WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Прохорчук Егор Борисович

Метил-ДНК связывающие белки с доменами «цинковые пальцы»: молекулярно-генетическая характеристика и анализ биологических функций методами нокаута.

03.01.03- молекулярная биология

Автореферат диссертации на соискание ученой степени доктора биологических наук

Москва- 2011

Работа выполнена в лаборатории генетической инженерии клеток млекопитающих Центра «Биоинженерия» РАН и в лаборатории молекулярных основ онкогенеза Института биологии гена РАН Оффициальные оппоненты:

Доктор медицинских наук, профессор, академик РАМН Арчаков Александр Иванович Доктор биологических наук, профессор, член-кор РАН Деев Сергей Михайлович Доктор биологических наук Купраш Дмитрий Владимирович Ведущая организация- Учреждение Российской академии наук Институт цитологии и генетики Сибирского отделения РАН (ИЦиГ РАН).

Защита состоится 23 декабря 2011 года в 13.00 на заседании Совета Д 501.001.76 по защите докторских и кандидатских диссертаций при Московском государственном университете имени М.В. Ломоносова по адресу: 119992, г. Москва, Ленинские горы, МГУ, НИИ Физико-химической биологии имени А.Н. Белозерского, ауд 536.

С диссертацией можно ознакомиться в библиотеке биологического факультета МГУ имени М.В.

Ломоносова Автореферат разослан «___» _____________2011 года Учёный секретарь диссертационного совета, кандидат биологических наук Крашенинников И.А.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы.

Полная идентичность двух молекул ДНК не может обеспечить одинаковую реализацию кодируемой ими генетической информации. Примером такого феномена могут служить две женские половые Х хромосомы, имеющие практически идентичную первичную последовательность ДНК, но кардинально отличающиеся с точки зрения транскрипции их генов:

лишь одна из двух хромосом будет на большем своем протяжении содержать активные гены, в то время, как гены второй Х хромосомы будут молчать. В последнее время ученые получают все новые и новые доказательства того, что надгенетические (эпигенетические) механизмы контроля генетической информации играют важнейшую биологическую роль в таких процессах как развитие эмбриона, дифференцировка клеток, дозовая компенсация половых хромосом, развитие онкологических и нейродегенративных заболеваний. Сложности и относительные неудачи в клонированни позвоночных организмов связаны с удивительной стабильностью эпигенетического профиля, в первую очередь гистоновых модификаций и метилирования ДНК, в процессе перепрограммирования терминально дифференцированной клетки в плюрипотентную. Однако, несмотря на прогресс, достигнутый в понимании роли эпигенетического контроля генной экспрессии в биологических процессах, остается открытым целый ряд вопросов о механизмах реализации эпигенетической информации. В частности, метилирование ДНК является необходимой модификацией для нормального эмбрионального развития мыши. Животные с генетическим нокаутом гена, кодирующего поддерживающую метил ДНК трансферазу, погибают во время эмбриогенеза сразу после гаструляции. Однако, предполагаемые белки-интерпретаторы метилирования ДНК, а именно метил ДНК связывающие белки семейства MBD ни по отдельности, ни совокупно не являются необходимыми для нормального прохождения эмбриогенеза. Таким образом, либо метилирование ДНК напрямую может ингибировать взаимодействие транскрипционных или иных белковых факторов с их участками узнавания, или же необходимо предположить существование отличного от MBD семейства метил ДНК узнающих белков, которые могут переводить сигналы метилирования ДНК, к примеру, в подавление транскрипции метилированных генов. После полной расшифровки генома человека появилась возможность поиска новых метил ДНК связывающих белков по гомологии с MBD доменом, однако, ни один из найденных таким образом новых белков специфически не связывал метилированную ДНК. В данной работе будут описано обнаружение и характеристика функциональных свойств белков, которые объединены в одно семейство за счет способности имеющихся в их составе трех доменов «циноквые пальцы» C2H2 типа специфически связывать метилированную ДНК. Существование второго семейства метил ДНК связывающих белков существенно расширяет наши представления о механизмах интерпретации метилирования ДНК.

Тот факт, что белок Каизо потенциально может быть вовлечен через белок-белковые взаимодействия в передачу сигналов от клеточной мембраны клетки в ядро, открывает новое направление в изучении эпигенетических механизмов контроля генетической информации как последствия межклеточных контактов.

Цель работы Проверить гипотезу о существовании у позвоночных организмов метил ДНК связывающих белков, отличных от белков MBD семейства. В случае обнаружения нового семейства таких белков провести их функциональную характеристику с помощью современных методов молекулярной биологии, в частности с использованием технологии генетического нокаута.

Основные задачи исследования Первой задачей исследования стала характеристика гена, ответственного за метил ДНК специфическое взаимодействие, которое было детектировано in vitro в экспериментах по задержке подвижности ДНК-белковых комплексов, образованных энхансерным элементом гена S100A4 и ядерными эксрактами многих клеточных линий, органов и тканей мыши и человека.

После получения достаточных доказательств о том, что описанные ДНК белковые комплексы образованы с участием белка Каизо, встал целый ряд задач по опредеднию биологической роли Каизо у позвоночных:

- получить и охарактеризовать мышей, у которых проведен генетический нокаут гена Каизо.

- определить гены мишени, с регуляторными участками которых Каизо взаимодействует in vivo и уровень транскрипции которых чувствителен к падению Каизо.

- определить морфологические и молекулярные последствия транзиентного понижения уровня Каизо в оплодотворенных ооцитах шпорцевой лягушки Xenopus.laevis.

- выяснить, как катенин р120 может влиять на ДНК связывающие и транскрипционные свойства Каизо при их взаимодействии.

- определить функциональную значимость взаимодействия Каизо с неметилированными последовательностями CTGCNA в составе некотрых генов, вовлеченных в канонические и неканонические сигнальные пути wnt.

- провести биоинформатический поиск гомологичных белков, используя в качестве референсной последовательность аминокислот трех доменов типа «цинковый палец» белка Каизо. В случае нахождения существенных гомологичных молекул провести их детальную характеристику, уделив особое внимание их способности специфически связывать метилированную ДНК.

Научная новизна работы Свойство белков ZBTB33 (Каизо), ZBTB4 и ZBTB38 специфически связывать метилированную ДНК было открыто впервые мире в процессе получения основных результатов данной диссертационной работы. Впервые показано, что мышь с удаленным геном Каизо проявляет устойчивость к развитию рака кишечника. Также пионерскими являются все результаты, указывающие на важность Каизо в процессе эмбрионального развития шпорцевой лягушки.

Проведение полногеномного картирования участков связывания Каизо было превым примером использования технологии ChIP-Seq в Российской Федерации. Помимо технической новизны следует обратить внимание на то, что данный экспреримент позволил выделить метил ДНК связывающую активность Каизо, как доминирующую in vivo, в то время как связывание неметилированных последовательностей CTGCNA было детектировано на уровне фона.

Последнее обстоятельство является убедительным аргументом в споре с рядом лабораторий (Dr Juliet Daniel, Dr Pierre McCrea), которые считают что реализация основной биологической функции Каизо проистекает через связывание участков CTGCNA, а не метилированных ЦфГ динуклеотидов. Таким образом, данная работа не только открывает новое направление в изучении доменов типа «цинковые пальцы», но и позволяет более точно сфокусировать исследования в этой области на интерпретации сигналов метилирования.

Практическая ценность работы Способность трех доменов типа «цинковый палец» белка Каизо связывать in vitro метилированную ДНК с высокой плотностью динуклеотидов ЦфГ выгодно отличает их от MBD метил ДНК связывающего домена, который способен узнавать и одиночные метилированные ЦфГ динуклеотиды. Более того, проведенные эксперименты показывают, что ДНК аффинные сорбенты, полученные с использованием «циноквых пальцев» Каизо преимущественно связывают метилированные ЦфГ островки (до 75% все связавшейся ДНК), в то время, как доля метилированных ЦфГ островков в элюированных фракциях сорбента на основе MBD домена белка MBD2 составляет не более 5%. Таким образом использование аффинных сорбентов на основе белка Каизо может существенно снизить расходы по определению профиля метилирования ЦфГ островков лини клеток, органа или ткани. Это особенно важно при характеристике новообразований. Известно, что метилирование ЦфГ островков в промоторных областях генов раковых супрессоров явлется одним из молекулярных механизмов, приводящих к трансформации клеток. Конечно же, аффинные сорбенты на основе Каизо не способны привести к определению статуса метилирования геномной ДНК с нуклеотидной точностью, однако для клинических применений это редко требуется. При использовании технологии определения первичной нуклеотидной последовательности нового поколения (Solexa, SOLiD) для анализа связанной Каизо сорбентом геномной ДНК объем такого секвенирования будет на порядок меньше, а значит и дешевле и доступнее для клинических исследователей, чем при использовании MBD сорбентов и тем более при так называемом «бисульфитном секвенировании». Другим направлением практического применения результатов работы может стать лечение онкологических заболеваний.

Мышь с удаленным геном Каизо проявляет устойчивость к развитию рака кишечника, вызванного аномальным уровнем активности сигнального пути wnt. Малые молекулы, которые бы ингибировали активности Каизо (транскрипционную или ДНК связывающую), вероятно, могут стать хорошими кандидатами для создания противоопухолевых препаратов, действие которых можно нужно будет проверять на модельных организмах, а потом и в клинических испытаниях.

Причем в последнем случае вполне вероятно важным окажется генотип опухоли и наибольший эффект препаратов следует ожидать у пациентов с опухолями с активным сигнальным путем wnt.

Апробация работы Основные результаты докладывались на конференциях Американской ассоциации по изучению рака (AACR) в 2001 и 2008 годах в США, в 2005 году на конференции по эпигенетическим механизмам пеперпрограммирования генома (Капри, Италия), а также на российских конференциях, в частности, на третьем международном съезде Биохимического общества (СанктПетербург 2002, на конференции, посвященной 40-летию журнала «Молекулярная биология» (Москва, 2007 год) и на седьмой международной конференции по биоинформатике регуляции и структуры генома (Новосибирск, 2010).

Публикации По результатам работы имеется 22 публикации в реферируемых журналах.

СОДЕРЖАНИЕ РАБОТЫ

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 1. Характеристика нового семейства метил-ДНК связывающих белков, содержащих BTB/POZ домен и домен “цинковые пальцы” Первая часть работы посвящена обнаружению новых метил-ДНК связывающих белков, структурно отличающихся от белков MBD семейства.

1.1 Обнаружение метил-ДНК зависимого связывания белковых комплексов с энхансерным элементом гена S100A4 в экспериментах in vitro.

Во многих тканеспецифичных и дифференциально экспрессирующихся в процессе развития генах, гиперчувствительные к обработке панкреатической дезоксирибонуклеазой I (ДНКазаI) участки, связаны с областями, участвующими в транскрипционном контроле. Чаще всего они коррелируют со связыванием регуляторных белков с прилегающими последовательностями. С целью выявления новых регуляторных областей гена S100A4 был произведен поиск гиперчувствительных участков к обработке ДНКазойI. Анализ их распределения в различных линиях клеток, показал, что три гиперчувствительных участка присутствуют внутри EcoRI рестрикционного фрагмента геномной копии мышиного гена S100A(рис. 1). Один из гиперчувствительных участков расположен в районе промотора гена (далее ДГУ1) и связан с транскрипционной активностью гена S100A. Второй (ДГУ2) наблюдается в районе с координатами (+700;+900) (за 0 принят старт транскрипции гена).

Рисунок 1. Картирование участков, гиперчувствительных к обработке ДНКазойI, расположенных в области с координатами (-2.т.п.н.; +2.0 т.п.н.) мышиного гена S100A4. Ядра, полученные из клеток линии КСМЛ-100 (дорожки с по 9) и Rac34E (дорожки с 10 по 14), обрабатывали увеличивающимся количеством ДНКазыI (обозначено треугольниками). Геномную ДНК ферментативно гидролизовали рестриктазой EcoRI и гибридизовали с радиоактивно меченой пробой ExIII (ПЦР фрагмент третьего экзона, размером 200 п.н). Серые прямоугольники обозначают сis-действующие элементы мышиного гена S100A4: 1-16 п.н.

последовательность; 2 - метилзависимый АР-участок; 3 - kB-подобный участок; 4 микросателлитная последовательность ДНК. Экзоны обозначены черными прямоугольниками.

Гиперчуствительные участки к обработке ДHКазойI обозначены стрелками.

Третий (ДГУ3) расположен во втором интроне в области с координатами + 1300 п.н. ДГУ2 и ДГУ3, в отличие от ДГУ1 присутствуют во всех протестированных клеточных линиях вне зависимости от транскрипционной активности гена S100A4 и имеют разную чувствительность к увеличивающимся количествам ДНКазыI (таблица 1).

Разница в структуре гиперчувствительных областей может быть отражением спектра ДНКбелковых взаимодействий в этих районах.

1.2 Об ие вого тора, бнаружени белков факт связыва етилированной ающегося с ме Таблица 1. Представленность гиперчувс х ствительных участков в гене S10 к обр НКазой l в последо стью ДНК, в 00A4 работке ДН в овательнос Д мышиных и ских клеточн.

и человечес ных линиях.

располо ДГУ2.

оженной с 3' конца Д Урове ень экспре ессии А идной Анализ нуклеоти мРНK K Тип клеток ДГУl ДГ ДГУк ГУ2 последо ти протяжен овательност нного гена S S100AКСМЛ-100 +++ +++. +++ +++ 0 + гиперчу ного тка к увствительн участ с 3'-конца КСМЛ-0 - - + + + VMR-Liv - - + + + ДГУ2 мышиного гена S100A4 вы о S ыявил VMR-0 - - + + + коротки CpG-остр c ий ровок Rac34E +/- +/- ++ ++ + Racl0P - - + + + последо тью СG АСG, овательност GСGСССАА Jurcat - - + + + Molt-4 ++ ++ ++ ? содержа и отида.

++ ащий три СрG динуклео СЕМ + + ++ ? + Посколь ранее было показано, что ьку е К562 - - ++ ? + эпигенети н ляется важн ранскрипци erg, Daams et al.

ический контроль явл ным при тр ии S100A4 (Sonnenbe 1986), бы определ статус метилирования ук овка ток ыл лен с казанного CpG-остро в линиях клет с различным уровнем активности гена S100A4. С помощь эндону уствительны к м м С ью уклеаз, чу ых метилиров ДНК было ус о лот дизации, чт этот уча ванию К, становлено методом Саузерн бл гибрид то асток ге S100A мыши в клеточн линиях КСМЛ и ена A4 ных Л-К ирован, а в Rac3 и Racl0P КСМЛ-100 неметили а 34E R м ан (рис.2).

метилирова Рисун 2. Опре арактера ме ия нок еделение ха етилировани Sm п льности ервом оне ого 00Aпоследовател в пе интро мышино гена S10 в различных линиях клет После в г НК л ток. выделения геномную ДН из кл СМЛ-100, Ra зовали леток линий КСМЛ-0, КС ac34E и Racl0P гидролиз рестриктазами HindIII и HhaI и ги и ктивно и ибридизовали с радиоак м бой. енты HindIII-НindI и HindIII меченой проб Фрагме ДНК H III II-НhаI имели размер 5 и 1.2 кп.н. соответственно. Эк обозн ры кзоны начены черными прям ми.

моугольникам Таки транскрипц 100Aим образом, уровень т ции гена Sи ования и гатой и статус метилиро изучаемой GС бог п ельности не коррелир уг с другом. Для последовате н ровали дру выяснения факта вз твия v к заимодейст in vitro белковых ф ледовательностью, бы прове факторов с этой посл ыли едены экспериме держке ДН ых комплексов в геле с ядерным ктами енты по зад НК -белковы к ми белковыми экстрак из клеточн и КСМЛ-10 ализе связы рных белко актов ных линий КСМЛ-0 и 00. При ана ывания ядер овых экстра из клеток КСМЛ-0 было выя обр К-белковых комплексов МКl и МКявлено разование двух ДНК о (рис.3, до щийся К2 к езает ии нного орожка 1). Образующ МК комплекс не исче при добавлени немечен метилиров н ожка 2). На о Кl является чным ванного конкурента (рис.3, доро апротив, комплекс МК я специфич к метилир НК (рис.3, дорожки 3 и 4). В фо ии МК2 комплекса уч рованию ДН 3 ормировани частвуют белки, связывающ В подобные ательности и микроса ю ДНК.

щие NF-kВ е последова ателлитную Рисунок 3. Электрофо я ДНК-белков комплек в 3 оретическая задержка Д вых ксов 4 ААГ, белковыми экстрактам из 4%-ном ПА образованных ядерными б ми к л Л-О оактивно ме про анным клеточной линии КСМЛ и радио еченым ометилирова ф м первого инт S ординатами (+685; +890) фрагментом трона гена S100A4 с коо ). МК- чный комплекс. МК1-комплекс специф етилированию - неспецифич е м фичный к ме ю всех трех CpG-п в изуч ости. Пробу х пар чаемой последовательно П ф ировали I сферазой (дор 1, 2, 3, 4), ферментативно модифици SssI метилтранс рожки H ожка), FnuDII а) и HhaI+Fпu жка). Для про HhaI ( 6 доро I ( 7 дорожка uDII (5 дорож оверки с сти ания кцию вляли збыток специфичнос связыва в реак добав 100 кратный из н урента: 85;+890) фра мети й немеченого ДНК конку (+68 агмент, илированный SssI м феразой (2 дорожка); (+685; +89 фрагмен (3 дорожка);

метилтрансф 90) нт н ная последова ДНК (4 дорож неспецифичн ательность Д жка).

П яет ес акт, метилирова трех CpG Представля интере тот фа что м ание д идов проис айоне откр матина (ДГ динуклеоти сходит в ра рытого хром ГУ2).

Это может агать вовлеч м ифического в молекуля цессы т предпола ченность метил-специ о фактора в ярные проц несвязанн с транс. т Д сти ивности S100Aные скрипцией. Сам факт наличия ДГУ2 вне зависимос от акти мог лишь подтвержд е предполож дать данное жение.

С помощью экспериме по интерферец метил оказано, чт в п ента и ции лирования было по то образован МКl комплекса непосредств вовл анин ого инуклеотид на ние о н венно лечены гуа перво CpG ди да кодирующ цепи (с координа +839) и гуанин второго CpG динукл ющей щей с атой p леотида на некодирую цепи ( с координатой +840) ( р ходя из все ных данны елан вывод к рис.4). Исх ех полученн ых, был сде д, что последова, узнаваема ваемая белком, m5СGm СААm5СG ( ).

ательность, ая и связыв к m5СGССС (далее Sm) Рисунок 4. Экспе илирования ДНК-белк к еримент по интерференции мети я кового ком Кl. Двуцепоче мент ДНК из первого инт ного гена Sмплекса МК ечный фрагм трона мышин 00A4 с координатами (+685; +89 обрабаты ДМC после че использо в кач о 90) ывали C, его овали честве рад м бы для эксперимента элек жки ДНК-бел диоактивно меченой проб ктрофоретической задерж лковых ком еле. На дорож оказана кодирующая цепь рожках мплексов в ге жках 1 и 2 по р ь фрагмента ДНК; на дор 3 и 4 - некодирующая цепь. Последовате НК, не вошедш белковый ком и ельности ДН шей в ДНК-б мплекс МK н -й и 3-й доро К, с й я Kl показаны на дорожках 1 и 4; а на 2- ожках, та ДНК которой образовался МKl ком д и 3 указаны остатки гуани рующей и (+839, значен мплекс. На дорожках 2 и о ина на кодир цепи обоз чер овалом и на некодирующей цепи (+840 обозначен звездочкой) защищенные от рным м) к 0, ), дей пипе наком оса чена жная ь йствия еридина. Зн вопро обознач возмож область защиты G на нек ), епень щиты ровня ы кодирующей цепи (+837) однако сте его защ в пять раз ниже ур защиты G в пол ложениях +839 и +840.

1.2 Кл ние нового чного к метилирован белка Каи лонирован о специфич нию ДНК б изо.

Для иденти щего тилированн посл ность я ификации белка, связывающ мет ную ледовательн CGCGCCC ышиного ге 4 (Sm) был вана следую а эксперим CAACG мы ена S100A4 ла реализов ющая схема мента:

гельфильт е нирование ядерных белковых экстрактов из клеток линии К5 с трационное фракцион б э к 5использов с S ых ций тодом ванием смолы Sephacryl S-300; анализ собранны фракц мет электрофо и ДНК-белковых комп г ользованием тивно оретической задержки к плексов в геле с испо м радиоакт меченой метилиров m довательнос аффи хро ия нных ванной Sm послед сти; инная оматографи отобран фракций, дающих об е специфич ке с Sm-сеф ис.5).

д бразование чного МК1 комплекса, на колонк фарозой (ри Анализ аф ф люированны н чатым соле иентом пок ффинных фракций эл ых с колонки ступенч евым гради казал, что специ к Д вует фракции с концентра ифичный к метилированию ДНК белок присутств во ф ацией хлорида кальция 300 рис.5).

0-400мМ (р Рисунок 5. Анализ аффинных белковых фракций на присут тствие спе ованию К тодом жки жности ецифичного к метилиро ДНК белка мет задерж подвиж ДН х сов диоактивно меченая пр - НК-белковых комплекс в 4% ПААГ. Рад роба дву й еотид, жащий ментативно модифицирова уцепочечный олинонукле содерж ферм м анную Sss метилтран m ательность. Н l-й дорож для контроля sI нсферазой Sm последова На жке н обр пецифичного МКl комп в ре связы с пробой разования сп о плекса еакцию ывания п доб ядер белковы экстракты из клеток л К562 и 0.4М фрак в бавляли рные ые ы линии кция дор 15 и 16 в присут 100 кратного мол избы специфи рожки тствии к лярного ытка ичного конкурента ДН метилиро и неметилирова Sm по ности, н НК: ованной н анной оследовательн соо о. ках п реакцию доб аффи ответственно На дорожк с 4-й по 14-ю в р бавляли инные фракции, собранные в пр 0 КCl ре. с рисутствии 0.1M-l.5М К в буфер Комплекс МКl обо лкой.

означен стрел Фр ование 0.4М ой фракции рирующем полиакрил г ракциониро М аффинно и в денатур ламидном геле и покраска геля сереб показ что она содерж смесь белков, о н бром зали, жит основными компонентами которой являлись белки с мо й к и арактеризо я олекулярной массой 100- 120 кДа. Белки были оха ованы методом масс-спект у ором анном (EM трометрии в сотрудничестве с Докто Матиасом Ма MBL, Heidelberg Одним из опр х я П нении g). м ределенных белков оказался белок Каизо. При сравн аминокисл оследовател елка едовательностями из базы дан лотной по льности бе Каизо с после з нных выяснилос что он является человеческим гомол гена мыши, от п ности сь, н логом ткрытого по способн связыватьс с катени р120 практичес одновр п ию 9 анной ся ином ски ременно (по состояни на 1999 год) с да работой, но независ проф сом иверситета Вандербил (Нэшвилль, н симо, фессором Рейнольдс из уни льт США a ds 1999). Основные домены бел А)(Daniel and Reynold О д лка Каизо: на С-конце три ДНК на "цинковы " типа С2Н конце домен К-связывающих домен ые пальцы" Н2, а на N к н под назва BTB (по сокращен наз nger).

анием B/POZ о нному званию Рох viruses и Zinc fin Анал баз дан показ что бе Каизо представл во многих органи лиз нных зал, елок лен измах (рыбах, земново екопитающ одных, мле щих).

Рисун 6. Мон ые ла о игают ил-ДНК-белк нок ноклональны антител к Каизо суперсдви мети ковый компл подтв астие о бразовании. Метилирова Sm пробу лекс, верждая уча Каизо в его об анную инкуб дерными экстрактами из клеток лини бразовавшим к бировали с яд ии К562. К об мся ДНК-белковым комплексам добав на 2-й дорожке - моноклон титела изо л вляли: 2 нальные ант к Каи 6F; на 3-й - неспе р имеразе, PAR сдвигали комплекс;

ецифические антитела (к поли АДФ рибозил поли RP) не суперс на пе дорожк в реакцию связывани антитела не добавлял инкубиро и разд ервой ке ю ия ли; овали деляли проду реакции в неденату 4 К Каизо а й укты и урирующем 4% ПААГ. Комплекс с К обозначен стрелкой c С.

Супер а к значен стрелкой с SS. Зве трелкой обозн рсдвинутый антителами комплекс обоз ездочка со ст начает ДНК-белковый ком дуктами дегр ко мплекс с прод радации белковой фракции.

Моно ые тела он оклональны антит (кло 6F, Upstate), полученны к эп К ые питопам Каизо, с высокой эффективностью суперсдви ил-специфи плекс МКl в эксперим игают мети ичный комп менте по электрофо ке елковых комплексов в геле оретической задержк ДНК-бе к (рис.6).

Рисунок 7. Анализ ра я ши щью аспределения Каизо в тканях мыш с помощ блот Нозерн бло ации. гибридизация тотальной РНК, выде ыши, от-гибридиза Блот-г я еленной из из разных органов мы с [-32P]дАТФ НК гена Каиз Ф меченой ДН зо человека.

Экс К а ых х Максималь экспре спрессия Каизо была изучена в различны органах мыши. М ьная ессия гена обна я и, ке ках. к Каизо мером аруживается в печени селезенк и в почк Однако, мРНК К разм 5-6 кп.н.

присутств х рассмотре шиных орга 7).

вует во всех енных мыш анах (рис.1.3 Изучен связывающ тв рекомбинантного ние ДНК с щих свойст о белка Каизо Чтобы отв в жет ли бел у м нную посл ность ветить на вопрос, мож лок Каизо узнавать метилирован ледовательн ДНК, и какой име домен ответств за это узнаван и свя авлен к енно н венен э ние язывание, был поста экспериме по задержке ДНК-белковых комплексов в геле с метил ент к о лированной и неметилир п тельностью Sm очищ нтных ков Каизо, рованной последоват ю щенных рекомбинан белк GST-К полученны за счет трансфо ых нтов К Б ых т ормации в бактерии различны фрагмен кДНК Каизо. Было показано (рис.8), что нантный бе Каизо (1-672 а.о.) обра л-специфич ( о рекомбин елок GST-К азует метил чный ДНК белковый комп мметрично метилиров следователь m и к плекс с сим ванной пос ьностью Sm. Удаление Nконцевого TB/POZ не ющих свой. Минимальный о домена BT е изменяет метил-ДНК-связываю йств Каизо.

размер белка, кот ецифично связывал метилир ательность Sm б торый спе рованную последова соответств амин м К к ами 82, е т вовал нокислотам белка Каизо с координата 480-58 которые содержат три “цинковых ельно, впер п ч н типа «цин льцы» х пальца”. Следовате рвые было показано, что домен нковые пал способен с но узнавать ично метили ю ДНК.

специфичн ь симметри ированную Рисунок 8. Изуч НК-связываю войств чение ДН ющих св рекомбина белк Каизо (rК В реакцию связы антного ка Каизо). ывания добавляли различное количество р тных к рекомбинант белков GSTКаизо (1-67 а.о.) и GST-Каизо (113-672 а.о.) 10, 3 и 1 нг, что 72 G н указано тр м ожками. Спе реугольником над доро ецифичный ДНКбелковый комплекс образуется л с мет й о лишь тилированной Sm последовате Д равой и нтный ельностью ДНК. На пр панели рекомбинан белок GST-Каизо (410-6 азует метил сп 672 а.о.) обра пецифичные ДНКбелковые комплексы с последоват A к тельностями ДНК Sm, Asm и AASm. Вид что введ допол н м дно, дение лнительного нуклеотида между CpG парам 1 и 2 приводит к ослаблению ДНК-белкового ми к ю к комплекса.

Из одство рекомбинан зменится ли сро нтных цинковых пальцев белка К к метилирова х Каизо м анной последова и, у елены ательности если CpG пары будут разде дополнит дами? Дл выясн тельными нуклеотид ля нения предпочти я p и последовате и ительного расстояния между тремя CpG парами в Sm п ельности и их нуклеотид окру ыл ден римент по задержке в геле ДНК-белковых дного ужения бы провед экспер о е к комплексов, образов екомбинант белком GST-К (410- а.о.) и различн о ванных ре тным к Каизо -672 ными модифика m ти (таблица зано, что 3- ра не важна для ациями в Sm последовательност а 2). Показ -я CpG пар связывани К ывает после ности ДНК, щие лишь две CpG па ия, белок Каизо связы едовательн, содержащ д ары, в то время как расст ежду G но шать тояние ме 1-й и 2-й CpG парами не должн превыш двух-трех нуклеотид а метилиро итозина на тимин при отере связы блица дов. Замена ованного ци иводит к по ывания (таб 2). Таким образом, показано, что рекомбинантный белок Каизо проявляет свои метил ДНКсвязывающие свойства через “цинковые пальцы”.

Таблица 2. Связывание рекомбинантных “цинковых пальцев” белка Каизо с метилированными последовательностями ДНК.

Проба Последовательность ДНК Связывание Sm CAGCAGCMGMGCCCAAMGCTGGGA ++++ Sm-A CAGCAGCMGAMGCCCAAMGCTGGGA +++ Sm-AA CAGCAGCMGAAMGCCCAAMGCTGGGA ++ VIRTUAL CAGCAGCMGAAAMGAAAMGCTGGGA + ASm CAGCAGCMGMGCCCAAAMGCTGGGA +++ AASm CAGCAGCMGMGCCCAAAAAMGCTGGGA +++ CCSm CAGCAGCMGMGCAAMGCTGGGA +++ CG3SM CAGCAGCMGMGCCCAACTGGGA +++ 1A2Sm CAGCAGCMGAMGCCCAACTGGGA +++ 2A2Sm CAGCAGCMGAAMGCCCAAGCTGGGA + Sm-TG CAGCAGCTGTGCCCAATGCTGGGA - AACG-Sm CAGCAGCAAMGCCCAACTGGGA +/- TGCG-Sm CAGCAGCTGMGCCCAACTGGGA + CGTG-Sm CAGCAGCMGTGCCCAACTGGGA - CGCA-Sm CAGCAGCMGCACCCAACTGGGA - CACG-Sm CAGCAGCCAMGCCCAACTGGGA - Константа диссоциации ДНК-белкового комплекса полноразмерного рекомбинантного белка Каизо и последовательности ДНК Sm, измеряемая в эксперименте по задержке ДНК-белковых комплексов в геле, равна 1 микромолю для неметилированной Sm последовательности и наномолю для метилированной Sm последовательности. Для сравнения, домен MBD связывается с единственной CpG парой в пределах 10 наномолей (Free, Wakefield et al. 2001). То есть Каизо демонстрирует наибольшее сродство к метилированной ДНК из всех известных метил ДНК связывающих белков.

1.4 Белок Каизо является метилзависимым транскрипционным репрессором in vivo.

Большинство белков BTB/POZ семейства являются репрессорами транскрипции. Будет ли Каизо подавлять транскрипцию репортерных генов в клетках млекопитающих, и будет ли репрессия зависеть от статуса метилирования последовательности ДНК промотора репортерного гена? Чтобы избежать эффекта молчания метилированной ДНК конструкции репортерного гена за счет эндогенных метил-ДНК зависимых репрессоров, таких как MBD1, MBD2 и других, были использовали клетки мышиных фибробластов с генетическим нокаутом гена Mbd2 (в дальнейшем используется обозначение Mbd2(-/-) клетки). В клетках Mbd2 (-/-) уровень репрессии метилированных репортерных генов значительно снижен, по сравнению с диким типом клеток (Hendrich, Guy et al. 2001). Репортерная конструкция несла в себе ген светлячковой люциферазы (firefly) под контролем SV40 промотора, а также 11 консенсусных участков связывания белка Каизо. Как и ожидалось, уровень транскрипционной активности полностью метилированной репортерной конструкции в клетках Mbd2 (-/-) составил 30-35% от уровня транскрипции неметилированной репортерной конструкции в тех же клетках.

Риcунок 9. Белок Каизо in vivo подавляет транскрипцию метилированных репортёрных генов. В эксперименте по временной трансфекции совместно трансфецировали в мышиные клетки Mbd2 (-/-) (серые столбики) и клетки Mbd2 (+/-) (используются в качестве контроля как дикий тип, белые столбики) репортёрная конструкция с геном репортёром светлячковой люциферазы под контролем SV40 или Pgk промоторов и конструкция, экспрессирующая различные формы белка Каизо. Относительная активность репортера представляет из себя процент уровня экспрессии репортёрного гена с метилированной конструкции относительно уровня экспрессии репортёрного гена с неметилированной конструкции.

Представленные результаты являются усреднением как минимум трех независимых экспериментов.

Экспрессия в клетках полноразмерного белка Каизо понизила уровень экспрессии репортёрной конструкции приблизительно в 6 раз до 5-7% от уровня неметилированного контроля (рис.9). Усиления уровня репрессии репортерного гена не было замечено в случае коэкспрессии в клетках форм белка Каизо без BTB/POZ домена (КаизоPOZ), без “цинковых пальцев” (КаизоZF) и без всех функциональных доменов (КаизоPOZ+ZF). Таким образом, Каизо может восстановить репрессию метилированных генов в дефектных Mbd2 (-/-) клетках, но для этого белку Каизо необходимы одновременно все его функциональные домены, т.е. BTB/POZ домен и “цинковые пальцы”.

Чтобы проверить способность Каизо репрессировать промотор, который метилирован в природных условиях, был выбран промотор мышиного гена фосфоглицерат киназы (Pgk), который молчит и метилируется в клетках благодаря инактивации Х хромосомы. Этот промотор содержит консенсусные участки связывания белка Каизо и связывается с ним in vitro при наличии метилирования CpG пар в последовательности ДНК Коэкспрессия Каизо в Mbd2 (-/-) клетках заметно снижает уровень транскрипции репортерного гена, находящегося под контролем промотора гена Pgk, в случае метилирования репортерной кострукции с 7% до 2% (рис.9). Схожие результаты по восстановлению репрессии метилированных репортерных конструкций, находящихся под контролем SV40 и Pgk промоторов, в Mbd2 (-/-) клетках были получены для белков Mbd2 и MeCP2 (Guy, Hendrich et al. 2001; Hendrich, Guy et al. 2001). Таким образом, Каизо является метил зависимым репрессором транскрипции со свойствами, сравнимыми с другими метил-ДНК связывающими белками, такими как Mbd2 и MeCP2.

1.5 Белок Каизо взаимодействует с отцовским метилированным районом H19 DMR.

Для определения потенциальной способности Каизо участвовать в основных процессах, связанных с метилированием ДНК, были выбраны в качстве модели импринтные гены.

Импринтные гены могут быть использованы как уникальная система для изучения эпигенетических процессов: отцовский и материнский аллели отличаются как уровнями метилирования ДНК, экспрессии генов, так и модификациями гистонов. В случае H19/Igf2-локуса материнский (неметилированный) аллель DMR является внутренним контролем при исследовании процессов, связанных с метилированием ДНК. Для изучения метилспецифичности связывания Каизо с районом H19 DMR в данном участке был картирован рестрикционный полиморфизм между подвидом Mus. musculus domesticus и видом Mus. spretus (рис.10а). ПЦР-продукт, соответствующий данному участку может быть полностью расщеплён рестриктазой HaeIII только в том случае, если в качестве матрицы для ПЦР была использована ДНК подвида Mus. musculus domesticus.

Рисунок 10. Взаимодействие Каизо с метилированным аллелем H19 DMR.

А. Картирование рестрикционного полиморфизма в районе H19 DMR.

ПЦР с последующей рестрикцией продукта HaeIII эндонуклеазой. В качестве матрицы использована ДНК следующих видов мышей: Dom. – Mus.musculus domesticus; Spr. – Mus.

spretus; Dom.xSpr. – Mm.domesticus x M.spretus. Б. Иммунопреципитация хроматина с антителами к белку Каизо и CTCF с последующей ПЦР и рестрикцией продукта HaeIII. «-Ab» – контроль без антител; «+» – положительный контроль для ПЦР. МГ – в метилированной форме; ЦГ – в неметилированной форме.

В случае, если была использована ДНК вида Mus. spretus или гибрида Mus. musculus domesticus/Mus. spretus ПЦР-продукт, соответственно, не может быть расщеплён вообще или может быть расщеплён только частично. В экспериментах по иммунопреципитации хроматина был использован хроматин, полученный из печени гибридной мыши Mus. musculus domesticus/SD7, причём при скрещивании самец принадлежал линии C57Black (Mus. musculus domesticus), а самка – линии SD7. Данная линия была искуственна получена в лабораторных условиях на основе линии C57Black (Mus. musculus domesticus) и характеризуется тем, что в её хромосомном наборе обе 7 хромосомы частично заменены на хромосомы, принадлежащие виду Mus. spretus. Таким образом, потомство от скрещивания особей линий C57Black и SD7 имеет тот же точечный полиморфизм между отцовским и материнским аллелями, что и потомство от скрещивания особей, принадлежащих к видам Mus. spretus и Mus. musculus domesticus (рис.10а).

Иммунопреципитационный и алелль сецифический рестрикционный анализ показал, что белок Каизо взаимодействует только с отцовским метилированным аллелем H19 DMR, тогда как CTCF можно было детектировать только на неметилированном материнском аллеле (рис. 10б).

Таким образом, показано, что Каизо in vivo связывается с метилированными последовательностями.

1.6 Семейство Каизо-гомологичных белков 1.6.1 Два новых белка ZBTB4 и ZBTB38, гомологичных Каизо, узнают метилированную ДНК in vitro.

Белок Каизо связывается с метилированной ДНК за счет цинковых пальцев, поэтому было предположено, что существуют и другие аналогичные белки с цинковыми пальцами, которые смогут узнавать метилированную ДНК. На основе поиска по базе данных данных NCBI, RefSeq проект были найдены два белка, гомологичные Каизо: ZBTB4 и ZBTB38 (рис.11). Эти белки имеют три гомологичных цинковых пальца и похожую доменную структуру всего белка : на Nконце все три белка содержат BTB/POZ домен. ZBTB4 и ZBTB38 более схожи друг с другом, чем с Каизо.

Рисунок 11. ZBTB4 и А ZBTB38 содержат цинковые пальцы, гомологичные Каизо. А. Выравнивание участка Каизо, содержащего три цинковых пальца, с B ZBTB4 и ZBTB38. Три цинковых пальца выделены.

Аминокислоты, совпадающие у трёх белков, отмечены звездочками. В. Структура Каизо, ZBTB4, ZBTB38.

Белки выровнены по трем гомологичные цинковые цинковым пальцам.

цинковые Глутамин-богатый домен пролин-богатый Эксперименты по задержке комплексов белок-ДНК показали, что ZBTB4 и ZBTB38, также как и Каизо, обладает сродством к метилированным последовательностям ДНК in vitro(рис.12а).

Рисунок 12. ZBTB4 и ZBTB38 связываются с метилированной ДНК in vitro и in vivo. ZBTB4 и ZBTB38 подавляют транскрипцию in vivo на метилированных матрицах ДНК. А,-Цинковые пальцы Каизо, ZBTB4, ZBTB38 были экспрессированы в кроличьих ретикулоцитных лизатах.

Полученные белки инкубировали с меченой (А.метилированной или неметилированной пробой) и разделяли полученные комплексы в 6% ПААГ.Б- Метил-специфичное связывание Каизо, ZBTB4 и ZBTB38 c метилированным участком DMR локуса Igf2/H19. Верхняя панель: хроматин иммунопреципитация с антителами, указанными на рисунке. Нижняя панель:

ДНК была выделена из агарозного геля (см. верхнюю панель) и рестрицирована HaeIII. В-метилчувствительный экспрессионный анализ.Конструкции, с которых экспрессировались белки, были совместно транзиторно трансфецированы с метилированной, либо неметилированной SV-40 репортёрной конструкцией.

Относительная репортёрная активность рассчитывалась следующим образом:

уровень экспрессии с метилированного репортёра/уровень экспрессии с неметилированого репортёра*100. На диаграмме приведены усредненные данные трёх экспериментов.

Используя импринтный локус Н19/Igf2 как модельную систему (как было описано раннее), удалось показать, что in vivo ZBTB4 и ZBTB38 связываются с метилированным отцовским аллелем Н19 (рис.12б). Метил-чувствительный эксперимент подтвердил, что оба гомолога Каизо являются метил-зависимыми репрессорами (рис.12в).Таким образом, ZBTB4 и ZBTB38 ведут себя также как и белки MBD семейства и белок Каизо: связывают метилированные CpG in vitro и in vivo (рис.12а,б), подавляют транскрипцию с метилированной матрицы (рис.12в).

Рисунок 13. ZBTB4 и ZBTB38 связываются с метилированной ДНК в клетках.. А-ZBTB4 и ZBTB38 были транзиторно трансфецированы в NIH3T3. Трансфецированые клетки были зафиксированы и окрашены либо преиммуной сывороткой (PI), либо антителами к данным белкам: -ZBTB4 и -ZBTB38. Затем клетки были обработаны вторичными антителами, конъюгироваными с Alexa Fluor® 488, которые флуоресцируют в том же диапазоне, что и GFP.

Сигнал после окрашивания антителами к ZBTB4 и ZBTB38 совпадает с хромоцентрами, окрашенными DAPI.Б- RFP-ZBTB4 и RFPZBTB38 были транзиторно трансфецированы в dnmt1-/-,p53-/- клетки, в которых нарушено метилирование. Трансфецированые клетки были зафиксированы и окрашены DAPI.

представлены по два типа клеток I тип клеток:

ZBTB4 и ZBTB38 уходят с хромоцентров в клетках с нарушенным метилированием ДНК.

II тип клеток, в которых ZBTB4 и ZBTB38 попрежнему остаются на хромоцентрах.

Известно, что в ядрах мышиных клеток области различных хромосом, содержащие большие и малые сателлитные повторы, которые метилированы, агрегируют и образуют структуры, называемые хромоцентрами. Эти структуры хорошо детектируются с помощью микроскопа, поскольку они хорошо окрашиваются специальным красителем DAPI. Оба белка ZBTB4 и ZBTB38 при трансфекции в мышиные клетки были локализованы в хромоцентрах (рис.13а). Для того чтобы понять, за счёт чего ZBTB4, ZBTB38 в клетках оказываются на хромоцентрах, а именно, влияет ли то, что ДНК в хромоцентрах метилирована на локализацию данных белков, были использованы клетки с нарушением метилирования. Это мышиные эмбриональные фибробласты, у которых удалён каталитический домен ДНК-метил трансферазы1. В данных клетках значительно понижен уровень метилирования ДНК (но всё же остаточное метилирование присутствует благодаря de novo метилтрансферазам DNMT3a,3b). Но, поскольку, удаление Dnmt-1 летально для клеток, так как клетки умирают по p53 зависимому пути (JacksonGrusby et al., Nat. Genetics,2001), то были использованы клетки, в которых отсутствуют и Dnmt-1 и p53 (клетки были любезно предоставлены/ профессором Бёрдом (Adrian Bird), которые жизнеспособны, в качестве контроля использовали мышиные эмбриональные фибробласты с удаленным геном p53. При трансфекции в контрольные клетки RFP-ZBTB4 и RFP-ZBTB38 эти белки были локализованы в хромоцентрах. При трансфекции в (dnmt1-/-,p53-/-) клетки ZBTB4 и ZBTB38 в примерно 60% клеток оказываются распределенными диффузно по всему ядру и только в 30-40% клеток по-прежнему локализованы в хромоцентрах (рис.13б). Аналогичная ситуация наблюдалась при трансфекции в эти же клетки другого метил-ДНК связывающего белка MeCP2.

Возможно, что данные белки могут также узнавать саму структуру гетерохроматина, а не только статус метилирования ДНК. Тем не менее, данный эксперимент позволяет сделать вывод, что ZBTB4 и ZBTB38 связывается с метилированой сателлитной ДНК in vivo.

Таким образом, было обнаружено новое семейство белков, узнающих метилированную ДНК и являющихся метил-зависимыми репрессорами.

2. Удаление гена Каизо в различных организмах Для выяснения биологической функции белка Каизо в живых организмах было решено произвести удаление гена, кодирующего белок Каизо, из геномов различных видов организмов:

лягушки (хКаизо), рыбы (dКаизо) и мыши.

2.1 хКаизо необходим для нормального развития лягушки Хenopus Laevis Для изучения возможного участия Каизо в регуляции развитии лягушки были проведены инъекции антисмысловыми олигонуклеотидами морфолино хКаизо (КМО), соответствующими 5’нетранслируемому району и первым шести кодонам, в эмбрионы лягушки на стадии деления двух клеток. Это привело к эффективному подавлению трансляции белка Каизо (рис. 14). Инъекция 10нг контрольных олигонуклеотидов морфолино не повлияла на развитие эмбрионов (см. таблицу 3, рис. 14а).

Таблица 3. Эксперимент по микроинъекции олигонуклеотидов морфолино в эмбрионы лягушки MO/РНК инъецированная Фенотип на стадиях 15-21 Фенотип на стадиях 33/ Успешная Гибель во Гибель Spina bifida Нормальны нейруляци время после (незакрытая й фенотип я нейруляци нейруляци нервная на стадии и и трубка и 33/ короткая ось) Контрольное MO 10 нг 46 (92%) 0 2 (4%) 4 (8%) 44 (88%) KMO 10 нг 0 97 (100%) 0 KMO 5 нг 0 0 25 (50%) 24 (48%) 1 (2%) spina KMO 0.5 нг 72 (72%) 0 4 (4%) bifida 44 (44%) 28 (28%) spina bifida 24 (24%) короткая ось KMO 5 нг/750 пг дикий тип hКаизо 28 (61%) 11 (24%) 16 (35%) 7 (15%) 12 (26%) KMO 5 нг/375 пг дикий тип hКаизо 22 (44%) 26 (52%) 17 (34%) 5 (10%) 2 (4%) KMO 5 нг/750 пг C31 мутантный 0 0 25 (50%) 23 (46%) 2 (4%) hКаизо 750 пг дикий тип hКаизо 58 (97%) 0 2 (3%) 8 (13%) 50 (83%) Инъекция КМО в количестве от 0.5нг до 10нг привела к потере способности эмбрионов к дальнейшему развитию и возникновению различных, зависящих от дозы КМО, фенотипических изменений эмбрионов (cм. таблицу 3, рис. 14,б-д). Характерной чертой инъекции 5нг КМО является появление белых апоптотических клеток вблизи бластопора в стадии нейруляции (рис.14). На стадии 21-22 КМО развитие останавливается, и поверхность эмбрионов покрывается белыми апоптотическими клетками, которые связаны с эффектом сшелушивания клеток с поверхности эмбрионов (рис.14в). Введение меньших доз КМО приводит к появлению менее значительных фенотипических отклонений с задержкой закрытия бластопора на стадии (рис.14г). Большинство из развившихся инъецированных КМО эмбрионов до стадии головастика короче в длину или имеют нарушения верхних дорсальных структур (spina bifida) (рис. 14д).

Фенотипически эффект введения в эмбрион КМО похож на картину развития эмбрионов, у которых снижен уровень ДНК-метилтрансферазы1 (xDnmt1) (Stancheva and Meehan 2000) (рис. 14е).

Рисунок 14. Фенотип эмбрионов лягушки с пониженным уровнем белка хКаизо. А- введение в эмбрион 10нг контрольных МО (СМО), стадия 15; Б,В- после введения в эмбрионы 5 нг КМО, стадия 15 и 21соответсвенно; Г- после введения в эмбрион 0.5 нг КМО, стадия 15;. Д- набор фенотипов у эмбрионов с введенным КМО (0.5нг): 44% эмбрионов выглядят нормальными на cтадии 38 (верхний эмбрион), 29% неспособны развить нормальные дорсальные структуры (spina bifida, нижний эмбрион). Другие фенотипы являются промежуточными между приведенными двумя случаями; Е- фенотип эмбрионов с введенным 10нг МО к хDnmt1. Стрелками указаны апоптотические клетки; Ж- Имунноблот ядерных белковых экстрактов из эмбрионов лягушки дикого типа и инъецированных 5 нг КМО с использованием специфических антител к хКаизо. Сверху указаны стадии развития эмбрионов.

Картина при удалении хКаизо и хDnmtпохожа, а ранее было показано, что снижение общегеномного уровня метилированной ДНК в эмбрионах лягушки приводит к активации транскрипции генов приблизительно на два цикла развития раньше нормы (Stancheva and Meehan 2000;

Stancheva, El-Maarri et al. 2002).

Рисунок 15. Снижение уровня белка хКаизо ведет к преждевременной активации транскрипции генов, регулируемых xDnmt1. А- Детекция активации транскрипции генов путем измерения включения радиоактивномеченного [35S]УТФ в эмбрионах дикого типа (WT) и в эмбрионах, иньецированных 0,5 нг КМО; Б- Анализ методом ПЦР в реальном времени РНК из эмбрионов, собранных на стадии 8, дикого типа (WT), инъецированных 5нг КМО и 5нг ДМО, на наличие транскриптов генов xOct-25, xBef, xDrak1, регулируемых хКаизо и хDnmt1. Ген xODC был выбран в качестве контроля.

Поэтому наличие преждевременной активации генов в эмбрионах лягушки со сниженным уровнем белка хКаизо в результате введения КМО было решено проверить путем измерения включения на стадиях бластулы и гаструлы радиоактивно меченного изотопом серы [35S]-УТФ в эмбрионах лягушки дикого типа и в инъецированных КМО. Как и ожидалось, в контрольных эмбрионах дикого типа активное включение УТФ начиналось после стадии сдвига в средней бластуле (МidВlastulaТransition). Однако, в эмбрионах с введенными КМО, у которых был снижен уровень белка хКаизо активное включение радиоактивно-меченного [35S]-УТФ начался на два цикла раньше (рис.15), в полной аналогии с эффектом снижения уровня Dnmt1 в эмбрионах лягушки(Stancheva and Meehan 2000).

Полученные данные позволяют предположить, что xDnmt1 и хКаизо принимают участие в одном и том же пути, подавляя экспрессию генов в эмбрионах лягушки до стадии МВТ.

2.2 dКаизо является необходимым для развития Danio Rerio Для определения роли белка Каизо в развитии рыб был поставлен эксперимент, аналогичный проведенным на лягушке. Были использованы флуоресцентно меченые морфолино к dКаизо, которые имеют ту же специфичность действия, что и немеченые. Морфолино dKMO инъецировали в эмбрионы на стадии 1-4 клеток. По прошествии 24 и 48 часов развития проводился анализ морфологии и проводился подсчет выживших эмбрионов (рис.16). Эмбрионы с введенными морфолино имели значительно больший процент смертности к 48 часам развития:

89% по сравнению с 17% у эмбрионов с введенными контрольными неспецифическими морфолино.

Рисунок 16. Белок Каизо Danio rerio необходим для развития рыб. Фенотип КМО инъецированных эмбрионов сравнивался с контрольными через 24 часа после оплодотворения. На нижней панель приведен флуоресцентный анализ через 24 часа после введения флуоресцентно меченых морфолино к dКаизо.

Большинство эмбрионов с введенными контрольными морфолино (83%) развивались нормально, однако среди dKMO эмбрионов лишь 2.5% развились нормально, остальные имели различные дефекты развития:

отставание в развитии (8.5%), осевые дефекты и неполное формирование головы. 2.5% нормально развившихся dKMO эмбрионов, однако, имели ненормальные нервные ответы, по сравнению с контрольными эмбрионами (данные не приведены). Эти эффекты введения dКМО в эмбрионы рыб аналогичны ранее описанным эффектам истощения белка dDnmt1(Stancheva and Meehan 2000), что повторяет картину, которая наблюдалась в экспериментах у лягушки, описанных выше.

2.2 Создание и анализ мыши с генетическим нокаутом по гену Каизо 2.2.1. Генетический нокаут гена Каизо в мыши не приводит к проявлению патологического фенотипа Генетический нокаут гена Каизо в мыши был осуществлен методом кондиционного нокаута. Для подтверждения делеции гена Каизо использовали методы иммуноблота и Нозерн-блот гибридизации (рис. 17). Анализ ядерных белковых экстрактов из печени мыши дикого типа и с нокаутом по гену Каизо методом задержки ДНК-белковых комплексов в геле показал, что метилспецифичный комплекс KGB не образуется в случае ядерных белковых экстрактов из печени мыши с нокаутом по гену Каизо.

Рисунок 17. Поодтверждение наличия нокаута по гену, кодирующему Каизо.

А. Нозерн-блот анализ тотальной РНК из тканей (мозг, печень, почки, селезенка) животных дикого типа и нокаутных по гену Каизо. EtBr – агарозный гель, прокрашенный бромистым этидием перед блотированием. Б. Иммуноблот ядерных экстрактов ткани (печени) животных дикого типа и нокуатных по Каизо. WT – ткани животных дикого типа; KO – нокаутных по гену Каизо. Полоса Каизо соответствует молекулярному весу 100кД. Нижняя панель демонстрирует иммуноблот на IkB-альфа белок как внутренний контроль.

Антитела к белку Каизо эффективно сдвигают KGB, но не оказывают влияния на другие ДНК-белковые комплексы, образующиеся в случае мутантных по Каизо экстрактов (рис. 18).

Несмотря на то, что у лягушки и у рыбы отсутствие Каизо приводило к остановке развития эмбрионов, мыши, мутантные по гену Каизо, не показали ни какого патологического фенотипа и могут поддерживаться в виде устойчивой линии более 10 поколений.

Рисунок 18. Анализ ядерных белковых экстрактов из печени мыши дикого типа и с нокаутом по гену Каизо методом задержки ДНКбелковых комплексов в геле. В качестве радиоактивно меченой пробы использовали фрагменты ДНК либо с метилированной (M+CG11), либо неметилированной (CG11) последовательностью ДНК. Нижний ДНКбелковый комплекс, образованный M+CG11 и белковыми экстрактами дикого типа, является метил-специфичным комплексом, образованным Каизо (KGB). На дорожках альфа-Каизо нанесены реакции связывания с добавленными в реакцию специфическими антителами к белку Каизо (ZFH6).

Мыши имели нормальный вес, давали жизнеспособное потомство нормального размера. В работе (Yoon, Chan et al. 2003) было показано, что в клетке Каизо взаимодействует с корепрессором N-CoR. Известно, что N-CoR участвует в процессах регуляции развития центральной нервной системы, эритроцитов и тимоцитов. Было решено проверить влияние отсутствия белка Каизо на функции этих тканей. Однако анализ кровяных телец мыши с удаленным Каизо не выявил серьезных отличий от крови мыши дикого типа по составу фракций белых и красных кровяных телец и их морфологии.

Для определения роли Каизо в поддержании плюрипотентности стволовых клеток и их воспроизведении были получены клеточные линии нейрональных стволовых клеток из Каизо +/y и Каизо -/y ЭС клеток. Нейрональные стволовые клетки нокаутные по гену Каизо не отличаются по морфологии и эффективности пролиферации от стволовых клеток нейронов мыши дикого типа.

Дифференцировка полученных нейрональных стволовых клеток в постмитотические нейроны и астроциты показала, что обе клеточные линии были неотличимы друг от друга. Значит, функция Каизо не важна для нейрональной специализации, Каизо не влияет на выживаемость стволовых клеток нервной системы, а также на дифференцировку нейрональных и астроглиальных клеток ex vivo.

2.2.2. Делеция Каизо приводит к усилению экспрессии гена Tctex1.

Методом гибридизации на микрочипах был проведён глобальный анализ изменения уровня экспрессии 30 тыс. генов у Каизо-нокаутных мышей. Идентифицирован ряд генов, транскрипция которых оказалась изменена при отсутствии Каизо. Геном с наиболее выраженным увеличением уровня экспрессии оказался ген Tctex1, кодирующий лёгкую цепь динеинового комплекса (Tai, Chuang et al. 1998). Данные гибридизации были подтверждены Нозерн-блот анализом, для которого была использована РНК, полученная из органов (печени и мозга) мышей дикого типа и нокаутных по Каизо (рис. 19). Уровень экспрессии Tctex1 оказался в 4,4±0,6 раза выше в печени нокаутных животных, чем в печени животных дикого типа и в 2,6±0,2 раза выше в мозге животных с делецией гена, кодирующего Каизо, чем в мозге животных дикого типа (рис. 18б).

Рисунок 19. Увеличение уровня экспрессии гена Tctex1 в тканях мышей, нокаутных по Каизо. А.

Нозерн-блот анализ тотальной РНК, выделенной из печени животных дикого типа и Каизо-нокаутных. Верхняя панель – гибридизация с зондом к мРНК гена Tctex1, нижняя панель – гибридизация с пробой к 26S рРНК. Б. Статистический обсчет результатов Нозерн-блот гибридизации РНК, выделенной из печени и мозга животных дикого типа и нокаутных по Каизо. ЕЛ/мм2 – удельная интенсивность радиоактивности геля в районе специфического транскрипта. WT – ткани животных дикого типа, KO – нокауных по Каизо.

При анализе базы данных Entrez Map Viewer было установлено, что в геноме мыши содержится два гена Tctex1: на 17 и 6 хромосомах. При этом ген, находящийся на 17 хромосоме имеет более сложную интрон/экзонную структуру и включает 5 экзонов, тогда как кодирующая часть гена, расположенного на 6 хромосоме состоит из одного экзона (рис.20а). Анализ последовательностей генов Tctex1 позволил идентифицировать рестрикционный полиморфизм в последовательностях мРНК (в гене, расположенном на 17 хромосоме, сайт узнавания рестриктазой MspI отсутствует, рис.20в).С помощью иммунопреципитации хроматина было показано, что Каизо взаимодействует только с CpG-островком гена Tctex1, расположенного на 17 хромосоме. Интересно отметить, что ацетилирование гистонов Н3 и Н4, являющееся маркером активного хроматина, было детектировано в той же области одновременно со связыванием Каизо.

При этом ни взаимодействия Каизо, ни ацетилирования гистонов в районе промотора гена, расположенным на 6 хромосоме детектированно не было (рис. 20б). ОТ-ПЦР рестрикционный анализ показал, что в препаратах тотальной РНК, полученной как из органов животного дикого типа, так и из органов Каизо-нокаутной мыши не содержится транскрипт, соответствующий гену Tctex1, расположенному на 6 хромосоме (рис. 20в, нижняя панель). Таким образом, можно заключить, что Каизо взаимодействует только с геном Tctex1, расположенным на 17 хромосоме, тогда как на 6 хромосоме, вероятно, находится нетранскрибируемый псевдоген.

Рисунок 20. Каизо взаимодействует с геном Tctex1 на 17, но не на 6 хромосоме. А. Схематическое изображение двух генов Tctex1, расположенных на 17 и 6 хромосомах. Стрелками обозначены экзоны; направление стелки – направление транскрипции. Б. Взаимодействие Каизо с CpG-островком гена Tctex1 in vivo. Иммунопреципитация хромати-на с антителами ZFH6 – поликлональными к Каизо; anti-Ac H3 – к ацетилированному гистону Н34 anti-Ac H4 – к ацетилированному гистону Н4; PI – сыворотка крови кролика;

«-Ab» – контроль без антител; «-/+» – отрицательный и положительный контроли для ПЦР, соответственно. В. В тканях животных как дикого типа, так и с делецией Каизо экспрессируется только ген, расположенный на 17 хромосоме.

Верхняя панель – полиморфизм в последователь-ностях мРНК двух генов. Заштрихованный нуклеотид – полиморфизм, нарушающий сайт узнавания рестриктазой MspI. Нижняя панель – ОТ-ПЦР и расщеплением ПЦР-продукта ферментом MspI Поскольку Каизо взаимодействует с метилированной ДНК, то было решено проверить статус метилирования участка в районе CpGостровка гена Tctex1методом бисульфитного секвенирования. Для исследования была использована ДНК, полученная из печени мышей дикого типа и с делецией гена, кодирующего Каизо. Были проанализированы две области: «-189; -57» и «+160; +460» по отношению к точке старта транскрипции. В области «-189; -57» метилирование ДНК детектировано не было (проанализировано по 10 клонов для ДНК животных дикого типа и Каизо-нокаутных). Область «+160; +460» характеризуется малым процентным содержанием метилированных CpGдинуклеотидов (проанализировано 20 клонов для ДНК животных дикого типа и 21 – для Каизонокаутных), причем уровень метилирования ДНК не зависит от присутствия Каизо (рис. 21).

Рисунок 21. Анализ CpG-островка гена Tctex1.

Делеция гена Каизо не приводит к изменению метилирования ДНК в районе CpG-островка гена Tctex1.

Верхняя панель – плотность метилирования ЦфГдинуклеотидов на 17 хромосоме в районе гена Tctex1. Серые прямоугольники – экзоны; стрелка – направление транскрипции. Районы 1 и 2 – участки, для которых был исследован статус метилирования.

Поскольку ген Tctex1 экспрессируется и в нормальном организме, можно предположить, что Каизо является модулятором активности гена Tctex1, взаимодействуя с остаточным метилированием ДНК в промоторной области. Таким образом, в результате проведенных исследований продемонстрирована возможность взаимодействия Каизо-содержащего белкового комплекса с последовательностями ДНК, подвергающимися метилированию в результате таких процессов, как геномный импринтинг, опухолеобразование и подавление транскрипции мобильных элементов. То, что нокаут Каизо не приводил к изменению в экспрессии большинства исследованных генов, может быть объяснено наличием «избыточного» количества метил-ДНКсвязывающих белков.

2.2.3. Делеция гена Каизо в мыши приводит к изменению структуры хроматина в районе H19 DMR, но не влияет на уровень экспрессии Н19 и IGFКак было показано выше (см. рис.10б) Каизо может связываться in vivo с метилированным отцовским аллелем в районе Н19 DMR. Для изучения функциональной роли Каизо в районе HDMR были проведен анализ структуры хроматина в районе Н19 DMR (ацетилирование и метилирование гистона Н3, убиквитинирование гистона Н2А) с помошью хроматин иммунопреципитации в животных дикого типа и нокаутных по гену Каизо.

Рисунок 22. Взаимодействие Каизо с метилированным аллелем HDMR. Делеция Каизо приводит к исчезновению убиквитинирования на отцовском аллеле H19 DMR. А. верхняя панель - картирование рестрикционного полиморфизма в D3-районе H19 DMR. А (нижняя панель),Б. Иммунопреципитация хроматина с указанными на рисунке антителами с последующей ПЦР и рестрикцией продукта HaeIII. «-Ab» – контроль без антител; «+» – положительный контроль для ПЦР ЦфГдинуклеотид, содержащий цитозин: МГ – в метилированной форме; ЦГ – в неметилированной форме.

При использовании антител к метилированному по остатку Клибо К27 гистону Н3 или к ацетилированному по остатку Кгистона Н3 разницы в распределении модификаций хроматина между отцовским и материнским аллелями для нокаутных по гену Каизо животных и животных дикого типа детектировано не было (рис.22). Также было исследовано убиквитинирование гистона H2A в районе H19 DMR. Показано, что данная модификация характерна только для отцовского метилированного аллеля. При этом делеция Каизо приводила к полному исчезновению данной эпигенетической модификации в районе H19 DMR (рис.22б). Таким образом, можно заключить, что Каизо способен привлекать убиквитинирование гистона Н2А к метилированным последовательностям ДНК.

Полученные при анализе распределения модификаций хроматина данные позволяют предположить, что Каизо играет важную роль в регуляции экспрессии генов H19 и Igf2.

Поскольку эпигенетические маркёры импринтных генов образуются во время гаметогенеза, можно было ожидать, что отсутствие Каизо во время спермато- или оогенеза приведёт к нарушению импринтинга в исследуемом локусе. Для проверки данного предположения было проанализировано потомство от скрещивания Каизо-нокаутного самца с самкой дикого типа, а также реципроктного скрещивания самца дикого типа с Каизо-нокаутной самкой. В обоих экспериментах животные дикого типа принадлежали к линии SD7. Поэтому потомство от данных скрещиваний имело рестрикционный полиморфизм между отцовским и материнским аллелями как в кодирующей последовательности гена H19, так и в кодирующей последовательности гена Igf2 (рис. 23).

Рисунок 23. Рестрикционный полиморфизм в кодирующих последовательностях генов H19 и Igf2.Делеция Каизо не влияет на уровень экспрессии H19 и Igf2.А.Схематическое изображение ОТ-ПЦР амплифицированных фрагментов с указанием рестрикционного полиморфизма.

Б.Обратная транскрипция с последующим расщеплением рестриктазами NlaIII либо BsaAI. В качестве матрицы для ОТ-ПЦР взята тотальная РНК, выделенная из ткани мышей, полученных от скрещиваний M.spretus () x M.m.domesticus () и ш () x M.spretus ().В.Аллель-специфичная ПЦР в реальном времени. В качестве матрицы для ОТ-ПЦР взята тотальная РНК, выделенная из тканей печени мышей, полученных от скрещивания Каизо-нокаутной самки и самца линии SD7.

При анализе мРНК, выделенной из тканей этих мышей не было детектированно разницы в содержании транскриптов генов H19 и Igf2 между нокаутными животными и животными дикого типа либо гетерозиготными по Каизо (рис. 23в). Таким образом, отсутствие Каизо во время гаметогенеза не влияет на формирование эпигенетических маркёров импринтинга.

2.2.4 Задержка развития рака кишечника в Apc Min/+ мыши с удаленным геном Каизо Ряд фактов привел к мысли о возможном участии Каизо в процессах неопластической трансформации кишечника. Вопервых, накоплено много данных об участии метилирования ДНК в подавлении экспрессии генов в процессе патогенеза рака кишечника (Kondo and Issa 2004). Во-вторых, белок Каизо может взаимодействовать с белком р120-катенином, который в 25% опухолей кишечника перестает экспрессироваться и в 40% опухолей он ненормально экспрессируется или ненормально распределен в клетке Рисунок 24. Удаление гена Каизо приводит к уменьшению размера опухолей и увеличению продолжительности жизни Apc Min/+ мышей. А- Диаграмма Каплана –Майера кривых выживания Каизо -/y Apc Min/+ мышей (пунктирная линия) и Каизо +/y Apc Min/+ -/y Min/+ мышей (непрерывная линия). Мыши Каизо Apc живут значительно дольше (в среднем 317 дней, серая вертикальная линия) мышей Каизо +/y Apc Min/+ (в среднем 217 дней, черная вертикальная линия, Р=0.006 [log шкала] ).

Б- Количество опухолей не изменяется с удалением гена Каизо. Прямоугольники показывают количество аденом на мышь, возникающих к 180 дню и к моменту гибели животного. Горизонтальная линия в прямоугольнике обозначает среднее количество по мышам. Серые прямоугольники – Каизо +/y Apc Min/+ мыши, незакрашенные - Каизо -/y Apc Min/+ мыши. Ни каких существенных различий между Каизо -/y Apc Min/+ и Каизо +/y Apc Min/+ мышами не было обнаружено ни на 180 день (Р= 0.10 [Манн-Витней], n20 ), ни в момент гибели (Р= 0.62 [Манн-Витней], n20). С- Размер опухолей, измеряемый по плошади, меньше в мышах Каизо -/y Apc Min/+ на 180 день (Р= 0.001 [Манн-Витней], n114), но не к моменту гибели (Р= 0.55 [Манн-Витней], n239). Серые столбики – Каизо +/y Apc Min/+ мыши, незакрашенные – Каизо -/y Apc Min/+ мыши. Указаны стандартные отклонения от среднего значения.

(Thoreson and Reynolds 2002; Kelly, Spring et al. 2004). В третьих, Каизо вовлечен в Wnt сигнальный путь (Kelly, Otchere et al. 2004; Kim, Park et al. 2004; Gregorieff and Clevers 2005; Park, Kim et al. 2005; Spring, Kelly et al. 2005), который часто нарушен в опухолях кишечника. Чтобы проверить участие Каизо в образовании рака кишечника, была использована мышиная модель Min/+ Min/+ человеческой болезни familial adenomatous polyposis Apc (Su, Kinzler et al. 1992). Apc мыши страдают от образования множественных полипов кишечника, возникающих в течении Min/+ первых шести месяцев их жизни. Мышь, с удаленным геном Каизо, была скрещена с Apc мышью. Изучение выживаемости и частота возникновения опухолей проводили в их потомках самцах Каизо-/y Apc Min/+.

-/y Min/+ Было зафиксировано значительное увеличение выживаемости Каизо Apc самцов, по +/y Min/+ сравнению с мышами Каизо Apc (рис. 24а). Опухоли возникали на 180 день, к моменту гибели животных их количество было сравнимо между мышами обоих генотипов (рис. 24б), но размер полипов был значительно меньше на 180 день у мышей с удаленным геном Каизо (рис.24в).

Рисунок 25. Недостаток уровня белка Каизо не изменяет уровень апоптоза или скорость митоза ни в нормальном эпителии кишечника, ни в эпителии аденом мыши. а- отсутствие значимых различий в уровне апоптоза в нормальном эпителии (4.18±0.96 v 4.66±0.84, n=3 р=0.51 Манн Витней) или в эпителии аденом (3.93±0.14 v 0.30±0.31, n=3 р=0.65 Манн Витней) мышей дикого типа и мышей с удаленным геном Каизо. б- Отсутствие значимых различий в скорости митоза в нормальном эпителии (0.69±0.26 v 0.91±0.24, n=3 р=0.38 Манн Витней) или в эпителии аденом (0.389±0.06 v 0.379±0.06, n=3 р=0.10 Манн Витней) мышей дикого типа и мышей с удаленным геном Каизо. Уровень апоптоза в эпителии аденом значительно ниже уровня апоптоза в эпителии нормальной слизистой ( р=0.04, Манн Витней, как показано ранее в Bedi et al, +/y Min/+ 1995, Cfncer Res 55: 1811-1816). Черные столбики – Каизо Apc мышь, незакрашенные столбики – Каизо -/y Apc Min/+ мышь. Указаны стандартные отклонения.

Анализ полипов мышей с и без гена Каизо не выявил существенных различий в митотических индексах или в уровне апоптоза ни в нормальном эпителии ни в аденомах (рис. 25), доказывая тем самым, что уменьшение скорости роста полипов в мышах без гена Каизо не вызвано уменьшением потенциала клеточного деления или усилением клеточной гибели. Для дальнейшего изучения вопроса вовлечения Каизо в процессы неопластической трансформации кишечника, был проверен уровень экспрессии гена Каизо в опухолях кишечника мышиной модели MUC2-/-, у которой развиваются злокачественные опухоли кишечника, как у человека при болезни хронического воспаления брюшины.

Рисунок 26. Уровень экспрессии Каизо выше в опухолях кишечника мыши.аИммуногистохимическое окрашивание срезов опухолей кишечника и нормальной слизистой антителами к Каизо 6F Muc2-/- мышей с указанным увеличением. б- Иммуноблот анализ двух пар опухолей кишечника Muc2-/- мышей и соответствующих нормальных слизистых, взятых в качестве контроля. Блот гибридизовали с антителами к белку Каизо 6F и к белку актин, для нормализации количества нанесенного в лунку общего количества белков.

Было проведено иммуногистохимическое окрашивание срезов и иммуноблот анализ MUC2-/- опухолей, нормальную слизистую этих же мышей использовали в качестве контроля.

Оба метода показали значительное увеличение содержания белка Каизо в клетках опухолей, по сравнению с контролем (рис. 26). Полученные данные предполагают участие Каизо в неопластической трансформации кишечника, так как отсутствие Каизо приводит к сдерживанию роста опухолей в Min/+ APC мышах, и в опухолях кишечника мыши повышен уровень экспрессии белка Каизо. Это предполагает, что Каизо может метил-зависимо подавлять экспрессию генов. На этом этапе исследования важным является обнаружение реальных генов мишеней Каизо в клетках кишечника, вовлеченных в раковую трансформацию.

2.2.5. Каизо является метил-чувствительным регулятором генов опухолевых супрессоров в раковых клетках кишечника.

Для определения роли Каизо в репрессии генов опухолевых супрессоров в раке кишечника были выбраны две линии клеток: Colo320 и HCT116, представляющие данный вид рака. Было показано, что Каизо экспрессируется в этих клеточных линиях (данные не приведены). С помощью methylight assay был проанализирован статус метилирования промоторных участков генов. Эта выборка генов включала в себя те локусы, для которых показано гиперметилирование в различных видах рака. Гиперметилирование было характерно для 57% генов в Colo320 и 24% генов в HCT116. Для дальнейшего анализа были выбраны три гена, гиперметилированные в обеих клеточных линиях: CDKN2A, HIC1, MGMT. CDKN2A является опухолевым супрессором, который инактивирует комплекс циклин D-cdk4/6, блокирует гиперфосфорилирование Rb, что приводит к остановке клеточного цикла (Sherr and Roberts 1995). HIC1 является транскрипционным репрессором и может регулировать SIRT1 при различных повреждениях (Chen, Wang et al. 2005). Подавление транскрипции MGMT приводит к нарушению в системе репарации и приводит к геномной нестабильности(Esteller 2002). Для определения взаимодействия Каизо с промоторами CDKN2A, HIC1, MGMT in vivo была проведена количественная иммунопреципитация хроматина, в результате которой продемонстрировано, что Каизо взаимодействует in vivo с промоторами выбранных генов в Colo320 и HCT116 клеточных линиях (рис.27а,в). Известно, что в клеточной линии HCT116 ген CDKN2A инактивируется благодаря гиперметилированию одного аллеля и мутации другого аллеля (Myohanen, Baylin et al.

1998). Для того чтобы определить, с каким аллелем взаимодействует Каизо, полученный пул ДНК в результате иммуноперципитации хроматина был проанализирован с помощью метилчувстительной рестрикцией. Оказалось, что Каизо в HCT116 связывается с метилированным аллелем промотора гена CDKN2A (рис.27с,д).

Рисунок 27. Каизо связывается с метилированными промоторами в раковых клетках кишечника. Количественный ChIP анализ был проведен на Colo320 (А) и HCT1(B) для определения связывания Каизо с промоторами CDKN2A, MGMT, HIC1.По оси Y отложено обогащение имуннопреципиации с антителами к Каизо или к IgG относительно ДНК до иммунопреципитации. С-СhIP с антителами к Каизо был выполнен на клетках HCT116, в которых промотор CDKN2A полуметилирован (1 дорожка).2 и 3 дорожкиПЦР после рестрикции MspI и HpaII соотвественно фрагментов ДНК после ChIP (Каизо связывается только с метилированным аллелем).Д –После ChIP был проведен ПЦР в реальном времени после обработки фрагментов ДНК рестриктазами MspIи HpaII.

Далее, необходимо было определить, зависит ли подавление транскрипции выбранных гиперметилированных генов от Каизо.

Рисунок 27. Каизо подавляет транскрипцию 8метилированных генов раковых клетках кишечника.После обработки клеток Colo320 (a), HCT116 (B) siRNA1 (черные) и siRNA2 (серые) на Каизо был определен уровень мРНК генов CDKN2A, MGMT, HIC1 с помощью ОТ-ПЦР в реальном времени.

Для этого, используя 2 разных siRNA на Каизо (siRNA1 и siRNA2), был понижен уровень клеточного белка Каизо. С помощью количественного ОТ-ПЦР было показано, что снижение уровня Каизо приводит к повышению уровня, как мРНК (рис.28), так и белка (данные не приведены) для CDKN2A, HIC1, MGMT в обеих клеточных линиях. Таким образом, удаление Каизо приводит к реактивации данных локусов. Для того чтобы определить, каким образом удаление Каизо оказывает влияние на транскрипцию генов опухолевых супрессоров, был проверен статус метилирования промотора CDKN2A в Colo320 и НСТ116 в присутствии и отсутствии Каизо. Для этого был использован MassArray анализ, который позволяет определить количество метилированных CpG в заданной последовательности. Были выбраны два участка в промоторе гена CDKN2A: один из участков содержал два консенсусных сайта для Каизо (Сhr9 21,964,659-21,964,922), второй участок (Chr21,966,178-21,966,699), в состав которого не входят сайты для Каизо. Было показано, что удаление Каизо не приводит к каким-либо изменениям в статусе метилирования промотора CDKN2A. Эти данные были также подтверждены с помощью бисульфитного сиквенса (данные не приведены).

Таким образом, метилирования промоторов генов, которые связаны с опухолеобразованием, недостаточно для подавления их транскрипции, более того их уровень экспрессии частично зависит от присутствия Каизо. Подобная ситуация наблюдалась при удалении другого метилДНК-связывающего белка MBD2(Sansom, Berger et al. 2003).Также известно, что гистондеацетилазы вносят свой вклад в снижении уровня транскрипции метилированной ДНК. Таким образом, в подавлении транскрипции генов с метилированным промотором могут участвовать несколько механизмов.

Поскольку Каизо может оказывать влияние на экспрессию генов супрессоров опухолевого роста, то было решено проверить, оказывает ли влияние удаление Каизо на чувствительность клеток рака кишечника к различным видам раковой терапии. Для этого клеточные линии Colo320 и HCT116 трансфецировали двумя видами siRNA на Каизо или контрольными siRNA. Через 24 часа после трансфекции клетки были синхронизированы с помощью сывороточного голодания. После синхронизации было изучено влияние Каизо на клеточный цикл: через 24 и 48 часов после синхронизации была произведена оценка, на какой стадии клеточного цикла находятся клетки.

Для клеток нетрансфецированных или трансфецированных контрольными siRNA в Colo320 через 24 и 48 часов 51% и 57% клеток соответственно находилось в G1 фазе клеточного цикла. В клетках с siRNA на Каизо в Colo320 через 24 часа было 68% и 62% клеток в G1 фазе (данные приведены для двух разных siRNA), а через 48 часов – 71% и 76%. В случае линии клеток HCT116, для нетрансфецированных клеток и контрольных клеток через 24 и 48 часов процент клеток в G1 фазе составил 51%. В случае использования siRNA на Каизо через 24 часа после сывороточного голодания процент клеток в G1 фазе был 61% и 66%, а через 48 часов – 78% и 56%. Для определения влияния противораковых препаратов на клетки с пониженным уровнем Каизо был использован этопозид в концентрации 50mol/L. После трансфекции siRNA на Каизо клетки обрабатывали этопозидом и оценивали смертность клеток с помощью окрашивания acridine orange/этидиум бромидом через 48 и 72 часа. Для контрольных и нетрансфецированных Colo320 было показано, что смертность клеток составляет 10% и 11% через 48 и 72 часа после обработки. Для клеток с siRNA на Каизо смертность через 48 часа составила 20-23%, а через часов – от 25 до 35%. Для линии клеток НСТ116 были получены следующие данные: для контрольных и нетранcфециро-ванных клеток смертность была замечена менее чем у 5% клеток (через 48 и 72 часа), тогда как при siRNA на Каизо смертность составила 22-28% через 48 часов и 24-27% через 72 часа. При использовании нормальных фибробластов из кишечника удаление Каизо не оказывало какого-либо влияния на уровень экспрессии генов CDKN2A, MGMT, HIC1 и не приводило к изменению в клеточном цикле или смерти клеток при использовании этопозида.

Таким образом, удалось показать, что Каизо участвует в подавлении транскрипции метилированных генов, которые вовлечены в регуляцию клеточного цикла и выживание клеток.

Каизо способствует пролиферации раковых клеток и устойчивости к противораковым реагентам.

3. Две функции домена “цинковые пальцы” белка Каизо Как было сказано выше, белок Каизо был определен одновременно в лаборатории доктора Рейнольдса как партнер р120 катенина в дрожжевой двугибридной системе (Daniel and Reynolds 1999). Им же было показано, что Каизо может специфически взаимодействовать и с неметилированной ДНК- CTGCNA, названной Каизо связывающим сайтом (КСС). Таким образом, белок Каизо может взаимодействовать как с метилированной ДНК, так и с неметелированными последовательностями, содержащими КСС. И если предположить существование некоторого сигнального пути, ответственного за передачу сигналов с поверхности клетки в ядро, приводящего к выключению генов, то изучение функциональной значимости взаимодействия Каизо с р120 катенином особенно важно.

Взаимодействие катенина р120 с Каизо опосредованно через Arm домен, таким образом, катенин р120 может формировать белковый комплекс либо с Е-кадхерином, либо с белком Каизо.

Исходя из возможности связывать как метилированную ДНК, так и неметилированную, Каизо может влиять на транскрипцию как генов, содержащих метилированные регуляторные элементы, так и генов, для промоторов которых характерно наличие последовательности КСС. Так КСС последовательность характерна для промоторов таких генов например, как Matrilysin, Siamois и Wnt11(Daniel and Reynolds 1999; Daniel, Spring et al. 2002). Данная часть работы посвящена определению функциональной значимости как взаимодействия Каизо с р120 катенином, так и взаимодействия Каизо с метилированной ДНК и последательностями, содержащими КСС.

3.1 Взаимодействие белка Каизо с р120 катенином и метилированной ДНК носят взаимоисключающий характер 3.1.1. Ядерная и цитоплазматическая локализация белка Каизо в клетках млекопитающих.

Влияние р120 катенина на клеточную локализацию Каизо.

Для метил-ДНК-связывающего белка Каизо определена ядерная локализация в клетках млекопитающих, однако способность его к взаимодействию с р120 катенином в цитоплазме, предполагает возможность цитоплазматической локализации Каизо (Daniel and Reynolds 1999;

Daniel, Spring et al. 2002). Используя метод иммунофлуоресцентного анализа на различных клеточных линиях, трансфецированных Каизо-GFP, было показано, что Каизо находится в ядре, однако и в цитоплазме наблюдается незначительное количество Каизо. Таким образом, метилДНК-связывающий белок Каизо может находиться в клетках млекопитающих не только в ядре, но и в цитоплазме.

Используя метод имммунофлуоресцентного анализа, было решено оценить влияние высокого уровня экспрессии р120 катенина на локализацию Каизо в клеточных линиях HeLa. При высоком уровне экспрессии р120 в клетках наблюдается «ветвящийся» фенотип, связанный с инактивацией RhoA и/или активацией Rac1 белков (Reynolds, Daniel et al. 1996; Anastasiadis and Reynolds 2001). Каизо-FLAG и р120-GFP были совместно трансфецированы в клеточную линию человека HeLa. В результате повышенного уровня экспрессии р120 катенина, полноразмерный Каизо делокализовался из ядра в цитоплазму (рис. 29а). Исходя из того, что домен «цинковые пальцы» Каизо отвечает за связывание белка с ДНК, было решено проверить, как будет локализоваться Каизо в клетке без этого домена.

Рисунок 29. Локализация белка Каизо при повышенной экспрессии р120 катенина. а - Совместная трансфекция поноразмерного Каизо (конструкция Каизо(1-672)-FLAG) с р120 катенином (конструкция р120-GFP) в клеточную линию HeLa.. б - Совместная трансфекция конструкции Каизо без домена «цинковые пальцы» (Каизо(1-490)-FLAG) с р120 катенином (р120-GFP) в клеточную линию HeLa. Для идентификации Каизо в иммунофлуорисцентном анализе использовались антитела на FLAG пептид.

При совместной трансфекции р120-GFP с Каизо (аа 1-490)-FLAG в линию клеток HeLa наблюдалась четко выраженная ядерная локализация белка, несмотря на сохранение ветвящегося фенотипа клеток (рис. 29 б).

На основе полученных данных можно предположить, что р120 катенин, несущий сигнал ядерной локализации способен взаимодействовать с Каизо и приводить к делокализации белка из ядра в цитоплазму, тем самым, понижая его транскрипционную активность и вовлекая Каизо в другие молекулярные механизмы жизнедеятельности клетки.

3.1.2. Определение функционального домена белка Каизо, ответственного за взаимодействие с р120 катенином Для определения функционального домена белка Каизо, необходимого для взаимодействия с р120 катенином была использована дрожжевая двугибридная система Cytotrap («Stratagene», США). В результате делеционного анализа с р120 катенином было показано, что провзаимодействовали только полноразмерный белок Каизо (аа 1-672), и последовательность, содержащая домен «цинковые пальцы» белка Каизо (аа 490-578). Далее были предприняты попытки более детального картирования сайта связывания белка Каизо с р120 катенином. С помощью двухгибридной системы было показано, что для взаимодействия с р120 необходимы второй и третий «цинковые пальцы». Таким образом, можно предположить, что функциональным доменом для взаимодействия Каизо с р120 катенином являются 2 и 3 «цинковые пальцы», которые вероятно, способны формировать структуру необходимую для данного белок-белкового взаимодействия.

3.1.3. Функциональный домен «цинковые пальцы» белка Каизо необходим для взаимодействия с р120 катенином in vivo Для подтверждения достоверности результатов, полученных в дрожжевой двугибридной системе, оценка необходимости домена «цинковые пальцы» белка Каизо для взаимодействия с р120 катенином была осуществлена в in vivo эксперименте с помощью коиммунопреципитационного анализа. Имуннопреципитационный анализ показал, что Каизо взаимодействует с р120 только при наличии “цинковых пальцев” (рис. 30). Таким образом, данные, полученные в in vivo эксперименте, подтверждают результаты дрожжевой двугибридной системы: делеция домена «цинковые пальцы» белка Каизо приводит к невозможности образования комплекса Каизо/р120.

Рисунок 30. Домен «цинковые пальцы» белка Каизо необходим для взаимодействия с р120 катенином in vivo. Схематичное изображение конструкций белка Каизо. Представлен результат коиммунопреципитации белка Каизо и его делеций с р120 катенином.

3.1.4. р120 катенин влияет на ДНК - связывающую активность белка Каизо Исходя из описанных выше результатов по взаимодействию домена «цинковые пальцы» Каизо с р120, можно предположить, что р120 катенин будет влиять на ДНК-связывающую активность Каизо, поскольку именно “цинковые пальцы” отвечают за связывание с ДНК.

Рисунок 31. р120 катенин ингибирует ДНК связывающую активность Каизо. А. Полноразмерный рекомбинантный Каизо-GST преинкубировали с р120 катенином, треугольники показывают увеличение добавляемого количества р120, количество добавляемого Каизо указано над треугольниками.

Б. Полноразмерный рекомбинантный MBD1-GST, преинкубировали с р120 катенином, треугольники показывают увеличение добавляемого количества р120, количество добавляемого MBD1 указано над треугольниками.. нс- неспецифический сигнал (связан с использованием экстрактов клеток sf9, так как его интенсивность увеличивается с возрастанием концентрации экстракта), проба- не связавшаяся меченая ДНК- проба.

Для подтверждения этой гипотезы был проведен эксперимент по задержке ДНК-белковых комплексов в ПААГ. При увеличении концентрации рекомбинатного белка Каизо (или MBD1 в качестве контроля) происходило возрастание интенсивности комплекса белок-ДНК, что говорит о специфичности данного взаимодействия. Однако, добавление увеличивающегося количества р1катенина практически полностью ингибирует связывание Каизо с ДНК и никак не влияет на взаимодействие белка MBD1 с ДНК (рис.31).

Задачей следующего эксперимента стало подтверждение данных, полученных в ДНКбелковых сдвигах, на модели клеточной линии HeLa. Для этого клетки HeLa трансфецировали конструкцией, кодирующую химерный белок Каизо-VP16, превратив его из репрессора метилированных генов в активатора (VP16-содержит сильный активационный домен). Экспрессия Каизо-VP16 приводила к увеличению активности гена репортера, который находился под контролем метилированного промотора SV40 (рис. 32а). Однако, добавление в трансфекцию вектора, кодирующего р120, приводило к заметному снижению активационного потенциала белка Каизо-VP16(рис.32а). При этом MBD1-VP16 зависимая активация репортера оказалась нечувствительна к присутствию р120 катенина (рис.32б).

Рисунок 32. р120 катенин подавляет метилДНК-связывающую активность белка Каизо без BTB домена. а, б - Измерение активности люциферазы, а - р120 подавляет способность конструкции Каизо vp 16 без BTB домена активировать транскрипцию с метилированных матриц, б - р120 не оказывает эффекта на способность конструкции MBD1- VP16 активировать транскрипцию с метилированных матриц.

Таким образом, взаимодействие белка Каизо с метилированной ДНК и с катенином р120 носят взаимоисключающий характер, что позволяет говорить о двух различных функциях белка Каизо в Б ядре и цитоплазме. В ядре Каизо связывается с метилированными участками ДНК и участвует в подавлении транскрипции. Роль Каизо в цитоплазме окончательно не определена. На данный момент времени можно предположить существование сигнального пути, ответственного за передачу сигналов с поверхности клетки в ядро.

3.2. Определение значимости взаимодействия Каизо с метилированной ДНК и с последательностями, содержащими неметилированный КСС.

3.2.1. Функция Каизо узнавания метилированной последовательности ДНК эволюционно консервативна.

Используя поиск по базе данных NCBI, были найдены гомологичные последовательности гена Каизо у лягушки Xenopus Laevis (хКаизо), рыбы Danio rerio (dКаизо), курицы (gКаизо).

Сравнение последовательностей аминокислот этих белков показало, что BTB/POZ домен, первый и второй “цинковые пальцы” наиболее консервативны, в то время как третий «цинковый палец» ZF3 гораздо более вариабелен (рис.32а). Было показано, что все рекомбинантные белки (лягушки, рыбы, а также и курицы), содержащие три “цинковых пальца” (ZF1-3-His), способны специфично связываться с метилированной последовательностью ДНК Sm, но не с его неметилированным аналогом (рис.33б). “Цинковые пальцы” Каизо курицы имеют одинаковое сродство к Hmat последовательности и метилированной последовательности Sm, в то время как хКаизо лягушки обладает значительно меньшим сродством к Hmat, в то время как связывание dКаизо рыбы с Hmat не детектируется.

Рисунок 33. Метил-ДНК связывающая активность Каизо эволюционно консервативна. А- Сравнение аминокислотных последовательностей «цинковых пальцев» белков Каизо курицы, лягушки, мыши и рыбы. Бэксперимент по задержке ДНК-белковых комплексов в геле с рекомбинантными белками His-ZF1-3 хКаизо, dКаизо, gКаизо и пробами ДНК: метилированной Sm, неметилированной S, и матрилизином Hmat в присутствии 2 мкг pdIC неспецифического конкурента ДНК. Стрелки указывают на специфический ДНК-белковый комплекс. В- метилчувствительный репрессионный анализ в mbd2-/- клетках показал, что все ортологи Каизо являеются метилчувстительными репрессорами.

Полноразмерные белки Каизо лягушки и рыбы, наработанные и почищенные из 293 клеток, имели те же ДНК-связывающие свойства, что и соответсвующие им рекомбинантные белки, содержащие только “цинковые пальцы”. С помощью метил-чувстительного эксперимента на mbd2-/- клетках удалось подтвердить, что свойство Каизо быть метил-чувстительным репрессором является эволюционно консервативным (рис.33в).

Необходимо также отметить, что для белка Каизо-ZF, содержащего только три “цинковых пальца”, было показано одинаковое сродство как к олигонуклеотиду «матрилизин», содержащему КСС, так и к метилированному «Sm» (рис.34а). Полноразмерный Каизо эффективно взаимодействовал только с метилированной «Sm» пробой, тогда как связывание с последовательностью «матрилизин» возможно было детектировать только при высоких концентрациях белка с помощью задрежки ДНК-белковых комплексов рекомбинатного Каизо (рис.34б).

Рисунок 34. Взаимодействие рекомбинантного Каизо с последовательностью «матрилизин» и Sm пробой (метилированной и неметилированной). А. Эксперименты с использованием рекомбинантных «цинковых пальцев» Каизо(Каизо-ZF). Б. Эксперименты с использованием полноразмерного рекомбинантного белка (Каизо).Треугольники – возрастающие количества белка. Стрелка – на ДНК-белковый комплекс.

3.2.2. Белок dКаизо, не связывающийся с КСС, может спасти эмбрионы лягушки от развития уродств при истощении белка xКаизо.

Уникальные свойства белка dКаизо по связыванию ДНК и специфичному подавлению транскрипции генов дают возможность проверить достаточность связывания Каизо с метилированной ДНК для восстановления фенотипа хКМО эмбрионов. Хотя выше было показано, что для проявления фенотипа достаточно инъецировать в эмбрион 10нг МО, однако было решено воспроизвести условия эксперимента, описанного в (Kim, Park et al. 2004), и было введено 40нг МО в эмбрионы лягушки на стадии двух клеток. При совместном введении в эмбрионы на стадии двух клеток РНК dКаизо и хКМО удается значительно увеличить число эмбрионов с нормальным протеканием гаструляции (стадия 12) от 10% до 45%. К 14 стадии (нейруляции) смертность снижена до 18% по сравнению с 80% для хКМО морфантов (рис. 35а,б хКМО+ dКаизо).

Присутствие РНК dКаизо позволяет почти половине (46%) эмбрионам успешно завершить стадию гаструляции/нейруляции, в то время как ни одному хКМО эмбриону это не удается сделать (рис.35).

Рисунок 35. Белок dKаизо, также как и hКаизо, могут спасти эмбрионы лягушки с истощенным белком хКаизо. A- Фенотипы неинъецированных контрольных эмбрионов (n =150), эмбрионов, инъецированных контрольными MO (n = 53) и xKMO, коинъецированных с dКаизо РНК (n = 84) (KMO+dКаизо). Указаны стадии развития эмбрионов. FITC окрашивание демонстрирует контроль инъецирования флуоресцентно меченных МО, стрелками указана нейронная складка. Б- Диаграммы показывают процент нормальных эмбрионов и эмбрионов с дефектами развития в экспериментах по спасению хКМО эмбрионов коиньекцией РНК dКаизо или РНК Каизо человека (hКаизо). Погибшие эмбрионы не учитывались.

Указаны стадии развития.

К стадии головастика процент выживших dКаизо/хКМО эмбрионов невелик, однако стоит отметить, что наблюдается небольшой процент полноценно развитых эмбрионов, несмотря на присутствие в них морфолино (рис. 35). Эти спасенные эмбрионы внешне отличаются от остановившихся в развитии хКМО эмбрионов, доживших до поздних стадий развития. Важно отметить, что способность к восстановлению фенотипа хКМО эмбрионов РНК dКаизо не отличалась от РНК дикого типа hКаизо, который связывается и с метилированными последовательностями ДНК Sm и с неметилированной ДНК Hmat (рис.35). Этот эксперимент говорит о том, что способность к связыванию последовательности ДНК CTGCNA белком Каизо не важна для спасения хКМО эмбрионов, в то время как связывание метилированных последовательностей ДНК важно для компенсации проблем раннего развития.

3.3.3.Определение участков связывания белка Каизо по мышиному геному.

С одной стороны белок dКаизо, не узнающий КСС, может компенсировать уродства, возникающие у лягушки при отсутствии хКаизо, с другой стороны сохраняется возможность, что в клетке Каизо сязывается с обоими видами последовательностей, и роль этого взаимодействия с КСС остается не раскрытой. Для того чтобы определить какая активность белка Каизо (связывание с метилированной ДНК или с последовательностями, содержащими КСС) преобладает в клетке была проведена хроматин иммунопреципитация с антителами к Каизо на фибробластах дикого типа и нокаутных по гену Каизо в качестве контроля. Пул ДНК, полученный в результате иммунопреципитации хроматина, использовали для получения библиотеки для секвенирования.

Полученную геномную библиотеку декодировали на секвенаторе Genome Analyzer GA (“Illumina”, США), длина одного чтения составляла 36 нуклеотидов. Чтения, полученные в результате секвенирования картировали на мышиный геном (mm9 версия). Число картированных чтений на мышиный геном составило приблизительно 39 млн.

Таблица 4. Анализ полученных данных на Genome Analyzer GA (“Illumina”, США).

Откартированные чтения использовались для поиска пиков, то есть районов, обогащенных чтениями. В качестве контроля были использованы данные, полученные для нокаутных по гену Каизо фибробластов. Был получен 391 участок для клеточной линии дикого типа (табица 4).

Средний размер пиков - около 500 пн. Анализ нуклеотидного состава участков связывания Каизо не выявил обогащения по последовательности CTGCNA (рис.36). В тоже время в участках Фибробласты дикого типа Нокаутные по гену Каизо фибробласты Число картированных ридов 38.99 на мышиный геном (млн) Число участков обогащенных 391 __ чтениями Средний размер пиков 5__ (кластеров), bp (медиана) (443) % чтений, попавших в 1.7% __ кластеры связывания белка Каизо наблюдалось значительное обогащение по CG и CGCG последовательностям. Таким образом, полногеномный анализ не выявил обогащения по последовательностям, содержащим КСС, и ещё раз подтвердил важность метил-ДНК связывающей активности Каизо.

Рисунок 36. Участки связывания Каизо обогащены CG, CGCG последовательностями, но не КСС. На диаграмме представлено количество участков, содрежащих CG, CGCG, КСС последовательности (темные столбики) по сравнению с распределением данных последовательностей в геноме (светлые столбики).

3.3.4. Взаимодействуя с хКаизо, белок xTcf3 не может активировать Wnt-сигнальный путь через взаимодействие с бета-катенином.

С одной стороны выше было показано, что для Каизо в геноме предпочтительными участками связывания является метилированная ДНК, содержащая CG и CGCG последовательности а не CTGCNA-содержащие последовательности. С другой стороны была опубликована работа(Kim, Park et al. 2004), в которой показано, что одной из прямой регулируемых мишеней белка Каизо у лягушки является ген Siamois, промотор которого содержит КСС последовательность. Было решено более детально исследовать данный ген и его регуляцию посредством Каизо. Для этого, используя метод хроматин-иммунопреципитации, было показано, что транзиторно экспрессированные белки dКаизо или хКаизо в клетках лягушки А6 не связываются с промотором гена Siamois. Однако одним из основных регуляторов транскрипции Siamois является TCF белок(Houston, Kofron et al. 2002), и возможно Каизо вовлечен в регуляцию транскрипции данного гена не за счет взаимодействия с ДНК, а за счет белок-белковых взаимодействий.

Белки семейства TCF содержат следующие структурные домены: HMG домен, отвечающий за связывание с ДНК (консенсусный сайт -A/TA/TCAAA); N-концевой домен, взаимодействующий с -катенином и С-концевой домен, необходимый для связывания с CtBP1(Roose, Molenaar et al. 1998). Используя рекомбинантные белки, удалось показать, что для взаимодействия хКаизо c полноразмерным xTcf3 и доминантно-негативным xTcf3 (xTcf3dn), у которого отсутствует домен, связывающийся с -катенином, достаточно трех “цинковых пальцев” хКаизо (рис.37а,б).

Рисунок 37. Домен “цинковые пальцы” Каизо взаимодействует с HMG доменом Tcf белков. А. Схема конструкций с различными участками хКаизо, использованных в копреципитации; Б. копреципитация in vitro полученных xTcf3 или Tcf3dn с указанными рекомбинантными белками. В. Конструкции с Tcf4, которые были использованы для in vitro трансляции; -кат – домен, взаимодействующий с катенином; TLE – TLE/Groucho связывающий домен; CtBP-связывающий домен; HMG- ДНК связывающий домен Г. Копреципитация делеционных Tcf4 и “цинковыми пальцами” Каизо лягушки (хКаизо-GST-ZF). В качестве контроля был использован GST. Д.

Задержка подвижности в геле комплексов in vitro транслированного xTcf3 и олигонуклеотидов, содержащих сайт для связывания xTcf3 (TCF bs-oligo). К комплексам добавляли химерные белки GST с различными делециями Каизо Способность Каизо связываться с xTcf3 – эволюционно консервативна, поскольку, “цинковые пальцы” Каизо у рыбы (dZF1-3), курицы (gZF1-3) также взаимодействует с xTcf(рис.37б). Анализ различных делеций Tcf4 с помощью ко-преципитации позволил определить, что для взаимодействия необходим HMG домен Tcf4 (рис.37в,г). Далее, с помощью эксперимента по задержке в геле комплекса xTcf3 и ДНК в присутствии полноразмерного хКаизо, GST-xZF1-или GST-dZF1-3 было показано, что трех цинковых пальцев Каизо достаточно с одной стороны для предотвращения образования комплекса xTcf3/ДНК (рис.37г), с другой стороны данный домен Каизо не оказывает влияние на хTcf3/-катенин комплекс.

В клетке xTcf3 находится в основном в ядре, причем в 40% клеток имеет диффузное распределение по ядру, а в 60% клеток данный белок имеет точечную ядерную локализацию.

хКаизо в мышиных фибробластах детектируется в ядре, причем распределен он диффузно. В присутствии же хКаизо или dКаизо xTcf3 перераспределяется по всему ядру, без четко выраженных структур. Таким образом, Каизо может оказывать влияние на внутриядерную локализацию хTcf3.

Для подтверждения способности Каизо конкурировать с ДНК за связывание с Tcf3 была поставлена хроматин иммунопреципитация в клетках трансфецированных только xTcf3 или совместно с Каизо. Было показано, что в клетках А6 myc-xTcf3 связывается с Siamois промотором. Однако, в присутствии НА-хКаизо или T7-dКаизо myc-xTcf3 делокализуется с данного участка ДНК (рис.38а). Таким образом, можно говорить о том, что Каизо препятствует взаимодействию хTcf3 с ДНК. Стоит отметить, что при тех же самых условиях детектировать хКаизо или dКаизо на промоторе Siamois не удалось.

Для определения влияния Каизо на транскрипционную активность Tcf3 была использована SuperTopflash репортерная система. В состав SuperTopflash Wnt репортерной плазмиды входит ген люциферазы, который находится под промотором, содержащим несколько сайтов для связывания TCF3/4. Люцифераза активируется введением в систему экзогенного -катенина. При котрансфекции хКаизо или dКаизо активация люциферазы уменьшалась в 4-7 раз (рис.38б). Если же люцифераза находилась под контролем промотора с мутантными сайтами для связывания с TCF3, то её активность не зависела от добавления как -катенина, так и от наличия Каизо (рис.38б). Отсюда можно сделать вывод, что взаимодействие Каизо с HMG доменом TCF3/блокирует способность TCF связываться с ДНК и препятствует -катенин-зависимой активации транскрипции. С другой стороны для определения, каким образом Tcf3 может оказывать влияние на ДНК-связывающую активность Каизо, была использована следующая система: в клетки трансфецировали метилированную репортерную плазмиду, хКаизоZFVP16 (эта конструкция содержала участок, кодирующий “цинковые пальцы” Каизо и активационный домен VP16) и xTcf3. Как оказалось, xTcf3 оказывает влияние на репортерную активность в данной модельной системе (рис.38в).

Рисунок 38. Каизо влияет на ДНКсвязывающую активность хTcf3, что сказывается на его репресионных и активационных функциях. А- С помощью хроматин иммунопреципитации показано, что после трансфекции в А6 клеточную линию конструкции myc-xTcf3 xTcfсвязывается с промотором Siamois.

Введение в данную систему хКаизо или dКаизо предотвращает связывание хTcf3 с данным промотором. Б- Увеличение уровня экспрессии хКаизо и dКаизо приводит к подавлении транскрипционной активности катенина в HeLa клетках.

SuperTopFlash (SuperTop) был использован как репортёр Wnt, SuperFopFlash (SuperFop) содержит мутантные сайты для Tcf3 и является контролем. В- Уровень экспрессии с метилированного люциферазного репортёра увеличивается при котрансфекции с хКаизоVP16.Связывание с метилированным промотором репортёра осуществляется благодаря цинковым пальцам Каизо, а активационные свойства- за счет активационного домена VР16.

Увеличение количества хTcf3HMGVP16 (Tcf3VP16) снижает активационный потенциал хКаизоVP16. И наоборот, активация репортерной люциферазы (с промотором Siamois) за счет хTcf3HMGVP16 подавляется в присутствии хКаизоVP16.

Таким образом, Каизо и xTcf3 могут оказывать взаимное влияние на связывание с ДНК.

Аналогично, хКаизоZFVP16 подавляет активацию Siamois промотора, которая осуществляется благодаря хTcf3HMGVP16 (рис.38в).

Полученные результаты указывают на то, что хКаизо и хTcf3 взаимно предотвращают связывание с ДНК, что может оказывать влияние как на репрессионный путь, связанный с Каизо, так и с Tcf3 (рис. 39).Таким образом, Каизо участвует в регуляции транскрипции гена Siamois не за счет взаимодействия с КСС последовательностью в его промоторе, а за счет белок-белковых взаимодействий.

Рисунок 39 Модель взаимного влияния Каизо и Tcf3 на ДНК-связывающую активность друг друга. АСхематическая схема активации генов-мишеней Tcfв зависимости от присутствия или отсутствия -катенина.

Для активации -катенин заменяет Groucho/CtBP в комплексе с Tcf3. Б- Репрессионная модель Каизо для генов Wnt-пути, предложенная в работе(2). В, Г- Модель, предложенная в данной работе: хКаизо препятствует связыванию хTcf3 с ДНК за счет белок-белкового взаимодействия, Каизо при этом с ДНК не связывается. Д, Е-Tcf3 потенциально может препятствовать связыванию Каизо с его метилированными сайтами узнавания (отмечены закрашенными кружочками).

ВЫВОДЫ 1. Каизо (ZBTB33) и Каизо подобные белки (ZBTB4 и ZBTB38) составляют семейство метил ДНК-связывающих белков, которые используют три домена «цинковые пальцы» C2H2 типа для узнавания симметрично метилированных ЦфГ динуклеотидов и BTB домен для модулирования транскрипции.

2. Мышь с генетическим нокаутом гена Каизо обладает устойчивостью у развитию рака кишечника, возникающего вследствие аномальной активации сигнального пути wnt.

3. Уменьшение уровня Каизо в раковых клетках приводит к реэкспрессии некоторых генов раковых супрессоров, которые исходно молчали и имели высокий уровень метилирования промоторов. Причем промоторные области остаются метилированными при увеличении транскрпционной активности генов в ответ на уменьшение уровня Каизо. Каизо- транскрипционный репрессор метилированных генов раковых супрессоров.

4. Транзиторное блокирование трансляции мРНК гена Каизо в оплодотворенных ооцитах шпорцевой лягушки приводит к гибели эмбрионов на стадии нейруляции. В эмбрионах с транзиторно уменьшенным уровнем экспрессии Каизо начало экспрессии генов зиготы происходит на две стадии раньше, чем в контрольных эмбрионах дикого типа. Каизо- неспецифический репрессор транскрипции генов зиготы у шпорцевой лягушки.

5. В геноме иммортализованных фибробластов мыши Каизо преимущественно связывает участки, содержащие CGCG поледовательности, а не CTGCNA.

6. Каизо может взаимодействовать с TCF3 и модулировать его ДНК связывающую способность, что влечет за собой изменения в активности wnt зависимых генов.

7. Взаимодействие с катенином р120 происходит с доменом «цинковые пальцы» белка Каизо. Такое взаимодействие приводит не только к уменьшению ДНК связывающих свойств Каизо, но и к ослаблению действия сигнала ядерной локализации Каизо. Р120- может регулировать ДНК связывающие свойства Каизо и его внутриклеточную локализацию.

СПИСОК ПУБЛИКАЦИЙ 1) Прохорчук Е.Б., Тульчинский Е.М., Георгиев Г.П., Луканидин Е.М. Анализ гомологичных последовательностей ДНК в первом интронегена mtsl мыши и человека: кВ-подобный сайт и микросателлитная ДНК // Генетика. 1996-Т. 32-С. 1317-1325.

2) Tulchinsky E, Prokhortchouk E, Georgiev G, Lukanidin E. A kappaB-related binding site is an integral part of the mts1 gene composite enhancer element located in the first intron of the gene // The Journal of Biological Chemistry. 1997-V. 72- P. 4828-4835.

3) Prokhortchouk EB, Prokhortchouk AV, Rouzov AS, Kiselev SL, Lukanidin EM, Georgiev GP. A minisatellite "core" element constitutes a novel, chromatin-specific activator of mts1 gene transcription // Journal of Molecular Biology. 1998-V. 280- P. 227-236.

4) Смирнов А.С., Рузов А.С., Гнучев Н.В., Прохорчук Е.Б Механизмы поддержания высокого конститутивного уровня NF-кВ в клетках аденокарцином мыши // Доклады академии наук (Биохимия, биофизика, молекулярная биология). 2000- Т. 373- С. 148-149.

5) Смирнов А.С., Буданов А.В., Рузов А.С., Иванов А.В., Прохорчук А.В., Гнучев Н.В., Прохорчук Е.Б. Высокий конститутивный уровень NF-кВ необходим для жизнеспособности клеток аденокарциномы мыши - возможная роль р53 // Молекулярная биология. 2000- Т.34- С.

775-782.

6) Прохорчук А.В., Прохорчук Е.Б. Обнаружение и анализ нового мышиного ДНКсвязывающего белка, специфичного к метилированию // Доклады академии наук (Биохимия, биофизика, молекулярная биология. 2000-Т. 370- С. 24-26.

7) Smirnov AS, Ruzov AS, Budanov AV, Prokhortchouk AV, Ivanov AV, Prokhortchouk EB High constitutive level of NF-kappaB is crucial for viability of adenocarcinoma cells // Cell Death & Differentiation. 2001- V. 8- P. 621-630.

8) Прохорчук A.B., Айтхожина Д.С., Саблина A.A., Рузов A.C., Прохорчук Е.Б. Каизо- новый член семейства BTB\POZ, белков специфично связывается с метилированной ДНК // Генетика.

2001- Т. 37- С.737-744.

9) Prokhortchouk A, Hendrich B, Jrgensen H, Ruzov A, Wilm M, Georgiev G, Bird A, Prokhortchouk E The p120 catenin partner Kaiso is a DNA methylation-dependent transcriptional repressor // Genes & Development. 2001- V. 15- P. 1613-1618.

10) Prokhortchouk E, Hendrich B Methyl-CpG binding proteins and cancer: are MeCpGs more important than MBDs? // Oncogene. 2002- V. 21- P. 5394-5399.

11) Ruzov A, Dunican DS, Prokhortchouk A, Pennings S, Stancheva I, Prokhortchouk E, Meehan RR Kaiso is a genome-wide repressor of transcription that is essential for amphibian development // Development. 2004- V. 131- P. 6185-6194.

12) Саложин С.В., Прохорчук Е.Б., Георгиев Г.П. Метилирование ДНК как один из основных эпигенетических маркеров // Биохимия. 2005- Т. 70- С.525-532.

13) Filion GJ, Zhenilo S, Salozhin S, Yamada D, Prokhortchouk E, Defossez PA. A family of human zinc finger proteins that bind methylated DNA and repress transcription // Mol Cell Biol. 2006- V. 26- P.169-181.

14) Della Ragione F, Tiunova A, Vacca M, Strazzullo M, Gonzlez E, Armstrong J, Valero R, Campanile C, Pineda M, Hulten M, Monros E, D'Esposito M, Prokhortchouk E. The X-linked methyl binding protein gene Kaiso is highly expressed in brain but is not mutated in Rett syndrome patients // Gene.

2006- V.373- P. 83-89.

15) Prokhortchouk A, Sansom O, Selfridge J, Caballero IM, Salozhin S, Aithozhina D, Cerchietti L, Meng FG, Augenlicht LH, Mariadason JM, Hendrich B, Melnick A, Prokhortchouk E, Clarke A, Bird A. Kaiso-deficient mice show resistance to intestinal cancer // Mol Cell Biol. 2006- V. 26- P. 199-208.

16) Orlov SV, Kuteykin-Teplyakov KB, Ignatovich IA, Dizhe EB, Mirgorodskaya OA, Grishin AV, Guzhova OB, Prokhortchouk EB, Guliy PV, Perevozchikov AP. Novel repressor of the human FMRgene - identification of p56 human (GCC)(n)-binding protein as a Krppel-like transcription factor ZF5// FEBS J. 2007- V. 274- P. 4848-4862.

17) Prokhortchouk E, Defossez PA. The cell biology of DNA methylation in mammals // Biochim Biophys Acta. 2008. V- 1783- P. 2167-2173.

18) Lopes EC, Valls E, Figueroa ME, Mazur A, Meng FG, Chiosis G, Laird PW, Schreiber-Agus N, Greally JM, Prokhortchouk E, Melnick A. Kaiso contributes to DNA methylation-dependent silencing of tumor suppressor genes in colon cancer cell lines // Cancer Res. 2008- V. 68- P. 7258-7263.

19) Ruzov A, Hackett JA, Prokhortchouk A, Reddington JP, Madej MJ, Dunican DS, Prokhortchouk E, Pennings S, Meehan RR. The interaction of xKaiso with xTcf3: a revised model for integration of epigenetic and Wnt signalling pathways // Development. 2009- V. 136- P. 723-727.

20) Ruzov A, Savitskaya E, Hackett JA, Reddington JP, Prokhortchouk A, Madej MJ, Chekanov N, Li M, Dunican DS, Prokhortchouk E, Pennings S, Meehan RR. The non-methylated DNA-binding function of Kaiso is not required in early Xenopus laevis development // Development. 2009- V. 136- P. 729-738.

21) Пехов В.М., Краснова Н.Ю., Мазур А.М., Селезнева О.В., Прохорчук Е.Б., Момыналиев К.Т.

Метилирование CpG-динуклеотидов генома Helicobacter pylori при повышении концентрации метионина // Молекулярная биология. 2010- Т. 44- С. 170-173.

22) Жигалова Н.А., Женило С.В., Айтхожина Д.С., Прохорчук Е.Б. Две функции домена “цинковые пальцы” метил-ДНК-связывающего белка Каизо // Молекулярная биология. 2010- Т.

44- C. 263-74.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.