WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 
На правах рукописи

Павлов Виталий Михайлович

Методология и результаты молекулярно-генетического изучения вакцинного штамма Francisella tularensis

03.02.03– микробиология

Автореферат

диссертации на соискание ученой степени

доктора биологических  наук

Оболенск – 2011

Работа выполнена в Федеральном государственном учреждении науки «Государственный научный центр прикладной микробиологии и биотехнологии» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека.

НАУЧНЫЙ КОНСУЛЬТАНТ:

доктор медицинских наук, профессор  Дятлов Иван Алексеевич

ОФИЦИАЛЬНЫЕ ОППОНЕНТЫ:

академик РАМН,

доктор биологических наук, профессор  Зверев  Виталий Васильевич

доктор медицинских наук, профессор  Афанасьев  Станислав Степанович

доктор медицинских наук, профессор  Дядищев  Николай Романович

Ведущая организация – Научно-исследовательский институт эпидемиологии и микробиологии им. Н. Ф. Гамалеи РАМН

Защита состоится «26» мая 2011 г. в «13» часов на заседании диссертационного совета Д 208.078.01 при Государственном научном центре прикладной микробиологии и биотехнологии по адресу: 142279, Московская область, Серпуховской район, пос. Оболенск.

С диссертацией можно ознакомиться в библиотеке Государственного научного центра прикладной микробиологии и биотехнологии 

Автореферат разослан «       » _____________ 2011 г. 
 


 Ученый секретарь

диссертационного совета,

кандидат биологических наук  Н. К. Фурсова 

Актуальность проблемы

Разработка современных лекарственных препаратов для лечения инфекционных заболеваний и средств их профилактики основывается на детальных данных о молекулярных структурах факторов патогенности и механизмах их действия. В частности, для создания вакцин важно знать, какие антигены являются протективными, а какие компоненты бактерий подавляют защитную функцию иммунной системы организма. История изучения возбудителя туляремии насчитывает более ста лет, однако до настоящего времени нет исчерпывающих сведений о факторах патогенности бактерий Francisella tularensis, их молекулярных структурах и механизмах действия (Titball R. W. et al., 2003; Домарадский И. В., 2004; Sjostedt A., 2006). Исследование генома туляремийного микроба является одним из магистральных направлений решения проблем, связанных с разработкой новых и совершенствованием уже имеющихся средств и методов борьбы с туляремией. Проведенные недавно работы по определению нуклеотидных последовательностей геномов аттенуированного вакцинного штамма F. tularensis subsp. holarctica LVS [http://bbrp.llnl.gov/bbrp/html/microbe. html] и природного вирулентного штамма F. tularensis subsp. tularensis Schu4 (Larsson P. et al., 2005) открыли широкие перспективы для изучения факторов патогенности и поиска протективных антигенов туляремийного микроба.

До недавнего времени адаптация общепринятых генетических методов для исследования генома F. tularensis представляла собой достаточно сложную проблему, что существенно препятствовало эффективному применению всего современного методического потенциала микробиологии для решения задач по выявлению факторов патогенности и иммуногенности туляремийного микроба.

Детальное исследование молекулярной структуры криптической плазмиды из бактерий F. novicida like F6168 (Родионова И. В. и др. 1991) позволит получить новые данные о влиянии данной плазмиды на биологические свойства бактерий рода Francisella и получить информацию, необходимую для конструирования плазмидных векторов. Важным этапом в исследованиях геномов микроорганизмов является перенос генетических структур в бактериальные клетки изучаемых микроорганизмов. Отсутствие информации о плазмидах, способных реплицироваться в F. tularensis, до последнего времени сдерживало адаптацию переноса ДНК в клетки туляремийного микроба методами трансформации. Оптимизация методов криотрансформации и конъюгации для F. tularensis позволит переносить в бактерии генетические конструкции для аллельного обмена и создавать модельные штаммы для изучения метаболизма туляремийного микроба.

Показано, что бактерии штамма F. tularensis LVS модулируют белковый синтез во время роста в макрофагах. Среди белков, индуцируемых при размножении бактерий F. tularensis внутри макрофагов, выделяется белок с молекулярной массой 23 кДа (Golovliov I. et al., 1997). Однако, функциональная роль этого белка в патогенезе F. tularensis до последнего времени выяснена не была. Одним из путей решения этой проблемы могло бы стать создание метода аллельного обмена генов в хромосоме F. tularensis, позволяющего конструировать изогенные штаммы, отличающиеся только по изучаемому гену.

Первичным защитным барьером прокариотических и эукариотических клеток являются белки семейства суперокиддисмутаз (СОД), которые превращают токсичный радикал O2– в молекулярный кислород (O2) и перекись водорода (H2O2) (Miller R. A. et al., 1997). У туляремийного микроба также выявлена СОД (Шимоняк Н. И. и др., 1992), тем не менее, роль этого фермента в патогенезе туляремии и в бактериальном метаболизме до последнего времени не была выяснена. Попытки инактивации СОД в других патогенных микроорганизмах приводили к потере жизнеспособности бактерий. Поскольку метод аллельного обмена позволяет не только инактивировать гены, но и модулировать их синтез, этот подход может быть использован для изучения СОД туляремийного микроба.

       Живая туляремийная вакцина на основе штамма F. tularensis 15/10 была создана в СССР в 40-50 годах двадцатого столетия (Олсуфьев Н. Г., 1975). На основе этого же штамма в США был получен штамм F. tularensis LVS и создана экспериментальная живая вакцина (Eigelsbach H. T. et al, 1961).

Поскольку обе вакцины обладают определенной реактогенностью, обусловленной не охарактеризованными пока факторами патогенности (Олсуфьев Н. Г., 1975), то проводимый в настоящее время сравнительный анализ нуклеотидных последовательностей геномов вакцинного штамма LVS и природных штаммов, несомненно, облегчит задачу создания генетически охарактеризованного современного вакцинного штамма без остаточных факторов реактогенности. Очевидно, что без эффективных методов целенаправленного аллельного замещения невозможно достижение существенных успехов в понимании молекулярных основ действия факторов как реактогенности, так и иммуногенности туляремийного микроба.

       В качестве бактериальных векторов для получения рекомбинантных вакцин используют целый ряд микроорганизмов, среди которых: аттенуированные штаммы M. tuberculosis (Ellner J.J., 1998; Senaratne R.H, et al., 2007; Henao-Tamayo M. et al., 2007), близкородственные микобактерии (Abou-Zeid C. et al., 1997),а также сальмонеллы (Mollenkopf H.J. et al., 2001) и некоторые другие (Miki K. et al., 2004). Известно, что туляремийная вакцина, обладая умеренной реактогенностью, вызывает формирование длительного напряженного иммунитета (Tarnvik A.,1989). Кроме специфического иммунитета вакцинные штаммы F. tularensis индуцируют краткосрочную неспецифическую защиту против других внутриклеточных патогенов (Legionella, Listeria и др.) (Belyi Y. F. et al., 1996). До последнего времени изучение иммуномодулирующих свойств штамма F. tularensis 15/10 сдерживалось из-за отсутствия генетических методов по переносу дополнительных генов, кодирующих протективные антигены, в клетки вакцинного штамма туляремийного микроба. Изучение иммунобиологических свойств вакцинного штамма туляремийного микроба с гетерологичными протективными антигенами (в частности, наиболее иммуногенными антигенами M. tuberculosis Ag85В и ESAT-6) позволит оценить потенциал вакцинного туляремийного штамма в качестве  нового бактериального вектора.

       Все вышеизложенное обосновывает актуальность разработки молекулярных инструментов для всестороннего исследования туляремийного микроба. Полученные модифицированные штаммы туляремийного микроба смогут открыть новые перспективы для изучения иммунобиологических свойств туляремийного микроба и получить детальную информацию о факторах патогенности и иммуногенности F. tularensis.

Цель и задачи исследования

Целью данной работы является разработка методологии молекулярно-генетического изучения F. tularensis и оценка с ее помощью роли отдельных генетических структур в иммунопатогенезе туляремийной инфекции.

Для осуществления данной цели были поставлены следующие задачи:

  1. Адаптировать и оптимизировать условия переноса плазмидных ДНК в клетки F. tularensis методами трансформации, конъюгации и мобилизации.
  2. Определить и проанализировать нуклеотидную последовательность криптической плазмиды из бактерий F. novicida like F6168, а также исследовать функциональную активность выявленных плазмидных генов.
  3. Создать ряд плазмидных векторов для клонирования промоторов и экспрессии гетерологичных генов протективных антигенов в F. tularensis и изучить их свойства.
  4. Создать варианты вакцинного штамма F. tularensis 15/10, синтезирующие протективные антигены возбудителя туберкулеза, и изучить иммунобиологические свойства полученных штаммов.
  5. Разработать систему аллельного замещения генов в хромосоме туляремийного микроба и способ получения вариантов вакцинного штамма F. tularensis с модифицированными генами iglC и sodB.
  6. Изучить иммунобиологические свойства полученных вариантов F. tularensis 15/10 и штамма LVS, дефектных по генам iglC и sodB.

Новизна исследования

       Впервые разработана система для аллельного замещения генов в хромосоме F. tularensis. Созданы плазмидные векторы для конструирования плазмид, необходимых для осуществления аллельного обмена в хромосоме F. tularensis. Предложенный метод позволяет: а) удалять определенные участки генома F. tularensis, б) модифицировать регуляторные и другие области оперонов; в) получать генетически маркированные вакцинные штаммы F. tularensis.

Впервые в геноме F. tularensis выявлены две копии гена iglC, кодирующего белок с молекулярной массой 23 кДа, и показана необходимость продукта гена iglC для внутримакрофагального размножения вакцинного штамма F. tularensis. Вариант вакцинного штамма без генов iglC не защищал вакцинированных мышей от гибели при заражении штаммом F. tularensis 503.

Показано снижение экспрессии гена sodB в F. tularensis в результате замены последовательности нуклеотидов инициирующего кодона ATG на GTG в гене sodB. Вакцинный штамм со сниженным уровнем синтеза белка СОД B обладает меньшей вирулентностью для мышей, чем немодифицированный вакцинный штамм.

Впервые показана возможность введения плазмид в вакцинный штамм туляремийного микроба методом криотрансформации. Оптимизированы условия криотрансформации F. tularensis.

Впервые показана возможность мобилизации плазмид из клеток Escherichia coli в клетки F. tularensis и оптимизированы условия межвидового скрещивания. Созданы мобилизуемые плазмидные векторы, позволяющие переносить фрагменты ДНК из E. coli в F. tularensis.

Впервые получен вариант конъюгативной плазмиды pSa, способный с высокой эффективностью переноситься из E. coli в F. tularensis и, наоборот, из F. tularensis в E. coli.

Проведено структурно-функциональное исследование криптической плазмиды из рода Francisella – плазмиды pFNL10. Выявлена способность плазмиды pFNL10 стабильно реплицироваться в клетках вакцинного штамма туляремийного микроба. Показано, что вклад в стабильность наследования плазмиды рFNL10 бактериями F. tularensis вносят продукты плазмидных генов, кодирующих белки, гомологичные белкам Phd-Doc системы фага Р 1.

Впервые созданы стабильные плазмидные векторы для вакцинного штамма F. tularensis, позволившие приступить к изучению возможности использования туляремийного вакцинного штамма в качестве реципиента при создании современных рекомбинантных вакцинных штаммов.

Впервые на основе F. tularensis 15/10 созданы штаммы, синтезирующие протективные антигены возбудителя туберкулеза. Показан повышенный синтез клетками F. tularensis гибридных белков, состоящих из лидерной части предшественника основного белка внешней мембраны F. tularensis Fop A и белкового антигена M. tuberculosis.

Впервые показано формирование специфического иммунного ответа на туберкулезные антигены у мышей, вакцинированных штаммами F. tularensis, синтезирующими протективные антигены возбудителя туберкулеза. Вакцинированные мыши обладали повышенной устойчивостью к аэрозольному заражению возбудителем туберкулеза.

Показана принципиальная возможность использования туляремийного вакцинного штамма в качестве реципиента при создании прототипов рекомбинантных вакцинных штаммов.

Практическая значимость

Разработана простая и надежная методология направленного конструирования неревертирующих мутантов F. tularensis, сочетающая локализованный мутагенез in vitro и гомологичную рекомбинацию in vivo, а также позволяющая получать достоверные данные о роли выбранных генов в проявлении патогенных и иммуногенных свойств возбудителя туляремии.

Оптимизированы способы стабилизации наследования и экспрессии генетической информации в клетках F. tularensis и подобраны векторы, обеспечивающие стабильную продукцию туберкулезных антигенов в клетках вакцинного штамма F. tularensis.

Сконструированы штаммы F. tularensis RVp17 и RVp18, способные к синтезу основных протективных антигенов возбудителя туберкулеза, которые могут служить основой для разработки новой рекомбинантной живой туберкулезной вакцины.

В Государственной коллекции патогенных микроорганизмов и клеточных культур (ГКПМ-Оболенск) депонированы 11 авторских штаммов, необходимые для изучения генетических детерминант факторов иммуногенности и патогенности возбудителя туляремии, а также сайт-направленного мутагенеза туляремийного микроба.

Результаты проведенных исследований послужили основой или были учтены при составлении ниже перечисленных документов: Методические указания МУ 3.3.1.2161-07 «Основные требования к вакцинным штаммам туляремийного микроба» (Федеральный уровень внедрения, 2007 г.), Методические рекомендации «Сайт-направленный мутагенез генома туляремийного микроба» (Учрежденческий уровень внедрения, 2003 г.) и Методические рекомендации «Сайт-направленный мутагенез генома туляремийного микроба» (Учрежденческий уровень внедрения, 2009 г.)

Положения, выносимые на защиту:

  1. Комплекс методических приемов, позволяющих переносить плазмиды в бактерии F. tularensis 15/10 методами криотрансформации и мобилизации. Вариант конъюгативной плазмиды pSa, при скрещивании который способен переходить из клеток E. coli в бактерии F. tularensis15/10 и обратно. Методология переноса плазмид в клетки F. tularensis позволяет создавать генетически маркированные штаммы, необходимые для всестороннего изучения факторов иммуногенности и патогенности туляремийного микроба.
  2. Плазмида рFNL10, выделенная из штамма F. novicida like F6168, способна реплицироваться в F. tularensis и содержит все элементы для репликации по тета-механизму. Наличие в плазмиде рFNL10 генов, кодирующих белки, гомологичные белкам Phd-Doc системы, обуславливает высокую стабильность наследования данной плазмиды бактериями F. tularensis. Плазмида рFNL10 является основой для создания плазмидных векторов для F. tularensis.
  3. Плазмидные векторы для F. tularensis, позволяющие клонировать промоторы и экспрессировать гетерологичные гены протективных антигенов в вакцинном штамме туляремийного микроба. Высокоэффективный способ экспрессии протективных антигенов M. tuberculosis в вакцинном штамме F. tularensis 15/10.
  4. Штаммы F. tularensis,  экспрессирующие микобактериальные антигены Ag85B и ESAT-6, которые индуцируют противотуберкулезный Тклеточный иммунный ответ у вакцинированных мышей и создают специфическую защиту мышей на модели легочной формы туберкулеза.
  5. Способ целенаправленного создания вариантов вакцинного штамма F. tularensis с модифицированными генами и делециями в хромосоме, основанный на методе аллельного обмена.
  6. Ген iglC в хромосоме F. tularensis находится в двух копиях. Направленное "выключение" синтеза 23 кДa белка, кодируемого геном iglC, в штаммах F. tularensis 15/10 и LVS приводит к подавлению способности клеток F. tularensis к внутримакрофагальному размножению.
  7. Продукт гена sodB F. tularensis необходим для жизнеспособности туляремийного микроба. Замена инициирующего кодона ATG на GTG в гене sodB приводит к снижению уровня экспрессии гена sodB в клетках F. tularensis. Штамм F. tularensis  FtsodB , несущий модифицированный ген sodB, обладает сниженной вирулентностью для мышей по сравнению с исходным штаммом F. tularensis LVS.

АПРОБАЦИЯ РАБОТЫ

Материалы диссертации доложены и представлены на 35 международных и 7 российских научных конференциях: Всесоюзной научной конференции «Актуальные проблемы профилактики туляремии» (Симферополь, 1991); XIV научно-практической конференции ГосНИИ ПМ "Новые технологии и биосистемы. Достижения и перспективы" (Оболенск, 1991); Российской научной конференции "Генетика и биохимия вирулентности возбудителей особо опасных инфекций" (Волгоград, 1992); Российской научной конференции "Иммунология и специфическая профилактика особо опасных инфекций" (Саратов, 1993); Международной конференции "Проблемы биологической и экологической безопасности" (Оболенск, 2000); Юбилейной научной конференции, посвященной 75-летию НИИ микробиологии МО РФ (Киров, 2003); 3-м Московском международном конгрессе «Биотехнология: состояние и перспективы развития» (Москва, 2005); VII-й Межгосударственной научно-практической конференции государств-участников СНГ (Оболенск, 2006); Всероссийской научно-практической конференции с международным участием «Вакцинология 2008. Совершенствование иммуно-биологических средств профилактики и лечения инфекционных болезней» (Москва, 2008); First International Conference on Tularemia (Umea, Sweden, 1995); Second International Conference on Tularemia (Hradec Kralove, Czech Republic, 1997); 3rd International Conference on Anthrax (University of Plymouth, UK, 1998); International Conference 'Problems of Medical and Ecological Biotechnology (Obolensk, 1999); 4th International Conference on Tularemia (City of Bath, UK, 2003);  First International Conference on Environmental, Industrial and Applied Microbiology "BioMicroWorld-2005" (Badajoz, Spain, March, 2005); NIAID Research Conference (Opatia, Croatia, 2006); 5th International Conference on Tularemia Marine Biological Labs (Woods Hole, MA, USA, 2006).

Диссертация обсуждена и одобрена на межлабораторной научном семинаре ГНЦ ПМБ 30 июня 2010 г. протокол № 15.

Публикации

По теме диссертации опубликовано 40 научных работ, в том числе 12 статей, представленных в научных журналах, рекомендованных ВАК; один патент и одна заявка на патент.

Структура и объем диссертации.

Работа состоит из введения; обзора литературы; собственных исследований, включающих описание материалов и методов исследований и экспериментальную часть; заключения, выводов и списка литературы. Диссертация изложена на 240 страницах, содержит 23 таблицы и 56 рисунков. Список литературы включает 215 работ.

содержание диссертации

Глава 1. Обзор литературы

В первых разделах главы обобщены данные о возбудителе туляремийной инфекции. Приведена современная классификация бактерий рода Francisella, основанная на анализе нуклеотидных последовательностей туляремийных геномов. Изложены этапы истории создания живой туляремийной вакцины и попытки конструирования эффективных препаратов корпускулярных и химических туляремийных вакцин. Проанализирована литература об особенностях противотуляремийного иммунитета на основании данных, полученных, главным образом, на мышиной модели туляремии. Основная часть обзора посвящена работам по генетическому обмену у F. tularensis. Особое внимание уделено вопросам переноса плазмид и генов в клетки F. tularensis, влияния на этот процесс видовой и подвидовой принадлежности реципиента, а также системы рестрикции-модификации. Другим важным вопросом, освещенным в обзоре, является гомологичная рекомбинация в клетках F. tularensis. Важной частью обзора литературы является раздел о плазмидах, способных реплицироваться и экспрессироваться в туляремийном микробе. Рассмотрены подходы использования таких плазмид в качестве основы для создания молекулярных инструментов изучения F. tularensis.

Заключительная часть обзора посвящена работам по исследованию факторов патогенности и иммуногенности F. tularensis, проведенным в последние годы с использованием молекулярно-генетических методов.

Глава 2. Материалы и методы

В работе были использованы 2 штамма F. tularensis, 20 штаммов E. coli, 3 штамма M. tuberculosis  и штамм M. bovis BCG. Бактериальные штаммы были получены из ГКПМ-Оболенск. Штамм F. tularensis LVS был любезно предоставлен Карен Элкинс (Национальный институт здоровья, США).

Бактерии  E. coli выращивали в L-бульоне или L-агаре (Маниатис Т. С. и др., 1984), при необходимости добавляли антибиотики: ампициллин (Ар), хлорамфеникол (Cm) или тетрациклин (Тс) в концентрациях 50, 10 и 20 мг/л, соответственно.

Клетки F. tularensis  выращивали на плотной питательной среде TA следующего состава: эритрит-агар, 1 % высушенной крови крупного рогатого скота, 1 % глюкозы, 0,05 % цистеина, 0,0025 % тиамина хлорида, рН 7,2, либо на FT-агаре (ФГУН ГНЦ ПМБ, Оболенск), при необходимости в среду добавляли антибиотики: сульфат полимиксина В (Pm) (100 мкг/мл), Сm (3-10 мг/л),

Tc (3-10 мг/л). При выращивании бактерий F. tularensis в жидкой питательной среде использовали питательную среду ТВ (Лапин А. А. и др., 2010) или питательную среду Чемберлена (Chamberlain Medium) (Chamberlain R.E., 1965).

Штамм M. tuberculosis H37Rv культивировали на жидкой питательной среде Middlebrook 7H9 или на твердой агаризованной среде Middlebrook 7H11 (Himedia Laboratories Pvt.Limited, Индия). Штаммы M. bovis BCG и M. tuberculosis Н37Ra культивировали на глицерин-альбуминовой среде (конечная концентрация БСА – 0,1 %) без добавления Tween-20 при температуре 37 C в течение 20 сут в атмосфере 0,5 % СО2 .

В работе использовали беспородных белых мышей массой (19 ± 2) г, мышей линии Balb/C, кроликов породы шиншилла из вивария ГНЦ ПМБ. В ряде экспериментов использовали мышей линии C57BL/6 (возраст 8–16 недель), свободных от патогенов (specific pathogen free – SPF), полученных из питомника лабораторных животных "Пущино" ( г. Пущино, Московская область).

После заражения наблюдение за мышами проводили в течение 21 сут. Величину ЛД50 определяли по методу Кербера (Ашмарин И.П., Воробьев А.А., 1962). Мышей эвтаназировали ингаляцией СО2 .

Диссеминацию штаммов F. tularensis в органах мышей (по 12 мышей линии С57BL/6 в группе, возраст 6-8 недель) определяли после подкожного введения 20 КОЕ/мышь. На 3, 5, 7 и 10 сут из каждой группы по 3 мыши была проведена некропсия печени и селезенки.

Мышей заражали бактериальной суспензией M. tuberculosis (1 · 106 КОЕ/мл в ЗФР c добавлением 0,05 % Tween-80) с использованием ингaляционной установки Glas-Col Inhalation Exposure System 099C (Terre Нaute, США, модель 4224). Органы мышей гомогенизировали в размельчителе тканей Seward stomacher 80 (Tekmar, США).

Все манипуляции с ДНК (выделение плазмидной ДНК из E. coli, рестрикция, дефосфорилирование, лигирование, электрофорез в агарозном геле, ДНК-ДНК гибридизация и трансформация плазмид в E. coli и др.) проводили согласно руководству (Маниатис Т. С. и др., 1984) и рекомендациям изготовителя (Fermentas, Латвия). Для определения размеров фрагментов в агарозном геле использовали маркеры молекулярных весов ДНК (Gibco-BRL, Grand Island, NY,и MBI Fermentas). Нуклеотидные последовательности определяли по методу Сэнджера (Sanger F. et al., 1977) на ABI373 ДНК-секвенаторе (Perkin-Elmer, Urayasu, Япония) и на секвенаторе ALF express II (Amersham Pharmacia Biotech, США).

Биоинформатический анализ последовательностей ДНК проводили с помощью программ FASTA и BLAST и баз данных GenBank и SWISSProt.

Плазмидную ДНК из штаммов рода Francisella выделяли щелочным методом (Маниатис Т. С.и др., 1984, Pavlov et al., 1994), в случае необходимости препараты ДНК очищали с помощью центрифугирования в градиенте хлористого цезия (CsCl) в присутствии бромистого этидия (EtBr) (Маниатис Т. С и др., 1984). Определение положения первых нуклеотидов матричных РНК проводили по (Pomerantsev A P. et al.,2001). Перенос плазмидных ДНК в F. tularensis проводили методом электростимуляции на электропораторе Gene Pulser II Electroporation System, (Bio–Rad, Hercules, CA,США (Baron G. S., et al., 1995) и криотрансформации (Мокриевич А. Н.и др., 1994). Скрещивание бактерий E. coli и F. tularensis проводили на плотной питательной среде.

ПЦР проводили с использованием термоциклера Gene Amp PCR System 2700 (Applied Biosystems,США).

Плазмиды:

pHV33mob - создана в результате встраивания BamHI-фрагмента ДНК плазмиды pDM4(25) (1,7 т.п.н.) с mob областью плазмиды RP4 в Bam HI сайт плазмиды pHV33. Селективный маркер – Ap;

pPV - получена в результате объединения фрагментов: BamHI фрагмента с oriT из плазмиды pDM4 (1,6 т.п.н.), PstI фрагмента плазмиды pDM4 с геном sacB Bacillus subtilis (2,6 т.п.н.) и HindIII-фрагмента плазмиды pSa с геном cat в плазмиде pUC19;

pVP5 - создана в результате встраивания BamHI-SnaI фрагмента ДНК плазмиды pML2.1 (Машко С. В. и др., 1985) с геном cat в BamH1-Sma1сайты плазмиды pUC18;

вектор рРМС1 был получен в результате объединения четырех фрагментов ДНК: RepA-SphI–NheI (2361 п.н.), cat-NheI–XhoI (1013 п.н.), groES-XhoI–SacI (367 п.н.) и RepB-SphI–SacI (552 п.н.). Селективный маркер –Cm.

Ампликон cat-NheI – XhoI, фланкированный сайтами NheI и XhoI, был получен с использованием пары праймеров Cm-NheI/Cm-XhoI и плазмидной ДНК pC194 в качестве матрицы. Ампликон groES-XhoI–SacI, фланкированный сайтами XhoI и SacI, был получен с использованием пары праймеров groES-Xho/groES-Sac и ДНК F. tularensis15/10 в качестве матрицы.

Фрагмент RepB-SphI–SacI плазмиды pUC57-RepB был вырезан из плазмиды pUC57-RepB рестриктазами SphI и SacI. Плазмида pUC57-RepB была получена в результате встраивания ампликона RepB-PstI–SphI (537 п.н.) между сайтами PstI и SphI плазмиды pUC57. Ампликон RepB-PstI–SphI (537 п.н.) был синтезирован с помощью пары праймеров RepB-Pst/RepB-Sph и плазмидной ДНК pFNL10 в качестве матрицы.

Препарат ДНК, несущей последовательность гена Sod A, получен методом ПЦР с использованием ДНК штамма M. tuberculosis H37Rv в качестве матрицы и пары специфических праймеров: 5’GAATGGATCCAGCCGAATACACCTTGCCAGAC3’ и 5’GCGGGAATTCCCGAATATCAACCCCTTGGT3’. Амплифицированный фрагмент ДНК был встроен между BamHI и EcoRI сайтами в плазмиду pET23b(+)(Novagen, USA). Штамм E. coli BL21 (pET23b(+)SodА) был использован для синтеза и последующего выделения рекомбинантного белка SOD А согласно инструкции производителя плазмиды pET23b(+) (Novagen, США).

Препарат ДНК, несущей последовательность модифицированного гена fbpB, кодирующего зрелый белок Ag85В получен методом ПЦР с использованием ДНК штамма M. tuberculosis H37Rv в качестве матрицы и пары праймеров 5’GATCATATGTTCTCCCGTCCGGGTCTG3’ и 5’GGTGGATCCTGACAGCCT GCGCC3’. Ампликон встроен между сайтами NdeI и BamHI в плазмиду pET23b(+)(Novagen, USA). Штамм E. coli BL21(pET23-85B) был использован для синтеза и последующего выделения рекомбинантного белка Ag85В-(His)6, согласно инструкции производителя плазмиды pET23b(+) (Novagen, США).

Препарат ДНК, несущей последовательность модифицированного гена esat-6, кодирующего белок ESAT-6, получен методом ПЦР с использованием ДНК штамма M. tuberculosis H37Rv в качестве матрицы и пары праймеров: 5’GGACATATGACAGACCAGCAGTGGAAT3’ и 5’TTTCTCGAGTCCGAA CATCCCAGTCAC3’. Ампликон встроен между сайтами NdeI и XhoI в плазмиду pET24b(+) (Novagen, USA). Штамм E. coli BL21(pET24-ES) использован для синтеза и последующего выделения рекомбинантного белка ESAT-6-(His)6 согласно инструкции производителя плазмиды pET24b(+) (Novagen, США). Очистку рекомбинантных белков проводили аффинной хроматографией на Ni2+NTAHisBind® Superflow™(Pharmacia Biotech, Швеция) по модифицированному протоколу, прилагаемому фирмой-производителем.

Антисыворотку к рекомбинантному белку SOD А получали с помощью подкожной иммунизации кроликов. Антисыворотки к рекомбинантным белкам Ag85B-(His)6 и ESAT6-(His)6 получали подкожной иммунизацией беспородных белых мышей. Иммунные сыворотки собрали через 7 дней после второй иммунизации. Титры специфических антител в сыворотках животных определяли с помощью твердофазного ИФА

При определении уровня синтеза IFN-γ спленоцитами мышей в качестве антиген-презентирующих клеток (АПК) использовали костно-мозговые макрофаги (КММ) мышей линии С57ВL6 категории SPF, которые получали по методу (Bosio C.M. et al., 2001). Концентрацию IFN- в клеточных супернатантах проводили с помощью набора Interferon gamma [(mINFγ], Mouse ELISA BiotrakTM System по методу фирмы-производителя (Amersham Biosciences, Великобритания).

Внутриклеточную выживаемость и способность к внутриклеточному размножению исходных и рекомбинантных штаммов F. tularensis определяли с использованием макрофагоподобной клеточной линии мышиных моноцитов J774A.1, полученных из Российской коллекции культур клеток позвоночных  Института цитологии РАН (РККК ИЦ РАН, С.-Петербург, Россия).

Оценку пролиферативной активности лимфоцитов проводили в реакции бласттрансформации лимфоцитов по методу (Mishell B. B. et al., 1980). Определение фагоцитарной активности перитонеальных макрофагов проводили по общепринятой методике (Учитель И. Я., 1978.)

Оценку протективности штаммов F. tularensis проводили с помощью иммунизации подкожно мышей линии С57BL/6 категории SPF (20 КОЕ/мышь). Двум контрольным группам вводили подкожно ЗФР и клетки M. bovis BCG в дозе 106 КОЕ/мышь, соответственно. На 28 сут после иммунизации проводили аэрозольное заражение животных Через 28 сут после экспозиции животных эвтаназировали ингаляцией СО2. Учет результатов высевов из легких и селезенок проводили на 21 сут.

Электрофорез в 12,5 % ПААГ с/без добавлением ДДС-Na проводили в буферной системе Леммли. Белковые зоны либо окрашивали Кумасси R 250 или без окрашивания использовали для оценки ферментативной активности или постановки иммуноблота.

Оценку ферментативной активности белка СОД А проводили по методу (Beauchamp C. et al., 1971). Определение количества белка проводили по Лоури с использованием бычьего сывороточного альбумина в качестве стандарта. Определение устойчивости к параквату проводили на чашках с плотной питательной средой, инкубируемых при 37 C в течение 48-72 ч, по величине зоны подавления роста.

Иммуноблотингом проводили по методу (Towbin H. et al.,1979). Титры антител к антигенам в антисыворотках определяли методом твердофазного ИФА по общепринятой схеме.

Достоверность отличий численных значений результатов экспериментов определяли по t-критерию Стьюдента (P<0,05) с помощью статиcтических программ, встроенных в программу Windows Excel .

Глава 3 . Криотрансформация, мобилизация и конъюгация плазмид в клетки вакцинного штамма F. tularensis 15/10

Криотрансформация туляремийного микроба. Для оптимизации условий передачи плазмид в клетки F. tularensis 15/10 методом криотрансформации выбрана плазмида pC194, способная реплицироваться в клетках F. tularensis и экспрессировать ген cat (Померанцев А. П. и др., 1991). Выявлено, что особенностью переноса плазмид в клетки F. tularensis при замораживании-оттаивании является необходимость присутствия в буфере для криотрансформации ионов магния. Показано, что оптимальным значением рН среды для трансформации является 7,5, оптимальное время инкубации перед замораживанием составляет 10 мин при температуре 22 С. Показано, что для замораживания смеси клеток F. tularensis и ДНК может быть  использован как сухой лёд-этанол, так и жидкий азот, но последний дает наилучший результат по выходу трансформантов. Метод применим также и для других штаммов туляремийного микроба.

Плазмидную ДНК pC194 переносили в клетки F. tularensis 15/10 не только в изолированном виде, но и в составе рекомбинантных плазмид, например, бирепликонной плазмиды pHV33. Плазмидные ДНК pHV33, выделенные из клеток E. сoli HB101(pHV33) и F. tularensis 15 (pHV33), трансформировали клетки F. tularensis 15/10 практически с одинаковой эффективностью, что свидетельствовало об отсутствии системы рестрикции, по крайней мере, в штамме F. tularensis 15/10.

Показано, что в клетках F. tularensis обнаруживается только один фенотипический признак плазмиды pHV33– устойчивость к Cm из трех признаков проявляемых данной плазмидой в клетках  E. coli – устойчивость к Cm, Ap и Tc. Однако, при селекции на среде с Tc (10 мг/л) были отобраны клоны, в которых плазмида pHVT33 отличалась от исходной плазмиды наличием делеции размером 1,5 т.п.н. Таким образом, подтвержден факт возможности внутримолекулярных перестроек в плазмиде pHV33 в бактериях F. tularensis.

Мобилизация плазмид из клеток E. coli в клетки F. tularensis. С целью выяснения возможности мобилизации плазмид из клеток E. coli в клетки F. tularensis и последующей оптимизации условий эффективного переноса плазмид между данными микроорганизмами создана плазмида pHV33mob, несущая mob область плазмиды RP4. Примечательно, что при селекции трансформантов на среде с Cm получены клоны, содержащие делеционный вариант плазмиды pHVmob, лишенный участка плазмиды pC194, прилегающего к области начала репликации. Показано, что полученный делеционный вариант pHV’mob содержал гибридный ген cat под промотором гена rep плазмиды pC194.

Функциональная активность области mob в плазмидах pHV mob и pHV’mob была оценена при скрещивании между клетками штаммов E. сoli S17(pHV mob) и E. сoli JM83 (pBR322), а также между клетками штаммов E. coli S17(pHV’ mob) и E. сoli JM83 (pBR322). В результате были получены клоны, способные расти на средах с Cm и Tc. Частота появления таких клонов составила 10-1 на донорную клетку при скрещивании в течение 3 ч. При скрещивании клеток E. сoli S17(pHV mob) (~1  108 КОЕ) и F. tularensis 15/10 (~ 1  109 КОЕ) на L-агаре в течение 20 ч при температуре 37 С, с последующей селекцией на агаровой среде ТА (100 мг/л Pm и 3 мг/л Cm) получены клоны (~104), содержащие плазмиду, совпадающую по размерам с плазмидой pHV33 mob. Результаты данного эксперимента позволили сделать вывод о возможности мобилизации плазмид из клеток E. coli в клетки F. tularensis и о способности «молекулярной машины» E. coli S17, кодируемой генами tra (из плазмиды RP4), переносить плазмиды из клеток E. coli в клетки F. tularensis.

Клоны туляремийного микроба, полученные в результате мобилизации плазмиды pHV’mob, росли медленнее, чем клоны, несущие плазмиду pHVmob. Особенностью медленнорастущих клонов заключалась в том, что электрофоретически плазмидная ДНК в бактериях не выявлялась. Трансформирующая активность плазмиды pHV’mob клеток F. tularensis методами электропорации и криотрансформации не отличалась от таковой плазмиды pHVmob, при этом отмечалось также формирование на селективной среде медленнорастущих колоний. Экспериментально подтверждена низкая копийность плазмиды pHV’mob в клетках F. tularensis.

Изучение влияния условий скрещивания (состава среды, температура и время скрещивания, а также концентрация клеток донора и реципиента) позволило выбрать оптимальные параметры, обеспечивающие эффективный перенос плазмиды pHV33mob в клетки F. tularensis 15/10.

С использованием выбранных условий мобилизации проведено конъюгационное скрещивание между клетками E. coli C600(pSa) и F. tularensis 15/10. Частота появления туляремийных клонов, устойчивых к Cm, составила ~ 1.10-7 на бактерию реципиента. Плазмидный анализ клонов показал наличие в бактериальных клетках высокомолекулярных плазмидных ДНК (рис.1).

  1  2  3 4 5 6  7 8  9 10  11 12 13 14 15 16 17

Рисунок 1. – Плазмидные профили клонов F. tularensis, полученных в результате скрещивания.

1,17 – маркеры молекулярных весов ДНК HindIII, 2-16 – плазмидные ДНК.

Электрофоретическая подвижность плазмидных ДНК, выделенных из разных клонов, различалась, что может быть объяснено либо различиями в размерах плазмид, либо разным количеством супервитков в ковалентно-замкнутых кольцевых плазмидах, что, очевидно, связано с нестабильностью самой плазмиды (pSa) (Ireland C. R., 1983). Для выяснения наличия изменений в составе плазмиды pSa изучали плазмиду pSa, выделенную из отдельного клона F. tularensis 15 (pSa). Показано, что плазмида pSa способна к обратному конъюгационному переносу из клеток F. tularensis 15(pSa) в клетки E. сoli C600 с частотой ~ 1.10-4 на бактерию реципиента. Конъюгационный перенос плазмиды pSa из клеток E. сoli C600 (pSa) в клетки F. tularensis 15/10 происходил с частотой 5  10-4 на реципиентную клетку, что на три порядка выше, чем частота конъюгационного переноса плазмиды pSa из клеток E. сoli  C600 (pSa) в клетки F. tularensis 15/10. Электрофореграмма (рис. 2) демонстрирует гетерогенность препаратов плазмидных ДНК из E. coli C600(pSa), что отражает нестабильность плазмиды pSa в клетках E. сoli C600.

При изучении возможности внутривидового коньюгационного переноса  плазмиды pSa в результате скрещивания клеток F. tularensis 15(pSa) и F. tularensis 15(pKK202) получены единичные биплазмидные клоны с частотой ~ 4.10-10, что существенно меньше частоты появления коньюгационных клонов при скрещивании клеток F. tularensis 15(pSa) и E. сoli C600.

Различия в эффективности конъюгации могут быть объяснены наличием капсул как у донорных клеток, так и у реципиентных, что, вероятно, затрудняет процесс межклеточного переноса плазмидной ДНК. Полученные данные указывают на возможность конъюгационного переноса плазмиды pSa между штаммами F. tularensis, хотя и с очень низкой частотой.

  1 2  3  4 5  6  7 8  9 10

Рисунок 2. – Электрофореграмма препаратов ДНК, выделенных из клонов E. сoli C600(pSa).

1-8,10 – ДНК трансконъюгантов E. сoli C600(pSa), 9 – маркеры молекулярных весов ДНК HindIII.

Возрастание частоты переноса плазмиды pSa в клетки F. tularensis по сравнению с исходной плазмидой pSa позволяет заключить, что плазмида pSa отличается от плазмиды pSa в области, ответственной за репликацию плазмиды. Показано, что трансформация клеток F. tularensis 15/10 возможна только при использовании ДНК плазмиды pSa, но не плазмиды pSa.

Таким образом, результаты межвидового скрещивания показали, что плазмида pSa имеет нестабильную структуру. Кроме того, показано, что при коньгационном переносе плазмиды pSa в клетки туляремийного микроба возникает вариант плазмиды pSa, способный реплицироваться как в клетках E. coli, так и в клетках F. tularensis. Установлено, что плазмида pSa способна переходить из клеток E. coli в клетки F. tularensis без дополнительных (плунжерных) плазмид (Померанцев А. П. и др., 1991). Анализ приведенных выше данных позволяет заключиь, что сконструированные нами плазмиды pHVТ33, pHV’mob и pSa могут быть использованы в качестве векторов (pHVТ33) или в качестве основы для создания плазмидных векторов (pGM5 и др.) для изучения генома туляремийного микроба.

Следует отметить, в порядке обсуждения, что описанный нами факт эффективного межвидового переноса плазмид из клеток E. coli в клетки F. tularensis, осуществляемый на простых питательных средах при температуре окружающей среды, позволяет предполагать возможность таких процессов в природных условиях и говорить об их вкладе в дальнейшую эволюцию вида F. tularensis.

Глава 4. Структурно-функциональная организация криптической плазмиды pFNL10.

При поиске плазмид, способных к репликации в клетках F. tularensis, было обнаружено, что такими свойствами обладает криптическая плазмида pFNL10, выделенная из штамма F. novicida like F6168 (Родионова И. В. и др., 1991). Изучене структурно-функциональной организации данной показало, что плазмида pFNL10 состоит из 3990 п. н., а содержание А+Т-пар в ДНК плазмиды равно 68 %. Данные о нуклеотидной последовательности pFNL10 размещены в базе данных GenBank под номером AF121418.

По данным анализа нуклеотидной последовательности, в плазмиде pFNL10 находится 6 протяженных открытых рамок трансляции (ОРТ), занимающих около 75 % последовательности ДНК (рис. 3).

Две ОРТ (ОРТ1 и ОРТ2) расположены на “– “-цепи плазмиды, остальные – на “+”-цепи. Участок ДНК размером 250 п. н. со свойствами домена начала репликации локализован между ОРТ1 и ОРТ5. В этом районе находятся три копии повтора, состоящего из 23 нуклеотидов: gatacaaaaagtagttttaaatt, разделенные двумя повторами, состоящими из 8 нуклеотидов: caaaaagt и двумя перекрывающимися повторами, состоящими из 17 нуклеотидов aatatataaagagaata. Наличие подобных прямых повторов характерно для доменов начала репликации плазмид, реплицирующихся по механизму тета-типа (del Solar G. et al., 1998).

Показано, что в ОРТ1 закодирована аминокислотная последовательность, состоящая из 339 аминокислотных остатков (а.о.), подобная аминокислотной последовательности белков инициации репликации RepA плазмид, реплицирующихся по тета-механизму. Стартовый нуклеотид аденин матричной РНК, синтезируемой с промотора перед ОРТ1, находится в положении 1647 нуклеотида “–“-цепи pFNL10.

Рисунок 3 – Структурно-функциональная организация плазмиды pFNL10.

Терминатор транскрипции обозначен треугольником; область начала репликации выделена заштрихованным прямоугольником. Участки гидролиза для рестриктаз обозначены: B-BamHI; Bg-BglII; C-ClaI; E-EcoRV; H-HindIII; S-SalI; X-XbaI.

Для ОРТ2 стартовый нуклеотид матричной РНК вблизи начала ОРТ не был обнаружен, что позволило предположить, что ОРТ1 и 2 входят в один  оперон. В ОРТ2 кодирована аминокислотная последовательность из 140 а. о., подобная последовательности белка АТФ-зависимой РНК-хеликазы из Sulfolobus solfataricus (GenBank № AE006810). Оперон, включающий ОРТ1 - ОРТ2, кодирует белки, отвечающие за репликацию, копийность и обеспечение мономерности плазмиды.

Стартовый нуклеотид тимин матричной РНК, синтезируемой с промотора, локализованного перед ОРТ3, находится в положении 3060 нуклеотида “–“-цепи плазмиды. В ОРТ3 кодирована аминокислотная последовательность, состоящая из 298 а. о., подобная аминокислотной последовательности белка интегразы Salmonella enterica и рекомбиназы плазмиды pAO1 из Bacillus pallidus.

Стартовый нуклеотид аденин матричной РНК, синтезируемой с промотора перед ОРТ 5, находится в положении 1968 нуклеотида “+”цепи плазмиды. ОРТ4, вероятно, не имеет собственного промотора и образует единый оперон с ОРТ5, так как последний нуклеотид терминирующего кодона ОРТ5 является первым нуклеотидом второго кодона ОРТ4: ОРТ5-5’аtt gaa gaa tgatact 3'-ОРТ4. ОРТ5 кодирует пептид размером 86 а. о., который подобен в функционально-активной области Phd-белку фага Р1 (Lehnherr H. et al., 1993). ОРТ4 кодирует пептид размером 68 а. о. Этот пептид подобен белкам E. coli., Sr. coelicolor, M. tuberculosis и S. aureus (по данным базы данных NCBI), кодируемых генами Phd-Doc системы этих микроорганизмов, но существенно отличается от белка Doc фага Р1.

BglII-EcoRV фрагмент ДНК плазмиды pFNL10, несущий оперон ОРТ5-ОРТ4, при встраивании в плазмиду pHV33 существенно снижает вероятность утраты плазмиды клетками штамма F. tularensis15/10 (pHV33-phd–doc). При выращивании в жидкой питательной среде без антибиотиков за 10 генераций 99 % бактериальных клеток сохраняли устойчивость к Cm, тогда как популяция штамма F. tularensis 15/10 (pHV33) содержала только 60 % клеток, устойчивых к Cm.

ОРТм кодирует пептид размером 56 а. о. Гомология аминокислотной последовательности этого белка с другими белками не найдена.

Структура, находящаяся за ОРТ2, подобна прокариотическим терминаторам. Данная последовательность нуклеотидов содержит инвертированный повтор:

  1 acatagtaga tcgactcttc ttagggattt tatatttttt gataaatcat ctattttgct

  61 agttaaatca tcaaatttat catcttgttg tttgactaaa tctaagaatc tattctcttt

121 tttaaaatcg ttcatgcaaa ccgcctatag ctttcttctt tttctgaaat tatttgtctt

181 cacaccataa ttaaattccc atttttataa gtaaagtctt ttaaaagctt gtcagtctct

Функциональная активность этого терминатора в F. tularensis была подтверждена экспериментально.

Таким образом, проведенные нами исследования криптической плазмиды pFNL10 позволили выявить генетические структуры, необходимые для репликации в клетках туляремийного микроба по тета-механизму. Поскольку данная плазмида содержит оперон, кодирующий Phd–Doc-подобную систему, необходимую для ее стабильное наследование в F. tularensis, то, очевидно, что плазмида pFNL10 может послужить основой для создания стабильных плазмидных векторов для изучения иммуно-биологических свойств F. tularensis.

Глава 5. Экспрессия генов гетерологичных протективных антигенов в клетках вакцинного штамма F. tularensis 15/10.

Возможность экспрессии гетерологичных протективных антигенов в клетках штамма F. tularensis 15/10 изучена на примере экспрессии F1-антигена чумного микроба. Рекомбинантная плазмида pCF10, несущая гены оперона fra Y. pestis создана на основе плазмидного вектора pHVT33. Фрагмент ДНК, содержащий гены оперона fra встроен в сайт Sal I плазмиды pHVT33. Полученная плазмида pCF10 (8,8 т. п. н.) введена в клетки F. tularensis15/10 методом криотрансформации. Среди Tc-чувствительных клонов F. tularensis были обнаружены клоны, которые, по данным РПГА с анти-F1 моноклональными антителами, синтезировали F1-антиген. Таким образом, показана возможность получения вакцинного штамма F. tularensis 15/10 с синтезирующего F1-антиген чумного микроба, а также продемонстрированы векторные свойства плазмиды pHVT33.

Показана также возможность использования бациллярной плазмиды pTV24 в качестве плазмидного вектора для клонирования фрагментов ДНК, несущих гены протективных антигенов возбудителя сибирской язвы, в клетках F. tularensis. Рекомбинантная плазмида pTVpag получена в результате встраивания фрагмента ДНК, несущего ген pag плазмиды pXO1 Bacillus. anthracis в сайт Bam HI плазмиды pTV24. При трансформации F. tularensis 15/10 плазмидной ДНК pTVpag был получен штамм F. tularensis 15/10 (pTVpag), синтезирующий протективный антиген B. anthracis.

Интересно отметить, что штаммы F. tularensis 15/10, несущие векторные плазмиды pHVT33 и pTV24 , а также с рекомбинантные плазмиды, полученные на их основе, часто утрачивали плазмиды при культивировании на жидких питательных средах и  при пассировании в организме экспериментальных животных. Эта особенность затрудняла изучение иммунобиологических свойств туляремийного вакцинного штамма, несущего дополнительные протективные антигены других бактерий. В дальнейшем данная трудность была преодолена в результате создания плазмидного вектора pPMC1, стабильно наследуемого бактериями штамма F. tularensis 15/10, на основе плазмиды pFNL 10. Плазмида рРМС1 (4259 н. п.) несет ген cat из плазмиды pC194, а также промотор и участок инициации трансляции оперона groES F. tularensis ( рис. 4).

Рисунок 4 – Генетическая карта плазмиды pPMC1.

Потенциальные возможности плазмиды pPMC1 в качестве плазмидного вектора были проверены на примере клонирования модифицированного гена sodA M. tuberculosis в клетках F. tularensis 15/10. Для повышения уровня экспрессии гетерологичного белка проведена замена в гене sodA редких для генома F. tularensis кодонов. В результате сконструированы три плазмиды, кодирующие три различных варианта гена sodA: плазмида pSFC21с неизмененным геном, плазмида pSFC22 с заменой редких кодонов в части гена, кодирующей C-концевую область белка, и плазмида pFSС24 с заменой редких кодонов по всей протяженности гена (рис. 5). Показано, что замены редких кодонов практически не повлияли на уровень экспрессии полученных вариантов гена sodА в клетках вакцинного туляремийного штамма (рис.6).Присоединение к структурной части гена sodA нуклеотидной последовательности, кодирующей лидерный пептид белка внешней мембраны F. tularensis FopA(плазмида pFS51) привело к существенному повышению экспрессии рекомбинантного гена sodA в туляремийном микробе (рис 6).

Рисунок 5 –Генетическая карта плазмиды pFSC24.

1  2 3  4 5  6 7  8

Рисунок 6. – Иммуноблот рекомбинантного белка СОД с кроличьей антисывороткой.

1 – лизат клеток F. tularensis 15/10, 2 –лизат клеток F. tularensis 15/10(pSFC21); 3 – клеточный лизат F. tularensis 15/10 (pSFC22); 4-6 – клеточный лизат F. tularensis 15/10 (pSFC24); 7 – клеточный лизат F. tularensis 15/10 (pSFC51); 8 – рекомбинантный белок СОД.

На основе pPMC 1 созданы также плазмиды, кодирующие синтез рекомбинантных белков, состоящих из лидерного пептида белка внешней мембраны F. tularensis FopA и антигена 85B M. tuberculosis (плазмида pPMC-FL–85B) и лидерного пептида белка внешней мембраны F. tularensis FopA и белкаESAT-6 M. tuberculosis (плазмида pPMC-FL–85B–ESAT-6).

В результате переноса названных выше плазмид в клетки вакцинного штамма F. tularensis 15/10 получено два штамма F. tularensis  RVp17 и RVp18, синтезирующих протективные антигены 85B M. tuberculosis и гибридный белок, состоящий из антигенов 85B и ESAT-6 M. tuberculosis, соответственно. Плазмиды pPMC-FL–85B и pPMC-FL–85B–ESAT-6 использованы также для получения штаммов F. tularensis LVS (F. tularensis LVS17 и LVS18, соответственно), синтезирующих протективные антигены M. tuberculosis. Показано, что штаммы F. tularensis RVp17 и RVp18, а также F. tularensis LVS17 и LVS18, стабильно наследуют рекомбинантные плазмиды и сохраняют уровень экспрессии клонированных микобактериальных белков при пассировании через организм экспериментальных животных.

Бактерии штамма F. tularensis RVp17 синтезировали две формы белка, содержащие антигенные детерминанты Ag85B, но отличавшиеся по размерам: белок с молекулярной массой ~33 кДа, подобный белку FL–Ag85B, и белок с молекулярной массой ~30,6 кДа, подобный микобактериальному белку Ag85B (рис.7, А). В бактериальных клетках F. tularensis RVp17 большая часть синтезируемого белка FL–Ag85B переходила в белок, подобный зрелому микобактериальному белку Ag85B.

Бактерии штамма F. tularensis RVp18 синтезировали белок, содержащий антигенные детерминанты Ag85B и ESAT-6. (рис.7, Б). Данный белок имел молекулярную массу 40±3 кДа, соответствующую молекулярной массе рекомбинантного белка FL–85B–ESAT-6 (405 а.о.). Белок FL–Ag85В–ESAT-6 находился в клетках, по-видимому, в непроцессированной форме.

Рисунок 7. – Иммуноблоттинг лизатов штаммов F. tularensis RVp17 и RVp18 с антисывороткой к белку Ag85В-(His)6.

А: 1– концентрированная культуральная среда M. bovis BCG; 2 – штамм F. tularensis RVp17, белок Ag85В-(His)6; Б:1 – штамм  F. tularensis RVp18; 2 – штамм F. tularensis 15/10(pPMC1); 3 – белок Ag85В-(His)6.

1  2 3  А

1  2 3 Б

Таким образом, проведенные исследования показали возможность экспрессии генов гетерологичных протективных антигенов Y. pestis, B. anthracis и M. tuberculosis в клетках вакцинного штамма F. tularensis. Показано, что использование сконструированного нами плазмидного вектора рРМС1 позволяет получать стабильные вакцинные штаммы, синтезирующие протективные антигены, которые будут далее изучены в аспекте использования  вакцинного штамма F. tularensis в качестве бактериального вектора для создания рекомбинантных вакцин.

Глава 6. Аллельное замещение в хромосоме туляремийного микроба

Конструирование плазмидного вектора для аллельного обмена генов в хромосоме F. tularensis. В качестве репликона векторной плазмиды для аллельного обмена в хромосоме F. tularensis выбрана плазмида pUC19, не способная реплицироваться в клетках туляремийном микроба. Ген cat плазмиды pSa встроен в плазмиду pUC19 в качестве селективного маркера, так как наличие одной копии этого гена в хромосоме F. tularensis позволяет бактериям расти на плотных средах, содержащих Cm в концентрации до 5 мг/л, тогда как для штамма F. tularensis 15/10 минимальная ингибирующая концентрация (МИК) Cm составляет менее 1 мг/л. В качестве селективного маркера для отбора бактерий, утративших плазмидный вектор, выбран ген sacB, подавляющий рост бактерий , несущих этот ген. Для проверки функциональной активности гена sacB Pst I фрагмент плазмиды pDM4 (2,8 т.п.н.), несущий ген sacB встроен в сайт Pst I плазмиды pHV33. В результате получена плазмида pHV-sacB в штамме F. tularensis 15/10 (pHV-sacB). Показано, что бактерии штамма F. tularensis 15/10 (pHV-sacB) не способны к росту на среде с 5 %-ой сахарозой, что указывает на экспрессию гена sacB в клетках туляремийного микроба. Для повышения эффективности переноса рекомбинантных плазмид в клетки туляремийного микроба в создаваемый плазмидный вектор для аллельного обмена была встроена mob-область плазмиды RP4. Данная структура позволяла мобилизовать плазмидный вектор из клеток E. coli S17 в клетки F. tularensis 15/10. В результате получен плазмидный вектор pPV для осуществления аллельного обмена в хромосоме F .tularensis, имеющий два сайта для встраивания целевых

фрагментов ДНК – SalI и XbaI (рис. 8).

Рисунок 8 – Генетическая карта плазмиды pPV , используемой для аллельного обмена в хромосоме F. tularensis

Создание плазмиды для удаления гена iglC из хромосомы F. tularensis. Для получения штамма F. tularensis , лишенного гена iglC методом аллельного обмена, создана плазмида, несущая модифицированный фрагмент ДНК из области гена iglC. Для синтеза данного фрагмента ДНК без гена iglC использованы следующие праймеры:

23SalL15

5’ACGCGTCGACTACAATGCTAGAAACCTT3’

23Bam

5’TCGGGATCCTATACATGCAGTAGGA3’

23Pst

5’AAACTGCAGCTGCATAGTAAGATCGGA3’

23SalR15

5’GCGTGTCGACTTAGCCGTGCCAATTACCA3’

В результате встраивания полученного фрагмента ДНК в сайт SalI плазмиды pPV была получена плазмида pPV23. В качестве реципиентного штамма для отбора трансформантов, несущих плазмиду pPV23, использовали штамм E. сoli DH5; затем плазмиду pPV23 переносили в штамм E. сoli S17.

Конструирование штаммов F. tularensis, несущих делецию по гену iglC. Для удаления гена iglC из хромосомы вакцинного штамма F. tularensis 15/10 плазмида pPV23 в результате скрещивания была перенесена мобилизацией из штамма E. сoli S17(pPV23) в штамм F. tularensis 15/10. Полученные в результате такого скрещивания резистентные к Cm клоны F. tularensis не содержали плазмид, т.е. генетическая конструкция, несущая ген cat, была интегрирована в хромосому туляремийного микроба. ПЦР анализ ДНК, выделенной из клеток клонов показал, что в половине проанализированных трансконъюгантов рекомбинация между плазмидой pPV23 и хромосомой туляремийного микроба прошла по левому плечу, в другой половине – по правому плечу.

Спонтанная элиминация векторной части интегрированной структуры в результате повторной рекомбинации позволила получить на селективной среде, содержащей 5% сахарозу Cm-чувствительные клоны F. tularensis . ПЦР анализ показал, что у половины проверенных клонов ампликоны, полученные с помощью праймеров 23SalL15 и 23SalR15, имеют размеры, характерные для F. tularensis 15/10, другая половина клонов (F. tularensis 15/10-23) дает два вида ампликонов, появление которых возможно только при наличии двух копий гена iglC в хромосоме (рис. 9).

Вывод о наличии в геноме туляремийного микроба двух копий гена iglC. был подтвержден методом ДНК-гибридизации по Саузерну , между фрагментами ДНК F. tularensis 15/10, полученными в результате гидролиза рестриктазами, и ДНК-зондом, содержащим последовательность гена iglC. Для инактивации второй копии гена проведено скрещивание клеток E. сoli S17(pPV23) и F. tularensis 15/10-23. В результате селекции клонов и ПЦР анализа их геномов получен штамм туляремийного микроба без двух копий гена iglC -F. tularensis15/10-23-23. Аналогично получены варианты штамма F. tularensis LVS без одной и двух копий гена iglC.

A

Б

Рисунок 9 – Электрофореграммы ПЦР продуктов, полученных на матрице ДНК штаммов F. tularensis с помощью праймеров, комплементарных (А) – левому плечу гена р23, (Б) – правому плечу гена р23

Создание плазмиды для модификации  гена sodB в хромосоме F. tularensis. Для снижения уровня экспресии гена sodB в клетках F. tularensis синтезирован фрагмент хромосомы F. tularensis, в котором инициирующий кодон ATG гена sodB заменен на кодон GTG. Для синтеза левого плеча фрагмента использованы следующие праймеры:

Xba-sodB

5’CACTCTAGATTATCCATTTGGTATTGAGG3’

Pst-sodB

5’ATGCTGCAGTACTCTCCTTAAATTCGTG3’

PstF-sodB

5’GACCTGCAGTGAAATTTGAATTACCAAAAC3’

Sal-sodB

5’TATGTCGACAACCTAATCAGCGAATTGC3’

При конструировании модифицированного гена sodB перед инициирующим кодоном GTG создан участок узнавания для рестриктазы PstI. Наличие этого сайта позволило отобрать с помощью рестрикционного анализа ампликоны, амплифицированные с ДНК клонов, несущих модифицированный ген sodB. В результате встраивания фрагмента ДНК, несущего модифицированный ген sodB между сайтами XbaI и SalI плазмиды pPV, получена плазмида pPV-sodB. В качестве реципиентного штамма для отбора трансформантов, несущих плазмиду pPV-sodB, использовали штамм E. coli DH5, затем данная плазмида была перенесена в штамм E. coli S17.

Конструирование штамма F. tularensis LVS со сниженным уровнем экспрессии гена sodB. Попытки делеции гена sodB из хромосомы штаммов F. tularensis 15/10 и LVS методом аллельного обмена оказались безуспешными, поскольку, вероятно, продукт гена sodB жизненно необходим для туляремийного микроба. Для выяснения влияния продукта гена sodB на иммунобиологические свойства туляремийного микроба  создан штамм F. tularensis LVS со сниженной экспрессией гена sodB. Данный штамм F. tularensis  FtsodB получен в результате алелльного обмена природного гена sodB, локализованного в хромосоме, на модифицированный ген sodB, содержащий инициирующий кодон GTG и локализованный на плазмиде pPV-sodB. Плазмида pPV-sodB перенесена из клеток E. coli S17-1 в клетки штамма F. tularensis LVS методом мобилизации. В результате селекции клонов, с последующим ПЦР- и рестрикционным анализом получен штамм F. tularensis  FtsodB, содержащий ген sodB, кодирующий матричную РНК, начало  синтеза белка с которой затруднено из-за присутствия редкого стартового кодона GTG.

Глава 7. Изучение иммуно-биологических свойств штаммов, сконструированных на основе штаммов F. tularensis 15/10 и LVS

Штаммы F. tularensis, модифицированные по гену iglС. Изучение влияния гена iglC на иммуно-иологические свойства туляремийного микроба проводили с помощью: (i) методов оценки уровня устойчивости к бактерицидному действию нормальной кроличьей сыворотки (НКС); (ii) способности к внутримакрофагальному размножению бактерий в эукариотических макрофагоподобных клетках линии J 774 A.1; (iii) способности полученных штаммов индуцировать клеточное звено иммунного ответа методом бласттрансформации, а также (iv) оценки протективности штаммов на мышиной модели эспериментальной туляремийной инфекции.

Показано, что устойчивость к бактерицидному действию НКС у бактерий штаммов F. tularensis 15/10-23 и F. tularensis 15/10-23-23 не изменилась по сравнению с таковой штамма F. tularensis 15/10. Это свидетельствует об отсутствии влияния продукта гена iglC на клеточные структуры штамма F. tularensis 15/10, определяющие устойчивость бактерий к НКС. Хотя полученные варианты вакцинных штаммов F. tularensis 15/10 и LVS одинаково хорошо росли в жидких питательных средах, тем не менее, в отличие от исходных штаммов, они снизили и даже потеряли способность к размножению в клетках J 774 A.1 (Табл. 2).

Таблица 2 – Размножение бактерий F. tularensis в клетках J 774 A.1

Штаммы F. tularensis

Индекс размножения

15/10

540

15/10-23

30

15/10-23-23

1

LVS

4000

LVS -23

1000

LVS -23-23

4

Вакцинация мышей линии Balb/C клетками штамма F. tularensis 15/10-23 приводила к формированию у животных протективного клеточного имму нитета, уровень которого был сходен с иммунитетом, формируемым у мышей при вакцинации штаммом F. tularensis 15/10. Вакцинация мышей

линии Balb/C клетками штамма F. tularensis 15/10-23-23 не индуцировала иммунного ответа у мышей. Реакция бласттрансформации спленоцитов при стимуляции суммарным антигеном F. tularensis была отрицательной, т.е. не отличалась от индекса стимуляции спленоцитов, полученных от неимунизированных мышей. Следовательно, продукт гена iglC необходим для внутримакрофагального размножения туляремийного микроба. Полученные данные подтвердили рабочую гипотезу о том, что стадия внутримакрофагального размножения клетками вакцинного штамма F. tularensis необходима для формирования протективного иммунного ответа живой туляремийной вакциной.

Штамм F. tularensis, модифицированный по гену sodB. Изучение культуральных свойств показало, что рост бактерий штамма F. tularensis  FtsodB замедлен по сравнению с бактериями штамма F. tularensis LVS. Так, при аэробном культивировании в жидкой питательной среде Мюллер-Хинтона (MHB) штамм F. tularensis  FtsodB имел более длительную лаг-фазу. Ферментативная активность железо-зависимая супероксиддисмутаза (FeСОД) в бактериях штамма F. tularensis  FtsodB оказалась существенно снижена по сравнению с таковой в бактериях штамма F. tularensis LVS. На рост культуры штамма F. tularensis  FtsodB в MHB при аэробных условиях существенно влияло присутствие перекиси водорода (H2O2). Повышенная чувствительность штамма F. tularensis  FtsodB к H2O2, несмотря на нормальную активность каталазы, позволило предположить, что часть повреждений клеток F. tularensis была вызвана радикалами OH· , которые образуются в присутствии избытка H2O2 и O2– (Halliwell B. et al.,  1984).

Клетки штамма F. tularensis  FtsodB также оказались весьма чувствителеными к действию препарата Паракват (N,N'-диметил-4,4'-бипиридина дихлорид), который широко используется в биологии для моделирования оксидативного стресса. Зона подавления роста агаровой культуры штамма F. tularensis  FtsodB составляла - (47,3 ± 3,5) мм по сравнению с зоной штамма F. tularensis  LVS - (35,3 ± 2,8 ) мм. Поскольку известно, что в присутствии Параквата увеличивается внутриклеточная концентрация радикала O2–, то дефицит FeСОД, вызванный модификацией гена sodB, вероятно, привел к подавлению роста культуры штамма F. tularensis  FtsodB. Таким образом, показано, что ген sodB кодирует FeСОД, которая нейтрализует негативное действие оксидативного стресса.

Показано также, что штамм F. tularensis FtsodB менее вирулентен для мышей линий C57BL/6 и Balb/C по сравнению с исходным штаммом F. tularensis LVS. Органы мышей линии C57BL/6, инфицированных штаммом F. tularensis FtsodB, были менее обсеменены бактериями F. tularensis и элиминация бактерий из органов происходила быстрее по сравнению с органами животных, инфицированными штаммом F. tularensis LVS. Полученные данные еще раз подтвердили гипотезу о том, что железо-зависимая супероксиддисмутаза, кодируемая геном sodB, необходима для выживания и размножения бактерий в организме инфицированных животных.

Штаммы F. tularensis, синтезирующие протективные туберкулезные  антигены. Показано, что введение в клетки штаммов F. tularensis 15/10 и LVS векторной плазмиды pPMC1и рекомбинантных плазмид, созданных на ее основе, не влияет на ростовые свойства полученных плазмидосодержащих бактерий. В частности, скорость размножения бактерий штаммов F. tularensis RVp17 и RVp18 в мышиных клетках J 774. A1. практически не отличалась от скорости размножения вакцинного штамма F. tularensis  15/10. Динамика размножения клеток штаммов F. tularensis 15/10 pPMC1, RVp17 и RVp18 в селезенке инфицированных мышей была подобна динамике размножения бактерий штамма F. tularensis 15/10. Сходные данные, полученные для штаммов F. tularensis LVS17 и LVS18, синтезирующих Ag85B и гибридный антиген Ag85B-ESAT-6, приведены в таблице 3. Введение плазмид pPMC1, pPMC-FL–85B и pPMC-FL–85B–ESAT-6 в клетки F. tularensis 15/10 не влияло на вирулентность полученных штаммов: LD50 была равна 30  100 КОЕ/мышь. Индексы стимуляции спленоцитов суммарным антигеном F. tularensis во всех группах мышей линии С57BL/6, вакцинированных штаммами F. tularensis рРМС1,

Таблица 3. Динамика изменения обсемененности органов мышей линии С57BL, инфицированных штаммами F. tularensis LVS17 и LVS18.

Обсемененность органов, Log КОЕ

Дни

3

6

14

21

Органы

Селезенка (С)

Печень (П)

С

П

С

П

С

П

Штаммы F. tularensis

LVS

5.4

5.2

5.0

5.2

<3

<3

< 2

< 2

V(рРМС1)

5.2

4.9

4.9

4.1

<3

<3

< 2

< 2

LVS 17

4.1

3.9

4.5

4.7

<3

<3

< 2

< 2

LVS 1 8

6.3

5.7

6.4

6.3

<3

<3

< 2

< 2

RVp17, RVp18 и 15/10, были высокими и находились в пределах – (11,3 ± 1,35) (для штамма F. tularensis 15/10) и (8,2 ± 0,9) (для штамма F. tularensis   RVp18). У животных, иммунизированных штаммами F. tularensis  RVp17 и RVp18, отмечался выраженный специфический иммунный ответ на антиген Ag85B-(His)6. Индексы стимуляции составили – (8,6 ± 1,24) и (4,2 ± 0,95), соответственно, достоверно (P < 0,05) отличаясь от величин индекса стимуляции для интактных мышей – (1,2 ± 0,28) и для мышей, вакцинированных штаммом F. tularensis 15/10 – (1,8 ± 0,56). Уровень стимуляции спленоцитов антигеном  ESAT-6-(His)6 в  группе мышей, вакцинированных клетками F. tularensis RVp18, был незначителен и составлял – (1,9 ± 0,18), достоверно (P<0,05) отличаясь от величин индекса стимуляуии для интактных мышей – (0,8 ± 0,42) и слабо отличаясь от индекса стимуляции для мышей, вакцинированных клетками F. tularensis рРМС1 – (1,2 ± 0,68).

Показано, что спленоциты иммунных мышей в ответ на туляремийные и микобактериальные антигены секретируют IFN- в культуральную среду. Данные о концентрациях IFN- в супернатанте спленоцитов в ответ на стимуляцию антигенами in vitro представлены в таблице 4.

Уровень секреции IFN- спленоцитами, полученными от мышей, иммунизированных бактериями F. tularensis RVp17, при стимуляции антигеном

Таблица 4. Уровни синтеза IFN- спленоцитами иммунных и не иммунных мышей С57BL

Штаммы F.tularensis

IFN-, нг/мл

Туляремийный антиген

Ag85B-(His)6

2 мкг/мл

ЕСАТ-6-(His)6

2 мкг/мл

15/10

75,8±5,3

10,2±0,7

н/о

рРМС1

83,8±3,8

15,0±1,0

0,8±0,3

RVp17

82,5±1,2

31,9±0,7

н/о

RVp18

73,7±8,1

20,3±0,7

4,8±0,2

контроль

6,5±0,8

0,2±0,3

н/о

Примечание: н/о –не определяли.

Ag85B-(His)6 превышал почти в 1,5 раза аналогичный уровень, определенный для мышей, иммунизированных бактериями F. tularensis  RVp18. Вакцинация мышей штаммом F. tularensis RVp18 также индуцировала образование спленоцитов, специфичных к ESAT-6. Таким образом, однократная иммунизация мышей рекомбинантными штаммами F. tularensis RVp17 и RVp18 активирует специфический Т-клеточный иммунитет. Выраженный иммунный ответ формировался также и на антигены туляремийного микроба, что позволило сделать вывод о том, что вакцинные свойства штаммов F. tularensis RVp17 и RVp18 в отношении защиты животных от туляремийной инфекции не изменились.

Оценка выраженности гуморального звена иммунитета животных показала, что в сыворотках мышей, вакцинированных бактериями штаммов F. tularensis RVp17 и RVp18, значимые титры антител к микобактериальным антигенам Ag85B и ESAT-6 отсутствуют, тогда как титры антител к суммарному туляремийному антигену, индуцируемые бактериями F. tularensis 15/10, F. tularensis  RVp17 и F. tularensis  RVp18, находились в диапазоне значений –(1 : 170  1 : 2620).

Протективность полученных рекомбинантных штаммов F. tularensis оценивали на мышиной модели легочной формы экспериментального туберкулеза, вызванной штаммами M. tuberculosis H37Rv и Erdman. Полученные данные по обсеменности легких и селезенки мышей, иммунизированных контрольными штаммами M. bovis BCG, F. tularensis LVS, F. tularensis LVS (рРМС1) и рекомбинантными штаммами F. tularensis LVS17 и LVS18, через 28 сут после заражения групп мышей бактериями вирулентного штамма M. tuberculosis Erdman, приведены на рис. 10. Уровень обсемененности микобактериями легких и

легкие  селезенка

Рисунок 10 – Обсемененность органов иммунных мышей после аэрозольного заражения M. tuberculosis Erdman.

селезенки мышей, вакцинированных штаммами F. tularensis LVS17 и LVS18, был существенно ниже, чем таковой у групп отрицательного контроля.

Протективность рекомбинантных штаммов, полученных на основе штаммов F. tularensis 15/10 и LVS, не превышала таковую туберкулезного вакцинного штамма M. bovis BCG. Протективность рекомбинантных штаммов была подтверждена гистолочески. Гистограммы срезов легких иммунных мышей С57BL,

вакцинированных рекомбинантными бактериями штаммов F. tularensis LVS17, LVS18, F. tularensis LVS и M. bovis BCG, после аэрозольного заражения штаммом  M. tuberculosis Erdman приведены на рис. 11.

  LVS  LVS 18

  LVS 17  BCG

Рисунок 11 – Гистологические срезы ткани легких мышей на 28 сутки после инфицирования бактериями M. tuberculosis Erdman.

Таким образом, целенаправленная модификация вакцинных штаммов F. tularensis позволяет получать информацию о влиянии изучаемого гена на иммуногенность и вирулентность туляремийного микроба. Полученные данные о протективных свойствах созданных стабильных рекомбинантных штаммов указывают на перспективность применения вакцинного штамма F. tularensis 15/10 в качестве бактериального вектора для создания комбинированных вакцин нового поколения.

Созданные молекулярные инструменты для модификации генома вакцинного штамма F. tularensis 15/10 открыли широкие перспективы для изучения молекулярно-генетических механизмах патогенности и иммуногенности F. tularensis с целью создания туляремийных вакцин нового поколения.

ВЫВОДЫ

  1. Адаптирован способ переноса плазмидных ДНК в клетки F. tularensis методом криотрансформации. Наличие ионов магния является необходимым условием переноса плазмид в клетки F. tularensis при использовании метода замораживания-оттаивания бактерий.
  2. Впервые показана возможность мобилизации плазмидных ДНК из клеток E. coli в клетки F. tularensis в результате скрещивания. Оптимизированы условия конъюгации и мобилизации плазмидных ДНК из клеток E. coli в клетки F. tularensis
  3. Показано, что при конъюгативном переносе плазмиды pSa из клеток E. coli в клетки F. tularensis в результате спонтанной мутации появляется плазмида pSa’, способная к высокоэффективному «челночному» переходу между клетками E. сoli и F. tularensis, не требующему наличия «плунжерных» плазмид.
  4. Впервые охарактеризована структурно-функциональная организация криптической плазмиды рFNL10 из штамма F. novicida like F6168. Плазмида рFNL10, имеющая 3990 п. н. и содержание Г+Ц-пар, равное 32 %, способна к репликации в бактериях F. tularensis. Плазмида рFNL10 содержит все генетические элементы, необходимые для репликации по механизму тета-типа, а также оперон Phd-Doc системы.
  5. созданы рекомбинантные плазмиды на основе репликонов плазмид pC194 и pTV24, позволяющие экспрессировать в клетках туляремийного микроба антигены Y. pestis и B. anthracis с целью создания поливалентных вакцинных препаратов.
  6. Сконструирован стабильный плазмидный вектор рРМС1 на основе репликона плазмиды рFNL10 для экспрессии гетерологичных антигенов в вакцинном штамме туляремийного микроба.

7. Показана возможность повышения уровня экспрессии гибридных генов, кодирующих гетерологичные белки, в клетках F. tularensis в результате присоединения к структурной части гена лидерной части предшественника основного белка внешней мембраны FopA F. tularensis.

8. Созданы стабильные штаммы F. tularensis RVp17 и RVp18, экспрессирующие микобактериальные антигены Ag85B и ESAT-6 и индуцирующие специфический протективный противотуберкулезный Т-клеточный иммунный ответ у вакцинированных мышей. Показана принципиальная возможность использования туляремийного вакцинного штамма в качестве бактериального вектора при создании прототипов рекомбинантных вакцинных штаммов.

9. Показана возможность гомологичной рекомбинации в геноме F. tularensis. Разработаны плазмидные векторы и метод аллельного обмена в хромосоме F. tularensis, позволяющий удалять участки генома, модифицировать регуляторные и другие области оперонов и получать генетически маркированные штаммы, что позволяет  проводить детальный анализ влияния выбранных генов на вирулентность и иммуногенность туляремийного микроба.

10. Геном F. tularensis содержит две копии гена iglC, кодирующего 23 кДа белок. Вариант вакцинного штамма, лишенный двух копий гена iglC, не размножается в мышиных макрофагоподобных клетках и не защищает мышей от гибели при экспериментальной туляремийной инфекции.

11. Показано, что супероксиддисмутаза F. tularensis, кодируемая геном sodB, необходима для жизнедеятельности туляремийного микроба. Бактерии F. tularensis с пониженным содержанием FeСОД менее вирулентны для мышей, чем исходный штамм F. tularensis  LVS.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

А) в изданиях, рекомендованных ВАК:

  1. Павлов В.М., Мокриевич А.Н. Создание векторной плазмиды для Francisella tularensis // Проблемы особо опасных инфекций.- Саратов, 1994.- Вып. 4 – № 74. . – С. 191–194.
  2. Мокриевич А.Н., Фурсов В.В., Павлов В.М. Криотрансформация туляремийного микроба плазмидной ДНК // Проблемы особо опасных инфекций.- Саратов, 1994. . – Вып. 4 – № 74. – С. 186–190
  3. Павлов В.М., Родионова И.В., Мокриевич А.Н., Мещерякова И.С. Выделение и молекулярно-генетическая характеристика криптической плазмиды из Francisella novicida-подобного штамма F6168. // Молекулярная генетика, микробиология и вирусология. – 1994. – № 3. – С. 39–40.
  4. Pavlov V.M., Mokrievich A.N. and Volkovoy K. Cryptic plasmid pFNL10 from Francisella novicida-like F6168: the base of plasmid vectors for Francisella tularensis. // FEMS Immunol. Med. Microbiol. – 1996. – V. 13. P. 253–256.
  5. Павлов В.М., Мокриевич А.Н., Носков А.Н. и  Ураков Н.Н. Туляремийный вакцинный штамм-потенциальный бактериальный вектор. // Вестн. Мед. Акад. Наук. - 1997. – № 3. – C. 15–17
  6. Алимов А.П., Павлов В.М. Патент РФ на изобретение № 2110575 – рекомбинантная плазмидная ДНК pro PF5, определяющая синтез капсульного антигена F1 возбудителя чумы и протективного антигена возбудителя сибирской язвы, и способ конструирования рекомбинантной плазмидной ДНК pro PF5 // Бюллетень № 13 от 10.05.1998.
  7. Померанцев А.П., Павлов В.М. // Плазмида pCSE4 для клонирования промотор-содержащих фрагментов ДНК в туляремийном микробе // Вест. РАМН. – 1999. – № 12. – С. 29–32.
  8. Pomerantsev A.P., Golovliov I.R., Ohara Y., Mokrievich A.N., Obuchi M., Norqvist A., Kuoppa K., Pavlov V.M. Genetic organization of the Francisella plasmid pFNL10 // Plasmid. – 2001. – V. 46 – N. 3. – P. 210–22.
  9. Golovliov I., Sjostedt A., Mokrievich A., Pavlov V. A method for allelic replacement in Francisella tularensis // FEMS Microbiol Lett. – 2003. – V. 222– N. 2. – P. 273–80.
  10. Bakshi C.S., Malik M., Regan K., Melendez J.A., Metzger D.W., Pavlov V.M., and Sellati T.J. Superoxide dismutase B gene (sodB)-deficient mutants of Francisella tularensis demonstrate hypersensitivity to oxidative stress and attenuated virulence // J Bacteriol.. – 2006. – V.188. – P. 6443–6448.
  11. Кравченко Т.Б., Платонов М.Е., Вахрамеева Г.М., Баннов В.А., Кудрявцева Т.Ю., Мокриевич А.Н., Павлов В.М. Клонирование и экспрессия протективных антигенов Mycobacterium tuberculosis Ag85 и ESAT-6 в клетках Francisella tularensis 15/10 // Биохимия – 2007. – т.72. - № 7. – с. 905–914.
  12. Лапин А.А., Павлов В.М., Мокриевич А.Н., Домотенко Л.В.,  Храмов М.В.  Простая жидкая питательная среда для молекулярно-генетических исследований Francisella tularensis // Пробл. особо опасных инфекций.- Саратов, 2009. – № 102. – С. 66 – 67 
  13. Мокриевич А.Н.,  Кондакова А.Н., Валаде Э., Платонов М.Е.,  Вахрамеева Г.М., Шайхутдинова Р.З., Миронова Р.И., Блаха Д., Бахтеева И.В.,  Титарева Г.М., Кравченко Т.Б., Комбарова Т.И., Видаль Д., Павлов В.М., Линднер Б., Дятлов И.А., Книрель Ю.А. Биологические свойства и строение липополисахарида вакцинного штамма Francisella tularensis, полученного при инактивации гена системы «чувства кворума» qseC* // Биохимия.– 2010. – Т. 75. – №  4. – С. 539 – 548.

Б) в прочих изданиях:

  1. Павлов В.М., Мокриевич А.Н. Клонирование гена Francisella tularensis, кодирующего синтез RecA–подобного белка, в Escherichia coli // Актуальные проблемы профилактики туляремии: Тезисы докладов Всесоюзной конференции. - Симферополь, 1991. - С.142.
  2. Никитин А.Н.; Еремин С.А.; Павлов В.М., Дроздов И.Г. Генетическая  трансформация туляремийного микроба плазмидной ДНК // Генетика и биохимия вирулентности возбудителей особо опасных инфекций: Тезисы докладов Всесоюзной конференции. - Волгоград, 1992. - С. 45
  3. Родионова И.В., Павлов В.М., Мокриевич А.Н., Мещерякова И.С. Выделение и молекулярно-генетическая характеристика плазмидной ДНК pFNL10 из штамма Francisella novicida-like F 6168 // Иммунология и специфическая профилактика особо опасных инфекций: Материалы Российской научной конференции.- Саратов, 1993. - С. 302
  4. Pomerantsev, A.P., Pavlov V.M.,  Urakov N.N. Francisella tularensis: behaviour of heterologous plasmids // First International Conference on Tularemia (Aug.23-25, 1995). Umea, Sweden: Abstracts.- 1995.- P. 13
  5. Norqvist A., Kuoppa K., Pavlov V.M.,  Sandstrm G. Construction and characterization of a cloning vector for use in Francisella tularensis // First International Conference on Tularemia (Aug.23-25, 1995). Umea, Sweden : Abstracts- 1995.- P. 28.
  6. Tedikov V.M., Mokrievich A.N., and Pavlov V.M. Cloning of ori pXO1 and pag gene of B. anthracis in Francisella tularensis // Salisbury Med. Bull.- Special Suplement no. 87.- 1996.-P. 98.
  7. Pavlov V.M., Mokrievich A.N. and Pomerantsev A.P.  Plasmid vectors for vaccine strain Francisella tularensis // Medizinische B-Schutz-Tagung des BWVg  22 und 23 oct. 1997.- 1997.- P. 10.
  8. Pavlov V.M. Methodical approaches to designing recombinant live vaccine Francisella tularensis straines // Second International Conference on Tularemia (9-11 oct. 1997, Hradec Kralove, Czech Republic): Vojenske Zdravotnicke Listy.-Suplementum.-1997.- Rocnik LXI. - P. 4-5.
  9. Mokrievich A.N., Pavlov V.M., Rodionova I.V., Meshcheryakova I.S. Restriction map of pFNL10 plasmid // Second International Conference on Tularemia (9-11 oct. 1997, Hradec Kralove, Czech Republic): Vojenske Zdravotnicke Listy – Suplementum.- 1997.- Rocnik LXVI. - P. 13-14
  10. Pavlov V.M., Mokrievich A.N., Staritsyn N.A., Shishkova N.A. Rec–A like Francisella tularensis strain: Isolation and properties // Second International Conference on Tularemia (9-11 oct. 1997, Hradec Kralove, Czech Republic): Vojenske Zdravotnicke Listy – Suplementum.- 1997.- Rocnik LXVI. - P. 14-15
  11. Рomerantsev A.P., Pavlov V.M. Molecular tools for study of transcriptional regulation in Francisella tularensis // Second International Conference on Tularemia (9-11 oct. 1997, Hradec Kralove, Czech Republic): Vojenske Zdravotnicke Listy – Suplementum.- 1997.- Rocnik LXVI. - P. 10
  12. Kravchenko T.B., Mokrievich A.N and Pavlov V.M. Immunobiological properties of recombinant vaccine strain of Francisella tularensis producing protective antigen of Bacillus anthracis // 3rd International Conference on Anthrax (University of Plymouth, 7-10 th September 1998): Abstract Book.- 1998.- P. 35.
  13. Bannov V.A., Kudriavtseva T.Yu., Mokrievich A.N., Eruslanov B.V., Shishkova N.A., Verevkin V.V., Pomerantsev A.P., Pavlov V.M. Study of OmpS Legionella pneumophyla gene expression in the tularemia microbe vaccine strain // Problems of  Medical and Ecological Biotechnology. The International Conference (December 14 - 15). Obolensk, Russia. – 1999.- P. 13.
  14. Kravchenko T.B., Titareva G.M., Bakhteeva I.V., Shishkova N.A., Pavlov V.M., Urakov N.N. Study of immune properties of the strain Francisella tularensis synthesizing Omps protein Legionella pneumophyla // Problems of Medical and Ecological Biotechnology. The International Conference (December 14 -15). Obolensk, Russia. – 1999 - P. 81.
  15. Kudriavtseva T.Yu., Pavlov V.M., Urakov N.N., Eruslanov B.V. Isolation of Legionella pneumophyla outer membrane protein and analysis of this protein expression by recombinant strains // Problems of Medical and Ecological Biotechnology. The International Conference (December 14 - 15). Obolensk, Russia. – 1999.-  P. 87.
  16. Pomerantsev A.P., Mokrievich A.N., Golovlev I.P., Pavlov V.M. Nucleotide sequence, structural organization and functional activity of the plasmid pFNL10 specific for bacteria of Francisella species // Problems of Medical and Ecological Biotechnology. The International Conference (December 14 - 15). Obolensk, Russia. – 1999.- Р. 126.
  17. Pavlov V.M. Genetics of tularemia microbe. // Problems of Medical and Ecological Biotechnology. The International Conference (December 14 -15). Obolensk, Russia. – 1999.- P. 289.
  18. Платонов М.Е., Мокриевич А.Н. и Павлов В.М. Conjugative transfer of plasmid DNA from Escherichia coli into Francisella tularensis // Международная конференция Проблемы биологической и экологической безопасности (22-24 мая). Государственный научный ценр прикладной микробиологии, Оболенск, Россия. – 2000.- С. 76-78.
  19. Platonov M., Titareva G.,  Kravchenko T. and Pavlov V.M. Immunobiological properties of Francisella tularensis with inactivated gene (iglC) encoding 23-kD protein // Fourth International Conference On Tularemia (September 15-19). City of Bath, Great Bretain. -  2003. - P. 48.
  20. Mokrievich A.N., Pavlov V.M. 2003. Conjugal transfer pSa plasmid from Escherichia coli in Francisella tularensis. // Fourth International Conference On Tularemia (September 15-19). City of Bath, Great Bretain. - 2003. - P. 49.
  21.  Platonov M., Mokrievich A.,  Kravchenko T., Shishkova N., and Pavlov V.M. 2003. Cloning of iron-dependent superoxide dismutase (SodA) of Mycobacterium tuberculosis in Francisella tularensis 15/10 // Fourth International Conference On Tularemia (September 15-19). City of Bath, Great Bretain. - 2003. - P. 50.
  22. Мокриевич А.Н, Павлов В.М. Francisella tularensis и межвидовой обмен генетической информации. //Юбилейной научной конференции, посвященной 75-летию НИИ микробиологии МО РФ (Киров, 2003); -  2003. - С. 147.
  23. Kravchenko T.B.,  Mokrievich A.N., Platonov M.E., Vahrameeva G.M., and Pavlov V.M. Development of recombinant Francisella tularensis vaccine strains carrying additional protective antigens. In the book of abstracts of the 1-st International Conference on Environmental, Industrial and Applied Microbiology. Badajoz, Spain, 2005, p.861
  24. Platonov M.E., Mokrievich A.N., and Pavlov V.M. Plasmid conjugation and mobilization from Escherichia coli into Francisella tularensis // 1-st International Conference on Environmental, Industrial and Applied Microbiology (March 15-18). Badajoz, Spain. – 2005. - P. 861
  25. Платонов М. Е., Мокриевич А. Н., Кравченко Т. Б., Вахрамеева Г. М., Шишкова Н. А., Павлов В. М. Экспрессия генов протективных антигенов туберкулезного микроба в вакцинном штамме Francisella tularensis 15/10 // 3-ий  Московский международный конгресс «Биотехнология: состояние и перспективы развития» (14-18 марта). Москва, Россия. – 2005. - С. 85.
  26. Pavlov V.M., Mokrievich A., Platonov M., Kravchenko T. Vachrameeva G., Titareva G.,   Bakhteeva I., Mironova R., Parra M., Elkins K.L., Brennan M.J. New bacterial vector for Mycobacterium tuberculosis protective antigens // The 2006 NIAID Research Conference (June 24-30). Opatija, Croatia. – 2006.- P. 43
  27. Кравченко Т.Б., Мокриевич А.Н., Платонов М.Е., Вахрамеева Г.М., Кудрявцева Т.Ю., Баннов В.А., Миронова Р.И., Комбарова Т.И., Потапов В.Д., Бахтеева И.В., Титарева Г.М., Ганина Е.А, Павлов В.М. Вакцинный штамм Francisella tularensis - новый бактериальный вектор для протективных антигенов Mycobacterium tuberculosis // Чрезвычайные ситуации международного значения в общественном здравоохранении в решениях Санкт-Петербургского саммита государств «группы восьми» и санитарная охрана территорий государств-участников содружества независимых государств/ VII-я Межгосударственная научно-практическая конференция государств-участников СНГ (3-5 октября). Оболенск, Россия. – 2006. - С. 147-148.
  28. Павлов В.М., Кравченко Т. Б., Мокриевич А. Н., Платонов М. Е., Вахрамеева Г. М., Кудрявцева Т. Ю., Баннов В. А., Миронова Р. И., Комбарова Т. И., Потапов В. Д., Бахтеева И. В., Титарева Г. М., Ганина Е. А. Противотуберкулезная протективная активность туляремийного вакцинного штамма с антигенами Mycobacterium  tuberculosis 85B и ESAT-6 // Всероссийская научно-практическая конференция с международным участием  «Вакцинология 2008. Совершенствование иммунобиологических средств профилактики и лечения инфекционных болезней» (11-12 ноября). Москва, Россия. - 2008. - С. 95.





© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.