WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


 

На правах рукописи

АНТОНОВ Валерий Алексеевич

ИДЕНТИФИКАЦИЯ И ВНУТРИВИДОВОЕ ТИПИРОВАНИЕ

ВОЗБУДИТЕЛЕЙ САПА И МЕЛИОИДОЗА

03.00.07 – микробиология

03.00.15 – генетика

Автореферат

диссертации на  соискание  ученой  степени

доктора  медицинских  наук

Волгоград – 2009

Работа выполнена в ФГУЗ «Волгоградский научно-исследовательский противочумный институт» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека.

Научные консультанты:

доктор медицинских наук,

профессор  Алексеев Владимир Валерьевич

доктор медицинских наук,

профессор  Замараев Валерий Семенович

Официальные оппоненты:

доктор медицинских наук, профессор Швиденко Инна Григорьевна

доктор медицинских наук, доцент Бойко Андрей Витальевич 

доктор медицинских наук, с.н.с.  Пятков Владимир Анатольевич 

Ведущая организация: ФГУН «Государственный научный центр прикладной микробиологии и биотехнологии» Роспотребнадзора 

Защита состоится « _» ___________ 2009 г. в ____часов на заседании диссертационного совета Д 208.078.01 по защите докторских и кандидатских диссертаций при ФГУЗ «Российский научно-исследовательский противочумный институт «Микроб» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (410005, г. Саратов, ул. Университетская, 46).

Автореферат разослан «____» _____________2009 г.

С диссертацией можно ознакомиться в научной библиотеке Российского научно-исследовательского противочумного института «Микроб».

Учёный секретарь диссертационного совета,

доктор биологических наук,

старший научный сотрудник         А.А. Слудcкий

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Burkholderia mallei и Burkholderia pseudomallei вызывают заболевания сап и мелиоидоз, признаваемые как самостоятельные нозологические единицы. Эти возбудители относятся ко II группе патогенности и, по мнению отечественных и зарубежных специалистов,  являются потенциальными агентами биотерроризма  (Wheelis M., 1998; Lehavi O., et al., 2002; Алексеев В.В. с соавт., 2003; Bossi P. et al., 2004; Ruppitsch W. et al., 2007). Исследовательские работы с использованием патогенных биологических агентов создают реальную опасность внутрилабораторных заражений персонала, а также угрозу аварий на объектах, где проводятся работы с патогенными микроорганизмами (Srinivasan A. et al., 2001; Currie B. J. et al., 2003).

Сегодня в мире проблема сапа не стоит так остро, как ранее, что связано с уменьшением численности лошадей, являющихся основным резервуаром этой инфекции, однако сап по-прежнему наносит значительный экономический урон в крупных животноводческих хозяйствах Турции, Ирана, Объединенных Арабских Эмиратов, Афганистана, Индии, Китая, Монголии,  а также стран Африки и Латинской Америки (Arun S. et al., 1999; Anuntagool N. et al. 2002; Nierman W.C. et al. 2004; Harvey S.P. 2005; Scholz H.C. et al., 2006). Заболеваемость сапом среди людей носит, в основном, спорадический характер. В то же время, возбудитель сапа крайне опасен в лабораторных условиях. Это подтверждает трагический опыт большого количества исследователей сапа (Вышелесский С.Н., 1909; Srinivasan A. et al., 2001).

Ранее считалось, что мелиоидоз единственное заболевание, вызываемое буркхольдериями, распространение которого в природе имеет определенные географические границы: оно эндемично лишь для Австралии и стран Юго-Восточной Азии (Cravitz L. 1950; Rogul M. et al., 1970; Ширяева Д.Т. 1976). На сегодняшний день эта точка зрения  изменилась. В настоящее время мелиоидоз обнаружен далеко за  пределами эндемичных территорий Азии и Австралии (Cheng A. C., 2005), спорадические случаи и очаги мелиоидоза выявлены  в странах Центральной  и Южной Америки,  Западной Африки и даже в Европе (Dance D.A., 2000; Carlson P., 2001; Heyse A.M. et al., 2003; Dance D.A. et al., 2004;  Issack M.I. et al., 2005; Rolim D.B., 2005). Причем, в Cальвадоре и Чили возбудитель мелиоидоза признан как этиологический агент нозокомиальных и оппортунистических инфекций с неблагоприятным прогнозом (Cheng A. C., 2005). Большинство случаев, зарегистрированных за пределами эндемичных территорий, связано с пребыванием в Юго-Восточной Азии и Австралии туристов, имевшими прямой контакт с контаминированной B.pseudomallei пылью или водой (Currie B. J., 2003;  Dance D.A. et al., 2004; Maccanti O. et al., 2004; Kateruttanakul P. et al., 2005; Mandjee A., 2005; Shrestha N., 2005). Риск заражения мелиоидозом увеличивается в период природных катастроф (Allworth A.M., 2005; Chierakul W. et al., 2005).

Актуальность создания эффективных средств диагностики сапа и мелиоидоза определяется реальной угрозой возникновения в любом регионе мира неблагоприятной эпидемической ситуации по этим инфекциям в связи со значительным ростом грузо- и пассажиропотоков, появления возбудителей за счёт завоза больных животных, а также пищевых продуктов, контаминированных патогенными буркхольдериями. Способность к длительной бессимптомной персистенции возбудителя мелиоидоза в организме являются дополнительными причинами расширения ареала инфекции в результате миграции людей и животных с латентной формой заболевания (Koponen M.A., 1991; Riecke K. et al., 1997; Ngauy V. et al., 2005; Frangoulidis D. et al., 2007).

На сегодняшний день можно констатировать, что существующие методы обнаружения патогенных буркхольдерий оказываются недостаточно эффективными для экспресс-диагностики, а идентификация возбудителей сапа и мелиоидоза по-прежнему является трудоемкой задачей. Традиционная лабораторная диагностика, направленная на выделение чистой культуры возбудителей с последующей ее идентификацией,  позволяет дать положительный ответ лишь через 36-48 ч. Серологические методики дают более быстрые результаты, но обладают относительно низкой  чувствительностью  и недостаточной специфичностью из-за возможных перекрёстных реакций с гетерологичными видами микроорганизмов и антигенной вариабельности штаммов. Кроме того, диагностическая ценность иммунологических методов ограничена при выявлении патогенных буркхольдерий на ранних стадиях инфекционного процесса.

Бурное развитие молекулярно-генетических технологий и достижения современной фундаментальной науки внесли значительный вклад в совершенствование средств диагностики, профилактики и лечения инфекционных болезней. Изучение геномов возбудителей особо опасных инфекций, включая B. mallei и B. pseudomallei привело к созданию и широкому внедрению новых методических подходов, направленных на идентификацию и типирование патогенов. Однако отсутствие общепринятых коммерческих тест-систем, предназначенных для выявления видоспецифических последовательностей ДНК и антигенов этих микроорганизмов, приводит к тому, что в рутинной практике до сих пор используют лишь микроскопию и биохимические системы идентификации подобные API 20NE (Zysk G., 2000; Cheng A. C., 2005). Молекулярно-биологические методы обнаружения патогенных буркхольдерий включают в схему лабораторной диагностики в качестве подтверждающих тестов, как правило, при положительных находках в полуавтоматических системах идентификации (Srinivasan A., 2001; Inglis T.J.J. et al., 2005). 

Традиционные методы типирования штаммов возбудителей сапа и мелиоидоза, основанные на культивировании микроорганизмов, изучении особенностей их метаболизма и антигенного строения, различной чувствительности к бактериофагам и антибиотикам (Манзенюк О.Ю. c соавт., 1994; Илюхин В.И. c соавт., 1995; Гришкина Т.А., 1996; Пивень Н.Н. , 1997; Илюхин В.И. c соавт., 1998), отличаются ресурсоемкостью и в большинстве случаев не позволяют выявить отличия между штаммами патогенных буркхольдерий. Данные методы, основанные на изучении фенотипических свойств,  имеют существенные недостатки, связанные с относительной однородностью фенотипических свойств штаммов этих видов микроорганизмов, что определяет трудности в их инфравидовой дифференциации. В связи с этим, на сегодняшний день ни один из фенотипических маркеров не обеспечивает необходимую эффективность при расшифровке вспышек сапа и мелиоидоза.

В последние годы среди используемых методов типирования главенствующее место стали занимать молекулярно-биологические подходы. Результаты генотипирования характеризуются большей достоверностью по сравнению с морфологическими, биохимическими или иммунологическими методами дифференциации микроорганизмов (Блохина И.Н. c соавт., 1992; Tenover F.C.,1997; Шагинян И.А., 2000). Методы генетического типирования – полиморфизм длин рестрикционных фрагментов, гель-электрофорез в пульсирующем электрическом поле, различные варианты полимеразной цепной реакции и мультилокусного сиквенс-типирования были адаптированы для дифференциации штаммов B. pseudomallei, выделенных из внешней среды, от животных и человека (Trakulsomboon S. et al., 1994; Haase A. et al., 1995; Trakulsomboon S. et al., 1997; Currie B.J. et al., 2000; Pitt T.L. et al., 2000), расшифровки вспышек мелиоидоза (Currie B.J. et al., 2001; Ulett G.C. et al., 2001) и оценки эффективности проводимой антибиотикотерапии (Vadivelu J. et al., 1997; Koonpaew S. et al., 2000). Следует отметить, что количество публикаций, в которых описаны методы типирования возбудителя сапа существенно меньше, чем его ближайшего «родственника» - возбудителя мелиоидоза (Harvey S.P., 2005; Chantratita N. et al., 2006; , U'Ren J.M. et al., 2007).

Применение автоматических секвенаторов и методологии биочипов позволило вплотную подойти к экспрессному секвенированию  полного генома микроорганизмов. Информация, полученная при секвенировании геномов патогенных буркхольдерий, может быть использована для разработки быстрых и точных методов диагностики и дифференциации возбудителей сапа и мелиоидоза от близкородственных микроорганизмов, а также для внутривидового типирования этих патогенов.

До проведения полного сиквенса геномов B.pseudomallei и B.mallei лишь небольшая часть генов была клонирована и изучена их структурно-функциональная организация. Проведенные исследования геномной организации возбудителей сапа и мелиоидоза на основе секвенирования полных геномов показали наличие у них двух хромосом с функциональным разделением генов между ними (Holden M.T. et al., 2004; Nierman W.C. et al., 2004). Большие хромосомы кодируют функции, ответственные за основные стороны жизнеобеспечения и роста клеток, в то время как меньшие – несут вспомогательную нагрузку, заключающуюся в обеспечении адаптационных свойств микроорганизмов в части выживаемости в различных условиях окружающей среды. Первые аннотированные сиквенсы геномов B. mallei ATCC 23344 и B. pseudomallei K96243 представлены на веб-серверах (http://www.tigr.org/) и (http://www.sanger.ac.uk/). На сегодняшний день эти базы данных содержат информацию об аннотированных геномов уже  4 штаммов B. mallei  и 4 штаммов B. pseudomallei.

Анализ геномных последовательностей буркхольдерий выявил множество гомологичных участков у B.pseudomallei и B.mallei, отсутствующих у близкородственного вида B.thailandensis (Holden M.T. et al., 2004; Nierman W.C. et al., 2004). С помощью методологии секвенирования и технологии ДНК-биочипов идентифицировано большое количество открытых рамок считывания (ORF), которые делетированы (дефектны) у B.mallei и B.thailandensis в сравнении с  B.pseudomallei. Как для B. mallei, так и для B.thailandensis  выявлена преимущественная локализация таких генов на малой хромосоме. Как правило, они связаны с различными метаболическими и клеточными функциями, определяющими межвидовые различия (Ong C. et al., 2004; Kim H.S. et al., 2005). Причем, у возбудителя сапа отмечена высокая тенденция к потере более протяженных фрагментов хромосом. Делеции затрагивают некоторые гены III типа секреции, сериновой металлопротеазы, кластеров, детерминирующих гликопротеиновую капсулу, а также продукцию и секрецию токсинов.

Расшифровка и сопоставление полногеномных последовательностей различных штаммов B. pseudomallei и B. mallei позволяет определять ДНК-маркеры (ДНК-стандарты) с которыми можно проводить сравнение остальных штаммов и изолятов с тем, чтобы делать выводы о присутствующих или отсутствующих в них последовательностях, по сравнению со стандартами.

Однако на сегодняшний день такая информация имеется лишь для нескольких штаммов из большого разнообразия диких штаммов и поиск вариабельных ДНК-маркеров для внутривидовой дифференциации патогенных буркхольдерий проводится эмпирически.

Существующая вероятность завоза инфекций на территорию нашей страны диктует необходимость технологических разработок, удовлетворяющих задачам не только высокоэффективной идентификации, но и дифференциации штаммов B.mallei  и B.pseudomallei. В настоящее время основополагающий подход к детекции и анализу возбудителей инфекций состоит в последовательном применении методов и средств диагностики, в комплексе представляющих собой единую систему, включающую специфическую индикацию, идентификацию патогена и типирование выявленного микроорганизма. Для многих видов микроорганизмов, в том числе возбудителей особо опасных инфекций, разработаны необходимые алгоритмы идентификации и дифференциации штаммов, основанные на фенотипических и генотипических признаках. Многообразие клинических форм и отсутствие патогномоничных симптомов сапа и мелиоидоза практически исключают возможность постановки диагноза только на основании клинической картины, в связи с этим возрастает роль лабораторных методов в верификации  диагноза. Возникающие проблемы их диагностики как в эндемичных, так и неэндемичных регионах определяют необходимость совершенствования лабораторного анализа и создания единой многоуровневой системы генодиагностики и внутривидовой дифференциации возбудителей.

Рассматривая современные методы идентификации и генотипирования штаммов патогенных буркхольдерий следует отметить, что на сегодняшний день отсутствует оптимальная схема ускоренного выявления внутривидовых различий B. pseudomallei и B. mallei, а  поиск генетических маркеров для быстрого генотипирования штаммов патогенных буркхольдерий продолжается вплоть до настоящего времени.

На основании вышеизложенного, очевидна актуальность научных исследований, направленных на более детальное изучение возбудителей сапа и мелиоидоза, их консервативных и вариабельных последовательностей с целью создания высокоэффективных генетических систем идентификации, отвечающих современным требованиям к чувствительности и специфичности диагностических тест-систем, а также разработки генотипических методов внутривидовой дифференциации штаммов B.mallei и B.pseudomallei.

Цель работы заключалась в разработке способов генной диагностики, конструировании амплификационных тест-систем для идентификации патогенных буркхольдерий и совершенствовании схем внутривидового типирования штаммов возбудителей сапа и мелиоидоза с применением методов молекулярной биологии.

Задачи исследования:

  1. Провести анализ нуклеотидных последовательностей, представленных в различных генетических базах данных, с целью подбора перспективных ДНК-мишеней для генной диагностики и генетической дифференциации штаммов возбудителей сапа и мелиоидоза в различных вариантах ПЦР-анализа, моно- и мультилокусного сиквенс-типирования.
  2. Сконструировать амплификационные тест-системы для выявления возбудителей сапа и мелиоидоза методом ПЦР, подобрать условия проведения реакции, оценить чувствительность и специфичность  генодиагностических систем на широком наборе гомологичных и гетерологичных штаммов микроорганизмов.
  3. Оптимизировать условия подготовки проб для исследования экспериментального биологического материала при различных клинических формах сапа и мелиоидоза и проб из объектов внешней среды, контаминированных B. mallei и B. pseudomallei.
  4. Оценить эффективность ДНК-зондов на основе хромосомной ДНК патогенных буркхольдерий и криптических плазмид возбудителя мелиоидоза для идентификации B. mallei и B. pseudomallei и исследования атипичных штаммов патогенных буркхольдерий методом ДНК-ДНК гибридизации.
  5. С помощью молекулярно-генетических методов изучить вариабельность геномов типичных и атипичных штаммов B. mallei и B. pseudomallei при различных условиях культивирования in vitro и экспериментальной инфекции и выбрать наиболее эффективные методы генетического типирования штаммов патогенных буркхольдерий.
  6. Провести сравнительный анализ эффективности фенотипических и молекулярно-биологических методов идентификации и внутривидовой дифференциации штаммов B. mallei и B. pseudomallei  и определить оптимальный алгоритм генодиагностики и генотипирования патогенных буркхольдерий.

Научная новизна:

В представленной работе впервые проведено комплексное исследование вариабельных фенотипических признаков и генотипических свойств возбудителей сапа и мелиоидоза с применением широкого спектра методов структурной геномики, позволившее решить ряд прикладных задач, направленных на совершенствование схем идентификации и генетического типирования патогенных буркхольдерий.

Получены приоритетные данные об использовании нуклеотидных последовательностей генов, детерминирующих 23S рРНК, флагеллярного гена и orf гена III типа секреции для идентификации возбудителей сапа и мелиоидоза и на основе этих генов впервые сконструированы отечественные высокочувствительные и специфичные амплификационные тест-системы для генодиагностики B.pseudomallei и B.mallei.

Впервые показана возможность использования ПЦР в качестве дополнительного метода идентификации при различных формах сапа и мелиоидоза, вызванных типичными и атипичными штаммами B. pseudomallei и B. mallei.

Впервые предложены группоспецифические олигонуклеотидные затравки burts1/burta2 для выявления триады буркхольдерий - B.pseudomallei, B.mallei и B.thailandensis, используемые в сочетании с методом ДНК-ДНК гибридизации и амплификации с произвольными праймерами для оценки генетического полиморфизма штаммов B.thailandensis, в том числе штамма B.thailandensis КМ-161, рекомендованного в качестве имитатора возбудителя мелиоидоза при проведении учебных занятий по идентификации ООИ методом ПЦР (патент на изобретение Российского агентства по патентам и товарным знакам «Штамм бактерий Burkholderia thailandensis КМ 161 – авирулентный имитатор возбудителя мелиоидоза» Российского агентства по патентам и товарным знакам N 2257413.от 27.07.2005 г.).

Представлены доказательства того, что алгоритмом ускоренной идентификации B. mallei и B. pseudomallei является сочетание реакции амплификации и последующего секвенирования фрагментов генов 16S рРНК, 23S рРНК, orf13 и fliC. Для доказательства достоверности ПЦР-диагностики сапа и мелиоидоза предложено секвенирование двух локусов геномной ДНК – фрагмента гена 16S рРНК и участков генов 23S рРНК,  orf13 или fliC.

Показано, что разработанный метод выделения ДНК из объектов окружающей среды (почва, вода), искусственно контаминированных микромицетами (патент на изобретение Российского агентства по патентам и товарным знакам №2295569 от 12. 07. 2005 г.), эффективен для экстракции и очистки ДНК патогенных буркхольдерий.

Впервые  предложен способ проведения  плазмидного анализа для внутривидового типирования штаммов возбудителя мелиоидоза. Приоритетность исследований подтверждена патентом на изобретение «Способ выделения плазмид Burkholderia pseudomallei» Российского агентства по патентам и товарным знакам № 2218401 от 10.12.2003 г.

Оптимизированы условия проведения рестрикционного анализа ДНК возбудителя сапа и впервые оценена генетическая гетерогенность коллекционных штаммов B.mallei методом пульс-электрофореза.

Впервые проведен анализ изолятов возбудителя сапа на основе реакции амплификации с произвольными праймерами и показана высокая эффективность ПЦР-типирования штаммов B.mallei. Для дифференциации штаммов патогенных буркхольдерий с использованием полимеразной цепной реакции предложен оригинальный набор олигонуклеотидных затравок.

Научная новизна исследования связана с определением вариабельных нуклеотидных последовательностей и тандемных повторов коллекционных штаммов возбудителей сапа и мелиоидоза, на основе которых возможно проведение ускоренного генетического типирования штаммов B.pseudomallei и B.mallei.

С помощью мультилокусного сиквенс-типирования и сравнительного анализа секвенированных последовательностей вариабельных участков генов «домашнего хозяйства» впервые установлено, что штаммы коллекционного центра живых культур Волгоградского научно-исследовательского противочумного института B.pseudomallei 100, С-141, а также B.pseudomallei 107 с неизвестным источником выделения, относятся к Юго-Восточной группе.

Проведенные исследования впервые позволили сформировать единую систему генодиагностики и генотипирования штаммов возбудителей сапа и мелиоидоза. Схема лабораторной диагностики и идентификации патогенных буркхольдерий дополнена методом ПЦР c разработанными амплификационными тест-системами и впервые предложена схема быстрого внутривидового генетического типирования штаммов B.mallei и B.pseudomallei.

Разработанные методические подходы легли в основу исследований, поддержанных грантами РФФИ 04-04-96503, 07-04-01568 и 07-04-08665.

Практическая ценность:

Разработанные амплификационные тест-системы в настоящее время используются в лабораториях Волгоградского НИПЧИ и могут быть рекомендованы для специализированных лабораторий для идентификации патогенных буркхольдерий и экспресс-диагностики сапа и мелиоидоза. С этой целью оформлены методические рекомендации «Идентификация возбудителей сапа и мелиоидоза методом полимеразной цепной реакции», утвержденные директором института Н.Г. Тихоновым 29 мая 2002 г. и методические рекомендации «Использование двух пар праймеров для идентификации возбудителей сапа и мелиоидоза методом ПЦР» (утверждены директором Волгоградского НИПЧИ В.В. Алексеевым 10 февраля 2005 г.).

Материалы диссертационной работы использованы при оформлении пакета первичной документации: «Инструкция по изготовлению и контролю амплификационной тест-системы для выявления Burkholderia pseudomallei и Burkholderia mallei» и «Инструкция по применению амплификационной тест-системы для выявления Burkholderia pseudomallei и Burkholderia mallei»,  утверждённой директором Волгоградского НИПЧИ  В.В. Алексеевым 10 февраля 2005 г. 

Методики плазмидного анализа, выделения и мобилизации внехромосомных репликонов B.pseudomallei,  включенные в методические рекомендации «Применение мобилизации для передачи криптических плазмид  B.pseudomallei в гетерологичные виды», утвержденные директором Волгоградского НИПЧИ Н.Г.Тихоновым 20 апреля 1998 г. и методические рекомендации «Способ получения штамма кишечной палочки, продуцирующего белок 30 kDa, опосредованный мелиоидозной плазмидой рСМ2» (утверждены директором Волгоградского НИПЧИ Н.Г.Тихоновым. 2 марта 2000 г.) используются в лабораториях Волгоградского НИПЧИ в различных разделах работ при изучении патогенных буркхольдерий.

Используемый метод ДНК-гибридизации включен в схему идентификации патогенных буркхольдерий, представленную в практическом руководстве «Мелиоидоз. Лабораторная диагностика возбудителей особо опасных инфекционных болезней» (Саратов, 1998). В государственной коллекции патогенных бактерий Всесоюзного НИПЧИ «Микроб» депонированы штаммы E.coli КМ 163, 164, 165, 166,  несущие в составе своего генома, фрагменты плазмиды рСМ2 возбудителя мелиоидоза, которые рекомендованы в качестве группоспецифических ДНК – зондов для идентификации патогенных буркхольдерий.

Результаты сравнительного анализа фенотипических и генотипических методов дифференциации типичных и атипичных штаммов патогенных буркхольдерий легли в основу методических рекомендаций «Постановка диагностических тестов для внутривидовой дифференциации штаммов возбудителей сапа и мелиоидоза (индивидуальная карта штамма)», утвежденных директором  Волгоградского НИПЧИ В.В.Алексеевым 25 июня 2003 г.

По материалам диссертационной работы составлены методические рекомендации: «Молекулярно-биологические подходы к идентификации и внутривидовому типированию возбудителей сапа и мелиоидоза», утвержденные директором Волгоградского НИПЧИ  В.В. Алексеевым 06 марта 2006 г.

Предлагаемые схемы ПЦР-типирования с набором произвольных праймеров и олигонуклеотидных затравок для детекции вариабельных ампликонов, а также методы мультилокусного сиквенс-типирования и пульс-электрофореза используются в лабораториях Волгоградского НИПЧИ для сравнительного анализа музейных штаммов возбудителей сапа и мелиоидоза и их изогенных мутантов с измененной вирулентностью и чувствительностью к антибиотикам.

Материалы диссертационной работы используются сотрудниками института в рамках учебных программ по первичной специализации и перепоготовке специалистов - Программы курсов повышения квалификации бактериологов и эпидемиологов по противодействию биотерроризму, утвержденной Главным государственным санитарным врачом Российской Федерации Г.Г.Онищенко 01.02.2001 г., Программы курсов повышения квалификации врачей – бактериологов общей медицинской сети, центров госсанэпиднадзора и противочумных учреждений по специфической индикации и лабораторной диагностике особо опасных инфекций, санитарной охране территории и противоэпидемической защите населения, утвержденной Главным государственным санитарным врачом Российской Федерации Г.Г.Онищенко 28.09.1999 г., а также Программы курсов повышения квалификации медицинских работников (с высшим и средним специальным образованием) санитарно-карантинных пунктов и отделов (СКП и СКО), утвержденной Главным государственным санитарным врачом Российской Федерации Г.Г.Онищенко. Кроме того, материалы настоящей работы используются при чтении лекций и проведении практических занятий для студентов III-VI курсов медико-биологического факультета Волгоградского государственного медицинского университета.

Положения, выносимые на защиту

  1. Амплификационные тест-системы, сконструированные для выявления возбудителей сапа и мелиоидоза, обеспечивают специфическую детекцию фрагментов генов 23S рРНК, флагеллярного гена (fliC) и orf гена III типа секреции патогенных буркхольдерий при исследовании методом ПЦР чистых культур и проб из объектов внешней среды, контаминированных B. mallei и B.pseudomallei, а также при генодиагностике различных форм экспериментального сапа и мелиоидоза, вызванных типичными и атипичными штаммами возбудителей.
  2. Группоспецифические олигонуклеотидные затравки burts1/burta2, обеспечивают амплификацию специфических фрагментов флагеллярного гена fliC триады буркхольдерий - B.pseudomallei, B.mallei и B.thailandensis с чувствительностью 1х102-1х103 м.к./мл при анализе чистых культур и биологического материала от экспериментально заражённых животных.
  3. Использование двух ДНК мишеней -  участков 16S рРНК и 23S рРНК, orf13 или fliC, при сочетании ПЦР и секвенирования является способом доказательства достоверности ПЦР-диагностики, быстрой идентификации B.mallei и B.pseudomallei и их дифференциации от близкородственных видов микроорганизмов.
  4. Методы пульс-электрофореза и мультилокусного сиквенс-типирования эффективны для дифференциации штаммов возбудителя мелиоидоза, в отличие от штаммов B. mallei, для которых применим рестрикционный анализ ДНК в формате пульс-электрофореза. При мультилокусном сиквенс-типировании штаммы возбудителя сапа объединяются в единый сиквенс-тип, входящий в клональный комплекс штаммов B. pseudomallei и их дифференциация невозможна.
  5. Быстрое генетическое типирование штаммов возбудителя мелиоидоза обеспечивают методы амплификации полиморфной ДНК с произвольными праймерами, VNTR-анализ, Rep-ПЦР и схема типирования на основе вариабельных ампликонов, а ускоренная оценка генетической гетерогенности штаммов возбудителя сапа возможна лишь с помощью VNTR-анализа и амплификации с произвольными праймерами.

Апробация работы

Основные материалы диссертации были  представлены на международной конференции «Геномика, протеомика и биоинформатика для медицины» (Москва, 2002), IV Всероссийской научно-практической конференции «Генодиагностика инфекционных заболеваний» (Москва,  2002), IV межгосударственной научно – практической конференции Государств стран СНГ «Современные технологии в диагностике особо опасных инфекционных болезней» (Саратов, 2003), XI Российском национальном конгрессе «Человек и лекарство» (Москва, 2004), V Всероссийской научно-практической конференции «Генодиагностика инфекционных болезней» (Москва, 2004), VI Межгосударственной научно-практической конференции государств-участников СНГ «Санитарная охрана территорий государств участников Содружества Независимых Государств: проблемы биологической безопасности и противодействия биотерроризму в современных условиях» (Волгоград, 2005), Межгосударственной научно-практической конференции государств-участников СНГ «Чрезвычайные ситуации международного значения в общественном здравоохранении в решениях Санкт-Петербургского саммита «Группы восьми» и санитарная охрана территорий государств-участников Содружества Независимых Государств»» (Оболенск, 2006), XI Региональной конференции молодых исследователей Волгоградской области (Волгоград, 2006), 65-й юбилейной научно-практической конференции молодых ученых с международным участием «Актуальные проблемы экспериментальной и клинической медицины» (Волгоград, 2007), V международном конгрессе по мелиоидозу (Thailand, 2007), а также на ежегодных итоговых научных конференциях Волгоградского НИПЧИ.

По теме диссертации опубликовано 83 научные работы. Материалы исследований использованы при написании трех монографий - «Мелиоидоз», под ред. Н.Г. Тихонова, Волгоград, 1995, «Практическое пособие для подготовки врачей-бактериологов и эпидемиологов по вопросам противодействия биотерроризму», Волгоград, 2004 и «Специфическая индикация патогенных биологических агентов. Практическое руководство», под ред. академика  РАМН, Г.Г.Онищенко.- М: ЗАО «МП Гигиена».- 2006.

Структура и объем работы

       Диссертация изложена в форме монографии на 268 листах машинописного текста, состоит из введения и 6 глав, включающих описание литературных данных и результаты собственных исследований, заключения и выводов. Работа иллюстрирована 21 таблицей и 61 рисунком. Список цитируемой литературы включает 386 источников, в том числе 82 отечественных и 304 иностранных работ.

СОДЕРЖАНИЕ РАБОТЫ

1. Таксономическое положение возбудителей сапа, мелиоидоза и близкородственных микроорганизмов

Патогенные буркхольдерии по многим биологическим свойствам схожи с псевдомонадами, и, по этой причине, ранее они были объединены в семейство  Pseudomonadaceae, род Pseudomonas. До этого они входили в различные роды и семейства. Так, возбудитель мелиоидоза имеет более 10 синонимов – Bacterium whitmori, Bacillus whitmori, Bacillus pseudomallei, Pfeifferella whitmori, Pfeifferella pseudomallei,  Actinobacillus pseudomallei, Loefferella whitmori, Loefflerella pseudomallei, Malleomyces pseudomallei, Pseudomonas pseudomallei, Burkholderia pseudomallei.

Возбудитель сапа первое биноминальное название - Bacillus mallei получил в 1885 г. через три года после его выделения в чистой культуре F.D. Lffler и J.W. Schutz. Однако в последующие годы у этого микроорганизма, так же, как и возбудителя мелиоидоза, изменялись как таксономические позиции, так и биноминальные обозначения (Acinetobacter mallei, Loefferella mallei, Actinobacillus mallei, Malleomyces mallei, Pfeifferella mallei, Bacillus mallei, Pseudomonas mallei, Burkholderia mallei). В самостоятельный род Burkholderia возбудители сапа и мелиоидоза, наряду с другими псевдомонадами 2-группы рРНК-ДНК гомологии, выделены на основе результатов секвенирования генов 16S рРНК (Yabuuchi E. et al., 1992).

Таксономическая позиция патогенных буркхольдерий на сегодняшний день определена. Однако вопросы внутриродового разграничения буркхольдерий медицинского значения продолжают интересовать исследователей до сих пор. Род Burkholderia включает 34 описанных вида (Coenye T. et al., 2001; Coenye T., Vandamme P., 2003), девять из которых известны как бактерии комплекса Burkholderia cepacia. Схожие проблемы возникли и при установлении таксономического положения мелиоидозоподобных культур - B.thailandensis (Brett P.J. et al., 1998) и B. oklahomensis (Glass M.B. et al., 2006). Сложность определения видовой принадлежности этих микроорганизмов может приводить к ошибкам их идентификации и дифференциации от B.pseudomallei (Koh T.H. et al., 2003; Inglis T.J.J. et al., 2005). Хотя секвенирование гена 16S рРНК является определяющим геном для идентификации многих видов микроорганизмов, для рода Burkholderia имеются ограничения, обусловленные отсутствием критериев корректной дифференциации видов бактерий комплекса B.cepacia (Mahenthiralingam E. et al., 2000). Идентификация всех 9 геномоваров этого комплекса стала возможной лишь при использовании данных секвенирования другой ДНК-мишени - recA гена буркхольдерий. Однако при анализе секвенированных последовательностей и построенных на их основе филогенетических деревьев, дифференцировать возбудители сапа и мелиоидоза между собой не удалось (Payne G.W. et al., 2006).

Возбудители сапа и мелиоидоза имеют высокую степень фенотипического сходства (Anuntagool N., Sirisinha S., 2002). При изучении данных микроорганизмов методом ДНК-ДНК гибридизации в отдельных случаях степень гомологии ДНК между штаммами B.mallei и B.pseudomallei  превышала внутривидовую гомологию ДНК B.pseudomallei (Rogul M. et al., 1970). О таксономической близости и идентичности рекомбинационных систем у возбудителей сапа и мелиоидоза свидетельствует и способность к взаимной трансформации на плотных средах без специальной обработки клеток для достижения компетентности (Тарасова Т.Д., Ряпис Л.А., 1983). Эти положения во многом объясняют трудности конструирования видоспецифических диагностических препаратов для возбудителя сапа.

2. Идентификация и внутривидовое типирование патогенных буркхольдерий на основе фенотипических признаков

Клиническая диагностика  сапа или мелиоидоза из-за большого многообразия симптомов и быстрого течения этих заболеваний весьма затруднена (Kanai K., Deysirilert L., 1998; Dance D. A., 1991; Dance D. A., 2000; Brett P.J., Woods D.E., 2000). Полиморфизм клинических проявлений мелиоидоза настолько велик, что даже в эндемичных регионах поставить диагноз на основании клинической картины крайне проблематично. Не вызывает сомнения, что существенное увеличение числа регистрируемых в разных странах случаев сапа и мелиоидоза связано не столько с расширением ареала распространения этих инфекций в мире, сколько с хорошо налаженной в развитых странах лабораторной службой. Именно  это привело к тому, что практически во всех  странах Западной Европы за последние годы зарегистрированы случаи мелиоидоза среди лиц, побывавших в качестве туристов или специалистов в эндемичных зонах (Dance D. A., 2000; Cheng A. C., 2005; Frangoulidis D. et al., 2007).  В нашей стране  регламентированных лабораторных исследований, направленных на выявление B.pseudomallei у туристов и лиц, прибывающих из эндемичных территорий, не проводится. Не исключено, что именно по этой причине в России не зарегистрировано ни одного случая мелиоидоза. Заболеваемость сапом среди людей носит в основном спорадический характер (Цветков Н.Е., 1947). Тем не менее, периодически появляются публикации о выделении B.mallei в клинических лабораториях Италии, Испании, США. В ряде случаев это связано с внутрилабораторным заражением, что подтверждает чрезвычайную опасность работы с культурами B. mallei.

На сегодняшний день идентификация возбудителей сапа и мелиоидоза, в основном, проводится на основании фенотипических признаков. После выделения чистых культур проводят идентификацию с помощью стандартных методических приемов (Илюхин В.И. с соавт., 1983; Поповцева Л.Д. 1985; Илюхин В.И. с соавт., 1995; Inglis T.J.. et al., 2005) или полуавтоматических систем идентификации подобно API 20 NE, рекомендуемой для анализа выделенных культур (Zysk G. et al., 2000; Cheng A. C., Currie B. J., 2005).

При диагностике сапа и мелиоидоза отмечен достаточно высокий процент лабораторных ошибок идентификации возбудителей в эндемичных, а в большей степени неэндемичных регионах, в которые были завезены эти инфекции (Inglis T.J.. et al., 2005; Inglis T.J.J. et al., 2006). Сложности идентификации патогенных буркхольдерий обусловлены перекрестными реакциями с непатогенными бактериальными видами, присутствующими в нестерильных объектах за счет идентичного биохимического профиля (Inglis T.J.J., et al., 1998; Glass M.B., 2005), атипичной морфологии колоний некоторых штаммов B.pseudomallei (Howard K., Inglis T.J., 2003). Измененные биохимические свойства B.pseudomallei и B.mallei в автоматических системах идентификации приводят к ложноотрицательным результатам. (Becker K.H., 1991; Inglis T.J. et al., 1998; Srinivasan A. et al., 2001).

В своей работе мы сравнили две системы идентификации - Nefermtest 24 («Lachema», Чехия) и API – 20NE («BioMerieux», Франция) со стандартными лабораторными тестами определения видовой принадлежности  B.mallei и B.pseudomallei. При анализе культур возбудителя мелиоидоза на основании таблицы дифференцирования «Указателя для анализа данных» получены идентификационные коды 1156577 и 1556577 (API 20 NE), что соответствовало литературным данным (Lowe P. et al., 2002). В системе Nefermtest 24 отмечен высокий процент ошибок идентификации штаммов. Особенно принципиальными были расхождения в оценке декарбоксилаз и денитрификации, которые являются определяющими тестами при дифференциации возбудителей сапа и мелиоидоза от B.cepacia и псевдомонад. На основании полученных данных сделано заключение, что система Nefermtest 24 существенно уступает по своей диагностической ценности API 20NE и не может быть рекомендована для идентификации патогенных буркхольдерий. С помощью обеих тест-систем нам не удалось правильно идентифицировать ни возбудитель сапа, ни B.thailandensis. Кроме того, данные системы идентификации весьма опасны с позиций соблюдения режима работы с возбудителями ООИ (СП 1.3.1285-03), ввиду возможной аэрозолизации микробной взвеси при исследовании.

Иммунодиагностические методы применяют на различных этапах лабораторной диагностики сапа и мелиоидоза и в различные сроки заболевания. Эти методы применяют и для ретроспективного серологического обследования лиц, постоянно или временно находившихся в эндемичных регионах (Ashdown L.R., 1981;  Ashdown L.R. et al., 1989;  Chierakul W. et al., 2005). Существующие сложности в трактовке результатов иммунодиагностических исследований могут быть связаны с регистрируемыми в ряде случаев перекрёстными реакциями, обусловленными антигенным родством патогенных буркхольдерий и гетерологичных микроорганизмов - возбудителей чумы, псевдотуберкулёза, туляремии, легионеллёза (Гонтарь И.П. с соавт., 1984; Беляков В.Д. с соавт., 1990; Пивень Н.Н., 1987; Пивень Н.Н., 1997).

Лабораторная диагностика включает не только этап идентификации возбудителей, но и определение индивидуальных особенностей штаммов, что имеет значение при определении степени сходства бактериальных культур, установлении источника инфекции при эпидемиологическом анализе и расшифровке различных вспышек инфекционных заболеваний. Внутривидовая дифференциация микроорганизмов на основе культурально-морфологичес-ких, биохимических, серологических свойств, а также вирулентности, устойчивости к антибиотикам и бактериофагам используется при паспортизации как известных, так и вновь выделяемых штаммов.

Возбудители сапа и мелиоидоза являются филогенетически тесно связанными между собой видами микроорганизмов, что подчеркивают многочисленные исследования их фенотипических свойств (Cravitz L., 1950; Howe C. et al., 1971; Илюхин В.И. с соавт., 1983; Беляков В.Д. с соавт., 1990; Kanai K., 1994; Пивень Н.Н., 1997; Anuntagool N., Sirisinha S., 2002). Наряду с этим им свойственна значительная однородность фенотипических признаков внутри вида, затрудняющая их интравидовое типирование, что и было выявлено в нашей работе.

Как показал, проведенный анализ фенотипических тестов 61 штамма B.pseudomallei и 14 штаммов B.mallei. имеющихся в коллекции ВолгоградНИПЧИ, лишь фаготипирование и анализ белкового спектра могут быть использованы для внутривидового типирования штаммов возбудителя мелиоидоза. Для штаммов возбудителя сапа эффективным методом дифференциации, основанным на анализе фенотипических свойств, является сравнительный электрофоретический анализ общеклеточных белков. Несмотря на выявление вариабельных биохимических признаков - окисление рамнозы, ксилозы, целлобиозы, реакции денитрификации, секреции клетками уреазы и гидролиз эскулина и различий в чувствительности к антибиотикам, эти тесты рекомендованы лишь в качестве дополнительных критериев дифференциации штаммов патогенных буркхольдерий, ввиду их относительно низкой внутривидовой вариабельности.

Проведенный анализ фенотипических свойств возбудителей сапа и мелиоидоза, на основе которых проводится идентификация и внутривидовое типирование B.mallei и B.pseudomallei, свидетельствует о необходимости расширения рамок лабораторных исследований и привлечения новых методических приемов для идентификации и типирования патогенных буркхольдерий, основанных на структуре их геномов.

3. Фенотипическая и генотипическая идентификация бактерий комплекса B.cepacia, B. thailandensis,  B.pseudomallei-like spp.

При генодиагностике и конструировании диагностических тест-систем важное значение имеет оценка их специфичности на широком наборе близкородственных и гетерологичных микроорганизмов, с которыми необходимо провести дифференциацию. Такой набор позволяет объективно оценивать диагностические возможности вновь создаваемых систем.

В первую очередь, это касается близкородственных патогенным буркхольдериям видов B.cepacia,  B.thailandensis и мелиоидозоподобных почвенных микроорганизмов (B. pseudomallei-like spp.).

B.cepacia  включена в род  Burkholderia в качестве типового вида (Yabuuchi E. et al., 1992). Детальный анализ биохимических свойств, белкового профиля и жирно-кислотного состава, а также ДНК-РНК и ДНК-ДНК гибридизация  привели к выводу, что вид B.cepacia фактически состоит из близко связанных, но генетически отличных друг от друга 9 различных видов (или геномоваров). Эта группа  бактерий стала упоминаться в литературе как B.cepacia комплекс (Coenye T. et al., 2001; Lipuma J.J. et al., 2001). Геномовары по фенотипипическим признакам схожи между собой, но генетически это отличные друг от друга группы штаммов (Coenye T. et al., 2001). При использовании биохимических и фенотипических тестов возникают трудности идентификации бактерий комплекса B.cepacia с микроорганизмами семейства -протеобактерий, включая Pandoraea и Ralstonia (Coenye T. et al., 2001; Lipuma J.J. et al., 2001), а также достаточно часто случаются ошибки их дифференциации от B.pseudomallei (Koh T.H. et al., 2003; Inglis T.J. et al., 2005).

При уточнении видовой принадлежности 25 штаммов, выделенных из различных источников и числящихся по паспортным данным в коллекционном центре Волгоградского научно-исследовательском противочумном институте как штаммы B.cepacia, нами отобрано 18 культур, соответствующих по биохимическим свойствам, включая определение лизиндекарбоксилазы, аргининдигидролазы, ONPG  виду B.cepacia. В реакции амплификации с видоспецифическими и геномоварспецифическими праймерами (Mahenthiralingam E. et al., 2000) с ДНК всех 18 штаммов нами получены положительные результаты. При ПЦР-типировании выявлено, что в коллекции Волгоградского научно-исследовательского противочумного института имеются штаммы B.cepacia принадлежащие к I (B. cepacia), II (B. multivorans), III (B. cenocepacia) и IV (B. stabilis) геномоварам.

К виду B.cepacia (геномовар I) принадлежат штаммы 25416, 3181, 3189, 610, 611, 620, 621 и 122. Причем, штамм  B.cepacia 122, до наших исследований числился в коллекционном центре как атипичный невирулентный штамм B.pseudomallei Vang, так как в реакции ДНК-ДНК гибридизации не давал положительного сигнала радиоавтографа (Замараев В.С., 2004). Из исследуемых штаммов к виду B.multivorans (геномовар II) принадлежит один штамм B.cepacia 1934. Этот штамм в коллекции Института сыворотки (Дания) по фенотипическим характеристикам ранее числился как атипичный штамм B.cepacia (Bremmelgaard A., 1975). Восемь штаммов отнесены нами к виду B. cenocepacia (геномовар III) и еще один (B.cepacia 8235) к B.stabilis (геномовар IV).

Бактерии B.thailandensis генетически и иммунологически близки к возбудителю мелиоидоза. При использовании общепринятых методов идентификации данный микроорганизм практически идентичен культурам возбудителя мелиоидоза, поэтому и предложено первоначальное наименование – B.pseudomallei-like. Основное его различие с B.pseudomallei состоит в низкой вирулентности для лабораторных животных и более высокой  биохимической активности по отношению к олигосахаридам из группы пентоз (Brett P.J. et al., 1997; Brett P.J. et al., 1998). После появления публикаций о регистрации B.pseudomallei в Иране (Pourtaghva M. et al., 1975), сотрудниками ВолгоградНИПЧИ в ходе экспедиционных поездок в Прикаспийскую территорию Азербайджана и Туркмении было выявлено несколько десятков культур, которые вырастали на селективных средах, предназначенных для B.pseudomallei (среда Эшдауна, среда с β-аланином и др.). Изолированные штаммы  агглютинировались в титрах 1:100, 1:200 мелиоидозной агглютинирующей сывороткой, но были авирулентны для золотистых хомячков. По совокупности исследуемых фенотипических признаков изучаемые почвенные микроорганизмы отнесены нами к мелиоидозоподобным штаммам (B. pseudomallei-like spp.) и получили рабочее название Ленкоранские штаммы.

Результаты, проведенного нами гибридизационного анализа коллекции микроорганизмов бактерий комплекса B.cepacia, мелиоидозоподобных штаммов и B.thailandensis, подтвердили гомологию их ДНК с B.pseudomallei. С гетерологичными микроорганизмами гомология отсутствовала (рис.1).

Рис. 1. Радиоавтограф гибридизации ДНК B.pseudomallei С-141 с ДНК штаммов B.pseudomallei-like spp. и другими гетерологичными микроорганизмами.  А – радиоавтограф; Б – схема нанесения ДНК

 

Два сапных штамма (Олоф и Конный) в реакции ДНК-ДНК гибридизации не давали положительных сигналов радиоавтографа (Замараев В.С., 2004), при использовании биохимической системы идентификации Nefermtest 24 «Lachema» (Чехия) отнесены к виду Alcaligenes (Сенина Т.В., 2004). Полученные нами данные подтвердили результаты, на основе которых эти два штамма было решено исключить из рода Burkholderia.

Таким образом, проведенные исследования позволили подобрать адекватный набор штаммов близкородственных буркхольдерий, который был использован нами при оценке специфичности сконструированных амплификационных тест-систем, предназначенных для обнаружения B.mallei и B.pseudomallei.

4. Разработка молекулярно-генетических способов детекции патогенных буркхольдерий

Приоритет разработки амплификационной тест-системы для идентификации возбудителей сапа и мелиоидоза принадлежит A.E.Lew и  P.M.Desmarchelier (1994), сконструировавших специфичные олигонуклеотидные праймеры на основе гена, кодирующего синтез 23S рРНК. В последующих работах использовали ген, детерминирующий 16S рРНК (Dharakul T. et al., 1996; Brook M.D.,1997; Woo P.C. et al., 2003) и спейсерную область между этими генами (Kunakorn M., 1995). Для повышения специфичности ПЦР рекомендовали двухстадийную ПЦР (Kunakorn M. et al., 2000; Hagen R.M. et al., 2002), рестрикцию ампликонов (Sprague L.D. et al., 2002), а также различные видоспецифические последовательности (Sermswan R.W. et al., 2000; Баннов В.А., Калачёв И.Я., 2003; Smith-Vaughan H.C., Gal D., Lawrie P.M. et al., 2003; Neubauer H. et al., 2007) и SNP-маркеры (Bauernfeind A. et al., 1998; U'Ren J.M. et al., 2005; Wattiau P. et al., 2007). Однако, до сих пор нет единого мнения, коммерческих тест-систем, а также регламентирующих документов, определяющих  обязательные ДНК-мишени  и необходимые праймеры для идентификации патогенных буркхольдерий. В то же время, накоплен большой опыт, свидетельствующий о том, что применение какой либо одной пары праймеров  при исследовании объектов внешней среды и проб клинического материала не обеспечивает достаточной эффективности анализа (Kunakorn M. et al., 2000; Sprague L.D. et al., 2002).

По этой причине для конструирования амплификационных тест-систем с целью генодиагностики сапа и мелиоидоза нами проведен анализ представленных нуклеотидных последовательностей патогенных буркхольдерий в различных генетических базах данных (http://www.ncbi.nlm.nih.gov/),  (http://www.ebi.ac.uk/),  (http://www.tigr.org/), (http://www.sanger.ac.uk/) и выбрано семь пар праймеров на основе фрагментов гена 23S рРНК, две пары олигонуклеотидных затравок, фланкирующих участки флагеллярного гена (fliC)), и одна пара праймеров, являющихся участком гена  orf13 системы III-типа секреции (TTS1).

Семь пар праймеров были общими для B.mallei и B.pseudomallei,одна пара олигонуклеотидных затравок гомологична последовательностям триады буркхольдерий - B.mallei, B.pseudomallei, B.thailandensis и две пары – B.mallei. Дополнительно в работе использована одна пары праймеров  для обнаружения B.mallei, фланкирующих участок гена  23S рРНК,  обозначенная М23-2/CVMP23-1 (Bauernfeind A. et al., 1998), и одна пара олигонуклеотидных затравок Bps16S-U33/Bps16S-OL731 (Dharakul T. et al., 1999), являющихся фрагментом гена 16S рРНК (табл.1).

Таблица 1

Характеристика используемых олигонуклеотидных праймеров

Праймеры

Нуклеотидные последовательности

праймеров

Размер

ампликона

Ожидаемая

специфичность

23S рРНК

burk3s

burk4as

CGAAGCTGCGGATGCGAGCTAGTCTC AGTCGCAGCCACCAGTTTATTGCAACC

615 п.н.

B.mallei

B.pseudomallei

burk1s

burk4as

AAGCCTGCGAAGGTGCGTTGAAAAGC  CAGTCGCAGCCACCAGTTTATTGCAACC

567 п.н.

B.mallei

B.pseudomallei

b23s5

b23a6

ACAAACAgTCggAgCCTCTTCg

CgCTCTCCTACCATgCgAgACT

666 п.н.

B.mallei

B.pseudomallei

b23s7

b23a8

GCTGCGGATGCGAGCTAGTCT

CCCCCATCGCATCTAACGAC

266 п.н.

B.mallei

B.pseudomallei

b23s7

burk4as

GCTGCGGATGCGAGCTAGTCT

AGTCGCAGCCACCAGTTTATTGCAACC

611 п.н.

B.mallei

B.pseudomallei

burk1s

burk2as

AAGCCTGCGAAGGTGCGTTGAAAAGC

CTTCCAATTGCTCCGCTCCCGAAGGA

351 п.н.

B.mallei

burk3s

burk2as

CGAAGCTGCGGATGCGAGCTAGTCTC

CTTCCAATTGCTCCGCTCCCGAAGGA

399 п.н.

B.mallei

М23-2

CVMP23-1

CACCGAAACTAGCA

CACCGAAACTAGCG

526 п.н.

B.mallei

16S рРНК

Bps16S-U33

Bps16S-OL731

AAGTCGAACGGCAGCACGG

TTTGCTCCCCACGCTTTCG

717 п.н.

B.mallei

B.pseudomallei

fliC

bfl1s

bflas2

ACGGTCTCCGTCGACCTCAC

CGTTGATCTGCGCAACCATC

376 п.н.

B.mallei

B.pseudomallei

burts1

burta2

ACGGCGTGTCGATCCTGCAA

GCCGACCTGGAAGCTCAGCG

242 п.н.

B.mallei

B.pseudomallei

B.thailandensis

orf13

BTTSs1

BTTSas3

GACTGACCGCGCTCAAAGCCG

TCCGGCCTGACAAACGTTTGG

162 п.н.

B.mallei

B.pseudomallei

Для каждой пары праймеров подобраны оптимальные буферные растворы, концентрации дезоксинуклеозидтрифосфатов, ионов Mg2+ и Taq-полимеразы, а также режимы ПЦР. При оптимизации параметров реакции амплификации с ДНК исследуемых буркхольдерий синтезировались чёткие единичные специфические ампликоны (рис.2). Эти результаты соответствовали расчетным данным, которые были получены с помощью компьютерного анализа и свидетельствовали о потенциальной пригодности выбранных нами праймеров для конструирования амплификационных тест-систем с целью идентификации B.pseudomallei и B.mallei.

  1 2 3 4 5 6 7 8 9  10 11 12 13 14 15 16 17 18 19 20 21

Рис. 2. Электрофореграмма продуктов реакции амплификации фрагментов генов 23S рРНК,  fliC и orf13 B. pseudomallei, B. thailandensis и B. mallei.

1,21. Маркер молекулярных масс (леддер 100 -1000 п.н.)

  1. ДНК B. pseudomallei 107, праймеры burts1/burta2 (242 п.н.)
  2. ДНК B. mallei 10230, праймеры burts1/burta2 (242 п.н.)
  3. ДНК B. thailandensis КМ 161, праймеры burts1/burta2 (242 п.н.)
  4. ДНК B. pseudomallei 107, праймеры b23s7/b23a8 (266 п.н.)
  5. ДНК B. mallei 10230, праймеры b23s7/b23a8 (266 п.н.)
  6. ДНК B. mallei 10230, праймеры burk1s/burk2as (351 п.н.)
  7. ДНК B. pseudomallei 107, праймеры bfl1s/bfl2a (376 п.н.)
  8. ДНК B. mallei 10230, праймеры bfl1s/bfl2a (376 п.н.)
  9. ДНК B. mallei 10230, праймеры burk3s/burk2as (399 п.н.)
  10. ДНК B. pseudomallei 107, праймеры burk3s/burk4as (615 п.н.)
  11. ДНК B. mallei 10230, праймеры burk3s/burk4as (615 п.н.)
  12. ДНК B. pseudomallei 107, праймеры b23s7/burk 4as (611 п.н.)
  13. ДНК B. mallei 10230, праймеры b23s7/burk 4as (611 п.н.)
  14. ДНК B. pseudomallei 107, праймеры b23s5/b23a6 (666 п.н.)
  15. ДНК B. mallei 10230, праймеры b23-s5/b23a6 (666 п.н.)
  16. ДНК B. pseudomallei 107, праймеры burk1s/burk4as (567 п.н.)
  17. ДНК B. mallei 10230, праймеры burk1s/burk4as (567 п.н.)
  18. ДНК B. pseudomallei 107, праймеры BTTS-s1/BTTS-as3 (162 п.н.)
  19. ДНК B. mallei 10230, праймеры BTTS-s1/BTTS-as3 (162 п.н.)

При анализе чистых культур наибольшая чувствительность реакции амплификации отмечена с праймерами Burk3s/Burk4as, b23s7/b23a8 и bfl1s/bflas2 (1х102 м.к./мл), а наименьшая с олигонуклеотидными затравками М23-2/CVMP23-1 (1х105 м.к./мл). Чувствительность праймеров Bps16S-U33 /Bps16S-OL731 и b23s7/Burk4as составила 1х104м.к./мл, а остальных исследуемых олигонуклеотидных праймеров - 1х103м.к./мл.

Для повышения чувствительности реакции амплификации нами апробирована 2-х раундовая («гнездовая») ПЦР. В первом раунде использовали праймеры burk3s/burk4as. Во втором раунде реакции для обнаружения возбудителей сапа и мелиоидоза применяли праймеры b23s7/b23a8, фланкирующие фрагмент размером 266 п.н., находящийся внутри участка гена 23S РНК, синтезируемого с помощью праймеров burk3s/burk4as. В результате исследований с помощью «гнездовой» ПЦР на чистых культурах патогенных буркхольдерий удалось повысить чувствительность реакции до 101 м.к./мл.

Однако, при оценке специфичности сконструированных нами праймеров лишь три олигонуклеотидные затравки bfl1s/bfl2a, BTTS-s1/BTTS-as3 и b23s7/b23a8 обеспечивали специфическую детекцию возбудителей сапа и мелиоидоза.  С олигонуклеотидными затравками burts1/burta2 положительный результат  реакции амплификации зарегистрирован с ДНК триады буркхольдерий -  B.mallei, B.pseudomallei и B.thailandensis. При анализе гетерологичных микроорганизмов, в том числе бактерий комплекса B.cepacia и мелиоидозоподобных почвенных микроорганизмов (Ленкоранских штаммов) специфических фрагментов амплификации не выявлено.

На основе этих четырех пар олигонуклеотидных затравок нами сконструированы четыре монолокусные амплификационные тест-системы с детекцией продуктов амплификации методом электрофореза. От всех других пар праймеров нам пришлось отказаться. В отдельных случаях это было обусловлено их относительно низкой чувствительностью, отсутствием специфических ампликонов при анализе ДНК некоторых штаммов B.pseudomallei, а также ввиду наличия ложноположительных результатов при исследовании гетерологичного микроорганизма – B.cepacia, хотя все разработанные праймеры показали свою пригодность при компьютерном анализе. При секвенировании фрагментов, включающих места посадки праймеров, нами выявлено несколько нуклеотидных замен в штаммах B.cepacia 8235 и 3181, которые послужили основой для формирования ложных результатов ПЦР.

При определении специфичности праймеров burk1s/burk2as и burk3s/burk2as нам не удалось дифференцировать с их помощью возбудители сапа и мелиоидоза. Этот вариант реакции обладал только группоспецифической активностью, детектируя все штаммы возбудителя сапа и часть штаммов возбудителя мелиоидоза.

Полученные результаты свидетельствовали о том, что результаты компьютерного анализа и исследования «in silico» целесообразно рассматривать как весомые, но ориентировочные данные, и для пригодности выбранных праймеров всегда необходимы исследования с широким набором как гомологичных, так и гетерологичных видов микроорганизмов.

Для оценки диагностической ценности тест-систем для выявления патогенных буркхолдерий нами проведены комиссионные испытания трех пар праймеров - bfl1s/bfl2a, BTTS-s1/BTTS-as3 и b23s7/b23a8. Материалом для исследования служили 30 проб взвесей чистых культур возбудителей сапа и мелиоидоза - Burkholderia mallei (5 штаммов),  Burkholderia pseudomallei (5 штаммов) с различной концентрацией клеток,  также как и 22 пробы гетерологичных микроорганизмов - B. thailandensis (5 штаммов),  B. сepacia (9 штаммов), Brucella abortus, Brucella  melitensis, Brucella suis, Brucella ovis, Francisella tularensis, Yersinia pestis, Vibrio cholerae, Bacillus anthracis (по одному штамму), 60 проб объектов внешней среды (вода, смывы), искусственно инфицированных Burkholderia mallei и Burkholderia pseudomallei и 46 проб, искусственно инфицированных гетерологичными видами микроорганизмов.

С данными тремя парами праймеров результаты исследований оказались идентичными. Из 30 исследованных проб чистых культур B.mallei и B.pseudomallei в дозах от 1х102 до 1х104 м.к./мл, положительные реакции выявлены в 26 пробах (86,6 %), в том числе при концентрациях не ниже 103 м.к./мл – в 100 % проб. Из 60 исследованных проб объектов внешней среды (вода, смывы), инфицированных B.mallei и B.pseudomallei в дозах от 1х102 до 1х104 м.к./мл, положительные реакции выявлены в 52 пробах (86,6 %), в том числе при концентрациях не ниже 103 м.к./мл – в 100 % проб. При исследовании 23 проб чистых культур гетерологичных микроорганизмов и 46 проб объектов внешней среды (вода, смывы), зараженных гетерологичными микроорганизмами в дозах 1х107м.к./мл, неспецифических (ложноположительных) реакций не выявлено.

Таким образом, три олигонуклеотидные затравки  bfl1s/bfl2a, BTTS-s1/BTTS-as3 и b23s7/b23a8 обеспечивают детекцию трех различных генетических мишеней при идентификации возбудителей сапа и мелиоидоза. Разработанные на их основе амплификационные тест-системы позволяют выявлять 100 % штаммов B.mallei и B.pseudomallei как в пробах чистых культур, так и пробах объектов внешней среды с пороговой чувствительностью 103 м.к./мл.

5. Использование ПЦР для выявления патогенных буркхольдерий при экспериментальной инфекции

При создании амплификационных тест-систем первичный анализ параметров их качества проводится на чистых культурах как гомологичных, так и гетерологичных видов микроорганизмов, а также контаминированных возбудителями пробах из объектов внешней среды. Однако эти результаты не дают возможности объективно оценивать диагностическую эффективность ПЦР при инфекционном процессе, вызванном изучаемыми патогенами.

В связи с этим, сконструированные нами тест-системы прошли апробацию в качестве диагностических средств при моделировании инфекционного процесса, вызванного заражением лабораторных животных как патогенными буркхольдериями, так и B.thailandensis.

При сравнительном анализе эффективности ПЦР и культурального метода выявлено, что реакция амплификации при остром мелиоидозе и сапе оказалась результативнее бактериологического метода. Достоверность различий в диагностической эффективности ПЦР и бактериологического метода (p < 0,01) подтверждено статистическим анализом полученных результатов. Выявление возбудителей с использованием ПЦР оказалось эффективным уже в первые сутки после подкожного заражения вирулентным штаммом B. mallei 10230 и B.pseudomallei 100 (в инкубационном периоде), тогда как с помощью бактериологического метода патогенные буркхольдерии выделяли лишь с 3-их сут заболеваний (рис. 3).

А Б

Рис. 3. Выявление возбудителей сапа и мелиоидоза с острой формой инфекции бактериологическим методом и ПЦР.

Примечание: А – мелиоидоз, Б – сап;  по оси ординат - % положительных  результатов.

В первые сутки наблюдения в реакции амплификации B.pseudomallei обнаруживали в 20 % образцов крови, 40 % образцов лимфатических узлов, в 20 % проб печени и селезёнки и в 10 % образцов легочной ткани, а B.mallei - в  паховых лимфатических узлах (20 %), образцах печени (20 %) и в 20 % образцов крови. На 3 сутки исследования B.pseudomallei обнаруживали во всех исследуемых тканях в 100% случаев,  а B.mallei –  в лимфатических узлах (60%), в образцах печени (80%), селезёнки (60%), лёгких (80%). В крови зараженных животных ДНК возбудителя сапа на 3 сутки регистрировали при анализе 60 % проб, а возбудителя мелиоидоза - в 100 % случаев.

Схожие данные получены R.L.Ulrich с соавторами (2006), которым также удалось обнаружить B. mallei методом ПЦР в легких, селезенке и печени через 24 ч после аэрозольного заражения мышей линии BALB/c.

Известно, что мелиоидоз и сап  могут протекать в различных формах с возможностью перехода из латентного и хронического в острое состояние и обратно. Бактериологический  и биологический методы эффективны для диагностики острого сапа и мелиоидоза, но выделить возбудители при хроническом течении чаще всего не удается (Цветков Н.Е., Черняк В.З., 1947; Беляков В.Д., 1990). Выяснение особенностей персистенции патогенных буркхольдерий нами проведено в условиях хронизации процесса при экспериментальном заражении лабораторных животных. Хроническую форму мелиоидозной инфекции моделировали на морских свинках с помощью аэрогенного заражения низковирулентным штаммом B.pseudomallei 56770 - 99/10 (LD50 составляла 5х105 м.к.) (Алексеев В.В. c соавт., 2000). Для моделирования сапной инфекции с длительным течением использовали ауксотрофный мутант B.mallei Ц-4 1360 со сниженной вирулентностью (LD50 при подкожном заражении для золотистых хомячков составляла 1х107 м.к.) (Шиповская Н.П. с соавт., 1983).

При использовании бактериологического метода на 3 сут после аэрогенного заражения культуру B.pseudomallei выделяли только из лёгких. Во всех остальных исследованных тканях мелиоидозный микроб обнаруживали с 20 сут вплоть до окончания срока наблюдения (38 сут). С помощью ПЦР на 3 сут после заражения, в отличие от бактериологического метода, B.pseudomallei обнаруживали в образцах лёгких, печени и селезёнки. При исследовании образцов крови, печени, селезёнки и лёгких культуральным  методом положительные результаты были получены в 18% проб, а при применении ПЦР - в 33 % случаев.

При сравнительной оценке эффективности бактериологического метода и ПЦР при хронической форме сапа также установлено статистически достоверное различие в диагностической эффективности этих двух методов (p<0,001). С помощью культурального метода сапной микроб обнаруживали лишь в 1 из 200 исследованных проб (0,5 %), в то время как в реакции амплификации ДНК возбудителя сапа детектировали в 75 пробах (37,5%)

Используемые праймеры показали свою пригодность и высокую эффективность при диагностике различных форм инфекций, что явилось основанием для включения ПЦР в схему лабораторной диагностики сапа и мелиоидоза.

При изучении персистенции B.thailandensis в организме зараженных лабораторных животных метод ПЦР, так же как и при подострых формах сапа и мелиоидоза, оказался более эффективным для обнаружения B.thailandensis. От морских свинок, зараженных B.thailandensis аэрогенно, в  реакции амплификации с использованием праймеров  burts1/burta2 положительные результаты  получены в 53 из 75 (70,6%) случаях. С помощью бактериологического метода культура B.thailandensis выделена в 9 из 75 (12%) пробах.

При секвенировании ампликонов, полученных при исследовании объектов внешней среды и проб экспериментального клинического материала, нами выявлена 100 % гомология с ДНК лишь возбудителей сапа и мелиоидоза. Однако для исключения возможных ложноположительных реакций и повышения специфичности идентификационных тестов необходимо использовать две ДНК мишени -  участки 16S рРНК, 23S рРНК и orf13 или fliC. Сочетание реакции амплификации и последующего секвенирования фрагментов этих генов является алгоритмом ускоренной идентификации B.mallei и B. pseudomallei и их дифференциации от близкородственных видов без проведения этапа культивирования микроорганизмов. Учитывая, что проведение идентификации на основе культурально-морфологических и биохимических признаков занимает 2-3 дня, а общее время исследований с помощью молекулярно-генетических методов составляет порядка 9 часов, данный алгоритм вполне оправдан. Аналогичные рекомендации по использованию нескольких ДНК-мишеней (16S рРНК с дополнительным секвенированием гена 23S рРНК или спейсерной области 16S-23S рРНК) предложены и другими авторами для быстрой идентификации возбудителей особо опасных инфекций (Ruppitsch W. et al., 2007).

6. Совершенствование молекулярно-генетических методов внутривидового типирования возбудителей сапа и мелиоидоза

Проблемы, связанные с недостатками фенотипических методов дифференциации штаммов патогенных буркхольдерий стимулировали развитие методов типирования, основанных на исследовании структуры их ДНК.

Для молекулярного типирования штаммов возбудителя мелиоидоза, выделенных из окружающей среды, от человека и животных были использованы такие методы как полиморфизм длины рестрикционных фрагментов (Yap E.H. et al., 1995), риботипирование (Desmarchelier P.M. et al., 1993; Sexton M.M., 1993; Trakulsomboon S. et al., 1997; Inglis T.J.,  et al., 2002; Grif K. et al., 2003 340, 353) и гель-электрофорез в пульсирующем электрическом поле (Vadivelu J. et al., 1997; Koonpaew S. et al., 2000; Cheng A.C. et al., 2005), а также RAPD (Haase A. et al., 1995) и МЛСТ (Godoy D. et al., 2003). Дифференциацию штаммов возбудителя сапа проводили с помощью пульс-электрофореза (Chantratita N. et al., 2006), ДНК-зондирования  (Monastyrskaya G. et al., 2004; Fushan A. et al., 2005) и риботипирования (Harvey S.P., Minter J.M., 2005). Однако, публикаций, касающихся ускоренного определения штаммовой гетерогенности патогенных буркхольдерий крайне мало. По крайней мере, поиск генетических маркеров для быстрого генотипирования штаммов B.mallei продолжается вплоть до настоящего времени.

Учитывая то, что в нашей коллекции отсутствовали штаммы возбудителей сапа и мелиоидоза, выделенные в период каких-либо вспышек заболеваний, в своей работе мы провели сравнительный анализ различных генотипических методов дифференциации коллекционных штаммов B.mallei и B.pseudomallei с целью установления степени сходства изучаемых культур и разработки оптимального алгоритма внутривидового типирования патогенных буркхольдерий. Из методов внутривидовой генетической дифференциации были использованы плазмидный анализ, монолокусное и мультилокусное-сиквенс типирование, схема типирования на основе вариабельных ампликонов, Rep-типирование, VNTR анализ и амплификация с различными произвольными праймерами. 

Все исследуемые методы оказались эффективными для дифференциации штаммов B.pseudomallei, но не для B.mallei, что связано с различной структурной и функциональной организацией геномов этих патогенов (Holden M.T. et al., 2004; Nierman W.C. et al., 2004).

В результате проведенного плазмидного анализа нами оптимизирован метод скрининга плазмидных репликонов и выделено 4 типа штаммов В.pseudomallei, отличающихся по наличию плазмидных репликонов pPM1, рСМ2, рСМ3 и pCM4. В I группу отнесены штаммы, содержащие плазмиду рРМ1, II группу составляют штаммы с плазмидой рСМ2, в III группу входят штаммы рСМ3 и IV группу объединены штаммы с плазмидой pCM4. Плазмиды сохранялись в плазмидсодержащих штаммах в условиях длительного культивирования на питательных средах и пассажах  на лабораторных животных, что свидетельствовало об их стабильном наследовании (Замараев В.С., 2004). На основе собственных и литературных данных (Jigen J., Li L., 1992; Radua S. et al., 2000) плазмидный анализ рекомендован в качестве генотипического метода дифференциации штаммов возбудителя мелиоидоза, в отличие от возбудителя сапа, в штаммах которого не обнаружены внехромосомные факторы наследственности не выявлены. Обнаруженные плазмиды могут выступать в качестве дополнительного критерия генотипической дифференциации штаммов и являться эпидемиологическим маркером в случае возникновении инфекционного процесса, вызванного плазмидсодержащим штаммом B.pseudomallei.

При компьютерном анализе и секвенирования участков генов 16S рРНК, 23S рРНК и fliC  нам необходимо было решить две задачи. С одной стороны, определить консервативные локусы среди различных видов буркхольдерий и гетерологичных микроорганизмов, на основе которых мы конструировали амплификационные тест-системы, а с другой – оценить вариабельность этих генов внутри видов B.mallei и B.pseudomallei. В случае выявления нуклеотидных замен в изучаемых генах, провести типирование патогенных буркхольдерий.  Однако количество таких различий оказалось недостаточным для эффективного разделения штаммов патогенных буркхольдерий ввиду выраженной гомологии геномов возбудителей. В результате кластерного анализа 30-ти штаммов возбудителя мелиоидоза и 16-ти штаммов возбудителя сапа нам  удалось сформировать 3 группы штаммов B. pseudomallei и две группы B. mallei на основе фрагмента гена 16S рРНК. При  сравнении нуклеотидных последовательностей целого гена 16S рРНК B. pseudomallei и B.mallei сформировано 9 и 4 группы штаммов, соответственно. На основе нуклеотидных последовательностей этого гена проведено выделение буркхольдерий в самостоятельный род бактерий (Yabuuchi E. et al., 1992) и B.thaillandensis в отдельный вид (Brett P.J. et al., 1998), а также дифференциация возбудителя мелиоидоза от возбудителя сапа (Gee J.E. et al., 2003), что также было подтверждено при выполнении настоящей работы.

При сравнении секвенированных последовательностей фрагментов 23S рРНК  B. mallei и B. pseudomallei не  обнаружено ни внутривидовых, ни межвидовых отличий, за исключением двух штаммов возбудителя мелиоидоза, выделенных в отдельную кластерную группу. Лишь при сравнении целого гена выявлены три нуклеотидные замены, на основе которых возможна дифференциация между собой этих двух видов микроорганизмов (Bauernfeind A. et al., 1998).  Различий в нуклеотидных последовательностях fliC генов было еще меньше. При формировании 4 кластерных групп, образованных обоими видами буркхольдерий, штаммы возбудителя сапа вошли в одну группу с B.pseudomallei.

Малое количество вариабельных последовательностей внутри выбранных генов патогенных буркхольдерий свидетельствовало о низкой эффективности этих ДНК-мишеней для генотипирования штаммов возбудителей сапа и мелиоидоза, а также определяло необходимость использования дополнительных методов дифференциации. Одним из таких методов является метод  мультилокусного секвенс-типирования, впервые предложенный D. Godoy с соавторами  (Godoy D. et al., 2003) для генотипирования возбудителя мелиоидоза. Разрешающая способность МЛСТ нами оценена при анализе двух коллекционных штаммов B. mallei 10230 и V-120 и трех штаммов B. pseudomallei 100, С-141 и 107. Классификацию аллельного профиля изучаемых штаммов B.pseudomallei и B.mallei проводили путем сравнения полученных нами сиквенсов с известной базой данных МЛСТ (http://www.bpseudomallei.mlst.net) на странице Burkholderia. Распределение аллелей исследуемых штаммов B. mallei и B.pseudomallei представлено в таблице 2.

Таблица 2

Характеристика исследуемых штаммов патогенных буркхольдерий

по сиквенс-типу

Штаммы

СT

Локусы

ace

gltB

gmhD

lepA

lipA

narK

ndh

B.pseudomallei 107*

51

3

1

2

3

1

4

3

B.pseudomallei 100*

219

3

2

2

1

1

2

1

B.pseudomallei С-141*

162

3

1

4

3

1

4

1

B.pseudomallei 7641**

1

1

1

1

2

4

2

1

B.pseudomallei Cam70**

2

1

1

2

4

1

1

1

B.pseudomallei SID5278**

3

1

1

2

2

5

3

1

B.mallei 10230*

40

1

12

3

4

1

18

1

B.mallei V120 *

40

1

12

3

4

1

18

1

B.mallei NCTC 10248**

40

1

12

3

4

1

18

1

B.mallei NCTC 10260**

40

1

12

3

4

1

18

1

B.mallei NCTC 10245**

40

1

12

3

4

1

18

1

Примечание -  *  - результаты получены в настоящем исследовании

** - результаты приведены в работе D.Godoy с соавторами (176)

Как следует из представленной таблицы, штаммы  возбудителя мелиоидоза имели различные СТ (сиквенс-типы), что позволяло их дифференцировать друг от друга, в отличие от штаммов B. mallei, которые имели одинаковый 40 СT.

Использование этой технологии и алгоритма BURST (Based Upon Related Sequence Types) (Feil J.E. et al., 2004) позволило установить, что авирулентный штамм B.pseudomallei 107 с неизвестным источником выделения, который получен нами от A. Bremmelgaard  и числящийся в ее коллекции как атипичный штамм возбудителя мелиоидоза (Bremmelgaard A., 1975), принадлежит, наряду с  анализируемыми B. pseudomallei 100 и B. pseudomallei С-141 к клональным комплексам штаммов Юго-Восточной Азии (рис. 4).

Рис. 4. Диаграмма различных СТ штаммов B.pseudomallei, выделенных в Юго-Восточной Азии (Алгоритм BURST).  Стрелками отмечены СТ штаммов из коллекции ВолгоградНИПЧИ.

Полученные нами результаты и литературные данные свидетельствуют, с одной стороны, о значительно большей генетической однородности B. mallei  (Godoy D. et al., 2003), а с другой, что метод МЛСТ недостаточно эффективен для внутривидового типирования возбудителя сапа и может быть использован лишь для дифференциации штаммов B. pseudomallei.

Оценка схемы типирования на основе амплификации вариабельных ампликонов (Variable Amplicon Typing Scheme), предложенной K. Duansonk с соавторами (2006), нами проведена на 18 штаммах возбудителя мелиоидоза и 4 штаммах возбудителя сапа из коллекции ВолгоградНИПЧИ.

В ходе эксперимента при анализе вариабельных продуктов амплификации (VAT), в зависимости от используемых праймеров и анализируемых штаммов, зарегистрировано от 3 до 9 фрагментов ДНК размерами от 132 до 788 п.н. Исследуемые 18 штаммов возбудителя мелиоидоза по наличию вариабельных ампликонов разделены на 13 VAT типов (рис.5). Большинство вариабельных локусов, выявленных с помощью субтрактивной гибридизации и на основе которых проводится типирование штаммов возбудителя мелиоидоза (Duangsonk K. et al., 2006), отсутствуют в геномах секвенированных штаммов B.mallei, поэтому нам не удалось разделить штаммы возбудителя сапа на различные генетические группы.

Рис. 5. Кластерный анализ VAT профилей штаммов возбудителя мелиоидоза.

Генетическая гетерогенность B.mallei была оценена нами методами рестрикционного анализа в формате пульс-электрофореза, VNTR-анализа и амплификации с произвольными праймерами, результаты которых позволили провести эффективную внутривидовую дифференциацию штаммов возбудителя сапа.

С помощью ПЭФ все исследуемые 14 штаммов возбудителя сапа разделены на 13 кластерных групп (90 % сходства). На уровне 92 % сходства каждый штамм B.mallei формировал уникальную кластерную группу (рис. 6).

Рис. 6. Электрофореграмма Xba I рестрикционных фрагментов ДНК и дендрограмма сходства штаммов B. mallei.  ПЭФ в 1% агарозном геле с окраской ДНК этидиумом бромидом. 

Амплификация с произвольными праймерами (метод RAPD) является одним из наиболее простых способов дифференциации штаммов. Данный метод использован для многих микроорганизмов, в том числе B.pseudomallei (Haase A. et al., 1995; Leelayuwat C. et al., 2000). Для генотипирования штаммов B.mallei этот методический прием не применяли.

Практически во всех цитируемых работах отмечено, что метод амплификации с произвольными праймерами требует не только строгой стандартизации подготовки культур, но и условий проведения ПЦР и электрофореза. Для получения высокоинформативных и воспроизводимых ДНК-профилей нами первоначально оптимизированы параметры реакции амплификации - отработаны температурные режимы ПЦР, определены необходимые концентрации праймеров, исследуемой ДНК, Taq-полимеразы, а также режимы электрофоретического разделения фрагментов амплификации.

Детекцию фрагментов, как и в случае ПЭФ, осуществляли в автоматическом режиме программы RFLPscan 3.12 из пакета программ Gene Profiler 4.03  (CSP Inc., USA). Кластерный анализ и графическое отображение матриц коэффициентов сходства проводили при помощи программы TreeCon for Windows v.1.3b. Группирование штаммов и построение дендрограмм проводили при помощи невзвешенного парно-группового метода UPGMA (Sneath P.H., Sokal R.R., 1973).

Из 19 проанализированных нами произвольных олигонуклеотидных затравок, для дифференциации штаммов патогенных буркхольдерий  экспериментально подобран набор праймеров, показавших наибольшую эффективность (табл. 3). Каждые из олигонуклеотидов или их комбинаций давали возможность обнаружить специфические микролокусы в геномах штаммов, которым свойственна различная степень нуклеотидной изменчивости на внутривидовом уровне.

Таблица 3

Набор произвольных праймеров для дифференциации штаммов возбудителей сапа и мелиоидоза методом RAPD

№ п/р

Обозначение

Последовательность

Автор

1

RA

GTTTCGCTCC

(Wongratanacheewin S., 2000)

2

Jeffreys

GGAGGTGGGCAGGAXG

(Jeffreys A.J., 1985)

3

Rep

CGACGCAGGC

(Liu Y., 2002)

4

PR 6

GAGACGCACA

(Haase A., 1995)

5

PR 7

CAGCCCAGAG

(Haase A., 1995)

6

PR 13

AGCGTCACTC

(Haase A., 1995)

7

PR 16

AAGCGACCTG

(Haase A., 1995)

При анализе электрофоретических профилей ДНК 14 штаммов возбудителя сапа выявлены схожие RAPD-паттерны, которые, независимо от используемых праймеров, имели коэффициент подобия более 75 %, что доказывало высокую степень однородности изучаемых штаммов B.mallei. Анализ электрофоретических RAPD - паттернов штаммов B.pseudomallei и B.thailandensis показал их более высокую полиморфность по сравнению со штаммами возбудителя сапа. Данная закономерность вполне объяснима  с позиций формирования адаптационной и генетической изменчивости у этой триады  буркхольдерий. Кроме того, размер геномов  B. pseudomallei и B.thailandensis превышает размер генома B. mallei, что также может влиять на количество RAPD-фрагментов на электрофореграммах.

Нами выявлено, что практически любой из праймеров пригоден для видовой дифференциации патогенных буркхольдерий. Однако в зависимости от праймеров формировалось различное количество и состав кластерных групп. Образованные кластерные группы отражали гетерогенность популяций патогенных буркхольдерий, при которой каждый штамм имел свой характерный RAPD-тип. Анализ штаммов, проведенный внутри каждого кластера в отдельности, показал, что при использовании разных праймеров формируются независимые группы.

Для проведения внутривидового типирования штаммов возбудителя сапа наиболее эффективны оказались праймеры Jeffreys, PR 6, PR 7 и RA, в то время как для для возбудителя мелиоидоза – олигонуклеотидные затравки PR 7, PR 16, PR 13, RA и Rep. При суммировании результатов RAPD-типирования и формировании единой матрицы сходства с использованием всего набора исследуемых праймеров каждый штамм B.mallei и B.pseudomallei формировал уникальную кластерную группу, соответственно количеству исследуемых штаммов, отражая гетерогенность популяций возбудителей сапа и мелиоидоза (рис.7).

Рис. 7. Дендрограмма сходства штаммов патогенных буркхольдерий с использованием набора произвольных праймеров

Детальный анализ геномов различных микроорганизмов, в том числе  B. pseudomallei и B. mallei позволил обнаружить многочисленные повторяющиеся последовательности. Одними из них являются вариабельные тандемные повторы, лежащие в основе VNTR-анализа (Keim P. et al., 2000; Farlow J. et al., 2001;  Сучков И. Ю. с соавт., 2004; Цыганкова О. И. с соавт., 2006). У патогенных буркхольдерий впервые тандемный повтор  размером 10 п.н., обнаружен при анализе штамма B.pseudomallei ATCC 23343 (Liu Y. et al., 2002).

В настоящем разделе работы была рассмотрена возможность использования VNTR-анализа для генотипирования коллекционных штаммов патогенных буркхольдерий. Амплификацию VNTR-локусов возбудителей сапа и мелиоидоза проводили с помощью праймеров SR1/SR5 (Liu Y. et al., 2002).

В результате амплификации во всех исследуемых штаммах возбудителей сапа и мелиоидоза синтезировались фрагменты ДНК размером от 422 до 692 п.н. (рис. 8).

1  2 3 4 5 6 7  8 9  10  11  12  13  14 15  16  17  18  19  20

Рис. 8. Электрофореграммы продуктов амплификации штаммов патогенных буркхольдерий с праймерами SR1/SR5.

На основе различий в размерах полученных ампликонов при анализе 6 штаммов В.pseudomallei и 11 штаммов В. mallei нами идентифицировано 11 аллелей (VNTR-типов). Шесть штаммов B.pseudomallei разделены на 5 аллелей. Среди 11-ти штаммов B.mallei идентифицировано 8 аллелей с различным числом тандемных повторов. Причем, два аллеля были общими для B.mallei и B.pseudomallei.

Стабильность тандемных повторов для каждого штамма и отсутствие изменений нуклеотидных последовательностей в этом генетическом локусе после пассажей на животных, как отмечено в работе Y. Liu с соавторами (2002), свидетельствует о возможности использования данного генетического маркера в VNTR анализе B.mallei и B.pseudomallei. При этом, амплификационная тест-система с праймерами  SR1/SR2 пригодна для простого, быстрого и высокоспецифичного ПЦР-типирования штаммов патогенных буркхольдерий.

Обобщая полученные результаты необходимо отметить, что в основу алгоритма генодиагностики и генотипирования патогенных буркхольдерий нами был заложен принцип дифференцированного подхода к выбору наиболее информативного метода или сочетаний молекулярно-генетических методов. Это позволило разработать единую схему идентификации и типирования B.mallei и B.pseudomallei (рис.9).

Рис. 9. Схема генетической идентификации и типирования B.mallei и  B.pseudomallei.

В данной схеме ПЦР-скрининг предполагает использование амплификационных тест-систем со специфическими праймерами bfl1s/bfl2a, BTTS-s1/BTTS-as3 и b23s7/b23a8 для детекции B.mallei и B.pseudomallei. Алгоритм генодиагностики и генотипирования патогенных буркхольдерий, включает на этапе идентификации культур реакцию амплификации и секвенирование ампликонов. Для дифференциации штаммов возбудителя мелиоидоза пригодны все используемые в работе генетические методы. Однако для ускоренного генотипирования B.pseudomallei целесообразно использовать различные варианты ПЦР-типирования (VAT, RAPD, Rep-ПЦР, VNTR).  К этому следует добавить, что для дифференциации штаммов B.mallei эффективны ПЭФ, VNTR и RAPD, но быстрое генетическое типирование штаммов возбудителя сапа обеспечивают метод анализа тандемных повторов и амплификация с произвольными праймерами.

Выводы

  1. Оценена сравнительная эффективность молекулярно-биологических методов идентификации и внутривидовой дифференциации штаммов B. mallei и B. pseudomallei. Предложена схема лабораторной диагностики сапа и мелиоидоза с включением ПЦР как на этапе идентификации чистых культур, так и анализа проб клинического материала и объектов внешней среды. Сформирована единая система генодиагностики и генотипирования патогенных буркхольдерий.
  1. На основе нуклеотидных последовательностей генов, детерминирующих  23S рРНК, флагеллярного гена fliC и orf гена III типа секреции, определены олигонуклеотидные праймеры, подобраны оптимальные условия,  определены параметры проведения ПЦР и сконструированы амплификационные тест-системы для идентификации патогенных буркхольдерий, позволяющие выявлять возбудителей сапа и мелиоидоза в концентрациях 1х102 -1х103 м.к./мл.
  1. Показано, что использование олигонуклеотидных праймеров burts1/burta2, сконструированных на основе флагеллярного гена fliC, позволяет идентифицировать три вида буркхольдерий B.pseudomallei, B.mallei и B.thailandensis при анализе чистых культур и обнаруживать B.thailandensis в пробах экспериментального клинического материала при моделировании инфекционного процесса.
  1. Для повышения специфичности идентификационных тестов необходимо использовать ПЦР с диагностическими праймерами, сконструированными на различные ДНК-мишени. Показано, что сочетание реакции амплификации и секвенирование ДНК мишеней -  участков 16S рРНК и 23S рРНК, orf13 или fliC является алгоритмом быстрой идентификации B. mallei и B. pseudomallei и их дифференциации от близкородственных видов микроорганизмов.
  1. Установлено, что эффективными фенотипическими методами дифференциации штаммов возбудителя мелиоидоза являются фаготипирование и анализ белкового спектров, в то время как проведение внутривидового типирования штаммов B.mallei  возможно на основе различий в спектре суммарных клеточных белков. Тесты, основанные на выявлении вариабельных биохимических признаков и различий в чувствительности к антибиотикам выступают лишь в качестве дополнительных критериев внутривидовой дифференциации штаммов патогенных буркхольдерий.
  1. На основе плазмидного анализа выявлено 4 группы штаммов В.pseudomallei, отличающихся по составу и размеру плазмидных репликонов. Показано, что обнаруженные плазмиды могут выступать в качестве дополнительного критерия генотипической дифференциации штаммов и являться  эпидемиологическим маркером в случае возникновении инфекционного процесса, вызванного плазмидсодержащим штаммом B.pseudomallei.
  1. Показана высокая эффективность метода мультилокусного сиквенс-типирования для дифференциации штаммов возбудителя мелиоидоза, позволившего установить, что анализируемые штаммы B.pseudomallei 100, С-141, а также B.pseudomallei 107 с неизвестным источником выделения, относятся к Юго-Восточной группе. Все исследуемые штаммы B. mallei формируют единый 40 сиквенс-тип, входящий в клональный комплекс штаммов B. pseudomallei.
  1. Отработаны условия проведения рестрикционного анализа ДНК штаммов возбудителя сапа, оценена их генетическая гетерогенность  и показана высокая эффективность метода пульс-электрофореза для внутривидового генетического типирования штаммов B.mallei. На основе полиморфизма длин рестрикционных фрагментов 14 штаммов возбудителя сапа с помошью кластерного анализа разделены на  13 генетических групп.
  1. Показана высокая эффективность RAPD-типирования для дифференциации штаммов патогенных буркхольдерий. Предложен набор олигонуклеотидных затравок, обозначенных Jeffreys, PR 6, PR 7 и RA для проведения внутривидового типирования штаммов возбудителя сапа и праймеров PR 7, PR 16, PR 13, и RA – для возбудителя мелиоидоза.
  1. Выявлена эффективность схемы типирования, основанной на анализе вариабельных ампликонов, для ускоренной генетической дифференциации штаммов возбудителя мелиоидоза, в отличие от штаммов B.mallei, в геномах которых вариабельные ампликоны не выявлены. С помощью ПЦР-типирования 18 штаммов возбудителя мелиоидоза разделены на 13 генетических группп (VAT типов).
  1. Установлена пригодность праймеров, фланкирующих тандемные повторы в гене, детерминирующем эстеразу патогенных буркхольдерий, для простого, быстрого и высокоспецифичного ПЦР-типирования штаммов возбудителей сапа и мелиоидоза. С помощью VNTR анализа среди 11 штаммов B.mallei идентифицировано 8 аллелей с различным числом тандемных повторов, в то время как шесть штаммов B.pseudomallei разделены на 5 аллелей.
  1. Показано, что алгоритм быстрой дифференциации штаммов B.pseudomallei включает методы ПЦР-типирования, основанные на анализе вариабельных ампликонов и количества тандемных повторов, амплификации ДНК с произвольными праймерами и Rep-ПЦР, в то время как быстрое генетическое типирование штаммов B.mallei обеспечивают VNTR-анализ и амплификация с произвольными праймерами.

Список работ, опубликованных по теме диссертации

  1. Генетика возбудителя мелиоидоза / Меринова Л.К.,  Гришкина Т.А., Тарасова Т.Д., Антонов В.А. // Мелиоидоз (под ред. акад. Н.Г.Тихонова).- 1995.- Волгоград.- С. 26-47.
  2. Антонов В.А., Замараев В.С., Захарова И.Б. Плазмиды возбудителя  мелиоидоза // Экологоэпидемический надзор за природно-очаговыми инфекциями в Северном  Прикаспии: Тез. науч.  конф.,  посвящ.  95-летию Астраханской ПЧС, Астрахань, 1996.- С.107.
  3. Антонов В.А.,  Замараев В.С., Захарова И.Б. Изучение гомологии  плазмид  возбудителя мелиоидоза // Там же.- С.103.
  4. Антонов В.А., Замараев  В.С., Меринова Л.К.  Мобилизация криптических плазмид Pseudomonas pseudomallei в гетерологичные виды микроорганизмов // Там же.- С.99.
  5. Денисов И.И., Андрус В.Н., Антонов В.А. Адаптация псевдомонад,  имеющих клиническое значение к дезинфектантам // Там же.- С.101.
  6. Илюхин В.И., Антонов В.А., Гришкина Т.А. Таксономическая позиция патогенных псевдомонад // Мат. VII съезда Всероссийского общества эпидемиологов, микробиологов и паразитологов, 28-31 января 1997, Москва. - 1997.- С.201-202.
  7. Антонов В.А., Меринова Л.К., Замараев В.С, Викторов Д.В. Анализ фенотипических свойств штаммов возбудителя сапа, несущих криптические плазмиды Pseudomonas pseudomallei // Мат. науч.-практ. конф., посвящ. 100-летию образования противочумной службы России, 16-18 сентября 1997, Саратов, 1997.- C.6-7.
  8. Замараев В.С., Антонов В.А. Плазмиды Pseudomonas pseudomallei // Мат. науч.-практ. конф., посвящ. 100-летию образования противочумной службы России, 16-18 сентября 1997, Саратов, 1997.- C.49-50.
  9. Антонов В.А., Меринова Л.К., Замараев В.С., Агеева Н.П., Викторов Д.В. Фенотипические свойства возбудителей сапа и мелиоидоза, содержащих плазмидные репликоны // Проблемы санэпид охраны территории стран СНГ: Тез. науч. практич. конф., 15-17 сентября, 1998.- Саратов, 1998.- С.174-176.
  10. Антонов В.А., Замараев В.С., Илюхин В.И. Группоспецифический ДНК-зонд для идентификации патогенных псевдомонад // Биотехнология .- 1998.-N5.- С.75-84.
  11. Антонов В..А., Меринова Л.К., Викторов Д.В., Замараев В.С., Захарова И.Б., Ткаченко Г.А. Влияние R-плазмид на отдельные фенотипические признаки штаммов возбудителя сапа и мелиоидоза // Диагностика, лечение и профилактика опасных инфекционных заболеваний. Биотехнология.Ветеринария: Мат. юбилейной науч. конф., посвящ. 70-летию НИИ микробиологии МО РФ, 30 ноября -1 декабря 1998, Киров, 1998.- C.48-49.
  12. Захарова И.Б., Замараев В.С., Антонов В.А., Ткаченко Г.А. Конструирование интегративного вектора на основе ColE1-репликона для клонирования в Burkholderia pseudomallei // Там же.- C.48-49.
  13. Замараев В.С., Антонов В.А., Илюхин В.И., Захарова И.Б. Выделение и первичная характеристика плазмид Pseudomonas (Burkholderia) pseudomallei // Мол.  генет. микробиол. вирусол.- 1998.- N4.- С.28-33.
  14. Vicktorov D.V., Piven N.N., Zakharova I.B., Plekhanova N.G., Antonov V.A. Melioidosis vaccine: some approaches to development / First Global Conference on Vaccines and Immunisation into the next millennium.6th-9 th September 1999, Manchester, UK, 1999, р.47-48
  15. Антонов В.А., Замараев В.С., Меринова Л.К., Илюхин В.И. Burkholderia mallei  как хозяин плазмид возбудителя мелиоидоза // Scientific Journal.- 1999.- №7.- р.225-226.
  16. Антонов В.А., Замараев В.С., Меринова Л.К.,  Захарова И.Б., Ткаченко Г.А, Бахтояров Г.Н., Клонирование фрагментов криптической плазмиды возбудителя мелиоидоза // Проблемы медицинской и экологической биотехнологии: Тез. докл. юбилейной науч. конф., посвящ. 25-летию ГНЦ прикладной микробиологии, 14-15 декабря 1999, Оболенск, 1999.- С.8. 
  17. Антонов В.А., Меринова Л.К., Викторов Д.В., Ткаченко Г.А., Бахтояров Г.Н. Влияние плазмиды RP1::Tn10 на чувствительность клеток сапного микроба к мелиоидозному бактериофагу // Там же.- С.9.
  18. Захарова И.Б., Замараев В.С., Антонов В.А. Физическое картирование криптической плазмиды рРМ1 возбудителя мелиоидоза // Проблемы особо опасных инфекций.- 1999.- Вып.79.- С.159-162.
  19. Ткаченко Г.А., Антонов В.А., Бахтояров Г.Н. Плазмиды возбудителя мелиоидоза // Тез. конф. молодых ученых Поволжья и Северного Кавказа, 15-17 февраля, 2000.- Нижний Новгород, 2000.- С. 81.
  20. Меринова Л.К., Антонов В.А., Замараев В.С., Викторов Д.В. Мобилизация криптических плазмид возбудителя мелиоидоза в гетерологичные виды микроорганизмов // Мол. генет. микробиол. вирусол.- 2000.- N2.- С.37-40.
  21. Антонов В.А., Илюхин В.И., Замараев В.С., Трушкина М.Н. Использование плазмид возбудителя мелиоидоза в качестве ДНК-зондов для идентификации близкородственных микроорганизмов // Биотехнология .- 2000.-N4.- С.8-14.
  22. Антонов В.А., Замараев В.С., Захарова И.Б., Меринова Л.К., Викторов Д.В., Попов С.Ф. Изучение плазмид патогенных буркхолдерий // Природно-очаговые инфекции в Нижнем Поволжье: Сб.науч. тр. (под ред. Н.Г. Тихонова).- Волгоград: Изд-во «Принт», ВолГУ, 2000.- С.41-46.
  23. Илюхин В.И., Кисличкин Н.Н., Тихонов Н.Г., Плеханова Н.Г., Денисов И.И., Кисличкина И., Антонов В.А., Пивень Н.Н., Викторов Д.В., Фарбер С.М. Перспективы применения Francisella tularensis 15 (LVS) для гетерологичной иммунизации и создания поливалентных рекомбинантных вакцин // Там же. - С.100-106.
  24. Antonov V.A., Zamaraev V.S., Zakharova I.B., Ilyukhin V.I. Discovery of resident plasmids among pathogenic species of Burkholderia // Scientific Journal.- 2000.- №8.- р.135-137.
  25. Илюхин В.И., Будченко А.А., Антонов В.А., Сеимова И.К., Трушкина М.Н. Внутривидовое типирование штаммов возбудителей сапа и мелиоидоза // Методические документы и отчеты по санитарно-эпидемиологической охране территории Российской Федерации. Реферативный сборник (под  ред.В.В.Кутырева).- Саратов, 2000.- С.32-33.
  26. Антонов В.А., Замараев В.С., Захарова И.Б., Илюхин В.И., Бахтояров Г.Н., Ткаченко Г.А., Алексеева В.В., Зинченко О.В. Использование плазмидного анализа для внутривидового типирования возбудителя мелиоидоза // Природно-очаговые особо опасные инфекции на Юге России, их профилактика и лабораторная диагностика: Сб. науч. тр.- Астрахань, 2001.- С.273-275.
  27. Будченко А.А., Илюхин В.И., Антонов В.А., Сеимова И.К., Трушкина М.Н., Меринова Л.К., Замараев В.С., Сенина Т.В. Изучение стабильности признаков, используемых для внутривидового типирования патогенных буркхолдерий // Там же.- С.276-278.
  28. Ткаченко Г.А., Антонов В.А. Замараев В.С., Илюхин В.И., Алексеева В.В., Зинченко О.В., Использование метода ПЦР для идентификации возбудителя мелиоидоза // Там же.-  С.328-330.
  29. Ilyukhin V.I., Senina T.S., Plekhanova N.G., Antonov V.A., Merinova L.K., Tkatchenko G.A., Zamaraeva S.V., Alekseeva V.V. Biological properties and differentiation of pathogenic species of genus Burkholderia // Natural infectious diseases. Abstract of scientific conference. 6 December, 2001, Ulaanbaatar, Mongolia, 2001.- P.33-36.
  30. Tkatchenko G.A., Antonov V.A., Zamaraev V.S., Ilyukhin V.I, Alekseeva V.V., Zintchenko O.V. Detection and identification of Burkholderia mallei and Burkholderia pseudomallei by PCR // Ibid.- P.68-70.
  31. Илюхин В.И., Сенина Т.В., Плеханова Н.Г., Антонов В.А., Меринова Л.К., Сеимова И.К. Burkholderia thailandensis: биологические свойства, идентификация и таксономическая позиция  // Мол. генет. микробиол. вирусол.- 2002.- N1.- С7-11.
  32. Ткаченко Г.А., Антонов В.А., Замараев В.С., Илюхин В.И., Алексеева В.В., Зинченко О.В. Идентификация патогенных буркхольдерий методом ПЦР // Мат. VIII съезда Всероссийского общества эпидемиологов, микробиологов и паразитологов, 26-28 марта 2002, Москва, 2002.- С.347-348.
  33. Антонов В.А., Ткаченко Г.А., Замараев В.С., Алексеева В.В., Илюхин В.И. Применение ПЦР при экспериментальном сапе // Технологии генодиагностики в практическом здравоохранении: Сб. тр. научн.-практ. симпозиума в рамках Международной конф.«Геномика, протеомика и биоинформатика для медицины», 20-21 июня 2002, Москва, 2002.-С.310-312.
  34. Антонов В.А., Ткаченко Г.А., Алексеева В.В., Замараев В.С., Илюхин В.И., Трофимов Д.Ю. Использование ПЦР для идентификации патогенных буркхольдерий // Генодиагностика инфекционных заболеваний: Мат. IV Всеросс. научн.-практ. конф., 22-24 октября 2002 г., Москва, 2002.- С.258-259.
  35. Антонов В.А., Ткаченко Г.А., Алексеева В.В., Замараев В.С., Илюхин В.И., Трофимов Д.Ю. Оценка возможности использования двух пар праймеров для идентификации возбудителей сапа и мелиоидоза и дифференциации от Burkholderia thailandensis // Там же.- С.259-260.
  36. Ткаченко Г.А., Антонов В.А., Замараев В.С., Алексеева В.В., Тихонов Н.Г. Идентификация патогенных буркхольдерий методом ПЦР // Гомеостаз и инфекционный процесс: Тез. докл. III Общеросс. конф.с международным участием, 14-16 мая 2002 г., Сочи, 2002.- С.106.
  37. Антонов В.А., Ткаченко Г.А., Алексеева В.В., Замараев В.С., Илюхин В.И. Использование полимеразной цепной реакции для идентификации возбудителей сапа и мелиоидоза // Карантинные и зоонозные инфекции в Казахстане.- 2002.- Вып 5.- С.22-25.
  38. Антонов В.А., Гришкина Т.А., Замараев В.С., Илюхин В.И. Влияние температуры культивирования на внехромосомные факторы наследственности возбудителя мелиоидоза // Журн. микробиол. эпидемиол. иммунобиол.- 2003.- N2.- С.3-7.
  39. Ткаченко Г.А., Антонов В.А., Замараев В.С., Илюхин В.И. Идентификация возбудителей сапа и мелиоидоза с помощью полимеразной цепной реакции // Мол. генет. микробиол. вирусол.- 2003.- N3.- С7-11.
  40. Антонов В.А., Алтухова В.В., Ткаченко Г.А , Бахтояров Г.Н., Будченко А.А., Замараев В.С., Илюхин В.И. Молекулярно-биологические методы внутривидового типирования штаммов возбудителей сапа и мелиоидоза // Современные технологии в диагностике особо опасных инфекционных болезней: Мат. IV межгосударственной науч.- практ. конф. Государств стран СНГ, 30 сентября-2 октября 2003 г., Саратов.- 2003.- С.17-19.
  41. Антонов В.А., Замараев В.С., Ткаченко Г.А., Алтухова В.В., Илюхин В.И. Некоторые аспекты эпидемиологического надзора и профилактики возникновения мелиоидоза на территории России // Там же.- С.19-21.
  42. Замараев В.С., Антонов В.А., Ткаченко Г.А., Алтухова В.В., Илюхин В.И. ПЦР-диагностика патогенных буркхольдерий // Там же.- С.62-63.
  43. Малахаева А.Н., Саяпина Л.В., Тихвинский М.С., Осина Н.А., Шарова И.Н., Анисимова Т.И., Адамова Г.В., Касина И.В., Савельев В.Н., Еременко Е.И., Замараев В.С., Антонов В.А. Характеристика реагентов для подготовки проб возбудителей особо опасных инфекций к анализу методом ПЦР в государственных испытаниях  // Там же.- С.109-110.
  44. Алексеева В.В., Антонов В.А., Ткаченко Г.А., Замараев В.С., Будченко А.А. Использование произвольных праймеров (RAPD) для внутривидового типирования штаммов возбудителя сапа // Карантинные и зоонозные инфекции в Казахстане.- 2003.- Вып. № 1 (7).- С.49-51.
  45. Алтухова В.В., Пименов Е.В., Алексеев В.В.,Чухланцев Д.А., Парамонов И.В., Маракулин И.В., Дармов И.В., Антонов В.А., Замараев В.С., Ткаченко Г.А., Илюхин В.И. Оценка возможности применения нескольких пар праймеров для идентификации патогенных буркхольдерий // Сб. науч. тр., посвящ. 75 - летию НИИ микробиологии МО РФ, Киров.- 2003.- С.20.
  46. Антонов В.А., Пименов Е.В., Алексеев В.В., Чухланцев Д.А., Парамонов И.В., Маракулин И.В., Дармов И.В., Замараев В.С., Ткаченко Г.А., Алтухова В.В., Илюхин В.И. Разработка амплификационной тест- системы для идентификации возбудителей сапа и мелиоидоза // Там же.-  С.21-22.
  47. Антонов В.А., Ткаченко Г.А., Алтухова В.В., Замараев В.С., Илюхин В.И., Трофимов Д.Ю. Использование ПЦР для идентификации Burkholderia mallei // Мол. генет. микробиол. вирусол.- 2004.- N1.- С12.
  48. Онищенко Г.Г., Федоров Ю.М., Жилина Н.Я., Субботин В.Г., Алексеев В.В., Липницкий А.В., Метлин В.Н., Прохватилова Е.В., Храпова Н.П., Лобанов А.Н.. Пашанина Т.П., Илюхин В.И., Батманов В.П., Лозовая Н.А., Лесовой В.С., Пучков В.С., Погасий Н.И., Кулаков М.Я., Андрус В.Н., Сухов В.В., Савченко С.Т., Замараев В.С., Антонов В.А., Тихонов С.Н., Плеханова Н.Г., Алтухова В.В., Перепелицына С.В., Кивокурцева Т.Ю., Попов С.Ф., Быкова О.И., Плешакова Т.В., Новицкая И.В., Викторов Д.В., Захарова И.Б., Сенина Т.В., Шумилов П.К., Жуков А.Н., Чайка А.Н // Практическое пособие для подготовки врачей-бактериологов и эпидемиологов по вопросам противодействия биотерроризму. – Волгоград, изд-во «Радуга», 2004.- 236 с.
  49. Алтухова В.В., Антонов В.А., Ткаченко Г.А., Плеханова Н.Г., Бахтояров Г.Н., Савченко С.С., Замараев В.С., Илюхин В.И. Генодиагностика сапа и мелиоидоза // Человек и лекарство: Мат. XI Рос. нац. конгресса, 19-23 апреля 2004 г., Москва, 2004.- С.417.
  50. Алтухова В.В., Антонов В.А., Ткаченко Г.А., Замараев В.С., Плеханова Н.Г., Илюхин В.И. Использование ПЦР для изучения особенностей течения мелиоидозной инфекции // Медицинская микробиология - ХХI век: Мат.Всерос. науч.- практ. конф. – Саратов, 2004. - С.20-22.
  51. Бахтояров Г.Н., Антонов В.А., Замараев В.С., Ткаченко Г.А. Использование плазмидного анализа для внутривидового типирования штаммов буркхольдерий // Там же.- С.30-32.
  52. Алтухова В.В., Антонов В.А., Голосеев Ю.А., Васильев В.П., Пивень Н.Н. Оценка возможности применения полиакриламидного дискового сорбента для обнаружения возбудителя мелиоидоза методом ПЦР // Генодиагностика инфекционных болезней: Сб. тр. V Всерос. науч.-практ. конф., 19-21 октября, Москва,  2004.- Т.2.- С.156-157.
  53. Антонов В.А., Алтухова В.В.,  Савченко С.С.,  Будченко А.А., Замараев В.С., Илюхин В.И., Алексеев В.В. Оценка эффективности использования различных систем праймеров для проведения внутривидового типирования штаммов возбудителей сапа и мелиоидоза // Там же.- С.158-159.
  54. Антонов В.А., Алексеев В.В., Липницкий А.В., Замараев В.С., Ткаченко Г.А, Алтухова В.В., Савченко С.С., Лесовой В.С., Гришина М.А. Стратегия и тактика конструирования амплификационных тест-систем для идентификации патогенных буркхольдерий и возбудителей особо опасных микозов / Генодиагностика инфекционных болезней // Там же.- С.160-161.
  55. Антонов В.А., Илюхин В.И. Молекулярно-биологические подходы к диагностике и внутривидовому типированию возбудителей сапа и мелиоидоза // Мол. генет. микробиол. вирусол.- 2005.- N2.- С3-9.
  56. Савченко С.С.,. Антонов В.А, Алтухова В.В., Замараев В.С. Генотипирование штаммов возбудителей сапа и мелиоидоза // Санитарная охрана территорий государств участников содружества независимых государств: проблемы биологической безопасности и противодействия биотерроризму в современных условиях: Мат. VI Межгосударственной науч.- практ. конф. государств-участников СНГ, 13-14 сентября, 2005, Волгоград.- 2005.- С.185-186.
  57. Алтухова В.В., Антонов В.А., Ткаченко Г.А., Замараев В.С. Дифференциация возбудителей сапа и мелиоидоза методом ПЦР // Там же.- С.203-204.
  58. Антонов В.А., Ткаченко Г.А., Алтухова В.В., Савченко С.С., Зинченко О.В., Замараев В.С., Илюхин В.И., Алексеев В.В. Использование методов генодиагностики и генотипирования для молекулярно-эпидемиологичес-кого анализа возможных вспышек сапа и мелиоидоза // Там же.- С.204-206.
  59. Зинченко О.В., Алтухова В.В., Замараев В.С., Голосеев Ю.А., Васильев В.П., Пивень Н.Н. Обнаружение возбудителя мелиоидоза методом ПЦР с использованием  магноиммуносорбентов // Там же.-  С.239-240.
  60. Антонов В.А., Зинченко О.В., Лобанов А.Н., Замараев В.С., Алексеев В.В., Трофимов Д.Ю., Гончарова Е.В., Саматов Г.А. Детекция возбудителей особо опасных инфекций в условиях автономной мобильной ПЦР-лаборатории // Генодиагностика инфекционных болезней: Мат. Рос. науч.-практ. конф., 25-27 октября, 2005, «Сосновка», Новосибирская обл.,-  Новосибирск.- 2005.- С.88-89.
  61. Антонов В.А., Зинченко О.В., Ткаченко Г.А., Замараев В.С., Алексеев В.В., Трофимов Д.Ю., Гончарова Е.В. Гибридизационно-флуоресцентная ПЦР-тест-система для идентификации возбудителей сапа (Burkholderia mallei) и мелиоидоза (Burkholderia pseudomallei) / Генодиагностика инфекционных болезней // Там же.- С.90-91.
  62. Алтухова В.В., Савченко С.С., Антонов В.А., Зинченко О.В., Замараев В.С., Абаев И.В., Печерских Э.И. Генетическое типирование возбудителей сапа и мелиоидоза // Актуальные вопросы клинической и экспериментальной медицины: Сб. тез. науч-практ. конф. молодых ученых.- Санкт-Петербург, 2006.- С.273-274.
  63. Зинченко О.В., Антонов В.А., Алтухова В.В., Замараев В.С., Трофимов Д.Ю. Конструирование гибридизационно-флуоресцентной амплификационной тест-системы для идентификации возбудителей сапа и мелиоидоза  // Там же.- С.274-275.
  64. Антонов В.А., Меринова Л.К., Викторов Д.В., Агеева Н.П., Замараев В.С.,  Илюхин В.И. Влияние плазмид на вирулентность и чувствительность клеток сапного микроба к мелиоидозному бактериофагу // Вестник Волгоградского Государственного медицинского Университета.- 2006.- №3.- С.63-66.
  65. Савченко С.С., АнтоновВ.А., Ткаченко Г.А., Алтухова В.В., Зинченко О.В., Замараев В.С. Идентификация и генетическое типирование возбудителей сапа и мелиоидоза с использованием методов секвенирования // Чрезвычайные ситуации международного значения в общественном здравоохранении в решениях Санкт-Петербургского саммита «Группы восьми» и санитарная охрана территорий государств-участников Содружества Независимых Государств»: Мат. VII Межгосударственной науч.- практ. конф. государств-участников СНГ, 3-5 октября, 2006, Оболенск.- 2006.- С.122-123. 
  66. Антонов В.А., Зинченко О.В., Ткаченко Г.А., Замараев В.С., Трофимов Д.Ю., Абрамов Д.Д. Идентификации возбудителей сапа и мелиоидоза методом ПЦР с гибридизационно-флуоресцентной детекцией // Там же.- С.176-177. 
  67. Зинченко О.В., Антонов В.А., Замараев В.С., Голосеев Ю.А., Васильев В.П., Ломова Л.В., Пивень Н.Н. Использование магноиммуносорбентов для обнаружения возбудителя  мелиоидоза в пробах почвы и молока  методом ПЦР // Там же.-  С.203-204.
  68. Онищенко Г.Г., Кривуля С.Д., Федоров Ю.М., Субботин В.Г., Ломов Ю.М., Мишанькин Б.Н., Черепахина И.Я., Москвитина Э.А., Подосинникова Л.С., Рыжко И.В., Фецайлова О.П., Пухов Ю.М., Прометной В.И., Мазрухо Б.Л., Пичурина Н.Л., Шелохович А.И., Сучков И.Ю., Водопьянов С.О., Водяницкая С.Ю., Голубев Б.П., Безсмертный В.Е., Королев Ю.С., Иванова С.М., Кутырев В.В., Куличенко А.Н., Куклев Е.В., Щербакова С.А., Осина Н.А., Шарова И.А., Билько И., Красовская Т.Ю., Пионтковский С.А., Донская Т.Н., Самойлова Л.В., Храпова Н.П., Кулаков М.Я., Прохватилова Е.В., Илюхин В.И., Замараев В.С., Антонов В.А., Сенина Т.В., Метлин В.Н., Липницкий А.В., Алексеев В.В., Лессовой В.С., Тихонов Н.Г., Агафонов А.П., Локтев В.Б., Рябчикова Е.И., Терновой В.А., Шестопалов А.М., Щелкунов С.Н., Раевский К.К., Дармов И.В., Миронин А.В., Маракулин И.В., Кузнецов С.Л., Крючков А.В., Федотов А.К., Елагин Г.Д., Рассанов В.П., Максимов В.А., Марков В.И., Хамитов Р.А., Устюшин В.Н., Богатиков Г.В., Кожевников А.В., Маркин В.А., Дмитриев А.О., Осин Н.С., Швагер М.М., Митрофанова Т.В., Карнаухова О.В. // Специфическая индикация патогенных биологических агентов. Практическое руководство.  Под ред. академика  РАМН, проф. Г.Г. Онищенко.- М: ЗАО «МП Гигиена».- 2006.- 288 с.
  69. Антонов В.А., Алексеев В.В., Липницкий А.В., Илюхин В.И., Замараев В.С., Ткаченко Г.А., Алтухова В.В., Гришина М.А., Савченко С.С., Зинченко О.В. Генодиагностика и генотипирование потенциальных агентов биотерроризма – возбудителей сапа, мелиоидоза и глубоких микозов // Мат. IX съезда Всерос. науч.-практ. общества эпидемиологов, микробиологов и паразитологов, 26-27 апреля 2007, Москва, 2007.- Т.3.- С.375-376.
  70. Антонов В.А., Алтухова В.В., Савченко С.С., Замараев В.С., Илюхин В.И., Алексеев В.В. Использование мультилокусного сиквенс-типирования (MLST) и амплификации с произвольными праймерами (RAPD) для дифференциации штаммов возбудителя сапа // Мол. генет. микробиол. вирусол.- 2007.- N3.- С3-9.
  71. Алтухова В.В., Антонов В.А., Ткаченко Г.А., Зинченко О.В., Замараев В.С., Плеханова Н.Г., Илюхин В.И., Трофимов Д.Ю. Использование полимеразной цепной реакции для обнаружения возбудителей сапа и мелиоидоза при экспериментальной инфекции // Мол. генет. микробиол. вирусол.- 2007.- N3.- С22-27.
  72. Антонов В.А., Викторов Д.В., Алтухова В.В., Ткаченко Г.А., Савченко С.С., Захарова И.Б., Меринова Л.К., Замараев В.С. Анализ штаммов буркхольдерий с помощью амплификации с использованием произвольных праймеров // Международные медико-санитарные правила и реализация глобальной стратегии борьбы с инфекционными болезнями в государствах-участниках СНГ: Мат. VIII Межгосударственной науч.- практ. конф. государств-участников СНГ, 25-26 сентября, 2007, Саратов.- 2007.- С.155-157. 
  73. Зинченко О.В., Антонов В.А., Ткаченко Г.А., Замараев В.С. Сравнительный анализ способов выделения ДНК возбудителя мелиоидоза из контаминированных проб почвы для проведения ПЦР // Там же.- С.210-211. 
  74. Савченко С.С., Антонов В.А., Алтухова В.В., Ткаченко Г.А., Зинченко О.В., Замараев В.С. Анализ штаммов патогенных буркхольдерий методами мультилокусного сиквенс-типирования и амплификации с использованием произвольных праймеров // Там же.- С.277-278. 
  75. Antonov V.A., Alekseev V.V., Tkachenko G.A., Altukhova V.V., Zamaraev V.S., Zinchenko O.V., Viktorov D.V., Ilyukhin V.I. and Trofimov D.Yu. Mobile PCR Laboratory for Burkholderia pseudomallei and Burkholderia mallei detection // The 5th World melioidosis congress, November 21-23 2007, Khon Kaen, Thailand, 2007.- P.88.
  76. Antonov V.A. Molecular identification and typing of Burkholderia pseudomallei and Burkholderia mallei: when is enough enough? // Ibid.- P.198.
  77. Viktorov D.V ., Alekseev V.V., Zakharova I.B., Antonov V.A. and Merinova L.K.High-level resistance to fluoroquinolones and cephalosporins in Burkholderia pseudomallei and closely related species // Ibid.- P.247.
  78. Антонов В.А., Ткаченко Г.А., Алтухова В.В., Зинченко О.В., Савченко С.С., Замараев В.С., Илюхин В.И., Алексеев В.В. Молекулярная идентификация и типирование Burkholderia pseudomallei и Burkholderia mallei // Молекулярная диагностика: Сб. тр. VI Всерос. науч.-практ. конф. c международным участием, 28-30 ноября, Москва,  2007.- Т.I.- С.330-332. 
  79. Викторов Д.В., Алексеев В.В., Захарова И.Б., Антонов В.А., Меринова Л.К. Резистентность высокого уровня к фторхинолонам и цефалоспоринам у Burkholderia pseudomallei и близкородственных видов // Там же.- С.355-357.
  80. Савченко С.С., Антонов В.А., Алтухова В.В., Ткаченко Г.А., Замараев В.С. Идентификация и дифференциация патогенных буркхольдерий на основе монолокусного секвенирования  // Там же.-  С.398-399.
  81. Шунова А.В., Ткаченко Г.А., Антонов В.А., Савченко С.С. Генетическое типирование патогенных буркхольдерий на основе вариабельных ампликонов (Variable Amplicon Typing) // Там же.- С.416-417. 
  82. Viktorov D.V., Zakharova I.B., Podshivalova M.V., Kalinkina E.V., Merinova O.A., Ageeva N.P., Antonov V.A., Merinova L.K., Alekseev V.V. High-level resistance to fluoroquinolones and cephalosporins in Burkholderia pseudomallei and closely related species // Trans. R. Soc. Trop. Med. Hyg. - 2008.-  N.102/S1, 544-551.
  83. Antonov V.A., Tkachenko G.A.,. Altukhova V.V, Savchenko S.S., Zinchenko O.V., Viktorov D.V., Zamaraev V.S., Ilyukhin V.I., Alekseev V.V. Molecular identification and typing of Burkholderia pseudomallei and urkholderia mallei: when is enough enough? // Trans. R. Soc. Trop. Med. Hyg. - 2008.-  N.102/S1, 563-568.
 






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.