WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

ТИМОФЕЕВ Эдуард Николаевич

ИММОБИЛИЗОВАННЫЕ И МОДИФИЦИРОВАННЫЕ ОЛИГОНУКЛЕОТИДЫ В ФИЗИКО-ХИМИЧЕСКИХ ИССЛЕДОВАНИЯХ ДУПЛЕКСОВ И ТРИПЛЕКСОВ ДНК

03.00.03 – Молекулярная биология

Автореферат диссертации на соискание ученой степени доктора химических наук

Москва 2009

Работа выполнена в Лаборатории стереохимии ферментативных реакций Учреждения Российской Академии Наук Института молекулярной биологии им. В.А. Энгельгардта РАН

Официальные оппоненты:

Доктор физико-математических наук, чл.-корр. РАН Георгий Валерианович Гурский Доктор химических наук, профессор Татьяна Семеновна Орецкая Доктор химических наук, профессор Владимир Алексеевич Ефимов

Ведущая организация:

Институт физико-химической медицины Минздрава РФ

Защита состоится ____________ 2009 г. в _________ на заседании диссертационного совета Д 002.235.01 при Институте молекулярной биологии им. В.А. Энгельгардта РАН по адресу: 119991, Москва, ул. Вавилова, д.32.

С диссертацией можно ознакомиться в библиотеке Института молекулярной биологии им. В.А. Энгельгардта РАН.

Автореферат разослан «____» _______________ 2009 г.

Ученый секретарь Диссертационного совета, кандидат химических наук А.М. Крицын

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность проблемы. Широкий спектр функций нуклеиновых кислот в живых системах определяется структурным разнообразием этого класса природных соединений.

Помимо канонической антипараллельной двойной спирали Уотсона-Крика природные полинуклеотидные цепи образуют трех- и четырехцепочечные структуры различных типов, параллельные дуплексы, рибозимы и ДНК-зимы. В качестве отдельного структурного семейства можно выделить сложные синтетические надмолекулярные олигонуклеотидные конструкции, в которых могут быть реализованы различные типы взаимодействий.

Из всех вышеперечисленных форм организации нуклеиновых кислот, вне всякого сомнения, наиболее важной является двойная спираль ДНК. Огромное значение исследований дуплексов ДНК обусловлено тем, что комплементарное узнавание в двойной спирали является основой современной молекулярной биологии и таких ее методов и приложений как полимеразная цепная реакция, биологические микрочипы, гибридизационный анализ, молекулярная диагностика.

Единственной структурой, сопоставимой с дуплексами ДНК по количеству посвященных ей исследований, является тройная спираль или триплексы. Открытые лишь через три года после опубликования структуры двойной спирали, трехцепочечные комплексы до настоящего времени являются объектом повышенного интереса, что обусловлено главным образом потенциальной возможностью использования синтетических олигонуклеотидов для контроля экпрессии генов на уровне транскрипции за счет связывания с двуспиральной ДНК. Другим важным аспектом в исследованиях этих структур является изучение роли и функций параллельных триплексов ДНК в генетической рекомбинации. Настоящая работа включает литературный обзор, полностью посвященный рассмотрению триплексов ДНК.

Доступность синтетических олигонуклеотидов вывела как биологические, так и физико-химические исследования дуплексов и триплексов ДНК на новый уровень. С середины 80-х появилась возможность детально исследовать поведение этих структур различными методами. Однако, уже скоро стало очевидно, что исследования только природных олигонуклеотидных цепей не позволяют в полной мере оценить влияние различных факторов на стабильность и специфичность образования дуплексов и триплексов ДНК. Кроме того, образование триплексов ДНК из природных цепей ограничено полипуриновыми и полипиримидиновыми участками, а также требованием протонирования цитидинов в пиримидиновых антипараллельных триплексах.

Возможности синтетической олигонуклеотидной химии в настоящее время позволяют в широких пределах варьировать состав и свойства олигонуклеотидов.

Огромное количество методов модификации олигонуклеотидов предоставляет возможности для целенаправленного изменения свойств взаимодействующих цепей.

Появилась уникальная возможность селективной трансформации цепей для оценки влияния тех или иных факторов на свойства образующихся комплексов.

Модифицированные олигонуклеотиды предоставляют недоступную ранее возможность моделирования новых типов взаимодействиий нуклеиновых кислот. Методы современной олигонуклеотидной химии позволяют модифицировать или полностью замещать сахарофосфат и нуклеиновые основания, синтезировать самые разнообразные конъюгаты олигонуклеотидов, проводить их иммобилизацию на поверхности или в объеме полимера, вводить в цепь ненуклеотидые фрагменты.

Целью настоящей работы являлось комплексное физико-химическое исследование дуплексов и триплексов ДНК с привлечением синтетических методов к построению олигонуклеотидных моделей и при разработке платформы анализа.

В ходе выполнения работы были решены следующие задачи:

1. Разработаны синтетические подходы к иммобилизации олигонуклеотидов и ДНК в объеме гидрофильного полимера. Предложена синтетическая платформа для параллельного анализа взаимодействий нуклеотидных цепей на гидрогелевых микрочипах.

2. Осуществлен параллельный анализ образования модифицированных дуплексов с использованием полной матрицы иммобилизованных гексануклеотидов (40элементов). Исследовано влияние типа модификаций на стабильность образующихся коротких дуплексов ДНК и специфичность их образования.

3. Проведено исследование влияния гидрофобных и ионных модификаций олигонуклеотидных цепей на стабильность и структуру дуплексов ДНК.

4. Проведен выбор адекватных олигонуклеотидных моделей, содержащих модифицированные цепи, для исследования новых и известных типов триплексов ДНК. Реализован новый принцип построения триплексов ДНК, позволяющий адресовать неприродные синтетические олигонуклеотиды к произвольной последовательности ДНК.

Научная новизна и практическая ценность работы. Рассмотренные в работе подходы к разработке уникальной платформы анализа и построению моделей в физикохимических исследованиях нуклеиновых кислот и полученные результаты имеют приоритетный характер и открывают новое направление исследований.

Физико-химические исследования модифицированных дуплексов ДНК осуществлены как традиционными методами, так и с привлечением новых подходов, основанных на использовании параллельных методов анализа. Разработка синтетических платформ для реализации этих новых подходов представляется одним из наиболее значимых результатов настоящего исследования. Предложенные в настоящей работе методы иммобилизации олигонуклеотидов в сшитых гидрофильных полимерах являются базовыми для нескольких поколений олигонуклеотидных гидрогелевых микрочипов. Три принципиально различных подхода к иммобилизации предоставляют возможность выбора технологического решения при изготовлении гидрогелевых трехмерных микрочипов – традиционная иммобилизация, фотонаправленный синтез или сополимеризация модифицированных олигонуклеотидов с акриловыми мономерами. Параллельный анализ образования дуплексов на олигонуклеотидных микрочипах широко используется в настоящее время для решения широкого круга биологических и диагностических задач.

Однако, возможности этого метода как инструмента физико-химических исследований все еще остаются вне поля зрения исследователей. В настоящей работе впервые представлен параллельный физико-химический анализ образования модифицированных дуплексов ДНК на матрице 4096 иммобилизованных гексануклеотидов.

Проведен синтез и физико-химические исследования дуплексов ДНК, содержащих неприродные цепи, с целью проследить влияние гидрофобных или ионных модификаций на стабильность двойной спирали. Полученные результаты представляют безусловный интерес при конструировании олигонуклеотидных проб для гибридизационного анализа.

В ходе выполнения работы впервые было экспериментально доказано образование нового типа триплексов ДНК с химерной ,-третьей цепью. Новый подход к построению третьей цепи – с использованием неприродных аномеров нуклеозидов – позволяет адресовать триплекс-образующие олигонуклеотиды к произвольной последовательности ДНК и не ограничивается полипуриновыми и полипиримидиновыми участками. В работе рассмотрены свойства различных типов триплексов, исследованных с использованием универсальных синтетических конструкций. Предложенный подход к построению внутримолекулярных моделей триплексов ДНК был реализован впервые и обеспечивает заметное повышение стабильности, задает взаимную ориентацию цепей, упрощает термодинамический анализ и сводит к минимуму влияние петли. Благодаря использованию таких моделей удалось экпериментально получить и охарактеризовать параллельный триплекс рекомбинантного типа или R-форму ДНК.

Апробация работы. Результаты работы были представлены на международных и российских конференциях: DOE Human Genome Program Contractor-Grantee Workshop IV, VII, VIII (США, 1994, 1999 и 2000), XIII Internationa Round Table «Nucleosides, Nucleotides and Their Biological Applications» (Франция, 1998), XV международная конференции «Новые информационные технологии в медицине, биологии, фармакологии и экологии» (Украина, 2007).

Публикации. По материалам диссертации опубликовано 32 работы, в том числе патентов.

Объем и структура работы. Диссертационная работа изложена на 265 страницах машинописного текста, содержит 104 рисунка, 23 таблицы, 10 схем. Диссертация состоит из введения, обзора литературы на тему «Синтетические подходы в исследованиях триплексов ДНК», обсуждения результатов, экспериментальной части, выводов и списка цитируемой литературы из 539 наименований.

CОДЕРЖАНИЕ РАБОТЫ 1. Исследование взаимодействий модифицированных олигонуклеотидов на трехмерной полимерной подложке За последнее десятилетие методы анализа взаимодействий нуклеиновых кислот пополнились рядом новых подходов, среди которых особое место занимает параллельный анализ на микрочипах. Олигонуклеотидные микрочипы представляют собой матрицу коротких олигонуклеотидов, иммобилизованных на поверхности стекла, пластика или в объемных микроэлементах гидрофильного сшитого полимера. Отличительной особенностью микрочипов, разрабатываемых в ИМБ РАН, является то, что они представляют собой гидрогелевые элементы, фиксированные на поверхности стекла или пластика. Трехмерная иммобилизация обеспечивает ряд существенных преимуществ, основными из которых являются повышенная чувствительность метода, обусловленная увеличенной емкостью элементов на единицу поверхности, меньшая плотность иммобилизации по сравнению с поверхностью, а также возможность изолировать ячейки и осуществлять независимые реакции или взаимодействия в каждой из них. В первой части работы представлены методы иммобилизации олигонуклеотидов, один из которых положен в основу синтетической платформы для изготовления гидрогелевых олигонуклеотидных микрочипов. Также представлен анализ взаимодействий коротких модифицированных олигонуклеотидов с микрочипом, составленным из всех возможных 4096 гексануклеотидов.

1.1. Иммобилизация коротких олигонуклеотидов в сшитых акриловых сополимерах Самым первым подходом к иммобилизации олигонуклеотидов в объеме геля являлась реакция 3-диальдегидных производных с гидразидными функциональными группами в геле. К сожалению, гидразидная химия не обеспечивает стабильности связи олигонуклеотида с подложкой, особенно в условиях многократных раундов гибридизации и отмывки.

Мы разработали два типа полимерных акриловых носителей для иммобилизации олигонуклеотидов. Эти полимерные носители содержат аминогруппы или альдегидные группы и позволяют проводить иммобилизацию соответственно 3-диальдегидных или аминоалкильных производных олигонуклеотидов в присутствии восстанавливающего агента. Введение аминогрупп в акриловый сополимер было выполнено с использованием хлоргидратов аминоалкилакриламидов. Эти соединения могут быть легко получены при ацилировании соответствующих диаминов акрилоил хлоридом в эфире. Для введения альдегидных групп был использован 5,6-О-изопропилиден-5,6-дигидрокси гексилакриламид, синтез которого представлен на схеме 1. Прочность связи между гелевой подложкой и стеклянной поверхностью достигалась благодаря испльзованию 3(триэтоксисилилпропил)акриламида. Активация альдегидных функциональных групп в геле проводилась последовательной обработкой сшитого полимера 80% уксусной кислотой и 0.1 М раствором NaIO4.

CHH3C OH i-iii O N + HO O N OH N iv, v CHH3C O O 2.O CHNH Схема 1. Синтез 5,6-О-изопропилиден-5,6-дигидроксигексилакриламида. (i) Ацетон, TsOH, азеотропная отгонка воды; (ii) MsCl в Py; (iii) LiN3 в ДМФ, 150°С; (iv) Ph3P в Py; (v) акрилоил хлорид, триэтиламин, 0°С.

Иммобилизация проводилась с использованием 5-32P-меченных олигонуклеотидов ATGCTACT-X, где X – окисленный метилуридиновый фрагмент или аминоалкильная группа (ON1 и ON2, соответственно). Немодифицированный олигонуклеотид (ON3) был использован в качестве отрицательного контроля. Химия иммобилизации представлена на схемах 2 и 3. Как и ожидалось, обе схемы иммобилизации обеспечивают высокий выход пришивки, таблица 1. Наилучшие результаты были получены при использовании в качестве восстановителя пиридин-борана как для амино-, так и для альдегидного сополимера (74% и 97%, соответственно).

Из всех исследованных методов иммобилизации наиболее привлекательным с точки зрения эффективности, стабильности и технологичности представляется метод, основанный на привязке аминоолигонуклеотидов к альдегидной полимерной подложке.

Вышеописанная процедура иммобилизации аминоолигонуклеотидов в сшитых акриловых сополимерах была адаптирована для процесса изготовления гидрогелевых олигонуклеотидных микрочипов. В модифицированной схеме иммобилизации мы использовали другой акриловый мономер – N-(2,2-диметоксиэтил)-акриламид, легко получаемый в одну стадию из коммерчески доступного (2,2-диметоксиэтил)амина.

Ячейки функционализованного сшитого сополимера были сформированы методом фотополимеризации смеси акриламида, бис-акриламида и N-(2,2-диметоксиэтил)акриламида. Альдегидные группы в геле были деблокированы короткой кислотной обработкой микрочипов, после чего с помощью автоматизированной системы нанесения каждая ячейка геля была загружена индивидуальным раствором аминоолигонуклеотида.

Восстановление оснований Шиффа пиридиний-бораном было осуществлено в условиях, препятствующих переносу олигонуклеотидных растворов между соседними ячейками.

O NR2 O NH O NR2 O NH O O O O CHCHR=H или Me C R=H или Me C HH1) H+ 1) H+ 2) NaIO2) NaIOLink - p -oligo-5' Link - p -oligo-5' NH NH O O O NR2 O NH O NR2 O NH O NR2 O NH O NR2 O NH R=H или Me R=H или Me R=H или Me R=H или Me 1) 5’-oligo-p-Link-NH1) 5’-oligo-p-Link-NH2) X-BH3, X=NaCN, Py или NMe2) X-BH3, X=NaCN, Py или NMeСхема 2. Иммобилизация аминоолигонуклеотидов на альдегидной полимерной подложке.

O NR2 O NH O NR2 O NH O O O O CHCHR=H или Me C R=H или Me C HHUme Ume 5'-oligo - p -O 5'-oligo - p -O O O O O O O X-BH3, X=NaCN, Py или NMeX-BH3, X=NaCN, Py или NMe5'-oligo - p -O 5'-oligo - p -O O O N N Ume Ume O NRO NRO NH(CH2)O NH(CH2)R=H или Me R=H или Me Схема 3. Иммобилизация 3-диальдегидных производных олигонуклеотидов на аминированной полимерной подложке.

Таблица 1. Данные по эффективности иммобилизации.

Тип подложки Функциональная группа Выход, % Неспецифическое (восстановитель) олигонуклеотида связывание, % -NH2 (NaCN·BH3) -CH=O 60±5 2±-NH2 (Py·BH3) -CH=O 74±5 5±1.NH2 (NMe3·BH3) -CH=O 68±5 3±-CH=O (NaCN·BH3) -NH2 95±5 9±-CH=O (Py·BH3) -NH2 97±5 8±-CH=O (NMe3·BH3) -NH2 94±5 3±-C(O)NHNH2 -CH=O 87±5 1±0.-C(O)NHNH2 -CH=O 88±5 1±0.Вышеописанный процесс изготовления был использован при разработке олигонуклеотидных гидрогелевых микрочипов для анализа 16S РНК некоторых патогенных микроорганизмов, микрочипов, содержащих полный набор всех возможных гексануклеотидов, при разработке методов амплификации ДНК с использованием микрочипов, в экспериментах по анализу полиморфизма на микрочипах и при исследовании ферментативных реакций с участием иммобилизованных олигонуклеотидов.

1.2. Функционализация ДНК и ее иммобилизация в полиакриламидном геле В работе представлен простой метод функционализации ДНК за счет апуринизации и введении аминогрупп по апуринизованным участкам. Благодаря наличию аминогрупп модифицированная ДНК может быть иммобилизована в альдегид-содержащем сшитом полиакриламиде. Такая процедура иммобилизации ДНК полностью совместима с иммобилизацией аминоолигонуклеотидов, что позволяет использовать ее при изготовлении гибридных ДНК-олигонуклеотидных микрочипов. Введение аминогрупп в ДНК может при необходимости сопровождаться ее фрагментацией по участкам функционализации.

Реакция апуринизации и последующее присоединение этилендиамина были изучены на олигонуклеотидной модели FAM-d(T6GT8), ON4. Апуринизация сопровождается незначительной фрагментацией (ок. 10%) с образованием более мобильного гексануклеотида FAM-dT6-p, являющегося продуктом -элиминирования. При инкубации апуринизованного олигонуклеотида с этилендиамином в течение 3 часов при 37°С и рН 7.4 наблюдается -элиминиерование и разрыв цепи в месте апуринизации с выходом ок.

70%. Восстановление образованного фрагмента боргидридом натрия приводит к образованию аминоолигонуклеотида FAM-dT6-dR-NH-C2H4-NH2. Помимо этого образуется до 15% полноразмерного аминоолигонуклеотида. При восстановительном аминировании апуринизованного олигонуклеотида этилендиамином при рН 4.4 в присутствии цианборгидрида натрия образуется полноразмерный аминоолигонуклеотид FAM-dT6-(dR-NH-C2H4-NH2)-dT8 с выходом около 90%. Наряду с основным продуктом в реакционной смеси содержалось не более 5% исходного апуринизованного олигонуклеотида и продукта -элиминирования.

При моделировании иммобилизации в гидрогелевых ячейках микрочипа был использован синтетический 40-мерный олигонуклеотид ON5 (рис. 1А). Эффективность иммобилизации ДНК оценивали по комплементарному связыванию четырех флуоресцентно меченных олигонуклеотидов ON6-ON9. Результат гибридизации ДНК микрочипа с олигомером ON8 представлен на рис. 1В. Гибридизация проходила с большей эффективностью при больших временах апуринизации (40 и 60 мин кислотной обработки) как в случае фрагментации, так и без нее. Большее количество апуриновых участков и меньшая длина фрагмента ДНК повышает эффективность иммобилизации и последующей гибридизации. Однако, при избыточной апуринизации следует ожидать снижения эффективности гибридизации, вследствие заметной потери пуриновых оснований. Количественные данные по гибридизации четырех проб с иммобилизованной ДНК представлены на рис. 1C и 1D.

DNA DNA PO2 POO O Purine OH O O 80% HCOOH O O DNA DNA NH2-(CH2)2-NH2.HCl, NH2-(CH2)2-NH2.HCl, pH 7.4, 3h; NaBHpH 4.4, NaBH3CN DNA DNA POPOO O OH OH NHNH NHNH O DNA OCH-linker-Gel PyBHOCH-linker-Gel PyBHDNA DNA - POPOO O OH OH NH-CH2-linker-Gel NH NH-CH2-linker-Gel NH O DNA Схема. 4. Конденсация апуриновой ДНК с этилендиамином.

В качестве длинных фрагментов ДНК были использованы перекрывающиеся одно- и двухцепочечные участки длиной 218 и 972 нуклеотидов к-ДНК антигена карциномы человека GA733-2 (клон GA733-2-2), а также 227-нуклеотидный участок HLA DQ 0201, которые были получены обычной или ассиметричной ПЦР. На рис. 2 показаны результаты гибридизации ДНК-микрочипа с олигонуклеотидами ON10 (10-мер), ON11 (15-мер) и ON12 (37-мер), комплементарными фрагментам длиной 218, 972 и 227 нуклеотидов, соответственно. Все три олигонуклеотидные пробы показали специфическое связывание с комплементарной иммобилизованной ДНК. Гелевые элементы с контрольной необработанной ДНК и ненагруженные ячейки не обнаружили сколько-нибудь заметного гибризационного сигнала. Увеличение времени апуринизации ДНК с 3 до 30 мин привело к усилению эффективности гибридизации. Однако, дальнейшее увеличение длительности кислотной обработки до 1 часа не привело к повышению сигналов гибридизации как для одноцепочечной, так и для двухцепочечной ДНК. При фрагментации флуоресцентный сигнал распределен более равномерно по полю ячейки, что свидетельствует о более равномерной иммобилизации. Нефрагментированная ДНК иммобилизуется преимущественно по поверхности ячейки. Следует отметить, что как одноцепочечная, так и двухцепочечная ДНК дают схожий профиль гибридизации. Это свидетельствует о том, что присутствие комплементарной цепи в геле не осложняет гибридизацию с олигонуклеотидными пробами.

1.3. Фотонаправленный синтез матрицы олигонуклеотидов на гидрогелевой полимерной подложке Совмещение технологии фотонаправленного синтеза олигонуклеотидов на поверхности с преимуществами гидрогелевых микрочипов позволило бы существенно расширить границы применения и эффективность использования биологических микрочипов. Нами была предпринятата попытка конвергенции двух различных подходов к изготовлению олигонуклеотидных микрочипов.

Среди акриловых полимеров, совместимых с процедурой олигонуклеотидного синтеза, можно назвать сшитый полидиметилакриламид и полиакрилоилморфолид. Оба этих носителя характеризуются совместимостью как с органическими растворителями, так и с водными растворами. Полидиметилакриламид хорошо набухает в воде, хлористом метилене, пиридине, диметилформамиде и удовлетворительно в ацетоне, спиртах и ацетонитриле. Стандартные реагенты для олигонуклеотидного синтеза – трихлоруксусная кислота в дихлорметане, раствор иода в системе ТГФ-пиридин-вода, кэпирующие растворы не вызывают разрушения полимера.





Depurination time 40-mer (ON5):

3 min C A 10 min ON20 min 40 min TACCAGTTTTACGGTCCCTCTGGCCAGTACACCCATGAAT 3.60 min 2. ON8 ON7 ON2. Фрагментированный Нефрагментированный 1.1.Время 0.апуринизации 0.B 1 2 3 60 min Labeled probe Depurination time 40 min 3 min D 10 min 2.20 min 20 min 40 min 60 min 2.10 min контроль 1.3 min 1.0.0.1 2 3 Labeled probe Рис. 1. Гибридизация олигомеров ON6-ON9 c иммобилизованным 40-мером. (А) Нуклеотидная последовательность 40мерного олигонуклеотида. (B) Результат гибридизации микрочипа с ON8. Контроль – флуоресцентно меченный октамер.

(С,D) Количественные данные по гибридизации ON6-ON9 (позиции на графике с 1 по 4 соответственно).

Fluorescence Intensity, AU Fluorescence Intensity, AU A B depurination time ДНК-микрочип 0. 3 min 0.12 30 min Необр. 227-нт 972-нт 218-нт 60 min 972-нт 0. __ __ __________ _________ 0.ON + - - + + - - + s.s.

0. - + + - - + + - d.s.

0. - - - - + - + + Фрагментированная 0. - + + + - + - - Нефрагментированная 0.1 2 3 4 5 6 7 Время 8 7 6 5 4 3 2 Lane number апуринизации depurination time 0.3 min 3 min 30 min 0.ON60 min 30 min ON0.60 min 0.0.0. 3 min 1 2 3 4 5 6 7 ONON11 Lane number 30 min Depurination time 0. 3 min ON60 min 30 min 0. 60 min 0. 3 min 0.ON30 min 0.60 min 0.1 2 3 4 5 6 7 Lane number Рис. 2. Гибридизация ДНК-микрочипа. (A) Результаты гибридизации с олигонуклеотидами ON10-ON12. (B) Количественные данные по гибридизации с ДНК-микрочипом.

Fluorescence Intesity, AU Fluorescence Intensity, AU Fluorescence Intensity, AU Метод пришивки полимера к стеклянной повехности с использованием N-(3триэтоксисилилпропил)-акриламидом, рассмотренный выше, обеспечивает стабильную привязку полимерной пленки к стеклу и стабильность в условиях деблокирования олигонуклеотидов (50% спиртовой этилендиамин при комнатной температуре в течение нескольких часов). В качестве функциональной группы для инициирования олигонуклеотидного синтеза в геле была выбрана аминогруппа, поскольку соответствующий мономер – хлоргидрат N-(2-аминоэтил)акриламида – может быть легко синтезирован в одну стадию из этилендиамина и акрилоилхлорида. Таким образом, олигонуклеотид оказывается связанным с гелевой подложкой фосфорамидатной связью.

Для фотонаправленного олигонуклеотидного синтеза в сшитом полидиметилакриламиде мы использовали 15 мкм или 50 мкм пленки геля на стекле.

Синтез олигонуклеотида (dT)16 на 50 мкм полидиметилакриламидной пленке с использованием стандартной DMTr химии показал высокую эффективность конденсации начиная со второго нуклеотидного звена, тогда как первый присоединенный нуклеотид характеризовался эффективностью в 90%. Емкость гелевой подложки в расчете на площадь 1 кв. дюйм составила 90 микромоль по данным фотометрии первого отщепленного DMTr фрагмента. Это соответствует концентрации доступных функциональных групп в геле 6 mM. Однако, это значение составляет лишь 6% от исходного количество использованного аминомономера.

Сравнительный анализ гибридизации на 15 мкм гидрогелевых и плоских микрочипах был осуществлен с использованием матрицы 1616 элементов размером 2и 800 мкм. Олигонуклеотид FAM-CTGAACGGTA (ON13) в концентрации 10-9 М (в 5SSPE) был использован для гибридизации с пробами на чипе, нуклеотидный состав которых был представлен полным набором вариаций в центральном тетрануклеотидном фрагменте. Анализ гибридизации показал, что поверхностные и гидрогелевые микрочипы различаются по двум основным характеристикам: емкость ячеек по иммобилизованной пробе и кинетика отмывки. Интенсивность сигнала с гелевых микрочипов приблизительно в 2 раза превышала этот параметр для поверхностных микрочипов, при этом интенсивность лазера при сканировании геля была понижена в 10 раз. Скорость отмывки пригибридизованной пробы с гелевого чипа существенно ниже скорости отмывки поверхностных чипов. Так, для получения стандартной гибридизационной картины на поверхностном микрочипе было достаточно провести одну отмывку при температуре гибридизации (16°С). В случае гелевых микрочипов для получения такого же уровня сигнала необходимо было провести многократную отмывку при повышенной температуре (50°С). Распределение мисматчевых сигналов представляется более адекватным в случае гидрогелевых микрочипов. Наиболее стабильным мисматчем на поверхностном микрочипе оказался TT (мисматч/перфект = 187/465), тогда как на гелевом – GT (543/1005). Наиболее существенным недостатком гелевых полидиметилакриламидных микрочипов является высокий уровень фона, который в 4 раза превышает фон на поверхностных микрочипах.

1.4. Иммобилизация олигонуклеотидов в сшитом полиакриламидном геле методом сополимеризации Нами впервые был разработан метод фото- или химически индуцируемой сополимеризации аллильных производных олигонуклеотидов с акриламидом, пригодный для изготовления гидрогелевых олигонуклеотидных микрочипов.

В качестве непредельных модификаторов олигонуклеотидной цепи, способных к совместной полимеризации с акриламидом, мы выбрали аллиловый спирт и бутендиол.

Соответствующие фосфорамидиты для использования в автоматическом олигонуклеотидном синтезе были синтезированы в одну или две стадии, соответственно.

Для достижения совместимости аллильных мономеров со всеми этапами олигонуклеотидного синтеза оказалось достаточным заменить стандартный окислитель раствором 1 М трет-бутил пероксида в ТГФ.

Для проведения сополимеризации в микрокаплях глицеринового раствора мономеров и персульфата аммония был использован метод межфазной доставки реагента, в данном случае TEMED.

Сополимеризация акриловых мономеров с аллильными олигонуклеотидами может быть проведена в микрокаплях в условиях межфазной доставки активатора или при облучении видимым или УФ светом. Последовательные циклы фотосополимеризации с применением физической или проецируемой маски позволяют формировать ячейки малого размера и получать микрочипы высокой плотности. С помощью соответствующей экспериментальной установки были получены микрочипы с размером ячеек 10 10 мкм. Пробы на модельном микрочипе представлены набором олигонуклеотидов 5-AllylXTGGAC (ON22-ON25) (X = TGA, TCT, GAC и CCC), тогда как флуоресцентно меченные олигонуклеотиды – набором 5-GTCCAY (ON26-ON29) (Y = TCA, AGA, GTC и GGG).

Результаты гибридизации такого микрочипа представлены на рисунке 3А.

Флуоресцентный сигнал ассоциирован преимущественно с перфектными олигонуклеотидами на чипе. Разрешение перфект/мисматч может быть повышено при отмывке микрочипа гибридизационным буфером в оптимальном диапазоне температур. С другой стороны, существует возможность провести термическую денатурацию дуплексов на микрочипе, что позволяет наблюдать различия между перфектным и мисматчевым дуплексами в широком интервале температур. На рисунке 3B показаны профили термической денатурации дуплексов ON25-ON29 и ON24-ON29.

При уменьшении размера ячеек скорость гибридизации существенно возрастает. На рисунке 32С представлены сравнительные данные по скорости гибридизации для ячеек размером 10 10 5 мкм и 100 100 5 мкм.

Иммобилизация аллильных производных олигонуклеотидов представляет собой самостоятельный подход к формированиию олигонуклеотидных гидрогелевых микрочипов и является прототипом технологии изготовления биочипов, используемой в настоящее время в Институте Молекулярной Биологии РАН.

1.5. Исследование стабильности и специфичности образования модифицированных дуплексов ДНК с использованием полной матрицы гексануклеотидов В этой главе представлено исследование специфичности образования и стабильности дуплексов, образованных модифицированными олигонуклеотидами и гексамерными иммобилизованными пробами. Мы использовали в олигонуклеотидный микрочип, содержащий все возможные гексануклеотиды (4096 проб). В качестве модификаций в исследуемых олигонуклеотидах были использованы 2-О-метиладенозин (Am), 2-О-метилрибозид 2,6-диаминопурина (Dm), 2-дезоксирибозид 2,6-диаминопурина (D), 2-О-метилцитидин (Сm) и 5-бромдезоксиуридин. Олигонуклеотидный микрочип, содержащий полный набор проб определенной длины, представляется чрезвычайно удобным инструментом при исследовании специфичности взаимодействии. Очевидно, что таким образом можно отследить все возможные мисматчевые дуплексы и провести их сравнение как между собой, так и с перфектным дуплексом. С применением синтетической платформы, рассмотренной выше, мы создали олигонуклеотидную матрицу всех возможных гексануклеотидов и использовали ее при исследовании коротких модифицированных дуплексов. С учетом относительно низкой стабильности гексамерных дуплексов каждая проба на микрочипе была дополнена смесью четырех природных нуклеотидов с 5 и с 3 конца.

0.ON25+ON0.0.ON26 ON27 ON28 ONA 0.ON24+ONB 0. 0.0.Иммобилизованные 10 20 30 40 олигонуклеотиды Temperature 1.ON0.0.ON0.C 0.ON1001005µm 0.ON0.10105µm 0.0.0. 0.0 10 20 30 40 50 Time, min Рис. 3. (А) Результаты гибридизации микрочипа с размером ячеек 10 10 5 мкм. (B) Профили плавления перфектного и мисматчевого дуплексов. (С) Кинетика гибридизации для ячеек различного размера.

a Пробы Fluorescence,.u.

Гибридизуемые 5’-GTCCA TCA TT-F 5’-GTCCA AGA TT-F 5’-GTCCA GTC TT-F 5’-GTCCA GGG TT-F a Fluorescence,.u.

Cпецифичность образования модифицированных дуплексов. Для всех замен дезоксиаденозина мы использовали одну и ту же последовательность 5-AAGTAACA. Это дало возможность прямого сравнения влияния различных аналогов на специфичность связывания. Модифицированные основания были введены во вторую, пятую и шестую позиции октамера (таблица 2).

Сравнительный анализ гибридизации немодифицированного олигонуклеотида и олигомеров с Am и D модификацией цепи показал, что при низкой температуре (7°С), когда наблюдаются наиболее интенсивные гибридизационные сигналы, распределение флуоресценции по ячейкам наиболее узкое для Am, а для D-замещенных олигомеров наиболее широкое. Такое распределение обусловлено дискриминацией мисматчей, т.е.

соотношением сигналов от перфектного и мисматчевого дуплексов при выбранной темпереатуре. Количественные данные по флуоресцентным сигналам, зарегистрированным при 7°С для дуплексов d(AXGTXXCA)•d(NGTTACTN) (X = dA, Am, D) и их стабильных мисматчей, представлены на рисунках 4А, 4B. Очевидное преимущество в дискриминации неперфектных дуплексов наблюдалось для всех модификаций Am. Чем выше степень модификации олигонуклеотида этим аналогом, тем лучше дискриминация. В случае D-модифицированных олигонуклеотидов специфичность образования дуплексов была близкой к немодифицированному контролю или хуже.

Таблица 2. Структура, стабильность и термодинамические данные для модифицированных и немодифицированнных олигонуклеотидов ON30-ON43.

Олиго Нуклеотидная Tmчип Tmраств H последовательность (°C) (°C) (ккал моль-1) ON30 AAGTAACA 18.6 20.6 30.4; 31.4c ON31 AAmGTAACA 18.7 - 32.ON32 AAmGTAmACA 15.0 13.1 33.7; 28.6c ON33 AAmGTAmAmCA 14.5 - 35.ON34 ADGTAACA 21.3 - 31.ON35 ADGTDACA 26.4 27.2 32.9; 52.2c ON36 ADmGTAACA 20.6 - 32.ON37 ADmGTDmACA 23.3 - 40.ON38 ACGACCTA 28.3 - 26.ON39 ACGACCmTA 28.4 - 31.ON40 ACmGACmCmTA 27.3 - 43.ON41 ATGATTCA 20.7 - 36.ON42 ABGATTCA 20.4 - 35.ON43 ABGABTCA 21.5 - 37.AAGTAACA ADGTAACA ADGTDACA AAGTAACA ADGTAACA ADGTDACA m D B 1.0.0.0.0.1.1.0.0.0.m m m m m m m m m m m m AAGTAACA AA GTAACA AA GTA ACA 0.AA GTA A CA AAGTAACA AA GTAACA AA GTA ACA AA GTA A CA m C A Рис. 4.

Флуоресцентные сигналы дуплексов выбранных ячеек микрочипа. Гибридизация с A - ( A ) и D-модифицированными ( B ) 1.0.0.0.0.1.0.0.0.0.олигонуклеотидами при 7°С. Гибридизация с A - ( C ) и D-модифицированными ( D ) олигонуклеотидами при температуре плавления соответствующего перфектного дуплекса, сигналы которого приняты за 1.

g T C C A t T T g T G g G C T t A c T T c T G G T T C g C g T T T G T g G g C g C g T T T G T g G t g t A T A T T G T G G g C C A A T T T t T g t C g A C T A T T c a T c C a A C T A T T G g T C G g A C T A T T G c T C G c A C T A T T G T T C G T A C T A T G T T G e c n e c s e r o u l f d e z i l a m r o N e c n e c s e r o u l f d e z i l a m r o N g C T C A t T T g T G g G T C t c A T T c T G G T T C g C g T T T T G g G g C C g g T T T T G g G t g t A A T T T T G G G g C C A A T T T T t t g g C C A A T T T T c a c a C C A A T T T T G g G g C C A A T T T T c G G c C C A A T T T T G T G T C C A A T T T T G G e c n e c s e r o u l f d e z i l a m r o N e c n e c s e r o u l f d e z i l a m r o N ATGATTCA ABGATTCA ABGABTCA m m C m m m AAGTAACA AD GTAACA AD GTD ACA 1.0.0.0.0.m A m m m ACGACCTA ACGACC TA AC GAC C TA 1.0.0.0.0.B 1.0.0.0.0.Рис. 5.

Флуоресцентные сигналы дуплексов выбранных ячеек микрочипа. Гибридизация с D - ( A ) и C - ( B ) и B-модифицированными олигонуклеотидами при температуре плавления соответствующего перфектного дуплекса, t C T A A G c C T A A G g C T A A G A C g A A G A C T A A G e c n e c s e r o u l f d e z i l a m r o N g C A T g G g C A T c G T C g T T G g C g T T G g t A T T G G C A T T t g C A T T a c C A T T G g C A T G T C c G T C G A c G T g C T T G T G C G t G A C T T T G G G G c C T e c n e c s e r o u l f d e z i l a m r o N G G t g C T G G a A C T G G c t A g G G A G C g G G G A a g G G G A g a G G G g C T G G A e c n e c s e r o u l f d e z i l a m r o N Однако, данные полученные при определенной выбранной температуре не отражают истинной дискриминации, поскольку не принимается в рассчет эффект стабилизации или дестабилизации при модификации цепей. Для корректной оценки дискриминирующей способности мы получили кривые плавления для всех дуплексов на микрочипе. Анализ специфичности был проведен при температуре плавления соответствующего перфектного дуплекса. На рисунках 4C, 4D представлены данные по дискриминации мисматчей для тех же олигонуклеотидов, но полученные при температуре плавления соответствующего перфектного дуплекса. Видно, что дискриминация мисматчей для Am- и для Dмодифицированных олигонуклеотидов существенно увеличилась.

Аналоги Dm содержат модификацию как в сахарном остатке, так и в основании.

Данные по дискриминации для Dm-замещенных олигонуклеотидов представлены на рисунке 5А. Эффект от введения этой модификации на специфичность образования дуплекса оказался более выраженным, чем для Am и D аналогов. Принимая во внимание заметный стабилизирующий эффект этого аналога можно считать его наиболее предпочтительной модификацией.

Модификация октамеров B и Cm аналогами не вызвала сколько нибудь выраженного эффекта на специфичность образования дуплексов по сравнению с немодифицированными олигонуклеотидами (рис. 5В и 5С)..

Стабильность дуплексов и термодинамические параметры. Профили денатурации модифицированных дуплексов, полученные с использованием полной матрицы гексануклеотидов, подтверждают стабилизирующий эффект 2,6-диаминопуриновых аналогов. Среднее значение Tm для D составило ~4°С. Заметную стабилизацию вызывает также аналог Dm. Влияние Am сводится к незначительной дестабилизации, тогда как Cm и B аналоги практически не влияют на стабильность дуплексов.

Мы провели сравнение флуоресцентных кривых плавления трех выбранных дуплексов с данными, полученными из УФ профилей термической денатурации в растворе. Различие в стабильности дуплексов не превышало 2°С.

2. Исследования дуплексов ДНК, содержащих неприродные цепи Среди факторов, определяющих устойчивость дуплексов ДНК, основными являются гидрофобные взаимодействия, водородное связывание, конформация сахарофосфата и ионные взаимодействия. Все многообразие модификаций олигонуклеотидов, как правило, сводится к изменению удельного вклада в структуру какого либо одного или нескольких из перечисленных факторов. В этой части работы рассмотрены модификации олигонуклеотидной цепи, изменяющие ее гидрофобные или ионные свойства.

Модификация цепей олигонуклеотидов проводилась с использованием нуклеозидов 5нитроиндола и замещенного 4-нитроиндола, межнуклеотидной фенантридиниевой вставки, цвиттерионной межнуклеотидной связи и N1-метил дезоксиаденозина.

2.1. Стабилизация коротких ДНК дуплексов концевым нуклеотидом 5нитроиндола Наиболее удачным синтетическим аналогом нуклеозидов, содержащим универсальное основание, принято считать 2-дезоксирибозид 5-нитроиндол. При введении в состав одной из цепей дуплекса 5-нитроиндол приводит лишь к незначительной дестабилизации, образуя при этом пары с природными основаниями с близкой эффективностью. Сходные характеристики были обнаружены также для 4-и 6нитроиндолов. В настоящем разделе рассмотрен стабилизирующий эффект от включения 1-(2-дезокси- -D-рибофуранозил)-5-нитроиндола (5NI) по 5 или по 3-конецу октамерного олигонуклеотида при различных сочетаниях прилежащего и спаренного с нитроиндолом нуклеотида.

Олигонуклеотидные модели. Целью настоящего исследования было изучение влияния природы соседних с 5NI по цепи или противостоящих нуклеотидов комплементарной цепи на стабильность коротких ДНК дуплексов и изменение термодинамических параметров. Мы синтезировали набор октамерных олигонуклеотидов 5-XGACCGTC и 5-GACCGTCX, где Х – А, G, T или С, и набор комплементарных им ундекануклеотидов 5-TGACGGTCYZT и 5-TZYGACGGTCT, где Y и Z – также какиелибо из природных нуклеотидов. Из этого набора олигонуклеотидов были составлены все возможные варианты дуплексов с различными сочетаниями X, Y, Z. Помимо этого были получены модифицированные олигонуклеотиды, отличающиеся от октамеров наличием концевого 5NI: 5-(5NI)XGACCGTC или 5-GACCGTCX(5NI). Комплементарные этим олигонуклеотидам олигомеры представлены набором ундекануклеотидов. Для анализа стабильности и рассчета термодинамических параметров были подобраны варианты дуплексов с различными сочетаниями X, Y, Z и 5NI. Таким образом, полученный набор моделей позволил провести сравнение характеристик немодифицированных и фланкированных 5NI либо по 5, либо по 3 концу дуплексов. Кроме того, была предусмотрена возможность проследить влияние различных сочетаний X, Y и Z.

Анализ стабильности дуплексов и значений термодинамических параметров. На основании профилей термической денатурации были рассчитаны термодинамические параметры образования дуплексов. Как и следовало ожидать, присоединение 5NI к одному из концов олигонуклеотида стабилизирует дуплекс. Выяснилось, однако, что если 5NI находится на 5-конце олигонуклеотида, имеет место более выраженная стабилизация.

На рисунке 6 представлена зависимость разницы температур плавления модифицированных и не модифицированных дуплексов (Tm) от природы спаренного с 5NI основания и положения модификации. Видно, что добавление 5NI с 5 конца октануклеотида вызывает больший эффект стабилизации дуплексов (среднее значение Tm составляет 6.8°С) по сравнению с 3 модификацией (среднее значение Tm – 2.7°С).

Вариации по температурам плавления в зависимости от природы основания в немодифицированной цепи невелики и укладываются в диапазон, не превышающий 2.2°С как для 3, так и для 5 модификации 5NI. Выступая в роли универсального основания, концевой 5NI не отдает явного предпочтения ни одному из спаренных с ним природных нуклеотидов.

3.T-NI 6.1.C-NI 8.1.G-NI 6.3.A-NI 6.0 5 m (°C) (° ) (° ) (° ) Рис. 6. Значения Tm (°C) для разных вариантов спаренных с 5NI оснований при модификации октануклеотидов по 3 концу (колонки серого цвета) или по 5 концу (колонки черного цвета).

8.А-Т Т-А G-C C-G T-T G-T C-T A-A G-A C-A A-C T-C C-C A-G T-G G-G -2.Рис. 7. Значения Tm (°C) для разных вариантов соседних с 5NI пар оснований при модификации октануклеотидов по 3 концу (колонки серого цвета) или по 5 концу (колонки черного цвета).

m T (°C) Для оценки влияния прилежащей пары оснований на стабилизирующий эффект 5NI в паре с аденином мы исследовали термическую денатурацию 32 коротких дуплексов ДНК. Сравнивая данные для перфектных пар природных оснований можно отметить значительный стабилизирующий эффект для модификации по 5 концу октануклеотида, в среднем Tm=6.5°С, при минимуме отклонений от средней величины. Для 3 концевой модификации среднее значение Tm составило 3°С и разброс значений оказался больше, что также можно проследить из рисунка 7. Для находящихся рядом с парой 5NI•A мисматчевых пар наблюдается снижение стабилизирующего эффекта и увеличение колебаний значений Tm относительно средней величины. Для 5NI на 5 конце среднее значение Tm составило 4.8°С, тогда как для 3 конца – 1°С. Можно также отметить, что, как правило, эффект стабилизации уменьшается в случае соседства 5NI c пуринами. Так, для 5 концевой модификации наименее стабильными оказались дуплексы с G•G, A•G, G•A и А•А мисматчевыми парами, соседними с 5NI. При рассматрении 3 концевой модификации, можно отметить дестабилизирующий эффект добавленного 5NI для соседних неперфектных пар A•A, G•A, T•G и G•G.

2.2. Олигодезоксинуклеотиды, содержащие замещенные 4-нитроиндолы:

синтез и исследование в составе дуплексов ДНК В данном разделе представлен синтез олигонуклеотидов, содержащих новые универсальные основания, 2-метил-4-нитроиндол и 2-фенил-4-нитроиндол, и исследовано поведение коротких дуплексов ДНК с одной модифицированной цепью.

Синтез фосфорамидитов нуклеозидов нитроиндолов и модифицированных олигонуклеотидов. Замещенные 4-нитроиндолы 2.12a и 2.12b были получены окислительной нуклеофильной конденсацией 3-нитроанилина с ацетоном или ацетофеноном в присутствии сильного основания. Синтез дезоксинуклеозидов 2-метил- и 2-фенил-4-нитроиндола (2.14a и 2.14b) был осуществлен путем алкилирования натриевых или калиевых солей гетероциклических оснований 3,5-ди-О-(п-толуил)-2-дезокси-Dрибофуранозил хлоридом. Алкилированием 2-метил-4-нитроиндола был синтезирован достаточно чистый нуклеозид с выходом 83%. Однако, при алкилировании 2-фенил-4нитроиндола нам не удалось добиться выхода более 26%. После удаления толуильных групп метилатом натрия была введена 4,4-диметокситритильная защита по 5 положению нуклеозидов. Последующий синтез фосфорамидитов нуклеозидов 2.16а и 2.16b был проведен с использованием 2-цианэтил-N,N,N,N-тетраизопропилфосфорамидита в присутствии тетразолида пиридиния (cхема 5).

NOR NON HO i, ii O R 2.N H OH 2.iii, iv R = CH3 (a), Ph (b) NOR N DMTO O CHH3C O 2.N P O H3C N CHi. – 3,5-ди-O-(п-толуил)-2-дезокси-D-рибофуранозил хлорид, NaH (или tBuOK);

ii. – KOH/MeOH;

iii. – DMTCl/Py;

iv. – ((iPr)2N)2-P-OCH2CH2CN, тетразол, Py.

Cхема 5. Получение фосфорамидитов нуклеозидов замещенных нитроиндолов.

Фосфорамидиты 2.16а и 2.16b были использованы для автоматического синтеза олигодезоксинуклеотидов ON61 – ON68 (табл. 3). Последовательность оснований в олигонуклеотидах была выбрана таким образом, чтобы оценить влияние 4-нитроиндолов в паре с каждым из природных оснований на стабильность дуплексов по сравнению с немодифицированным дуплексом и с дуплексами, содержащими 5-нитроиндол. В качестве контрольных олигонуклеотидов были синтезированы немодифицированные олигомеры (ON73, ON74), а также олигонуклеотиды, содержащие 5-нитроиндол (ON69ON72).

Исследования стабильности модифицированных дуплексов. Денатурацию дуплексов проводили в растворе, содержащем 0.1М хлорид натрия и 0.01M фосфат натрия при рН 7.

Рассчитанные значения температур плавления дуплексов (Tm) и энтальпии переходов (H) приведены в табл. 3. Наименьший дестабилизирующий эффект модификации наблюдался для дуплексов, содержащих 5-нитроиндол. В этом случае средняя величина дестабилизации Tmст составила 8.9С. Близкие результаты были получены для 2-метил-4нитроиндола Tmст = 9.9C). Наибольшую дестабилизацию обнаружили модифицированные дуплексы с 2-фенил-4-нитроиндолом (Tmст = 12.1C).

Дискриминирующую способность универсальных оснований оценивали по диапазону температур плавления для всех четырех природных оснований. Самый узкий диапазон значений показали дуплексы, содержащие 2-фенил-4-нитроиндол (Tmд = 5.3C).

Несколько большую избирательность проявили 2-метил-4-нитроиндол и 5-нитроиндол, Tmд = 6.2 и 6.1C соответственно. Таким образом, обладая более выраженным «универсальным» характером, 2-фенил-4-нитроиндол также в большей степени дестабилизирует дуплекс. Наблюдаемая обратная корреляция между стабильностью модифицированных универсальными основаниями дуплексов и дискриминирующей способностью гетероцикла наблюдалась и для другого универсального основания, 3нитропиррола. Меньшая дискриминирующая способность 3-нитропиррола по сравнению с 5-нитроиндолом сочетается с более выраженным дестабилизирующим эффектом.

Таблица 3. Характеристики олигонуклеотидов ON61-ON74 и образуемых ими дуплексов.

## Последовательность Mcalc/Mexp Tm, °C H, ккал/моль 5’-AGTTCC(1a)CTGACGA ON61 4289.8 / 4288.9 43.6 5’-AGTTCCA(1a)TGACGA ON62 4313.8 / 4314.2 37.4 5’-AGTTCCAC(1a)GACGA ON63 4298.9 / 4299.7 43.5 5’-AGTTCCACT(1a)ACGA ON64 4273.8 / 4272.8 39.2 5’-AGTTCC(1b)CTGACGA ON65 4351.9 / 4352.6 41.6 5’-AGTTCCA(1b)TGACGA ON66 4375.9 / 4375.4 37.5 5’-AGTTCCAC(1b)GACGA ON67 4360.9 / 4361.3 39.6 5’-AGTTCCACT(1b)ACGA ON68 4335.9 / 4336.7 36.3 5’-AGTTCC5NICTGACGA ON69 4275.8 / 4275.9 41.1 5’-AGTTCCA5NITGACGA ON70 4299.8 / 4300.2 38.9 5’-AGTTCCAC5NIGACGA ON71 4284.8 / 4285.9 45.0 5’-AGTTCCACT5NIACGA ON72 4259.8 / 4261.3 42.7 5’-AGTTCCACTGACGA ON73 4248.8 / 4249.3 50.8 5’-TCGTCAGTGGAACT ON74 4279.8 / 4280.- - 2.3. Модификация цепей олигонуклеотидов интеркалирующей фенантридиниевой вставкой В этой главе рассмотрен синтез фосфорамидита интеркалятора на основе фенантридина – метидия – и гибридизационные свойства олигонуклеотидов, модифицированных этим красителем.

Синтез интеркалирующей метидиевой вставки осуществлен в соответствии со схемой 6. С использованием полученного фосфорамидита был осуществлен автоматический синтез модифицированного олигонуклеотида 5-CCATG-Meth-GCTAT (ON73). Структура полученного олигонуклеотидного конъюгата с метидием была подтвержена масс-спектрометрическим анализом неочищенной синтетической смеси методом MALDI TOF.

F F F O NH NH H2N NHO F + + N N (CF3CO)2O F CH3 F CHв CF3COOH 2.O O 2.OH OH CHH3C O i-iii OH O OH O HO O O OH 2.iv-v CHH3C O O 2.O N + O N O N vi-viii HO O NHO O ODMTr F F 2.ix-x F O NH NH O CH3 CHF + N F H3C N CHCH3 F P O CNEO NH 2.O O O O ODMTr Схема 6. Синтез фосфорамидита метидия (2.28). (i) Me2CO, CHCl3, TsOH, кипячение с азеотропной отгонкой воды; (ii) MsCl в Py; (iii) натриевая соль триэтиленгликоля; (iv) MsCl в Py; (v) LiN3 в ДМФА, 130°C; (vi) 80% CH3COOH; (vii) DMTrCl в Py; (viii) Ph3P в Py; (ix) имидазольное производное 2.18 в Py; (x) (iPr2N)2POCH2CH2CN, тетразол, Py в MeCN/CH2Cl2.

Стабильность и свойства гетеродуплекса, содержащего одну модифицированную интеркалирующей вставкой цепь, были изучены с использованием олигонуклеотидных моделей 5-CCATG-Meth-GCTAT (ON73), 5-CCATGGCTAT (ON74) и 5-ATAGCCATGG (ON75). В спектрах поглощения олигонуклеотида ON73 и модифицированного дуплекса ON73•ON75 при температуре 20°С в наблюдаются полосы поглощения при 520 и 526 нм соответственно, характерные для красителя, взаимодействующего с цепями олигонуклеотидов. При температурах выше 70°С спектры ON73 и модифицированного дуплекса соответствуют поглощению несвязанного красителя (max = 495 нм).

Длинноволновый сдвиг в спектрах поглощения связанного метидия указывает на интеркаляцию красителя в соответствующий стэкинг-контакт.

Дополнительным свидетельством интеркаляции метидия является высокий квантовый выход флуоресценции этого красителя при взаимодействии с дуплексом – восьмикратное увеличение qmeth при интеркаляции близко к десятикратному увеличению этого параметра для бромистого этидия. Следует отметить также, что изотермы связывания метидия (в виде амида) и этидия с немодифицированным дуплексом практически совпадают. Число мест связывания для обоих красителей также совпадает – одно на три пары оснований. Все эти данные однозначно указывают на один и тот же тип взаимодействия красителей с дуплексом – интеркаляцию.

Исследование стабильности модифицированного дуплекса методом термической денатурации в 0.1 М NaCl при рН 7 показало заметный прирост температуры плавления (Tm = 8.1°С) после введения модификации. Анализ профилей денатурации в рамках модели двух состояний показал, что стабилизация модифицированного дуплекса обусловлена энтропийной составляющей (H = 10.6 ккал/моль, S = 36.ккал/(моль·К)).

Расчеты молекулярной механики модифицированного дуплекса позволили оценить особенности взаимодействия интеркалирующей вставки с цепями дуплекса и сделать два основных вывода: 1) интеркаляция метидия осуществляется в тот же стэкинг-контакт, в который введена интеркалирующая вставка; 2) вхождение красителя в стэкинг-контакт осуществляется со стороны главного желоба.

2.4. Олигонуклеотиды с удлиненной цвиттерионной межнуклеотидной связью Введение цвиттерионных фрагментов (рис. 8) в олигонуклеотиды было проведено с использованием фосфорамидитов модифицированных нуклеозидов 2.22 (dTNMe) и 2.(dTNH). При конструировании этих модифицированных нуклеозидов учитывалась возможность электростатического взаимодействия между протонированной 5 аминогруппой нуклеозида и примыкающей фосфодиэфирной группой. Оптимизация геометрии цвиттерионной структуры позволила определить оптимальную длину линкера между аминогруппой и гидроксильной группой. Модифицированный фрагмент не искажает геометрию В-формы ДНК и формирует шестичленную квазициклическую систему в конформации кресла. В силу возможных инверсий конфигурации протонированного азота, предполагается некоторая гибкость гидроксиэтильной цепи.

Рассчетные неэлектростатические составляющие потенциальной энергии структуры мало отличаются от немодифицированного дуплекса, что свидетельствует о незначительных отклонениях конформации цепи при модификации. С другой стороны, значительный вклад электростатической составляющей приводит к заметному понижению суммарного значения потенциальной энергии структуры.

O H3C NH O N O O O O O O P H3C O NH + NH N O O R O Рис. 8. Цвиттерионная межнуклеотидная связь.

Синтез защищенного нуклеозида 2.31 был выполнен в 3 стадии без использования временной защиты 3 гироксильной группы тимидина (схема 7). После замещения ртолуолсульфоната тимидина N-метил-этаноламином, N-(2-гидроксиэтил)-N-метил-2,5дидезокси-5-аминотимидин был очищен от избытка амина с использованием Dowex-50.

Альтернативная синтетическая схема с использованием временной защиты 3 гироксильной группы была задействована при синтезе N-(2-гидроксиэтил)-2,5-дидезокси5-аминотимидина. По 3 положению нуклеозида была введена гидрофобная третбутилдиметилсилильная группа, что заметно облегчило хроматографическую очистку производных нуклеозида 2.33.

Фосфорамидиты защищенных нуклеозидных аналогов были получены in situ и использованиы без выделения для синтеза олигонуклеотидов ON76-ON83 (табл. 4).

Протонирование по аминогруппам модифицированных нуклеотидов приводит к появлению цвиттер-ионной структуры и вызывает изменение общего заряда цепи. Этот эффект был зафиксирован в неденатурирующем гель-электрофорезе в сшитом полиакриламиде.

O O H3C H3C DMTrO NH NH N O N O N TsO O O i-ii H3C 2.OH OH iii-iv 2.O O H3C H3C DMTrO NH HO NH N O N O N NH O O F3C v-vii O OH O 2.2.Si Схема 7. Синтез нуклеозидов 2.31 и 2.36. (i) N-метил-этаноламин в ДМФ, 100°С, ч.; (ii) DMTrCl в Py; (iii) tBDMSCl, Im, Py; (iv) этаноламин в ДМФ, 100°С, 2 ч.; (v) трифторуксусный ангидрид, диметиламинопиридин в ацетонитриле, -10°С; (vi) DMTrCl в Py; (vii) 1 M TBAF в ТГФ.

Таблица 4. Нуклеотидный состав олигомеров ON76-ON83 и данные MALDI спектров.

## Последовательность Мexp (Мcalc) ON76 5-d(T)ON77 5-d(TTTTTNHTTTT) 2718 (2721) ON78 5-d(TTTTTNMeTTTT) 2734 (2735) ON79 5-d(TTNHTTNHTTNHTTNHT) 2852 (2850) ON80 5-d(TTNMeTTNMeTTNMeTTNMeT) 2910 (2906) ON81 5-d(GATATCTTC) ON82 5-d(GATATNMeCTTC) 2751 (2747) ON83 5-d(GATNMeATNMeCTNMeTC) 2867 (2861) Физико-химические исследования модифицированных дуплексов проводились методами термической денатурации в растворе и КД-спектроскопии. В качестве комплементарных цепей были использованы олигодезоксинуклеотиды A10 (ON84) и 5GAAGATATC (ON85). Стабильность дуплекса с однократной модификацией оказалась заметно ниже стабильности контрольного немодифицированного дуплекса (Tm ~ 10°С).

Столь резкое расхождение расчетных данных и эксперимента можно объяснить конформационной гибкостью модифицированного фрагмента. Спектры КД контрольного дуплекса ON76•ON84 и модифицированных дуплексов ON84•ON77 и ON85•ONподтверждают результаты расчетов в отношении структурных характеристик дуплексов.

Известно, что В-форма poly(dA)•poly(dT) отличается двумя характеристичными полосами в области 260-280 нм. При низких температурах (0°С) спектры гибридного дуплекса ON77•ON84 и контроля ON76•ON84 практически не отличаются. Это свидетельствует в пользу В-формы модифицированного дуплекса.

2.5. Олигонуклеотиды, содержащие 2-дезокси-N1-метиладенозин.

Несмотря на заметный интерес к этой модификации, в литературе нет синтетических или биофизических работ с использованием этого дезоксинуклеозида в олигонуклеотидных моделях. В данном разделе рассмотрен синтез и гибридизационные свойства коротких синтетических шпилек ДНК, содержащих 2-дезокси-N1метиладенозин (m1dA).

Синтез защищенного фосфорамидита 2-дезокси-N1-метиладенозина и модифицированных олигонуклеотидов. Синтез защищенного фосфорамидита 2.представлен на схеме 8. Стадия метилирования 2-дезоксиаденозина была проведена после предварительной защиты 5 гидроксильной группы монометокситритильным фрагментом.

Алкилирование защищенного дезоксиаденозина проводилось в диметилацетамиде с помощью иодистого метила и позволило получить соединение 2.38 с выходом 72%.

Замена традиционной в олигонуклеотидном синтезе диметокситритильной группы монометокситритильной в модифицированном нуклеозиде позволила повысить стабильность 5 защитной группы в соли 2.38. Такая замена не влияет на эффективность детритилирования в ходе олигонуклеотидного синтеза.

O Cl NH2 HN NHCH3 CH+ + N N N N N N N N N MMTrO N MMTrO N HO N O O O iii-iv i-ii 2.OH O OH CHP 2.CNEO N CHH3C CHСхема 8. Синтез фосфорамидита m1dA. (i) MMTrCl в Py; (ii) MeI; (iii) (ClCH2CO)2O в Py, NH3 в MeOH; (iv) (iPr2N)2P(OCH2CH2CN), тетразол.

Введение модифицированных нуклеотидов в олигомеры в ходе автоматического олигонуклеотидного синтеза не потребовало изменения стандартного протокола. Ранее было показано, что отщепление модифицированных N1-метиладенозином олигонуклеотидов от подложки и дальнейшее деблокирование может быть осуществлено в метанольном аммиаке при комнатной температуре за 60 часов без риска перегруппировки Димрота. Следуя той же процедуре, мы провели обработку олигонуклеотидов, содержащих m1dA (табл. 5) В отдельных экспериментах было показано, что использование в синтезе фосфорамидитов с лабильными защитными группами (dAPAC и dGiPr-PAC) позволяет сократить время обработки до 2 часов при комнатной температуре.

Подтверждение модификации цепей было получено из данных MALDI массспектрометрии. Убедительные доказательства включения m1dA в синтезированные олигонуклеотиды и отсутствия перегруппировки были получены из ВЭЖХ анализа смеси нуклеозидов, образующихся при ферментативном гидролизе олигомеров фосфодиэстеразой змеиного яда и фосфатазой. Мы провели проверку совместимости стандартного протокола деблокирования олигонуклеотидов с выбранной модификацией.

Обработка m1dA-модифицированных олигонуклеотидов концентрированным водным аммиаком при 55°С в течение 10 часов привела к 80% конверсии m1dA m6dA. При увеличении времени обработки до 16 ч перегруппировка Димрота проходила практически количественно. Ферментативный гидролиз обработанного таким образом олигонуклеотида приводил к образованию четырех природных нуклеозидов и m6dA. Надо отметить, что перегруппировка на уровне олигомеров не сопровождается какой либо деградацией цепи. Это обстоятельство позволяет использовать фосфорамидит 2.40 для синтеза как m1dA-, так и m6dA-модифицированных олигонуклеотидов.

Гибридизационные свойства модифицированных шпилек. Мы исследовали термическую денатурацию коротких олигонуклеотидных шпилек, содержащих m1dA (табл. 5). В силу неспособности m1dA к образованию Уотсон-Криковских пар введение этого нуклеотида в олигомер способствует формированию неспаренных одноцепочечных участков. При введении модификации в петлевой фрагмент шпильки можно ожидать некоторой стабилизации внутримолекулярного дуплекса. Как видно из данных таблицы, значения Tm для модифицированных шпилек выше по сравнению с природным контролем.

Как и ожидалось, введение модификации в область стебля вызывает резкую дестабилизацию (ON90). Увеличение размера петли или введение дополнительной модификации в петлю также негативно сказывается на стабильности шпильки (Tm -4.5 и -7.6°С соответственно).

Таблица 5. Олигонуклеотидные шпильки ON86-ON92.

ON## Нуклеотидный состав* Mcalc Mobserved Tm,°C ON86 5-GGACGTAATAGTCC 4287.8 4285.8 53.ON87 5-GGACGTAATAGTCC 4302.8 4301.2 53.ON88 5-GGACGTAATAGTCC 4302.8 4303.7 55.ON89 5-GGACGTAATAGTCC 4302.8 4300.4 56.ON90 5-GGACGTAATAGTCC 4302.8 4302.2 n/d ON91 5-GGACGTAAATAGTCC 4613.8 4612.8 48.ON92 5-GGACGTAAAATAGTCC 4944.2 4941.2 45.* Остатки m1dA выделены жирным шрифтом 3. Исследования триплексов ДНК Триплексы ДНК являются объектом исследований уже в течение длительного времени, что обусловлено, по крайней мере, двумя причинами. Во-первых, триплексформирующие олигонуклеотиды (ТФО) являются доступными синтетическими сиквенсспецифичными агентами, которые могут быть использованы для контроля экспрессии генов, индуцированной рекомбинации или мутагенеза. Во-вторых, некоторые типы трехцепочечных комплексов играют важную роль в биологических процессах, таких как рекомбинация. В этой части диссертации рассмотрены подходы к построению третьей цепи с использованием неприродных аномеров нуклеозидов, а также рассмотрены свойства различных типов триплексов, исследованных на внутримолекулярных синтетических конструкциях одного и того же типа.

Исследования химерных ,-триплексов , , , 3.1.1. Структурный полиморфизм ,-олигоцитидилатов , , , В конце 90-х годов была предложена новая синтетическая модель триплексов ДНК, которые могут быть построены на произвольной нуклеотидной последовательности. В рамках этого подхода мы исследовали связывание химерных ,-олигоцитидилатов с АТсодержащими дуплексами ДНК.

В работе были исследованы химерные ,-олигоцитидилаты, которые предположительно могут распознавать АТ-дуплексы ДНК смешанного нуклеотидного состава. Шестичленная гетероциклицеская система цитозина представляется наиболее предпочтительной с точки зрения водородного связывания и положения гликозидных связей (рис. 9).

O O N N H N O H N O N N H H H H H O H N O N N N N N H N N H N N N N O N N O O O O O Рис. 9. Схема ATC и TAC триплетов.

В исследованиях термической денатурации, кругового дихроизма и поляризации флуоресценции интеркалированного бромистого этидия мы использовали олигонуклеотидные модели, представленные в таблице 6.

Таблица 6. Олигонуклеотидные модели ON93-ON100.

Название Нуклеотидная последовательностьа ON93 5'-CCCCCCCCCC-Lb-ATATATATAT-L-ATATATATAT-3' ON94 5'-CCCCCCCCCC-L-AAAAAAAAAA-L-TTTTTTTTTT-3' ON95 5'-CCCCCCCCCC-L-ATATATATAT-L-ATATATATAT-3' ON96 5'-CCCCCCCCCC-3' ON97 5'-CCCCCCCCCC-3' ON98 5'-TTATTTTAATTATTTTTATAAATTTTATTT-TMRc-3' ON99 5'-AAATAAAATTTATAAAAATAATTAAAATAA-3' ON100 5'-CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC-3' а C – -дезоксицитидин; bL = триэтиленгликольный линкер; cTMR – тетраметилродамин.

Исследования термической денатурации трех олигонуклеотидных моделей– ON93, ON94 и ON95 – однозначно указывают на образование межмолекулярных структур и не подтверждают модель триплекса с олигоцитидиловой третьей цепью. Определение времени вращательной релаксации олигонуклеотида ON94 дало основания предположить, что раствор не является гомогенным и содержит как моно-, так и бимолекулярные структуры. Оценочная доля бимолекулярных структур составила 0.6±0.1.

Дополнительные исследования термической денатурации подтвердили предположение об образовании низкотемпературных самоассоциатов олигоцитидилатов.

Таблица 7. Значения Tm (°C)а для низко- и высокотемпературных комплексов, образующихся при нейтральных значениях рН.

Назв. Низкотемпературный переход Высокотемпературный переход 0.1 M Na+ 0.5 M Na+ 1M Na+ 0.1 M Na+ 0.5 M Na+ 1M Na+ 30 mM Mg2+ ON93 17.3 20.9 22.5 46.8 54.8 57.8 51.ON94 14.9 19.4 52.9 64.4 67.ON95 19.2 57.ON96 22.6; 26.5b ON97 16.а Значения Tm определялись как точка полуперехода (Tm = ±0.5°C).

b Tm при концентрации цепей 10 µM.

Плавление цепей d(C)10 и d(CC)5 не является равновесным: кривые отжига и денатурации не совпадают. Подобное поведение было отмечено для i-ДНК и связано с замедленной скоростью формирования и диссоциации i-мотива. Инвертированный профиль плавления олигомера ON96 при 295 нм представляет дополнительное доказательство образования полупротонированного комплекса на основе химерной ,олигоцитидиловой цепи.

Дополнительные данные о низкотемпературных комплексах с СС+ парами оснований были получены из анализа спектров КД олигонуклеотида ON93. Две полосы, высокоспецифичные для протонированных СС+ пар оснований (при 265 и 289 нм), были обнаружены для этого олигомера в 0.25М NaCl в диапазоне 4.5-6.9. Увеличение рН до приводит к депротонированию цитозинов и исчезновению соответствующих полос в спектрах.

Несмотря на выраженную склонность химерных ,-олигоцитидилатов к самоассоциации при низких температурах, нам удалось зафиксировать межмолекулярный триплекс в экспериментах по неденатурирующему гель-электрофорезу в присутствии mM MgCl2 при рН 7.0. Образование триплекса наблюдалось при присоединении химерной ,-цепи ON100 к дуплексу ON98•ON99 (рис. 10). Полное связывание дуплекса наблюдалось при 15°С и использовании 5-кратного избытка третьей цепи.

Дорожка 1 2 3 4 5 6 C B B A Рис. 10. Неденатурирующий гель-электрофорез олигонуклеотида ON98 (дорожки и 7, полоса А) и дуплекса ON98•ON99 (дорожка 2, полоса B) в присутствии возрастающих количеств химерного олигомера ON100 (дорожки 3-6, соответственно 1-, 3-, 5- и 10кратное количество ON100, триплекс – полоса С).

3.1.2. Связывание неприродных ,-олигоцитидилатов с дуплексами ДНК , , , Более детальное исследования связывания коротких АТ-содержащих синтетических дуплексов ДНК с химерными олигоцитидилатами было выполнено на моделях, представленных в табл. 8, а также с использованием олигомеров ON98, ON99, и ON100.

Таблица 8. Олигонуклеотидные модели ON101-ON106.

Олиго Нуклеотидная последовательностьа ON101 5'-d(T)30-TMRb-3' ON102 5'-d(A)30-3' ON103 5'-d(C)30-3' ON104 5'-d(AT)16-TMR-3' ON105 5'-d(CC)15-3' ON106 5'- CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC-3' а C – -дезоксицитидин, С – 2OMe-C; bTMR – тетраметилродамин.

По данным неденатурирующего гель-электрофореза при 15°С образование триплекса ON98•ON99•ON100 сопровождалось формированием самоассоциатов химерных олигоцитидилатов избыточной третьей цепью. Понижение температуры до 3°С, как и ожидалось, способствовало повышению стабильности комплекса ON98•ON99•ON100, который можно было наблюдать при добавлении лишь 3-кратного избытка олигоцитидилата. Образования триплексов с регулярной или альтернирующей последовательностью из олигонуклеотидов ON101, ON102, ON103 и ON104, ON105 не наблюдалось даже при использовании 20-кратного избытка третьей цепи. Либо структурные особенности регулярного и альтернирующего дуплексов, либо специфические требования при образовании предполагаемого триплекса препятствуют его формированию. В то же время, для этих моделей характерно образование самоассоциатов poly-dC при нейтральных значениях рН.

Для оценки роли конкуренции между процессами образования триплекса и самоассоциатов poly-dC мы исследовали поведение полностью модифицированного олигоцитидилата ON106 в отношении дуплекса ON98•ON99. Ожидалось, что предполагаемое подавление самоассоциации за счет модификации природных цитидинов по 2-положению сахарного остатка может способствовать более эффективному связыванию олигоцитидилата с дуплексом. Однако, эффективность образования комплекса оказалась ниже по сравнению с ON100. Для полного связывания дуплекса потребовалось увеличить избыток третьей цепи до 10-кратного. Весьма интересным оказался тот факт, что введение модификаций не препятствовало формированию самоассоциатов poly-dC.

Повышение рН до 8 привело к подавлению самоассоциатов poly-dC. Однако, образование межмолекулярного комплекса ON98•ON99•ON100 также оказалось подавленным. Это обстоятельство однозначно указывает на возможность взаимодействия с ДНК дуплексом протонированной poly-dC цепи. В этом случае может быть реализована схема водородного связывания третьей цепи с пуринами дуплекса в предполагаемом трехцепочечном комплексе, аналогичная той, что наблюдается в антипараллельных триплексах с G и T основаниями в третьей цепи.

3.1.3. Распознавание инвертированных ТА пар дуплекса -тимидином Принимая во внимание возможность реализации другой схемы водородного связывания в химерных триплексах (рис. 11), мы изучили возможность распознавания инвертированных ТА пар дуплекса -тимидином.

Образование химерных триплексов было изучено на 15-нуклеотидных моделях (табл. 9) с помощью неденатурирующего гель-электрофореза при рН 7.8 и температуре 10°С, а также методом термической денатурации в растворе.

N N N O N O O H N N N H N O H H H H H H H H O H O H O N N N N N N N N N H H H N N N N N N N N N N N N O O O A B C Рис. 11. Схемы триплетов оснований: ATC (A), ATC+ (B), ATT в антипараллельном триплексе с G и T в третьей цепи (С).

Таблица 9. Олигонуклеотидные модели ON107-ON126*.

Нуклеотидная Олиго последовательность ON107 5'-AAA-AAG-GAG-AGG-GAG ON108 5'-CTC-CCT-CTC-CTT-TTT ON109 5’-GTG-GGT-GTG-GTT-TTT ON110 5’-GAG-GGA-GAG-GAA-AAA ON111 5'-AAA-AAG-GAG-TGG-GAG ON112 5'-AAA-ATG-GAG-AGG-GAG ON113 5'-AAA-AAG-GTG-TGG-GTG ON114 5'-TTT-TTG-GAG-AGG-GAG ON115 5'-CTC-CCA-CTC-CTT-TTT ON116 5'-CTC-CCT-CTC-CAT-TTT ON117 5'-CAC-CCA-CAC-CTT-TTT ON118 5'-CTC-CCT-CTC-CAA-AAA ON119 5’-GTG-GGT-GTG-GTT-TTT ON120 5’-GTG-GGT-GTG-GTT-TTT ON121 5’-GTG-GGT-GTG-GTT-TTT ON122 5’-GTG-GGT-GTG-GTT-TTT-G ON123 5’-GAG-GGT-GAG-GAA-AAA ON124 5’-GAG-GGA-GAG-GTA-AAA ON125 5’-GTG-GGT-GTG-GAA-AAA ON126 5’-GAG-GGA-GAG-GTT-TTT-G *Неприродные -тимидины выделены жирным шрифтом и подчеркнуты.

Как и ожидалось, неинвертированные дуплексы образовывали триплексы с AG- и TG-содержащими ТФО ON109 и ON110. Избыток третьей цепи ON110 проявлялся в геле в виде параллельного дуплекса, с подвижностью ненамного превышающей подвижность Уотсон-Криковского дуплекса. ДНК дуплекс ON111•ON115 c однократной инверсией образовывал трехцепочечный комплекс с химерным олигонуклеотидом ON119, однако не связывался с GA-содержащим ТФО ON123. При другом расположении инвертированной пары оснований в дуплексе ON112•ON116 оба химерных олигонуклеотида – GTcодержащий ON120 и GA-содержащий ON124 – оказались способными к образованию триплексов. Три изолированные инверсии пар оснований дуплекса ON113•ON117 не позволяют сформировать устойчивый химерный триплекс. Нам не удалось зафиксировать связывание олигонуклеотидов ON121 или ON125 с этим ДНК дуплексом. Шесть структурных переходов (три и три ) должно заметно ослабить стэкинг взаимодействия в гипотетическом триплексе. Наконец, пять сопряженных АТ/TA инверсий в дуплексе ON114•ON118 удалось распознать с помощью химерных олигонуклеотидов ON122 и ON126. В этом случае структурные изменения оказались минимальными с единственным переходом в трехцепочечном комплексе.

Полученный триплекс сходен по строению с известной моделью чередующихся цепей, в которой третья олигонуклеотидная цепь построена из двух блоков различной полярности.

Образование параллельной ДНК не препятствовало формированию химерных триплексов с GA мотивом. Параллельные GA-дуплексы проявлялись как результат самоассоциации избыточного количества третьей цепи.

Для оценки стабильности немодифицированных и химерных триплексов мы исследовали денатурацию этих комплексов в 0.1 М Трис-боратном буфере в присутствии 0.03 М MgCl2 (Табл. 10). Характер денатурации всех исследованных комплексов соответствует типичному профилю плавления триплекса ДНК с двухфазным переходом. С учетом данных элетрофореза, мы соотнесли низкотемпературные переходы на полученных кривых во всех случаях с плавлением триплекса, а не параллельной ДНК.

Немодифицированные олигонуклеотиды образовывали наиболее стабильные трехцепочечные структуры. Введение однократной инверсии в дуплекс существенно снижает стабильность триплексов как для GT, так и для GA мотива. Величина Tm составила более 15°С. Триплексы с пятью сопряженными инверсиями оказались наиболее стабильными из модифицированных структур. Стабильность химерных триплексов коррелирует с количеством / переходов в третьей цепи. Различие в стабильности между GT и GA мотивами химерных триплексов было минимальным для моделей с однократной инверсией с разницей в температурах плавления 1.5°С, тогда как немодифицированные триплексы и химеры с пятью инверсиями показали большее различие с предпочтительной стабилизацией GA мотива. Данные по стабильности подтверждают предположение о том, что аномерные переходы нарушают стэкинг и вызывают искажения в регулярной структуре триплекса.

В этом контексте решение проблемы стабилизации химерных триплексов может заключаться в дополнительной модификации природных или неприродных -нуклеотидов каким либо фрагментом, способным заполнить образующиеся «провалы» в стэкинге.

Таблица 10. Стабильность немодифицированных и химерных триплексов.

трипл дупл Триплекс Tm °C Tm °C ON107•ON108•ON109 30.5 54.ON107•ON108•ON110 34.2 55.ON112•ON116•ON120 11.9 56.ON112•ON116•ON124 10.4 55.ON114•ON118•ON122 13.7 55.ON114•ON118•ON126 15.6 55.* ± 0.5°C.

3.2. Исследования внутримолекулярных моделей триплексов с гидрофильным межцепным линкером Большая часть данных по структуре, стабильности и специфичности образования триплексов различных типов получена на олигонуклеотидных моделях. Во многих случаях использование внутримолекулярных моделей является предпочтительным, т.к.

позволяет повысить стабильность комплексов, а также заметно упрощает термодинамический анализ. Наиболее корректными являются модели, представляющие собой олигонуклеотидные блоки, соединенные между собой оксиалкильной цепью. Такие гидрофильные ненуклеотидные петли в минимальной степени возмущают стуктуру и энергию стебля. В настоящем исследовании впервые использован гидрофильный триэтиленгликольный линкер при построении внутримолекулярных моделей триплексов.

3.2.1. Исследование антипараллельного триплекса с АТТ триплетами оснований Нами впервые была исследована внутримолекулярная олигонуклеотидная модель триплекса 3'-(dA)10-pO(CH2CH2O)3p-(dT)10-pO(CH2CH2O)3p-(dT)10-5' (ON127). Для сравнения были изучены также олигонуклеотиды 3'-(dA)10-pO(CH2CH2O)3p-(dT)10-5' (ON128) и 3'-(dA)10-pO(CH2CH2O)3p-(dT)10-3' (ON129), которые могут существовать в виде двухцепочечных шпилек с параллельной и антипараллельной ориентацией цепей.

Основываясь на экспериментально измеренных профилях тепловой денатурации мы рассчитали термодинамические параметры переходов. Данные термодинамического анализа показали, что энтальпийные стабилизирующие взаимодействия (энергия водородных связей, стэкинг-взаимодействия, электростатические взаимодействия) приблизительно одинаковы в уотсон-криковском дуплексе и хугстиновском дуплексе в составе триплекса. Если судить по величинам Тm, ионы магния в концентрации 0.01 М стабилизируют спиральные структуры приблизительно также, как и 0.5 М Na+. Ионы Mg2+ усиливают энтальпийные взаимодействия, вероятно, за счет образования специфических стабильных комплексов с двух- и, особенно, трехцепочечными спиралями.

Термодинамические параметры образования триплекса с АТТ триплетами оснований при различных концентрациях Na+ представлены нами впервые.

Наличие положительного экстремума при 260 нм в спектре КД триплекса указывает на то, что основные черты конформации дуплекса сохраняются и в трехцепочечной структуре. Исходя из этого факта следует предположить, что в триплексе по крайней мере уотсон-криковский дуплекс имеет В-подобную конформацию.

Показано, что бромистый этидий интерклирует в тройную спираль олигонуклеотида ON127 и флуоресцирует с высоким квантовым выходом, совпадающим с qДНК. Анализ кривых связывания EtBr c ON127 позволил оценить максимальное число мест связывания EtBr на триплексе, которое соответствует трем триплетам оснований на одну молекулу красителя.

3.2.2. Исследование триплекса рекомбинантного типа (R-форма ДНК) Триплексы рекомбинантного типа резко отличаются от триплексов классического типа, поскольку в R-ДНК в каждой цепи присутствует полный набор нуклеиновых оснований и третья цепь ориентирована параллельно гомологичной цепи дуплекса.

5’CATGCTAACT 5’CATGCTAACT CATGCTAACT GTACGATTGA GTACGATTGA CATGCTAACT-3’ CATGCTAACT CATGCTAACT-3’ A B Рис. 12. Топология сворачивания параллельного R-триплекса. Третья цепь выделена наклонным шрифтом для каждого из конформеров.

В настоящей работе мы исследовали свойства параллельного триплекса из олигонуклеотида 5'-d(CATGCTAACT)-pO(CH2CH2O)3p-d(AGTTAGCATG)pO(CH2CH2O)3p-d(CATGCTAACT)-3' (ON130). Существует два способа укладки сегментов ON130 в триплекс - А (в главную бороздку уотсон-криковского дуплекса укладывается 3'-сегмент) и В (в главную бороздку уотсон-криковского дуплекса укладывается 5'-сегмент), рис. 12. Полученные нами результаты однозначно указывают на то, что при низких температурах и рН 7 ON130 образует относительно стабильный триплекс (Тm находится в пределах от 26 до 34°С в зависимости от условий) с параллельно ориентированными идентичными цепями, причем конформер А превалирует в равновесной смеси.

Кривые плавления ON130 в 0.01 М фосфатном буфере, рН 7.0, при концентрации NaCl 0.25 и 1.0 М, а также в присутствии либо двухвалентных ионов (0.01 М Mg2+ или Мn2+), либо 0.1 М спермидина обладают ярко выраженным двухфазным характером и свидетельствуют об образовании в области низких температур многоцепочечных комплексов. Как моно-, так и двухвалентные катионы увеличивают стабильность триплексов. Ионы натрия не оказывают влияния на кооперативность первого перехода, тогда как двухвалентные катионы и, в еще большей степени, спермидин делают низкотемпературный переход более кооперативным. Мы рассчитали кажущиеся значения H° и S° из кривой плавления триплекса ON127 в присутствии спермидина. Для низкотемпературного перехода H°=32.2±4 ккал/моль, S° =104.6±12 кал/мольК, а для высокотемпературного перехода H°=49.9±4 ккал/моль, S° =141.6±6 кал/мольК. Cудя по формальным термодинамическим параметрам образования триплекса, его стабильность ниже стабильности триплексов классического типа.

Таблица 11. Cтабильность R-триплекса.

Условия Tm (°C)* плавление триплекса плавление дуплекса Фосфатный буфер 24.5 61.0.25 М NaCl 26.9 77.1.0 M NaCl 30.7 82.0.01 M MgCl2 30.8 67.0.01 M MnCl2 30.7 67.0.1 M спермидин 36.6 69.*Ошибка не превышает ±0.5°С.

Реакция модификации тиминов OsO4 и ферментативное расщепление S1 нуклеазой, выполненное при 0-3°С, свидетельствует об образовании внутримолекулярного трехцепочечного комплекса с экранированными пиримидиновыми основаниями и не содержащего одноцепочных участков. Однако, 3'-концевой сегмент олигонуклеотида защищен в меньшей степени по сравнению с двумя другими. Это дает основание полагать, что образование триплекса из олигонуклеотида ON130 протекает преимущественно по схеме А. Обнаружено, что пиримидины легче подвергаются выщеплению, чем пурины, а цитидины легче, чем тимины.

Определение гидродинамического объема и времени вращательной корреляции ON130 также однозначно указывает на существование триплекса.

Оптимизация геометрии структуры позволила предложить схемы водородного связывания для всех четырех триплетов оснований. Следует отметить относительную изоморфность триплетов. Экспериментально наблюдаемая стабильность триплетов описывается следующим рядом: G:C-G = A:T-A >> T:A-T > C:G-C.

3.2.3. Стабилизация рекомбинантного триплекса иодистым пропидием С использованием той же синтетической модели, которая позволила зафиксировать образование внутримолекулярного рекомбинантного триплеса в отсутствие белка RecA, мы изучили взаимодействие иодистого пропидия с параллельным R-триплексом. В данном разделе рассмотрено взаимодействие пропидия с параллельным триплексом ON130, а также с антипараллельным триплексом из олигонуклеотида 5'-(dA)10pO(CH2CH2O)3p-(dT)10-pO(CH2CH2O)3p-(dT)10-3' (ON131) и ДНК дуплексом.

Показано, что фенантридиновая система пропидия интеркалирует между соседними триплетами триплекса ON130. Связывание пропидия с ON130 является антикооперативным, так же как и в случае ДНК. По максимальному числу мест связывания красителя параллельный триплекс заметно отличается от ДНК и антипараллельного триплекса. В ON130 пропидий интеркалирует в в каждый второй стэкинг-контакт.

Результаты экспериментов по термической денатурации ON130 с различным числом связанных молекул пропидия свидетельствуют о заметной стабилизации триплекса.

Связывание первой молекулы пропидия приводит к существенной стабилизации триплекса (Tm=13.6°C). При связывании второй молекулы красителя этот эффект становится менее выраженным ((Tm=6.5°C). Связывание третьей и четвертой молекулы пропидия практически не меняет стабильность параллельного триплекса.

Конформационные рассчеты комплексов параллельного триплекса с пропидием позволили определить предпочтительный тип связывания иодистого пропидия с Rтриплексом.

3.2.4. Исследование пуриновых параллельных триплексов В настоящем разделе представлено исследование параллельного триплекса с AGтретьей цепью. Возможность образования такого комплекса была впервые продемонстрирована нами с использованием внутримолекулярных моделей с межцепными гидрофильными линкерами. Мы исследовали две олигонуклеотидные модели: 5-d(CT)5-L-d(AG)5-L-d(GA)5 (ON132) и 5-d(GA)5-L-d(TC)5-L-d(GA)5 (ON133), где L – триэтиленглигольный линкер. Структура моделей позволяет им складываться с образованием антипараллельного или параллельного триплекса с идентичными GAцепями.

Профили термической денатурации обеих моделей характеризуются выраженным двухфазным характером. Два кооперативных перехода указывают на образование трехцепочечного комплекса при низких температурах при условии, что процесс является внутримолекулярным. Последнее было подтверждено экспериментами по поляризации флуоресценции интеркалированного бромистого этидия. Дополнительные доказательства образования триплексов были получены из данных по химической модификации диэтилпирокарбонатом, OsO4 и нуклеазой S1. Характер модификации цепей ON1заметно отличается от распределения, наблюдаемого для ON132 и позволяет предположить, что параллельный триплекс существует в виде двух возможных топоизомеров, между которыми существует динамическое равновесие.

Из профилей термической денатурации были рассчитаны термодинамические параметры образования параллельного и антипараллельного триплекса, из которых следует, что параллельный триплекс намного менее устойчив по сравнению с антипараллельным.

ВЫВОДЫ 1. Разработана общая синтетическая платформа для параллельного анализа ДНК на трехмерной полимерной подложке. Платформа представляет собой комплексное решение задачи иммобилизации модифицированных по 3 или 5 концу олигонуклеотидов в объеме изолированных ячеек полиакриламидного геля.

Данный подход нашел применение при изготовлении микрочипов для термодинамического анализа дуплексов, а также при разработке широкого набора диагностических микрочипов.

2. Разработан эффективный метод функционализации ДНК с целью флуоресцентного мечения или иммобилизации. Метод основан на частичном кислотном гидролизе ДНК с последующей модификацией апуриновых участков.

3. Впервые продемонстрирована возможность использования трехмерной полимерной подложки для фотонаправленного синтеза олигонуклеотидных матриц высокой плотности. Показано, что олигонуклеотидный синтез в тонком слое сшитого полидиметилакриламида с использованием фосфорамидитов с фотоудаляемой защитой проходит с высокой эффективностью и позволяет достигать существенного усиления гибридизационного сигнала по сравнению с поверхностно-связанными пробами.

4. Предложен новый способ изготовления олигонуклеотидных микрочипов, основанный на сополимеризации 5-аллильных производных олигонуклеотидов с акриламидом. Метод позволяет формировать ячейки размером от 10 микрон с равномерным распределением пробы по объему гелевого элемента и представляет собой прототип современной технологии изготовления гидрогелевых микрочипов.

5. Впервые проведен параллельный физико-химический анализ взаимодействий модифицированных олигонуклеотидов с использованием микрочипа, содержащего 4096 гексануклеотидных проб. Исследована специфичность образования модифицированных дуплексов ДНК и их стабильность. Установлено, что из всех исследованных модификаций 2-O-метилрибозид 2,6-диаминопурина обеспечивает наилучшее соотношение стабилизации и дискриминирующей способности.

6. Предложен ряд новых модификаций нуклеотидной цепи, позволяющих проследить влияние гидрофобных или ионных фрагментов на стабильность двойной спирали.

Получены данные о стабильности и структуре дуплексов, модифицированных известными и новыми типами универсальных оснований, интеркалятором на основе фенантридина, а также нуклеотидными звеньями с положительным зарядом на основании или в 5 положении дезоксирибозы.

7. Проведено исследование трехцепочечных комплексов принципиально нового типа, структура которых не органичена полипуриновыми или полипиримидиновыми трактами Уотсон-Криковской двойной спирали. Третья, неприродная цепь в этих комплексах построена из - и -нуклеотидных звеньев, что обеспечивает связывание оснований третьей цепи с пуринами либо одной, либо другой цепи дуплекса. Впервые получены экспериментальные доказательства образования триплексов нового типа, предложена схема образования триплетов, проведена оценка термической стабильности этих комплексов.

8. Предложена универсальная модель внутримолекулярного триплекса ДНК, построенная на основе гидрофильного линкера ненуклеотидной природы. С использованием данной модели различные типы триплексов ДНК. Впервые исследованы закономерности образования параллельного пуринового триплекса, а также параллельного триплекса рекомбинантного типа. Исследовано связывание этих комплексов с флуоресцирующими красителями.

Список работ, опубликованных по теме диссертации 1. А.К. Щелкина, О.К. Мамаева, О.Ф. Борисова, Ю.П. Лысов, Э.Н. Тимофеев, И.А.

Ильичева, Б.П. Готтих, В.Л. Флорентьев. Трехцепочечная «скрепка» из олигонуклеотида 3-d(A)10-pO(CH2CH2O)3-pd( T)10-pO(CH2CH2O)3-p-d(T)10-5.

Молекулярная биология 1992, т.26, с.1314-1326.

2. A. Schyolkina, O. Mamaeva, O. Borisova, Y. Lysov, E. Timofeev, I. Il'icheva, B. Gottikh and V. Florentiev. 3-stranded clip of the oligonucleotide 5’ -T10-T10-A10 Anisence Res.

Develop. 1994, v. 4, pp. 27-33.

3. A. Schyolkina, E. Timofeev, O. Borisova, I. Il’icheva, E. Minyat, E. Khomyakova and V.

Florentiev. The R-form of DNA does exist. FEBS Letters v. 339, 1994, pp. 113-118.

4. O. Borisova, A. Schyolkina, E. Timofeev, S. Tsybenko, A. Mirzabekov and V.

Florentiev. Stabilization of parallel (recombinant) triplex with propidium iodide. J.

Biomol. Struct. Dyn. 1995, v.13, pp. 15-27.

5. О.Ф. Борисова, А.К. Щелкина, Э.Н. Тимофеев, В.Л. Флорентьев. Димеры триплексов ДНК. Молекулярная биология 1995, т.29, с.635-640.

6. A. Schyolkina, O. Borisova, E. Minyat, E. Timofeev, I. Il’icheva, E. Khomyakova and V.

Florentiev. Parallel purine-pyrimidine triplex: experimental evidence of existence. FEBS Letters 1995, v.367, pp. 8l-84.

7. E. Timofeev, S. Kochetkova, A. Mirzabekov and V. Florentiev. Regioselective immobilization of short oligonucleotides to acrylic copolymer gels. Nucleic Acids Res.

1996, v.24, pp. 3142-3148.

8. S. Parinov, V. Barskii, G. Yershov, E. Kirillov, E. Timofeev, A. Belgovskiy and A.

Mirzabekov. DNA-sequencing by hybridization to microchip octanucleotide and decanucleotide extended by stacked pentanucleotides. Nucleic Acids Res. 1996, v.24, pp.

2998-3004.

9. E. Timofeev, I. Smirnov, L. Haff E. Tischenko, A. Mirzabekov and V. Florentiev.

Methidium intercalator inserted into synthetic oligonucleotides. Tetrahedron Letters 1996, v. 37, pp. 8467-8470.

10. D. Proudnikov, E. Timofeev and A. Mirzabekov. Immobilization of DNA in Polyacrylamide Gel for the Manufacture of DNA and DNAOligonucleotide Microchips.

Analytical Biochemistry 1998, v. 259, pp 34-41.

11. G. Yershov, E. Timofeev, I. Ivanov, V. Florentiev and A. Mirzabekov. Method of immobilizing water soluble bioorganic compounds on a capillary-porous carrier. US patent 5741700 (1998).

12. A. Mirzabekov, E. Timofeev, V. Florentiev and E. Kirillov. Rapid method to detect duplex formation in sequencing by hybridization. US patent 5,861,247 (1999).

13. V. Vasiliskov., E. Timofeev, S. Surzhikov, A. Drobyshev V. Shick and A. Mirzabekov.

Fabrication of microarray of gelimmobilized compounds on a chip by copolymerization.

BioTechnique 1999, v. 27 pp. 592-4, 596-8, 600 passim.

14. В.А. Василисков, Э.Н. Тимофеев, С.А. Суржиков, А.Л. Дробышев, В.В. Шик, А.Д.

Мирзабеков. Метод получения микрочипов с помощью сополимеризации с акриламидом. Молекулярная биология 1998, т. 32, с.923- 925.

15. A. Mirzabekov, D. Proudnikov, E. Timofeev, S. Kochetkova, V. Florentiev and V. Shick.

Methods for immobilizing nucleic acids on a gel substrate. US Patent 5,981,734 (1999).

16. S. Sundberg, J. Jacobs, J. Schullek, G. McGall, A. Mirzabekov, E. Timofeev, D.

Fujimoto, C. Holmes and H. Yang. Derivatization of solid supports and methods for oligomer synthesis. US Patent 5,919,523 (1999).

17. S.V. Kochetkova, E.I. Tishchenko, E.N. Timofeev,.I.L. Shchaveleva and V.L.

Florentiev. Intercalating insert into internucleotide linkages as way for stabilization and detection of of short DNA duplexes. Nucleos. Nucleot. 1999, v. 18, pp. 1495-1496.

18. A. Stomakhin, V. Vasiliskov, E. Timofeev, D. Shulga, R. Cotter, A. Mirzabekov. DNA sequence analysis by hybridization with oligonucleotide microchips: MALDI mass spectrometry identification of 5mers contiguously stacked to microchip oligonucleotides.

Nucleic Acids Res. 2000, v. 28, pp. 1193-1198.

19. Э.Н. Тимофеев, А.Д. Мирзабеков. Способ изготовления микрочипов на основе олигонуклеотидов. Патент РФ 2157385 (2000).

20. Э.Н. Тимофеев, А.Д. Мирзабеков, В. A. Василисков. Способ иммобилизации модифицированных непредельными фрагментами олигонуклеотидов путем сополимеризации. Патент РФ 2157377 (2000).

21. S. A. Surzhikov, E. N. Timofeev, B. K. Chernov, J. B. Golova, A. D. Mirzabekov.

Advanced method for oligonucleotide deprotection. Nucleic Acids Res. 2000, v. 15, E29.

22. E. N. Timofeev, O. F. Borisova, A. K. Shchyolkina. Structural polymorphism of oligo(dC) with mixed alpha,beta-anomeric backbone. J. Biomol. Struct. Dyn. 2000, v. 17, pp. 655-664.

23. A. K. Shchyolkina, E. N. Timofeev, Yu P. Lysov, V. L. Florentiev, T. M. Jovin and D. J.

Arndt- Jovin. Protein-free parallel triple-stranded DNA complex formation. Nucleic Acids Res. 2001, v. 29, pp. 986-995.

24. E. Timofeev and A. Mirzabekov. Binding specificity and stability of duplexes formed by modified oligonucleotides with a 4096-hexanucleotide microarray Nucl. Acids. Res.

2001, v. 29, pp. 2626- 2634.

25. S.V. Kochetkova, E.N. Timofeev, E.A. Korobeinikova, N.A. Kolganova and V.L.

Florentiev. Oligodeoxynucleotides with extended zwitter-ionic internucleotide linkage.

Tetrahedron. 2001, v. 57, pp. 10287-10292.

26. Н.А. Колганова, С.В. Кочеткова, Э.Н. Тимофеев, Б.П. Готтих, В.Л. Флорентьев.

Повышение стабильности дуплексов олигонуклеотидов. Эффект присоединения 1(2-дезокси--D-рибофуранозил)-5-нитроиндола. Молекулярная биология 2002, т.

36, с. 1-8.

27. A. Mirzabekov, G. Yershov, D. Guschin, M. Gemmel, V. Shick, D. Proudnikov and E.

Timofeev. Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction. US Patent 6,465,174 (2002).

28. A. Mirzabekov, E. Timofeev and V. Vasiliskov. Method of fabrication of microarray of gel-immobilized compounds on a chip by copolymerization. US Patent 6,656,725 (2003).

29. Э.Н. Тимофеев, С.В. Кочеткова, В.Л. Флорентьев. Исследование связывания неприродных ,-олигоцитидилатов с дуплексами ДНК. Молекулярная биология 2004, т. 38, с. 459-464.

30. E. N. Timofeev, B. V. Goryaeva, V. L. Florentiev Recognition of Base Pair Inversions in Duplex by Chimeric (,) Triplex-Forming Oligonucleotides. J. Biomol. Struct. Dynam., 24, No. 2, 183-188 (2006).

31. E. N.Timofeev, S. N. Mikhailov, A. N. Zuev, E. V. Efimtseva, P. Herdewijn, R. L.

Somers and M. M. Lemaitre. Oligodeoxynucleotides containing 2-deoxy-1methyladenosine and Dimroth rearrangement. Helv. Chim. Acta 2007, v.90, pp. 928-937.

32. Э. Н. Тимофеев, Н. А. Колганова, И. П. Смирнов, С. В. Кочеткова, В. Л.

Флорентьев. Олигодезоксинуклеотиды, содержащие замещенные 4-нитроиндолы:

синтез и исследование в составе дуплексов ДНК. Биоорг.химия 2008, 34 (2): 220226.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.