 у хакасов и увеличением продукции IL-4, IL-10 - у европеоидов.

8. Распространенность полиморфизмов генов цитокинов С+3953Т IL-1, IL1-Ra VNTR, –330 T/G IL-2, -174 G/C IL-6, -251 T/A IL-8 у хакасов и европеоидов имеет выраженные межпопуляционные различия и является определяющим в иммунопатогенезе Helicobacter pylori-сопряженных хронического гастрита и язвенной болезни у хакасов и европеоидов.

9. Иммуногенетическими предикторами Helicobacter pylori-ассоциированной язвенной болезни у хакасов являются генотип АА промоторного региона -251 Т>А гена IL-8 (OR=3,15), генотип GG промоторного региона -330 T/G  IL-2 (OR=1,91); у европеоидов - генотип СС промоторного региона С+3953Т гена IL-1 (OR=2,63), генотип R2R3 гена IL-1Ra (OR=8,08), генотип СС промоторного региона -174 G>C гена IL-6 (OR=2,25). У хакасов риск развития хронического гастрита при инфицировании Helicobacter pylori ассоциирован с генотипом СТ полиморфизма С+3953Т гена IL-1 (OR=1,97); у европеоидов – с генотипом R2R3 гена IL-1Ra (OR=4,41) и генотипом GТ промоторного региона - 330 T/G гена IL-2 (OR=2,35).

10. Фактором, снижающим риск развития язвенной болезни ассоциированной с Helicobacter pylori, у хакасов является генотип ТА промоторного региона -251 Т>А гена IL-8 (OR=0,40); у европеоидов - генотипы СТ и ТТ промоторного региона С+3953Т гена IL-1 (OR=0,51 и OR=0,44, соответственно), генотипы R3R4 и R4R4 гена IL-1Ra (OR=0,30 и OR=0,51, соответственно). Риск развития хронического гастрита, ассоциированного с Helicobacter pylori, снижен у хакасов и европеоидов, - носителей генотипа ТТ промоторного региона -330 T/G  IL-2 (OR=0,42 и OR=0,28, соответственно).

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

1. Агеева, Е.С. Особенности хеликобактер-ассоциированной язвы желудка у населения Республики Хакасия / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Сибирский вестник гепатологии и гастроэнтерологии. – 2007. - № 21. - С. 48–49.

2. Штыгашева, О.В. Фенотипический состав лимфоцитов собственной пластинки желудка при язвенной болезни желудка у жителей Республики Хакасия / О.В. Штыгашева, Е.С. Агеева // Сибирский вестник гепатологии и гастроэнтерологии. – 2007.–№21.–С.146–147.

3. Агеева, Е.С. Этно-биологические аспекты хеликобактер-ассоциированной патологии желудка / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Этносы развивающейся России: проблемы и перспективы: материалы 2 межрегиональной научно-практической конференции 27-28 сентября 2007 г., г. Абакан / под. ред. Фотековой Т.А. – Абакан: Издательство Хакасского Государственного Университета им. Н.Ф. Катанова, 2007. – С. 177–178.

4. Агеева, Е.С. Патогенетические аспекты в формировании хеликобактер-ассоциированной патологии / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Генетика человека и патология: Сборник научных трудов / Под ред. В.П. Пузырева. Вып. 8. – Томск: Изд-во «Печатная мануфактура», 2007. – С. 42-44.

5. Штыгашева, О.В. Иммунобиологическая толерантность к хронической персистенции Helicobacter pylori / О.В. Штыгашева, Е.С. Агеева, Н.В. Рязанцева // Клинико-эпидемиологические и этно-экологические проблемы заболеваний органов пищеварения материалы восьмой Восточно-Сибирской гастроэнтерологической конференции с международным участием и красноярской краевой гастроэнтерологической конференции / под ред. проф. Цуканова В.В., проф. Салминой А.Б. – Красноярск, 2008. – С. 100-111.

6. Штыгашева, О.В. О роли персистенции микроорганизмов в генезе неинфекционных заболеваний / О.В. Штыгашева, Е.С. Агеева // Вестник Российской Военно-медицинской академии. - 2008. – 2 (22). - Ч. II. - С. 648-649.

7. Агеева, Е.С. Молекулярно-генетические особенности распространенности персистенции Helicobacter pylori в Республике Хакасия / Е.С. Агеева, О.В. Штыгашева // Вестник Российской Военно-медицинской академии. - 2008. – 2 (22). - Ч. II. - С. 651-652.

8. Агеева, Е.С.Роль апоптоза в патогенезе мультифакториальных заболеваний / Е.С. Агеева, О.В. Штыгашева // Актуальные проблемы медицины: материалы межрегиональной научно-практической конференции 16-17 мая 2008 г., г. Абакан / под ред. Штыгашевой О.В. - Абакан: Издательство ООО «ДиалогСибирь-Абакан». – 2008. – С. 82–86.

9. Особенности апоптоза лимфоцитов периферической крови при язвенной болезни у коренных жителей Республики Хакасия / Е.С. Агеева, О.В. Штыгашева Н.Н. Буторин и др. // Актуальные проблемы медицины: материалы межрегиональной научно-практической конференции 16-17 мая 2008 г., г. Абакан / под ред. Штыгашевой О.В. - Абакан: Издательство ООО «ДиалогСибирь-Абакан». – 2008. – С. 89–90.

10. Агеева, Е.С. Методы дифференциального окрашивания апоптотических клеток / Е.С. Агеева, О.А. Берсенева // Актуальные проблемы медицины: материалы межрегиональной научно-практической конференции 16-17 мая 2008 г., г. Абакан / под ред. Штыгашевой О.В. - Абакан: Издательство ООО «ДиалогСибирь-Абакан». – 2008. – С. 234–236.

11. Штыгашева, О.В. Роль Helicobacter pylori в патогенезе актуальных социально-значимых заболеваний / О.В. Штыгашева, Е.С. Агеева // Материалы конференции «Вопросы сохранения и развития здоровья населения республики Тыва», в рамках ежегодной итоговой научно-практической конференции ГУ НИИ медицинских проблем Севера СО РАМН «Вопросы сохранения и развития здоровья населения Севера и Сибири» / Под. ред. В.Т. Манчука и С.В. Смирновой – Кызыл: Тувинское книжное издательство, 2008 – Вып. 7. – С. 156–159.

12. The Features of Interactions  between H. pylori and Human Organism in Caucasian and Mongol Populations / O.V. Shtygasheva, E.S. Ageeva, N.N. Butorin, N.V. Ryazantseva // Helicobacter. – 2008. – Vol. 13, N 5. - P.432.

13. Иммунологические показатели крови при язвенной болезни у коренного населения Хакасии / Е.С. Агеева, О.В. Штыгашева, Н.Н. Буторин и др. // Российский журнал Гастроэнтерологии, Гепатологии, колопроктологии. Приложение № 32. материалы Четырнадцатой Российской Гастроэнтерологической Недели. 6-8 октября 2008 г, г. Москва. – Т. XVIII, № 5. – С. 143.

14. Анализ вклада гена -251 Т>А ИЛ-8 в генетическую предрасположенность язвенной болезни у хакасов / Е.С. Агеева, О.В. Штыгашева, В.М. Иптышев, А.А. Сморгова // Вопросы патогенеза типовых патологических процессов. Труды Всероссийской научно-практической конференции с международным участием. – Новосибирск: Сибмедиздат НГМУ, 2009. – С. 24-27.

15. Агеева, Е.С. Анализ уровня интерлейкина-1 у больных гастродуоденальной НР-ассоциированной патологией коренного населения Республики Хакасия / Е.С. Агеева, А.А. Сморгова // Материалы XLVII Международной научной студенческой конференции «Студент и научно-технический прогресс»: Медицина / Новосиб. гос. ун-т. Новосибирск, 2009. – С. 3.

16. Ассоциации полиморфизма генов интерлейкина 1 с гастродуоденальной патологией у хакасов / Е.С. Агеева, О.В. Штыгашева, В.М Иптышев и др. // Клинико-эпидемиологические проблемы и этно-экологические проблемы органов пищеварения. Материалы девятой восточно-сибирской гастроэнтерологической конференции с международным участием 6-7мая 2009 / под. ред. проф. В.В. Цуканова, проф. А.Б. Салминой – Красноярск, 2009. - С. 133-134.

17. Иммунологические особенности течения гастродуоденальной патологии у жителей Хакасии / Е.С. Агеева, О.В. Штыгашева В.В. Цуканов, Н.В. Рязанцева // Иммунология. – 2009. – Т. 30, №3. – С. 162-165.

18. Polymorphisms in Genes Interleukins Associated with Ulcer Disease in a High-Risk Khakas Population / O.V. Shtygasheva, E.S. Ageeva, N.N. Butorin, N.V. Ryazantseva // Helicobacter. – 2009. – Vol. 14, N.4. - P.360

19. Агеева, Е.С. Изучение ассоциаций полиморфизмов генов интерлейкинов с язвенной болезнью у хакасов / Е.С. Агеева, О.В. Штыгашева // Российский журнал Гастроэнтерологии, Гепатологии, колопроктологии. Приложение № 34. материалы Пятнадцатой Российской Гастроэнтерологической Недели. 12-14 октября 2009, Москва.–Т. XIX, № 5.–С.131.

20. Механизмы формирования иммунного ответа при Helicobacter pylori персистенции у коренного населения Хакасии / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева, Е.В. Кудряшова // Четвертая Всероссийская научно-практическая конференция / Под ред. акад. РАМН проф. В.А. Шкурупия.– Новосибирск, 2009. – С. 5-6.

21. Характеристика морфологических изменений слизистой оболочки желудка у хакасов при персистенции инфекции H. pylori / О.А. Берсенева, Е.А. Осипова, Е.С. Агеева, А.С. Пуликов // «Наука и общество: взгляд молодых исследователей»: материалы третьей научной конференции школьников и студентов с международным участием, Абакан / под. ред С.В. Небыковой - Абакан: ООО «ДиалогСибирь-Абакан», 2009.–С.43-46.

22. Агеева, Е.С. Особенности патогенеза Helicobacter pylori-инфекции у представителей хакасской популяции / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Бюллетень Сибирской Медицины. – 2009. - №4 – С. 5-9.

23. Некоторые показатели морфометрии слизистой оболочки желудка при персистенции Helicobacter pylori у коренных жителей Республики Хакасия / О.А. Берсенева, Е.А. Осипова, Е.С. Агеева, А.С. Пуликов // Экология Южной Сибири и сопредельных территорий. Выпуск 13: в 2 т. Т. II / отв. ред. В.В. Анюшин. – Абакан: Издательство Хакасского государственного университета им. Н.Ф. Катанова, 2009. - С. 113- 115.

24. Система цитокинов у больных с хронической персистенцией Helicobacter pylori у коренного населения Хакасии / Е.С. Агеева, О.В. Штыгашева, В.М. Иптышев, Н.В. Рязанцева // Дни иммунологии в Сибири: Материалы Всероссийской научно-практической конференции с международным участием / Под ред. В.А. Козлова, С.В. Смирнова, В.Т. Манчука. – Красноярск: Издательство КрасГМУ, 2010. – С. 91-93.

25. Молекулярные механизмы изменений слизистой оболочки желудка у хакасов при персистенции Helicobacter pylori / О.А. Берсенёва, Е.С. Агеева, О.В. Штыгашева и др. // Дни иммунологии в Сибири: Материалы Всероссийской научно-практической конференции с международным участием / Под ред. В.А. Козлова, С.В. Смирнова, В.Т. Манчука. – Красноярск: Издательство КрасГМУ, 2010. – С. 96-98.

26. Иммунопатогенетические особенности развития Helicobacter pylori-ассоциированных заболеваний / Е.С. Агеева, З.К. Хаитова, О.В. Штыгашева и др. // Вопросы патогенеза типовых патологических процессов. Труды II Всероссийской научно-практической конференции с международным участием. – Новосибирск: Сибмедиздат НГМУ, 2010 – С. 7-10.

27. Агеева, Е.С. Модуляция программируемой гибели клеток при хронической персистенции Helicobacter pylori / Е.С. Агеева // Актуальные проблемы медицины: материалы 13-ой межрегиональной научно-практической конференции с международным участием; г. Абакан, 4-5 мая 2010 / отв. ред. О.В. Штыгашева. – Абакан: Издательство ГОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2010. – С. 232-238.

28. Агеева, Е.С. Особенности распределения генов цитокинов (IL-1 и IL-8) у больных язвенной болезнью / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Актуальные проблемы медицины: материалы 13-ой межрегиональной научно-практической конференции с международным участием; г. Абакан, 4-5 мая 2010 / отв. ред. О.В. Штыгашева. – Абакан: Издательство ГОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2010. – С. 238-243.

29. Фенотип лимфоцитов периферической крови при Helicobacter pylori-ассоциированной гастродуоденальной патологии / Е.С. Агеева, О.В. Штыгашева, З.К. Хаитова и др. // Актуальные проблемы медицины: материалы 13-ой межрегиональной научно-практической конференции с международным участием; г. Абакан, 4-5 мая 2010 / отв. ред. О.В. Штыгашева. – Абакан: Издательство ГОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2010. – С. 243-246.

30. Гены и болезни хакасов / О.В. Штыгашева, Е.С. Агеева, В.Н. Харьков, В.А. Степанов // Красноярск: Поликор, 2010-296 с.

31. Фенотип лимфоцитов крови больных с Helicobacter pylori-ассоциированным раком желудка / Е.С. Агеева, О.В. Штыгашева, М.О. Максимов, Г.Н. Стрижаков // Материалы научно-практической конференции молодых ученых «Актуальные вопросы охраны здоровья населения регионов Сибири». Вып. 8. / Под ред. В.Т. Манчука, С.В. Смирновой – Красноярск, 2010. – С. 3-4.

32. Роль TNFA в патогенезе Helicobacter pylori-ассоциированной гастродуоденальной патологии / Е.С. Агеева, В.М. Иптышев, О.В. Штыгашева, Н.В. Рязанцева // Материалы итоговой научно-практической конференции НИИМПС СО РАМН «Вопросы сохранения и развития здоровья населения Севера и Сибири» / Под ред. В.Т. Манчука, С.В. Смирновой. – Красноярск, 2010. - Вып.9. – С. 135-136.

33. Агеева, Е.С. Популяционные особенности распространенности инфекции Helicobacter pylori в Хакасии / Е.С. Агеева, О.В. Штыгашева // «Инфекция Helicobacter pylori в России»: сборник научных статей / под. ред. Корниенко Е.А. и др. – СПб., 2010. – С. 5-12.

34. Агеева, Е.С. Ассоциация полиморфизмов генов G-174С ИЛ6 и Т-251А ИЛ8 с язвенной болезнью у хакасов / Е. С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Иммунология. – 2010. - № 3, Т. 31. – С. 131-133.

35. Молекулярно–генетические факторы, влияющие на исход инфицирования Helicobacter pylori у жителей Республики Хакасия / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева, В.В. Цуканов // Российский журнал гастроэнтерологии, гепатологии, колопроктологии. – 2010. - № 4. - С. 13-18.

36. Роль апоптоза в дисрегуляции локального и системного иммунитета при Helicobacter pylori-инфекции / Е.С. Агеева, О.В. Штыгашева, В.М. Иптышев  и др. // Бюллетень Сибирской медицины. – 2010. - № 5. - С. 13-18.

37. The external features of polymorphism in genes IL-1B in patients with atrophic gastritis / E.S. Ageeva, O.V. Shtygasheva, N.N. Butorin, N.V. Ryazantseva // Helicobacter. – 2010. – Vol. 15, N.4. - P.357.

38. The phenotype lymphocytes of patient with H. pylori-associated the gastric cancer / O.V. Shtygasheva, E.S. Ageeva, M.O. Maksimov, G.N. Strizhakov // Helicobacter. – 2010. – Vol. 15, N.4. - P.384.

39. Изучение фагоцитарной активности нейтрофилов и цитокин-продуцирующей способности лимфоцитов у больных с персистенцией Helicobacter pylori / Ю.В. Саранчина, Е.С. Агеева, С.В. Водолазова, О.В. Штыгашева //  «Наука и общество: взгляд молодых исследователей»: материалы четвертой научной конференции школьников и студентов с международным участием 12-13 ноября 2010 г., г. Абакан / под. ред О.В. Комаровой - Абакан: ООО «ДиалогСибирь-Абакан», 2010. – С.85-86.

40. Изучение фагоцитарной активности нейтрофилов и цитокин-продуцирующей способности лимфоцитов у больных с персистенцией Helicobacter pylori / Ю.В. Саранчина, Е.С. Агеева, С.В. Водолазова и др. // «Наука и общество: взгляд молодых исследователей»: материалы четвертой научной конференции школьников и студентов с международным участием 12-13 ноября 2010 г., г. Абакан / под. ред О.В. Комаровой - Абакан: ООО «ДиалогСибирь-Абакан», 2010. – С.85-86.

41. Особенности цитокин-продуцирующей способности лимфоцитов больных хроническим гастритом и язвой желудка, ассоциированными с Helicobacter pylori у жителей Хакасии / Ю.В. Саранчина, Е.С. Агеева, О.В. Штыгашева, С.В. Водолазова // Экология Южной Сибири и сопредельных территорий. Выпуск 14: в 2 т. Т. II / отв. ред. В.В. Анюшин. – Абакан: Издательство ГОУ ВПО «Хакасского государственного университета им. Н. Ф. Катанова», 2010. - С. 133- 115.

42. Аспекты прогнозирования перехода Helicobacter pylori-ассоциированного хронического гастрита в рак желудка / Е.С. Агеева, О.В. Штыгашева, О.М. Максимов и др. // Актуальные вопросы долголетия: Материалы Всероссийского научно-практической конференции, г. Красноярск, 8-10 декабря 2010 г. / Под ред. В.Т. Манчука, С.В. Смирновой. - Красноярск: Изд-во КрасГМУ, 2010. - С. 3-5.

43. Агеева, Е.С. Роль аллельных вариантов гена IL-1 в формировании H. pylori-ассоциированной гастродуоденальной патологии / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Медицинский Академический Журнал, 2010. – Т. 10, №5. - С 114.

44. Оценка иммунного статуса больных с персистенцией Helicobacter pylori / Ю.В. Саранчина, Е.С. Агеева, С.В. Водолазова и др. // Достижения науки и практики в обеспечении санитарно-эпидемиологического благополучия Вооруженных Сил Российской Федерации: труды Третьего съезда военных врачей медико-профилактического профиля Вооруженных Сил Российской Федерации (Санкт-Петербург, 8-10 декабря 2010 г.). – СПб. 2010–С.179.

45. Штыгашева, О.В. Роль иммунорегуляторных цитокинов в патогенезе хронического гастрита и язвенной болезни, поиск предикторов заболеваний / О.В. Штыгашева, Е.С. Агеева, В.М. Иптышев // Сибирский медицинский журнал. – 2011. - № 1. – С. 88-90.

46. Агеева, Е.С. Популяционные особенности ассоциации полиморфизма генов интерлейкинов с патологией желудка и двенадцатиперстной кишки у хакасов / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Терапевтический архив. – 2011. – Т. 83, № 2. – С. 16-19.

47. Агеева, Е.С. Роль полиморфизма гена -330 T/G IL-2 в патогенезе Helicobacter pylori-ассоциированных хронического гастрита и язвенной болезни / Е.С. Агеева, О.В. Штыгашева // Дни иммунологии в Сибири: материалы Всероссийской научно-практической конференции с международным участием / под. ред. В.А. Козлова, С.В. Смирновой, В.Т. Манчука. – Абакан: Издательство ГОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2011. - С. 116-118.

48. Саранчина, Ю.В. Влияние полиморфизма гена С+3953Т IL-1 на продукцию интерлейкина при хроническом гастрите, ассоциированном с Helicobacter pylori инфекцией / Ю.В. Саранчина, Е.С. Агеева, О.В. Штыгашева // Дни иммунологии в Сибири: материалы Всероссийской научно-практической конференции с международным участием / под. ред. В.А. Козлова, С.В. Смирновой, В.Т. Манчука. – Абакан: Издательство ГОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2011. - С. 165-167.

49. Штыгашева, О.В. Формирование научной школы: молекулярно-генетические предикторы и факторы риска социально-значимых заболеваний у коренного и пришлого населения Хакасии / О.В. Штыгашева, Е.С. Агеева // Актуальные проблемы медицины: материалы 14-й межрегиональной научно-практической конференции с международным участием; г. Абакан, 27-28 апреля 2011 г. / под. ред. О.В. Штыгашевой. – Абакан: Издательство ГОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2011. - С. 6-9.

50. Особенности иммунного статуса при семейной трансмиссии хеликобактериоза у населения Хакасии / Е.С. Агеева, О.В. Штыгашева, Ю.В. Саранчина, С.В. Водолазова // Актуальные проблемы медицины: материалы 14-й межрегиональной научно-практической конференции с международным участием; г. Абакан, 27-28 апреля 2011 г. / под. ред. О.В. Штыгашевой. – Абакан: Издательство ГОУ ВПО «Хакасский государственный университет им. Н. Ф. Катанова», 2011. - С. 209-219.

51. Агеева, Е.С. Ассоциация полиморфных маркеров 251 Т>А гена IL-8 с язвенной болезнью у хакасов / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева // Молекулярная медицина. – 2011. - №2. – С. 17-22.

52. Аллельный полиморфизм генов IL-1 и IL-8 при персистенции Helicobacter pylori в случаях семейной трансмиссии у жителей Хакасии / Ю.В. Саранчина, Е.С. Агеева, С.В. Водолазова, О.В. Штыгашева // Клинико-эпидемиологические и этно-экологические проблемы заболеваний органов пищеварения: материалы одиннадцатой Восточно-Сибирской гастроэнтерологической конференции с международным участием; г. Иркутск, 24-25 мая 2011 и Забайкальской конференции «Актуальные проблемы гастроэнтерологии», г. Чита, 27-28 мая 2011 / Под ред. В.В. Цуканова. – Красноярск, 2011.–С.55-56.

53. Семейный анамнез в определении предрасположенности к заболеваниям / Е.С. Агеева, Ю.В. Саранчина, С.В. Водолазова, О.В. Штыгашева // Клинико-эпидемиологические и этно-экологические проблемы заболеваний органов пищеварения: материалы одиннадцатой Восточно-Сибирской гастроэнтерологической конференции с международным участием; г. Иркутск, 24-25 мая 2011 и Забайкальской конференции «Актуальные проблемы гастроэнтерологии», г. Чита, 27-28 мая 2011 / Под ред. В.В. Цуканова. – Красноярск, 2011. – С. 63-66.

54. Этно-популяционные особенности распределения полиморфизма гена IL-1 при Helicobacter pylori-ассоциированной гастродуоденальной патологии / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева и др. // Бюллетень Сибирской медицины.–2011. - №3.–С. 14-18.

55. Роль IL-1 и IL-8 в патоморфозе слизистой оболочки желудка при Helicobacter pylori-ассоциированном гастрите/ Е.С. Агеева, О.В. Штыгашева, А.С. Пуликов, Н.Н. Буторин // Бюллетень ВСНЦ СО РАМН. – 2011. - №1(77), ч. 1. – С. 16-20.

56. Ageeva, E.S. The polymorphism in genes and pathomorphosis of the mucous membrane of the stomach at Helicobacter pylori-associated gastritis / E.S. Ageeva, O.V. Shtygasheva, N.V. Ryazantseva // Helicobacter. – 2011. – Vol. 16 (S.1). – P.124.

57. Агеева, Е.С. Поиск молекулярно-генетических факторов риска Helicobacter pylori-ассоциированных заболеваний желудка / Е.С. Агеева, О.В. Штыгашева // Этносы развивающейся России: проблемы и перспективы: материалы четвертой Всероссийской научно-практической конференции с международным участием, 20-21 октября 2011 г., г. Абакан / под. ред. Т.А. Фотековой. – Абакан: Издательство ФГБОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2011. – С. 176-178.

58. Изменение показателей иммунного ответа при хронической персистенции Helicobacter pylori-инфекции у населения Хакасии / Ю.В. Саранчина, С.В. Водолазова, Е.С. Агеева, О.В. Штыгашева // Этносы развивающейся России: проблемы и перспективы: материалы четвертой Всероссийской научно-практической конференции с международным участием, 20-21 октября 2011, Абакан / под. ред. Т.А. Фотековой. – Абакан: Издательство ФГБОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2011.–С.185-186.

59. Ageeva, E.S. Features of immune response in pathogenesis of ulcer disease at the native and stranger inhabitants of Khakassia / E.S. Ageeva, O.V. Shtygasheva // Abstracts of XII International Euroasian Congress of Surgery and Gastroenterology. Baku, October 2011.-P.36-37.

60. Продукция провоспалительных цитокинов IL-1 и IL-8 при инфекции Helicobacter pylori / Ю.В. Саранчина, С.В. Водолазова, Е.С. Агеева, О.В. Штыгашева // Экология Южной Сибири и сопредельных территорий. Выпуск 15. В 2 т. Т. II / отв. ред. В.В. Анюшин. – Абакан: Издательство ФГБОУ ВПО «Хакасский государственный университет им. Н.Ф. Катанова», 2011. - С. 141-142.

61. Особенности иммунного ответа при хронической инфекции Helicobacter pylori-инфекции / Ю.В. Саранчина, С.В. Водолазова, Е.С. Агеева, О.В. Штыгашева // «Актуальные вопросы бактериологии»: материалы научно-практической конференции. – 2011. – С. 63-65.

62. Генетические детерминанты прогноза инфицирования Helicobacter pylori / Е.С. Агеева, О.В. Штыгашева, Н.В. Рязанцева и др. // Бюллетень СО РАМН. – 2011. – Т.31, №6.–С. 5-9.

63. Роль нарушений системы цитокинов в патогенезе Helicobacter pylori-ассоциированной патологии / Е.С. Агеева, О.В. Штыгашева, В.М. Иптышев, Н.В. Рязанцева // Бюллетень Сибирской медицины. – 2011. - №6. –С. 5-8.

64. Агеева, Е.С. Показатели спонтанного и индуцированного апоптоза при Helicobacter pylori-инфекции / Е.С. Агеева // Сибирский медицинский журнал.–2012.-№1.–С.37-39.

СПИСОК ИСПОЛЬЗОВАННЫХ СОКРАЩЕНИЙ

АИ – апоптотический индекс

ДНК – дезоксирибонуклеиновая кислота

ИФА - иммуноферментный анализ

ОП – оптическая плотность

ПЦР – полимеразная цепная реакция

РХВ - равновесие Харди-Вайнберга

ФГА - фитогемагглютинин

ХГ –  хронический гастрит

ЭДТА – этилендиаминтетраацетат

ЭФГДС – эзофагогастродуоденоскопия

ЯБ - язвенная болезнь

CagА (cytotoxin associated gene А) – цитотоксин-ассоциированный антиген

CD (cluster differentiation) – кластер дифференцировки

CI (Confidence Intervals) - доверительный интервал

HP - Helicobacter pylori

IFN – интерферон

Ig - иммуноглобулин

IL - интерлейкин

IL-1Rа - антагонист рецептора интерлейкина

OR (Odds Ratio) – отношение шансов

Th - Т-хелперный лимфоцит

TNF (tumor necrosis factor) – фактор некроза опухоли

VacA (vacuolating-associated cytotoxin А) – вакуолизирующий цитотоксин

VNTR (variable nucleotide trend repeat) – вариабельность длины тандемных повторов

 





© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.