WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Дурнова Наталья Анатольевна ХИРОНОМИДЫ ПЕРИФИТОНА ВОДОЕМОВ САРАТОВСКОЙ ОБЛАСТИ:

ЭКОЛОГИЧЕСКИЕ ОСОБЕННОСТИ, МОРФОЛОГИЯ, ЦИТОГЕНЕТИКА (DIPTERA, CHIRONOMIDAE, CHIRONOMINI) 03.02.05. – энтомология

Автореферат диссертации на соискание ученой степени доктора биологических наук

Санкт-Петербург – 2010

Работа выполнена на кафедре общей биологии, фармакогнозии и ботаники ГОУ ВПО «Саратовский государственный медицинский университет им. В.И. Разумовского» Научные консультанты: доктор биологических наук, профессор Кузнецова Валентина Григорьевна доктор биологических наук, профессор Белянина Светлана Ивановна

Официальные оппоненты:

доктор биологических наук, профессор Стекольников Анатолий Александрович доктор биологических наук, профессор Нарчук Эмилия Петровна доктор биологических наук Гохман Владимир Евсеевич

Ведущая организация: ГОУ ВПО «Новосибирский государственный университет»

Защита диссертации состоится «__» _______2010 года в ___часов на заседании диссертационного совета Д 002.223.01 при Зоологическом институте РАН» по адресу: 199034, Санкт-Петербург, Университетская наб., 1; E-mail: brach@zin.ru

С диссертацией можно ознакомиться в библиотеке Зоологического института РАН Автореферат разослан «__» _________________2010 г.

Ученый секретарь диссертационного совета доктор биологических наук О.Г. Овчинникова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Хирономиды – всесветно распространенное семейство длинноусых двукрылых насекомых (Chironomidae, Nematocera, Diptera), включающее около 5000 видов, относимых к 11 подсемействам (Макарченко, Макарченко, 1999; Saether et al., 2000; Макарченко, 2006), наиболее крупными из которых являются Orthocladiinae (270 видов) и Chironominae (230 видов). Личинки многих видов хирономид обитают в бентосе, но еще большее число видов заселяют приподнятые над дном субстраты и относятся к зооперифитону. Несмотря на присутствие в бентосе и зооперифитоне ряда общих эвритопных видов (в том числе и хирономид), эти эволюционно близкие группировки гидробионтов по многим характеристикам экологически независимы друг от друга (Баканов и др., 2003; Протасов, 2005; Скальская и др., 2006а,б). В современных условиях хирономиды все чаще используются как модельный объект при анализе уровня антропогенного загрязнения вод и донных отложений (Извекова др., 1996; Зинченко, 2002; Мисейко, 2003; Lobinske & Ali, 2006), при этом исследования базируются, как правило, на оценке бентосных видов.

Изучение видового состава и биотопической приуроченности перифитонных хирономид может внести существенный вклад в экологический мониторинг пресноводных водоемов.

Точная видовая идентификация хирономид возможна только при условии, когда наряду со сравнительным морфологическим анализом учитываются экологические, молекулярные и цитогенетические сведения (Шилова, 1976б; Carew et al., 2003). Например, давно и хорошо известно, что только особенности политенных хромосом позволяют дифференцировать виды-двойники, морфологически не отличимые друг от друга. В настоящее время методы кариосистематики занимают важное место в таксономических исследованиях разных групп насекомых (Angus, 1982; Кузнецова, 1985;

Филиппенко и др., 2000; Гохман, 2006; Чубарева, Петрова, 2008; MaryanskaNadachowska et al., 2008; Kuznetsova et al., 2009, 2010; Лухтанов, Кузнецова, 2009) и, несомненно, актуальны для семейства Chironomidae (Bauer, 1945;

Keyl, 1962; Steffan, 1966; Hoffrichter, 1971; Wlker, 1980, 1991; Белянина, 1983; Петрова, 1986, 1989, 1993; Кикнадзе и др., 1991а,б, 1996; Шобанов, 1994а,б,в; 2002а,б; Белянина, Дурнова, 1998, 2005; Shobanov et al., 1999;

Полуконова, 2005; Кикнадзе, 2008). В настоящее время накоплены подробные цитогенетические сведения только для 8-10% видов хирономид (Кикнадзе и др., 1996); личинки большинства этих видов ведут бентосный образ жизни – представители родов Chironomus, Camptochironomus, Sergentia и др. Уровень изученности других родов хирономид, особенно включающих фитофильные виды, остается сравнительно низким.

Значимость кариологических исследований заключается не только в точном определении видовой принадлежности отдельных особей, но и в возможности оценки цитогенетической структуры популяций, и в выявлении уровня межвидовой и межпопуляционной дивергенции, что в настоящее время успешно продемонстрировано на примере рода Chironomus (Гундерина, 1986, 2001; Голыгина, 1999; Butler et al., 1999; Гундерина, Кикнадзе, 2000; Кикнадзе и др., 2007; Кикнадзе, 2008). Существующие филогенетические построения у хирономид также касаются, в основном, представителей рода Chironomus (Шобанов, Зотов, 2001; Шобанов, 2002а,б, 2005; Гурьев, 2002; Кикнадзе и др., 2004; Полуконова, 2005; Демин, Полуконова, 2008). Изучение межвидовой и внутривидовой дивергенции у других видов хирономид не проводилось, филогенетические связи перифитонных видов установлены не были.

Современные исследования показывают существенную роль гибридизации (симгенеза) в эволюции разных групп живых организмов (Боркин, Даревский, 1980; Ляпунова, Якименко, 1983; Панов, 1986;

Якименко, 2003). Наличие у хирономид политенных хромосом позволяет определить «видовую принадлежность» определенной хромосомной последовательности и проследить, в результате каких скрещиваний могли возникнуть генотипические сочетания последовательностей у гибридных форм (Michailova, 1989a,b, 1996a,b; Полуконова, Белянина, 2002). Однако изучение гибридогенеза у хирономид находится на самых начальных этапах, поэтому актуальным является вопрос о роли гибридизации в процессе видообразования в этой группе насекомых.

Комплексный морфологический, кариологический, экологический и молекулярно-генетический анализ хирономид перифитона необходим для осуществления точной видовой диагностики морфологически сходных видов и подвидов; анализа адаптивного хромосомного полиморфизма и внутривидовой хромосомной дивергенции; выявления изменений генотипической структуры популяций под влиянием экологических факторов, а также для установления родственных отношений хирономид разного таксономического уровня.

Цель настоящей работы – выявление на основе морфологических, цитогенетических, молекулярно-генетических и экологических особенностей преобладающих тенденций микро- и макроэволюционной дифференциации и установление родственных отношений хирономид трибы Chironomini (Chironomidae, Diptera), обитающих в зоне прибрежных макрофитов водоемов Саратовской области.

Для достижения цели исследования необходимо было решить следующие задачи:

1. Установить видовой состав хирономид трибы Chironomini прибрежных зарослей водоемов Саратовской области и сопряженных территорий и проанализировать приуроченность личинок этой группы хирономид к различным погруженным субстратам.

2. Провести морфологический анализ хирономид зоны прибрежных зарослей, выявить морфологические признаки, имеющие наибольшее значение для видовой диагностики и выявления степени морфологической дивергенции популяций, подвидов и видов; сравнить морфологические особенности личинок видов-обрастателей, видов-минеров и личинок бентосных видов.

3. Изучить структуру политенных хромосом личинок видов родов Glyptotendipes, Endochironomus, Synendotendipes, Polypedilum, Kiefferulus, Phaenopsectra, Demeijerea, Xenochironomus, Stenochironomus, Parachironomus и Microtendipes и составить цитофотокарты политенных хромосом из слюнных желез личинок.

4. Проанализировать внутри- и межпопуляционный хромосомный полиморфизм массовых видов хирономид зоны прибрежных зарослей и составить кадастры хромосомных последовательностей для каждого изученного вида.

5. Провести морфологический и кариологический анализ известных и впервые выявленных межвидовых гибридов и гибридов между подвидами (цитотипами) в родах Endochironomus и Glyptotendipes.

6. Провести молекулярно-генетический анализ (по фрагменту гена мтДНК цитохром С оксидазы I (COI) протяженностью 535 нп) представителей родов Glyptotendipes, Endochironomus, Synendotendipes, Dicrotendipes, Polypedilum, Stenochironomus, Xenochironomus, Cricotopus;

установить время и последовательность возникновения видов фитофильных хирономид из разных родов.

7. Установить родственные отношения родов хирономид на основе морфологических, кариологических и молекулярно-генетических данных.

Научная новизна. Впервые проведено комплексное исследование морфологии, кариотипов, молекулярно-генетических и экологических особенностей хирономид, заселяющих погруженные субстраты в зоне прибрежных зарослей макрофитов пресноводных водоемов Саратовской области и соседних территорий (27 видов из 13 родов). Впервые проанализирована биотопическая приуроченность хирономид прибрежных зарослей. На основе рисунка дисков политенных хромосом выявлено 6 новых для науки видов: Synendotendipes kaluginae, Durnova, 2010, Glyptotendipes minutus sp. n., Xenochironomus sp. n., Endochironomus sp. n., Polypedilum sp. n., Phaenopsectra sp. n. (описания видов отправлены в печать или подготовлены к печати). Впервые описаны кариотипы 4-х видов (Glyptotendipes imbecillis, Xenochironomus xenolabis, Stenochironomus gibbus, Phaenopsectra flavipes) и составлены подробные цитофокарты для 15-ти видов из родов Glyptotendipes, Endochironomus, Synendotendipes, Polypedilum). На основе цитофотокарт впервые проведено картирование инверсионных последовательностей у всех изученных видов; подробно исследован хромосомный полиморфизм и цитогенетическая структура популяций 13 видов. Впервые установлена зависимость спектра и частоты хромосомных перестроек у личинок от типа заселяемого ими субстрата. Проанализированы особенности пространственной организации хромосом в интерфазных ядрах в связи со специфическими условиями существования видов. Впервые рассчитаны цитогенетические расстояния между межпопуляционными и внутрипопуляционными группировками двух модельных видов (Glyptotendipes glaucus и G. pallens), и на этой основе установлен уровень цитогенетической дивергенции. На примере рода Glyptotendipes проведен сравнительный анализ морфологии и кариотипов бентосных и перифитонных видов. На основании сравнительного морфологического анализа личинок 41го вида впервые проанализированы филогенетические отношения 24-х родов из подсемейств Chironominae и Orthocladiinae. Впервые установлена нуклеотидная последовательность фрагмента гена мтДНК цитохром оксидазы I (COI) протяженностью 535 нп у 10-ти видов: Endochironomus albipennis, E. tendens, Glyptotendipes barbipes, G. gripekoveni, G. imbecillis, G.

mancunianus, Polypedilum sordens, Stenochironomus gibbus, Synendotendipes kaluginae, Xenochironomus sp. n. На основе этих данных установлено время дивергенции изученных таксонов и время возникновения минирования и обрастания субстратов как двух прогрессивных эволюционных стратегий в семействе Chironomidae.

Теоретическая и практическая значимость. Комплекс выявленных морфологических и кариотипических признаков позволяет производить точное определение видов хирономид зоны прибрежных зарослей и проводить их сравнительный морфологический и цитогенетический анализ.

Разработанные цитофотокарты политенных хромосом являются необходимым условием для изучения хромосомного полиморфизма массовых видов хирономид, так как на их основе возможно точное картирование для уже зарегистрированных и вновь выявленных хромосомных перестроек. Сведения по видовому составу хирономид прибрежных зарослей макрофитов и накопленные данные по хромосомному полиморфизму массовых видов могут служить основой для экологического мониторинга водоемов Саратовской области. Комплексный анализ цитогенетической и морфологической дифференциации хирономид, заселяющих различные экологические ниши прибрежных зарослей, вносит вклад в изучение эволюционных тенденций у видов, вступающих в коэволюционные связи с обитающими здесь другими видами животных или растений. Установление времени дивергенции разных таксономических групп хирономид методом молекулярно-генетического анализа может служить основой для более глубокого понимания эволюции семейства Chironomidae.

Апробация результатов. Материалы работы были представлены на X Российском симпозиуме по хирономидам (Борок, ИБВВ РАН, октябрь 19г.), III Всероссийской конференции по кариосистематике беспозвоночных животных (Москва, январь 1997 г.), X Всероссийской конференции молодых ученых (Борок, ИБВВ РАН, март 1997 г.), VI Всероссийском диптерологическом симпозиуме (Санкт-Петербург, апрель 1997 г.), XI Cъезде Русского энтомологического общества (Санкт-Петербург, сентябрь 1997 г.), Симпозиуме «Современные достижения популяционной, эволюционной и экологической генетики (Владивосток, сентябрь, 2001 г.), XII Cъезде Русского энтомологического общества (Санкт-Петербург, август 2002 г.), Юбилейном совещании, посвященном памяти С.С. Хохлова (Саратов, сентябрь 2002 г.), XI Российском симпозиуме по хирономидам (Борок, ИБВВ РАН, октябрь 2002 г.), Международном хирономидологическом симпозиуме (США, Миннесота, август 2003 г.), Международном симпозиуме «Кариосистематика беспозвоночных животных IV» (Санкт-Петербург, август 2006 г.), IX Международной научнопрактической конференции «Современные проблемы популяционной экологии» (г. Белгород, октябрь 2006 г.), научно-практической конференции «Экологические проблемы урбанизированных территорий» (Елец, март 20г.), XIII съезде Русского энтомологического общества (Краснодар, сентябрь 2007 г.), X Международной научно-практической конференции «Живые объекты в условиях антропогенного пресса» (Белгород, сентябрь 2008 г.), II Международной научно-практической конференции «Экология биосистем:

проблемы изучения, идентификации и прогнозирования» (Астрахань, август 2009 г.), Всероссийской научно-практической конференции с международным участием «Экология, эволюция и систематика животных» (Рязань, ноябрь 2009 г).

Публикации. По теме диссертации опубликовано 49 работ, в том числе 10 в журналах, рекомендуемых ВАК РФ для публикаций материалов докторских диссертаций по биологическим наукам; 6 статей находятся в печати.

Положения, выносимые на защиту.

1. Личинки хирономид зоны прибрежных зарослей пресноводных водоемов характеризуются приуроченностью к определенным субстратам, в основном, к живым и разлагающимся макрофитам; большинство фитофильных видов находится на ранних этапах коэволюционных взаимодействий с растениями, при этом прочные коэволюционные связи с определенными видами макрофитов у них пока не сформированы. Наиболее узкоспециализированными видами хирономид прибрежной зоны являются минеры древесины и тканей губок.

2. Накопление цитогенетических изменений в процессе внутри- и межвидовой дифференциации происходит заметно быстрее, чем накопление морфологических различий.

3. Рисунок дисков политенных хромосом является хорошим маркером для изучения систематики и установления родственных связей таксонов разного ранга в семействе Chironomidae.

4. Сравнительный кариотипический анализ хирономид-обрастателей и хирономид-минеров погруженных субстратов (виды из родов Glyptotendipes, Endochironomus, Synendotendipes, Polypedilum, Dicrotendipes, Xenochironomus, Stenochironomus, Phaenopsectra, Demeijerea, Parachironomus, Kiefferulus) показывает лишь частичную гомологию по рисунку дисков политенных хромосом у близких видов в пределах одного рода и её полное отсутствие у видов разных родов, а в некоторых случаях – и у видов одного рода.

5. Внутрипопуляционный и межпопуляционный хромосомный полиморфизм является отражением адаптивных процессов у хирономид, в частности, изменение частот определенных инверсионных последовательностей дисков политенных хромосом зависит от заселяемого личинками субстрата.

6. Фитофилия (у хирономид – способность личинок к обрастанию или минированию растительных субстратов) возникала в эволюции хирономид неоднократно в разных таксономических группах.

Структура и объем диссертации. Диссертация состоит из введения, семи глав и выводов. Текст диссертации изложен на 300 страницах.

Приложение включает 43 таблицы и 113 рисунков. Список литературы содержит 598 источников, из которых 190 на иностранном языке.

Благодарности. Выражаю искреннюю благодарность своим научным консультантам д.б.н. В.Г. Кузнецовой и д.б.н. С.И. Беляниной. Очень признательна за ценные советы в процессе обсуждения результатов работы д.б.н. Н.А. Петровой, проф. П. Михайловой (P. Michailova, Болгария), д.б.н.

Н.А. Шобанову, д.б.н. В.М. Лухтанову, д.б.н. Л.И. Гундериной, к.б.н.

А.Г. Истоминой, д.б.н. Т.Б. Зинченко, д.б.н. В.М. Басову. Благодарю за сотрудничество своих коллег: д.б.н. Н.В. Полуконову, к.б.н. М.Ю. Воронина, к.б.н. Л.Е. Сигареву, А.Г. Демина.

СОДЕРЖАНИЕ РАБОТЫ

ГЛАВА 1. Видовой состав, экологические, морфологические и цитогенетические особенности хирономид зоны прибрежно-водных макрофитов пресноводных водоемов России и сопредельных стран (обзор литературы) 1.1. Видовой состав и экологические особенности хирономид фауны прибрежных зарослей макрофитов Приведена характеристика зоны прибрежно-водных макрофитов, которая относится к области широкого экотона – «вода-суша», занимает ключевое место в экосистемах речных пойм (Залетаев, 1997; Соловьева, Розенберг, 2006) и отличается повышенной продуктивностью, биологическим разнообразием и интенсивными процессами самоочищения водотока (Коломыц, 1987; Ермохин, 2000). Особое внимание уделено обсуждению понятия «перифитон» или «биоценоз обрастаний», т.е. группе гидробионтов, поселяющихся на поверхности находящихся в воде твердых субстратов (Бенинг, 1924). Рассмотрены вопросы, касающиеся современного состояния изученности хирономид перифитона.

Обсуждаются особенности двух прогрессивных эволюционных стратегий хирономид – минирования и обрастания личинками различных погруженных субстратов. Рассмотрены некоторые аспекты эволюции перифитонных хирономид и, в частности, последовательность возникновения способности к «обрастательному» или «минирующему» образу жизни;

обсуждается тенденция к увеличению доли хирономид-минеров в семействе Chironomidae в целом (Калугина, 1963а, 1974б). Так как при исследованиях зооперифитона материал собирался только с поверхности обросших субстратов (Кондратьев, 1979; Потапов, 1983; Баканов и др., 2003; Скальская, 1982, 1998; Скальская и др., 2005, 2006а,б), т.е. организмы, находящиеся внутри субстратов, при этом не учитывались, а биотопическая приуроченность установлена всего для нескольких фитофильных видов Endochironomus и Glyptotendipes (Калугина, 1963а), экологические особенности хирономид перифитона нельзя считать достаточно изученными.

1.2. Морфологические и цитогенетические особенности.

Использование цитогенетических признаков в систематике хирономид 1.2.1. Морфологический анализ в современной систематике хирономид В настоящее время мировая фауна хирономид насчитывает не менее 5000 видов из 440 родов 11 подсемейств: Tanypodinae, Aphroteniinae, Podonominae, Usambaromyiinae, Buchonomyiinae, Chilenomyiinae, Diamesinae, Prodiamesinae, Orthocladiinae, Chironominae, Telmatogetoninae (Saether et al., 2000). Для Палеарктики зарегистрировано около 1300 видов из 217 родов, для Неарктики 1051 вид из 205 родов (Ashe, Cranston, 1990; Saether et al., 2000). В России, по предварительным данным, обитает более 900 видов (Макарченко, Макарченко, 2009). Имаго хирономид изучены во много раз лучше, чем личинки и куколки (Зорина, 2002), и для большинства видов данные по преимагинальным стадиям отсутствуют или очень краткие. В разделе приведены краткие сведения об изученности основных родов хирономид, включающих перифитонные виды.

1.2.2. Признаки кариотипа, используемые в систематике хирономид на разных таксономических уровнях Приведен обзор, посвященный истории применения видоспецифичной структуры политенных хромосом в систематике семейств Drosophillidae (Painter, 1934; Dobzhansky, 1951; Sorsa, 1974), Simuliidae (Чубарева, 1977;

1987; Чубарева, Петрова, 2008), Culicidae (Стегний, 1991; 1993) и, более детально – Chironomidae (Bauer, 1945; Keyl, 1962; Steffan, 1966; Hoffrichter, 1971; Wlker, 1980, 1991; Белянина, 1983; Петрова, 1986, 1987, 1989; 1990;

1991; Кикнадзе и др., 1991а,б, 1996; Шобанов, 1994а,б,в, 2002а,б;

Полуконова, 2005; Белянина, Дурнова, 1998, 2005). Рассмотрены признаки, используемые при видовом описании кариотипа хирономид: хромосомное число (2n), длина хромосом, степень политении, расположение и выраженность центромерных районов, число и локализация ядрышек, колец Бальбиани и пуффов. Установлено, что наиболее диагностически значимым является рисунок дисков политенных хромосом, для которого характерна высокая консервативность, впервые установленная Кейлом (Keyl, 1957, 1960, 1962; Keyl H.-G., Keyl I., 1959; Keyl, Strenzke, 1956) для видов рода Chironomus.

Обобщены данные о неслучайном расположении хромосом в интерфазных ядрах эукариот (Навашин, 1957; Kitani, 1963; Дубинин и др., 1966; Прокофьева-Бельговская, 1967; Стегний, 1991, 1993, 2006; Manuelidis, Borden, 1998; Енукашвили и др., 2003; Разин, 2006). Так как упорядоченность организации интерфазного ядра в значительной степени определяется локализацией в нем гетерохроматина (ГХ), приведено описание особенностей центромерного, теломерного и интеркалярного ГХ (Прокофьева-Бельговская, 1986; Жимулев и др., 1989; Жимулев, Беляева, 2003). Рассматриваются типы хромоцентров и их встречаемость в кариотипах хирономид. Например, в подсемействе Chironominae у Chironomus melanotus, Ch. cucini и Ch. pilicornis имеется непрочный хромоцентр (Wlker, Butler, 1983; Кикнадзе и др., 2002), а у Lipiniella arenicola и Parachironomus parilis – прочный (Kiknadze et al., 1982; Michailova, 1989а). Обсуждается роль ГХ в эктопической коньюгации политенных хромосом в интерфазном ядре.

Отмечено, что у некоторых видов эктопические контакты являются определенным этапом в эволюции кариотипа, в частности, на пути к эволюционному уменьшению числа хромосом (Keyl, 1962; Martin et al., 1974;

Петрова, Максимова, 1978; Петрова, 1983; Michailova et al., 1994а).

Приводится обзор сведений о структуре В-хромосом, которые присутствуют в геномах многих видов эукариот (Camacho et al., 2000) и обнаружены приблизительно у 7% изученных видов хирономид (Мисейко и др., 1971а; Чубарева, 1971; Белянина, 1975; Ильинская, Петрова, 1985;

Петрова, 1990; Петрова, Чубарева, 1997; Сиирин и др., 2003).

Наличие гигантских политенных хромосом у личинок хирономид делает их незаменимым объектом при изучении хромосомного полиморфизма, который выявлен в результате популяционнокариологических исследований многих видов хирономид (Белянина, 1983;

Петрова, 1990; Жиров, 1994; Ильинская, Петрова, 1996; Петрова и др., 1996;

Кикнадзе и др., 1996; Кикнадзе, 2008; Кикнадзе, Истомина, 2000; Гундерина, 2001). Отмечается, что хромосомный полиморфизм лучше всего изучен на примере видов Chironomus, что обусловлено наличием высокой степени гомологии по последовательностям дисков у большинства видов этого рода.

На основании имеющихся данных удалось выявить некоторые закономерности хромосомной эволюции и провести филогенетические исследования этих насекомых (Keyl, 1962; Martin, 1979; Wlker, 1980;

Полуконова, 2001б, 2005; Шобанов, 2002а,б, 2005; Кикнадзе и др., 2007).

Показано, однако, что для большинства хирономид, в том числе и для видов, личинки которых ведут специфический образ жизни, минируя погруженные в воду субстраты, эти данные немногочисленны.

ГЛАВА 2. Материал и методы Материалом для исследования послужили гидробиологические и энтомологические сборы перифитонных хирономид, проведенные в период с 1990 по 2009 гг., а также куколки и имаго, выведенные в лабораторных условиях. Всего обработано более 230 проб, изготовлено и изучено около 4500 временных микропрепаратов политенных хромосом и 650 постоянных морфологических препаратов личинок, куколок и имаго. Постоянные и часть временных препаратов хранятся в коллекции кафедры общей биологии, фармакогнозии и ботаники Саратовского государственного медицинского университета. Сбор и хранение личинок проводились по стандартным гидробиологическим методикам (Черновский, 1949; Константинов, 1950;

Шилова, 1969б, 1972; Панкратова, 1983). Морфологические препараты фиксировались в глицерин-желатине по методике Макарченко (1985).

Определение имаго, куколок и личинок хирономид проводилось по соответствующим определителям (Черновский, 1949; Шилова, 1969б; Родова, 1978; Pinder, 1978; Панкратова, 1983; Pinder, Reiss, 1983, 1986; Cranston et al., 1989; Макарченко, 2006). В большинстве случаев видовая диагностика личинок подтверждалась анализом имаго; выведение взрослых особей из личинок проводилось в лабораторных условиях согласно методикам, предложенным Шиловой (1974а, 1976а) и Михайловой (Michailova, 1985b).

При изучении приуроченности личинок хирономид к заселяемым субстратам использовалась методика количественного учета перифитонных видов (Зимбалевская, 1974; 1981; Кондратьев, 1979), но при этом учитывались не только особи, прикрепленные к поверхности погруженного субстрата, но и личинки, находящиеся внутри него. Видовое определение гидрофильной растительности проводилось по соответствующим определителям (Лисицына и др., 1993; Еленевский и др., 2001).

Изучение и описание морфологии личинок, куколок и имаго осуществлялись с использованием современных обозначений и терминов (Шилова, 1972; Шобанов, 1989; Saether, 1980; Макарченко, 1985; Ashe, Cranston, 1990; Логинова, Белянина, 1994; Полуконова, 2001а). Измерение количественных признаков проводилось с помощью окуляр-микрометра.

Для выявления филогенетического родства был проведен морфологический анализ личинок 41-го вида из четырех подсемейств Chironomidae: Diamesinae, Tanipodinae, Orthocladiinae и Chironominae. В качестве внешней группы использован представитель подсемейства Tanipodinae – Macropelopia paranebulosa. Всего рассмотрено качественных и количественных морфологических признаков, наиболее часто используемых для установления видовой принадлежности хирономид.

На филлограмме (глава 4) приведены сокращенные названия каждого вида (в списке приведены в скобках):

Подсемейство Diamesinae 1. Prodiamesa olivacea Fittkau, 1962 (Meigen, 1818) (P. olivacea) Подсемейство Tanipodinae 2. Macropelopia paranebulosa Fittkau, 1962 (M. paranebulosa) Подсемейство Orthocladiinae 3. Cricotopus glacialis Edwards, 1922 (C. glacialis) 4. Cricotopus silvestris Fabricius, 1794 (C. silvestris) Подсемейство Chironominae 5. Camptochironomus tentans, Fabricius, 1805 (C. tentans) 6. Cryptochironomus ussouriensis (Goetghebuer, 1933) (C. ussouriensis) 7. Chironomus luridus Strenzke, 1959 (Ch. luridus) 8. Ch. muratensis Ryser, Scholl & Wlker, 1983 (Ch. muratensis) 9. Ch. obtusidens Goetghebuer, 1921 (Ch. obtusidens) 10. Ch. piger Strenzke, 1959 (Ch. piger) 11. Ch. plumosus (Linnaeus, 1758) (Ch. plumosus) 12. Dicrotendipes nervosus (Staeger, 1839) (D. nervosus) 13. Demeijerea rufipes (Linnaeus, 1761) (D. rufipes) 14. Einfeldia pagana (Meigen, 1838) (E. pagana) 15. Endochironomus albipennis (Meigen, 1830) (E. albipennis) 16. E. tendens (Fabricius, 1775) (E. tendens) 17. Glyptotendipes barbipes (Staeger, 1839) (G. barbipes) 18. G. glaucus Meigen, 1818 (G. glaucus) 19. G. gripekoveni (Kieffer, 1913) (G. gripekoveni) 20. G. imbecillis Walker, 1856 (G. imbecillis) 21. G. mancunianus (Edwards, 1929) (G. mancunianus) 22. G. minutus sp. n. (G. minutus) 23. G. pallens (Meigen, 1804) (G. pallens) 24. G. paripes Edwards, 1929 (G. paripes) 25. G. varipes Goetghebuer, 1927 (G. varipes) 26. Kiefferulus tendipediformis (Goetghebuer, 1921) (K. tendipediformis) 27. Lipiniella moderata Kalugina, 1970 (L. moderata) 27. Micropsectra logani Johannsen, 1928 (M. logani) 29. Microchironomus tener (Kieffer, 1918) (M. tener) 30. Phaenopsectra flavipes Meigen, 1818 (P. flavipes) 31. Polypedilum nubeculosum (Meigen, 1804) (P. nubeculosum) 32. Polypedilum sp. n.

33. P. sordens (Van der Wulp, 1874) (P. sordens) 34. Sergentia baueri Wlker, Kiknadze, Kerkis & Nevers, 1999 (S. baueri) 35. Stenochironomus gibbus (Fabricius, 1794) (S. gibbus) 36. Synendotendipes kaluginае sp. n. (S. kaluginае) 37. Tanytarsus volgensis Miseiko, 1967 (T. volgensis) 38. Xenochironomus xenolabis Kieffer, 1916 (X. xenolabis) 39. Xenochironomus sp. n. (Xenochironomus sp.) 40. Baeotendipes noctivaga (Kieffer, 1911) (B. noctivaga) 41. Cladopelma goetghebueri Spies & Saether, 2004 (C. goetghebueri) Морфология представителей большинства родов подсемейства Chironominae была изучена лично автором. Данные о морфологии представителей родов Baeotendipes, Camptochironomus и Chironomus предоставлены Н.В. Полуконовой (кафедра общей биологии, фармакогнозии и ботаники Саратовского государственного медицинского университета).

Для морфологического анализа представителей подсемейств Orthocladiinae, Tanipodinae и Diamesinae использованы литературные данные (Панкратова, 1983; Макарченко, 2006). Для анализа филогении хирономид использовали программу PAUP (Swofford, 2002).

Препараты политенных хромосом слюнных желез личинок готовились по модифицированной этил-орсеиновой методике (Демин, Ильинская, 1988;

Демин, Шобанов, 1990). Изучение и фотосъемка кариотипов проводились под микроскопом «Микромед 2» со стандартной фотонасадкой при увеличениях ок.7, об.40 (либо об.90); отснято более 4500 кадров.

Обработка цифровых изображений проводилась с использованием программы PhotoShop 6.0 и CorelDraw 13. При изучении политенных хромосом использованы атласы кариотипов (Michailova, 1989a; Кикнадзе и др., 1991б, 1996) и сводки кариотипов хирономид мировой фауны (Петрова, 1989, 1990). Для большинства видов созданы оригинальные цитофотокарты политенных хромосом с разделением их на мелкие отделы, и указаниями активных районов. Инверсионные последовательности обозначали порядковыми номерами в соответствии с очередностью их описания;

сочетания последовательностей в каждом плече обозначались двумя цифрами, указывающими на принадлежность каждого гомолога к определенной последовательности (например, glaА1.1., glaА1.2. и т. д.).

Уровень гетерозиготности популяций оценивался по частоте встречаемости гетерозиготных особей и среднему числу гетерозиготных инверсий на особь (Чубарева, 1974; Кикнадзе и др., 1991б, 1996; Шобанов, 1994а, в).

Цитогенетические расстояния между популяциями и внутрипопуляционными выборками рассчитывались по методу Нэя (Nei, 1972). Дендрограммы, иллюстрирующие цитогенетические расстояния между выборками, строили по методу среднего присоединения. Различия по доле отдельных хромосомных последовательностей и их зиготических сочетаний в кариотипах хирономид из разных выборок оценивали при попарном сравнении по -критерию Фишера. Сравнительная оценка результатов проводилась на основе данных по цитогенетическим расстояниям на разных этапах дивергенции видов в роде Chironomus (Гундерина, 2001).

Проведены молекулярно-генетические исследования 17-и образцов 14и видов хирономид, собранных в водоемах Саратовской области:

1. Dicrotendipes nervosus: из р. Волги у Саратова и из р. Терешки у пос.

Лысые Горы.

2. Endochironomus albipennis: из оз. Сазанка в г. Энгельсе.

3. E. tendens: из р. Терешки у пос. Лысые Горы и из р. Красавки у с. НовоАлександровка.

4. Glyptotendipes barbipes: из р. Узень в г. Новоузенске.

5. G. glaucus: из р. Волги у г. Энгельса.

6. G. gripekoveni: из пруда у г. Маркс и из р. Красавки у с. НовоАлександровка.

7. G. imbecillis: из р. Волги у с. Узморье.

8. G. mancunianus: из пруда у г. Маркс.

9. Polypedilum sordens: из р. Красавки у с. Михайловка.

10. Stenochironomus gibbus: из р. Терешки у с. Черкасское.

11. Synendotendipes kalugini sp. n. : из оз. Холодного у г. Энгельса.

12. Xenochironomus xenolabis: из р. Красавки у с. Ново-Александровки.

13. Xenochironomus sp. из р.Терешки у с. Черкасское.

14. Cricotopus glacialis из р. Волги у с. Узморье.

Выделение тотальной ДНК проводилось с использованием коммерческого набора реактивов Diatomtm DNA Prep 100 «Изоген» в соответствии с протоколом фирмы-изготовителя. Амплификация гена COI проводилась на термоциклере «Терцик» с использованием коммерческого набора реактивов GenePak@ PCR Core «Изоген» в соответствии с протоколом фирмы-изготовителя.

Структура праймеров: LCO 5'GGTCAACAAATCATAAAGATATTGG3', HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3' (Folmer et al., 1994).

Условия ПЦР и структура праймеров для амплификации фрагмента гена COI (713 нп): I. 94° – 1 мин; II 5 циклов: a) 94° – 1 мин., b) 45 ° – 1.мин., c) 72 ° – 1.5 мин.; III. 35 циклов: a) 94 ° – 1 мин., b) 50 °– 1.5 мин., c) 72 ° – 1 мин.; IV. 72 ° – 5 мин. Детекция ПЦР-продуктов проводилась с помощью горизонтального электрофореза в пластине 1% агарозного геля с добавлением бромистого этидия. В качестве буфера использовался стандарный трис-боратный буфер. Для световой идентификации и фотографического фиксирования результатов электрофореза, пластина геля помещалась в УФ-трансиллюминатор. Для эллюции ПЦР-продуктов из геля применялся набор реактивов Diatomtm DNA Elution «Изоген».

Определение первичной нуклеотидной последовательности гена проводилось на коммерческой основе в ЗАО «Евроген». Для коррекции полученных последовательностей использовалась программа ChromasPro, выравнивание проводилось с помощью ClustalW; филогенетические построения с использованием метода ME, расчет времени дивергенции, а также графическая обработка всех дендрограмм осуществлялись с использованием пакета программ, реализованного в Mega4, построение Байес-дендрограммы проводилось в программе и MrBayes 3.1.2. В качестве моделей замещения аминокислот использовали алгоритмы Poisson correction и Number of differences.

ГЛАВА 3. Видовой состав и биотопическая приуроченность перифитонных хирономид зоны прибрежно-водных макрофитов Саратовской области 3.1. Видовой состав В водоемах Саратовской области обнаружено 27 видов хирономид, обитающих в зоне прибрежно-водных макрофитов, из них: 25 видов из родов подсемейства Chironominae (Glyptotendipes, Endochironomus, Synendotendipes, Polypedilum, Kiefferulus, Dicrotendipes, Phaenopsectra, Microtendipes, Xenochironomus, Stenochironomus, Demeijerea и Parachironomus), и 2 вида рода Cricotopus подсемейства Orthocladiinae. Два вида (Glyptotendipes gripekoveni и Endochironomus tendens) представлены двумя цитотипами. Всего рассмотрено 18 вариантов различных субстратов.

3.2. Экологические группы хирономид по отношению к заселяемым субстратам Исследован видовой состав и проанализирована биотопическая приуроченность перифитонных хирономид водоемов Саратовской области (в нашем понимании – как «обрастателей» и минеров погруженных субстратов) и впервые предложена их экологическая классификация (рис. 1).

I. «Обрастатели» подводных субстратов (Endochironomus albipennis, Dicrotendipes nervosus, Microtendipes pedellus, Cricotopus sylvestris и C.

glacialis) отмечены для большинства проб, при этом наиболее распространенным в изученных водоемах является E. albipennis.

II. Эвритопные виды, сочетающие «обрастание» с минированием (Glyptotendipes glaucus, G. pallens), являются наиболее массовыми в большинстве изученных нами водоемов. Личинки G. glaucus способны обитать внутри субстратов (гнилая древесина, разлагающиеся листья и стебли водных макрофитов), а также обрастать самые разнообразные подводные субстраты (камни, коряги, раковины моллюсков). Личинки G.

pallens заселяют разлагающиеся листья рогозов и ткани пресноводных губок.

· – биотопическая приуроченность указана согласно по литературным данным · (Калугина, 1963а, 1975; Панкратова, 1983) Рис. 1. Классификация перифитонных хирономид по заселяемым субстратам III. Минеры разлагающихся растительных тканей (Synendotendipes impar, S. kaluginae sp. n.) всегда предпочитают разлагающиеся растительные остатки. Кроме них, в прошлогодних растительных тканях обитают эвритопные виды хирономид и единичные особи хирономид-обрастателей.

IV. Минеры отмирающих и живых тканей макрофитов (Glyptotendipes gripekoveni, Endochironomus tendens, Polypedilum sordens, Kiefferulus tendipediformis, Phaenopsectra sp. n., Ph. flavipes) способны минировать нижние кроющие листья разных видов рогоза, ежеголовника, сусака, которые находятся на разных стадиях деструкции. В наиболее старых листьях рогозов обнаруживаются эвритопные личинки G. glaucus, относительная доля которых может превышать 50% (рис. 2).

0,0,0,Виды Рис. 2. Доля видов хирономид от общей численности (N=1208) в разлагающихся наружных листьях рогоза узколистного V. Минеры только живых тканей макрофитов (Glyptotendipes mancunianus, G. imbecillis, G. viridis, G. aequalis, G. caulicola) являются наиболее специализированными среди всех фитофильных хирономид, так как их личинки внедряются в живые части водных растений и живут в них до окукливания. В изученных водоемах личинки G. mancunianus доминировали в наружных живых листьях сусака, стрелолиста обыкновенного, ежеголовника прямого (рис. 3), камыша озерного и рогоза широколистного.

VI. Минеры полуразложившейся древесины подразделяются на:

а) облигатные, к которым относится вид рода Stenochirоnomus (S. gibbus) и б) факультативные, к которым относятся эвритопные Glyptotendipes glaucus, G. gripekoveni, Endochironomus tendens, заселяющие сильно размягченную древесину, и Polypedilum pedestre (в массовом количестве встречен в лубяном слое коры затопленных стволов и ветвей).

Доля G.

G.

G. pallens P. sordens E. tendens G. glaucus C. glacialis gripekoveni D. nervosus G. imbecilis S. kaluginae hyb. glapal E. albipennis mancunianus 0,0,0,Виды Рис. 3. Доля видов хирономид от общей численности (N=1513) в живых наружных листьях ежеголовника прямого VII. Комменсалы (минеры тканей пресноводных губок и мшанок) подразделяются на: а) облигатные, к которым относятся Xenochironomus sp., X. xenolabis, Demejerea rufipes и Glyptotendipes varipes и б) факультативные, к которым относятся эвритопные виды Endochironomus albipennis, Dicrotendipes nervosus, Glyptotendipes pallens, G. glaucus, Polypedilum sordens и Microtendipes pedellus.

Самым массовым видом, заселяющим погруженные субстраты в изученных нами водоемах, является G. glaucus, личинки которого способны заселять разнообразные субстраты, предпочитая погруженную древесину и разлагающиеся части водных макрофитов (рис. 4).

0,0,0,0,Субстрат Рис. 4. Биотопическая приуроченность личинок G. glaucus (N=1446) Доля G.

s p.

K.

E. t e nde ns P. sordens G. glaucus hyb. gla/pal G. imbecilis D. ne rv osu s E. al bi pe nni s mancuni anus Cri c ot opus sp.

G. gripekoveni Phaenopsectra t en di pe di f ormi s хирономид на субстрате Доля вида от общей численности губки древесина погруженная осока ( корни ) корневища ) листья ) листья ) (живые побеги ) тростника камыш озерный (разлагающиеся живые листья ) обыкновенного рогоз узколистный рогоз Лаксмана сусак зонтичный рогоз узколистный ежеголовник прямой прошлогодние стебли рогоз широколистный (наруж.

живые листья ) (наруж.

живые листья ) (наруж.

живые листья ) стрелолист об. ( наруж.

(наруж.

разлагающиеся (наруж.разлагающиеся ГЛАВА 4. Морфологический анализ хирономид зоны прибрежноводных макрофитов водоемов Саратовской области 4.1. Имаго, куколка, личинка Приведены результаты анализа 25 видов перифитонных хирономид из 12 родов (Glyptotendipes, Endochironomus, Synendotendipes, Polypedilum, Kiefferulus, Dicrotendipes, Phaenopsectra, Microtendipes, Xenochironomus, Stenochironomus, Demeijerea и Parachironomus). Для каждого вида приводится краткая сводка опубликованных данных по морфологии имаго, куколки и личинки. Приведены оригинальные описания фаз метаморфоза для каждого вида. Описания большинства видов сопровождается оригинальными рисунками, а в ряде случаев – таблицами, в которых проводится сравнение между близкими видами с целью их более четкой дифференциации. В этом же разделе приводятся первоописания 5-ти видов (для Synendotendipes kaluginae sp. n. и G. minutus sp. n. представлены подробные описания имаго, куколки и личинки; для Xenochironomus sp. n., Endochironomus sp. n., Polypedilum sp. n. и Phaenopsectra sp. n. приведены подробные описания личинки).

4.2. Основные направления морфологической адаптации личинок хирономид к специфическим условиям обитания Рассмотрены основные направления морфологической адаптации личинок хирономид к специфическим условиям обитания. Рассмотрены особенности морфологии личинок, связанные со спецификой их образа жизни.

4.2.1. Морфологические адаптации личинок к обрастанию и минированию растительных субстратов (на примере видов Glyptotendiрes) 1. Морфологические особенности видов, личинки которых ведут бентосный образ жизни (G. barbipes, G. paripes, G. minutus sp. n.): пологая дуга ментума и округлые небольшие выступы на основаниях максилл. У данных видов в строении ротовых частей взрослых личинок наблюдаются некоторые черты сходства с личинками первой стадии других видов Glyptotendiрes, что, по мнению Калугиной (1979), является признаком примитивности и свидетельствует о первичности бентосного образа жизни по сравнению с минированием и обрастанием субстратов. Представляется, однако, более вероятным, что формирование бентосных видов и видовминеров рода Glyptotendipes происходило независимо, на что указывают данные молекулярно-генетического анализа (глава 7).

2. Морфологические особенности эврибионтных видов, сочетающих способность к минированию с «обрастанием» погруженных субстратов (G.

glaucus, G. pallens): в строении ротового аппарата личинок сочетаются признаки, характерные как для бентосных видов, так и для узкоспециализированных минеров макрофитов: дуга ментума более крутая, чем у бентосных видов, но в основания максилл имеются только округлые зубцы; зарубки на срединном зубце отсутствуют.

3. Морфологические особенности видов, узко приспособленных к минированию тканей живых водных макрофитов (G. macunianus, G.

imbecillis) – резкое увеличение крутизны ментума, уменьшение его боковых зубцов и развитие острых зубцов в основании максилл. Такие же особенности, хотя и в меньшей степени, характерны и для G. gripekoveni, при этом у личинок подвида G. g. gripekoveni Belyanina et Durnova, 2004, предпочитающих минировать отмирающие листья водных растений, эти особенности выражены сильнее по сравнению с личинками G. g.

paragripekoveni Belyanina et Durnova, 2004. Кроме того, нами впервые отмечено, что личинки G. g. gripekoveni достаточно часто заселяют еще живые «старые» листья рогоза или частухи, что, несомненно, свидетельствует о далеко зашедшей специализации личинок этого подвида к минированию. Личинки G. g. paragripekoveni встречались только в сгнившем или полусгнившем растительном субстрате, и приспособления к минированию живых тканей у них выражены более слабо, чем у G.

macunianus, G. imbecillis и G. g. gripekoveni.

4.2.2. Приспособления к облигатному минированию древесины у личинок рода Stenochironomus Личинки S. gibbus узко приспособлены к обитанию внутри древесины и на поверхность субстрата не выходят. В связи с этим, они демонстрируют черты узкой приспособленности к минированию: уплощенную в дорсовентральном направлении голову, которая суживается в передней части; кроме того, они имеют вогнутый ментум и почти полностью редуцированные вентроментальные пластинки. Личинки не способны плавать, совершая ундулирующие движения; их тело вялое, передние и задние подталкиватели редуцированы.

4.2.3. Приспособления к комменсализму у личинок рода Xenochironomus У изученных нами видов X. xenolabis и Xenochironomus sp.

характерными особенностями, возникшими в результате узкой приспособленности к обитанию в тканях губок, являются: массивное, но малоподвижное тело; маленькая головная капсула; разделение лабрума на две лопасти, несущие длинные густые щетинки, которые, предположительно, выполняют функцию осязания. Личинки обоих видов не способны совершать ундулируюшие движения и не способны к фильтрационному питанию. Как и личинки S. gibbus, личинки Xenochironomus при извлечении из субстрата быстро гибнут.

4.3. Филогенетические отношения некоторых родов по данным морфологического анализа.

Для выявления межвидового филогенетического родства по морфологическим признакам личинки был отобран 41 вид хирономид из 24-х родов, относящихся к четырем подсемействам (см. гл. 2). Рассчитаны относительные попарные эволюционные расстояния между видами и построены филогенетические деревья с использованием двух алгоритмов – Mean, при котором оценивалось усредненное количество пар символьных различий, и Total, при котором программа оценивала общее количество парных различий (рис. 5).

Рис. 5. Схема филогенетического родства некоторых видов семейства Chironomidae, построенная по критерию минимального эволюционного расстояния с учетом общего количества пар символьных различий (TOTAL) Из представителей подсемейства Chironominae, наиболее близким к корню филогенетического дерева оказался род Xenochironomus, включающий два близких вида – Xenochironomus sp. и X. xenolabis. Расположение этих видов в отдельном кластере объясняется специфичностью их морфологии, обусловленной узкой специализацией личинок к минированию тканей губок.

Молекулярно-генетические данные (Глава 7) также показывают, что предковая форма Xenochironomus четко обособлена от других видов трибы Chironomini.

Наиболее эволюционно прогрессивной группой являются представители Chironomus и Glyptotendipes, что, в целом, согласуется с данными молекулярно-генетического анализа (Глава 7). Расположение на филограмме (рис. 5) Kiefferulus tendipediformis в одном кластере с видами Glyptotendipes свидетельствует о филогенетической близости двух родов, при этом дивергенция родов Kiefferulus и Glyptotendipes по морфологическим признакам личинки более выражена, чем дивергенция по нуклеотидным последовательностям (Глава 7).

В один большой кластер попали представители родов Endochironomus, Synendotendipes, Polypedilum, Sergentia (рис. 5), что, в целом, соответствует их положению на дендрограмме, иллюстрирующей время их возникновения (Глава 7). Stenochironomus gibbus входит в сборный кластер, объединяющий представителей как трибы Tanytarsini, так и Chironominae, что подтверждает его экологическую специфичность и особенности морфологии, отличающие его от большинства представителей трибы Chironominae – вогнутый ментум, редукция подталкивателей, отсутствие подставок преанальных кисточек и др.

(Макарченко, 2006).

Для более точного морфологического анализа хирономид-обрастателей и хирономид-минеров нами проанализированы признаки 20 видов хирономид, 10-ти родов подсемейства Chironominae, из которых фитофильных видов: Dicrotendipes nervosus, Demeijerea rufipes, Endochironomus albipennis, E. tendens, Glyptotendipes glaucus, G. gripekoveni, G. imbecillis, G. mancunianus, G. pallens, Kiefferulus tendipediformis, Phaenopsectra flavipes, Polypedilum sp. n., P. sordens, Stenochirоnomus gibbus, Synendotendipes kaluginae sp.n. Три бентосных вида рода Glyptotendipes – G.

barbipes, G. paripes и G. minutus sp. n. Два вида, минирующих ткани губок – Xenochironomus xenolabis и Xenochironomus sp.

Анализ проводился на основании 29 качественных и количественных морфологических признаков личинки. Данные признаки наиболее часто используются для установления видовой принадлежности этой группы родов. Построение филогенетических деревьев проводилось с использованием алгоритмов «Mean» и «Total» (рис. 6). В качестве внешней группы использован S. gibbus, как наиболее древний вид по данным молекулярного анализа (Глава 7.1).

Изученные виды группированы в три кластера (рис. 6). Первый кластер включает представителей родов Glyptotendipes, Demeijerea, Kiefferulus и Dicrotendipes. Представители рода Glyptotendipes образовали несколько групп. В первую попали эволюционно близкие между собой G. imbecillis и G.

mancunianus, личинки которых являются узкоспециализированными минерами живых тканей макрофитов. Во вторую объединены бентосные виды G. barbipes, G. paripes и G. minutus sp. n. В третью – фитофильные виды (G. glaucus, G. gripekoveni, G. pallens), личинки которых способны минировать как живые, так и разлагающиеся ткани водных макрофитов.

Филогенетические построения отражают экологическую специализацию личинок этого рода, отмеченную нами ранее (Дурнова, 2001).

K. tendipediformis по числу эволюционных шагов оказался ближе к G.

imbecillis и G. mancunianus, чем другие представители рода Glyptotendipes, что свидетельствует о том, что роды Glyptotendipes и Kiefferulus сходны по морфологии личинок. Близкое родство этих родов подтверждается результатами молекулярно-генетического анализа (Глава 7.1). В этом же кластере оказались Dicrotendipes nervosus и Demeijerea rufipes, морфологически сходные с видами Glyptotendipes по ряду признаков.

Рис. 6. Схема филогенетического родства некоторых фитофильных видов семейства Chironomidae (анализ по признакам личинок), построенная по построенная по алгоритму: Total Второй кластер объединяет представителей четырех родов – Endochironomus, Phaenopsectra, Synendotendipes и Polypedilum, что также согласуется с близким временем их возникновения, установленным по молекулярно-генетическим данным. Эти шесть видов являются минерами только растительных субстратов. Отдельный кластер образуют X. xenolabis и Xenochironomus sp. – облигатные минеры губок, обладающие комплексом морфологических особенностей, отражающих их специфический образ жизни.

Распределение видов по кластерам в филограмме соответствует не только их систематическому положению, но и экологической специализации, поскольку заселение личинками одинаковых субстратов определяет формирование у них сходных морфологических признаков.

ГЛАВА 5. Цитогенетический анализ хирономид перифитона зоны прибрежно-водных макрофитов водоемов Саратовской области В главе представлены результаты кариологического исследования всех видов хирономид, для которых в главе 4 даны подробные морфологические описания.

5.1. Кариотипы и хромосомный полиморфизм Род Glyptotendipes. Подробные описания кариотипа и хромосомного полиморфизма составлены для G. glaucus, G. pallens, G. gripekoveni, G.

paripes, G. minutus sp. n., G. barbipes, G. mancunianus и G. imbecillis. Проведен сравнительный анализ политенных хромосом видов рода. Ранее, у большинства этих видов обозначение плеч длинных хромосом проводилось произвольно, без учета гомеологии рисунка дисков. Опубликованная (Белянина, Дурнова, 1998) цитофотокарта хромосом G. glaucus и проведенный на ее основе сравнительный анализ хромосом видов Glyptotendipes позволили выделить в хромосомных плечах маркерные участки, которые четко прослеживаются в кариотипах G. glaucus, G.

gripekoveni, G. paripes, G. barbipes, G. pallens, G. mancunianus и G. imbecillis.

На основе установленной гомеологии рисунка дисков предложено изменить обозначение хромосомных плеч у 4-х видов рода и ввести универсальную маркировку плеч (в скобках указано старое обозначение плеч):

G. gripekoveni: A (B), B (A), C, D, E, F G. paripes: A (D), B (C), C (B), D (A), E, F G. barbipes: A (C), B (D), C (A), D (B), E, F G. salinus: A (C), B (D), C (A), D (B), E, F Обозначение хромосомных плеч у Glyptotendipes aequalis (Hirvenoja, Michailova, 1991), G. pallens (Michailova, Todorova, 1998), G. minutus sp. n.

(описан как Glyptotendipes sp. с 2n=4: Белянина, Дурнова, Шобанов, 1999), Glyptotendipes ospeli (Сontreras-Lichtenberg, Kiknadze, 2000), G. mancunianus и G. imbecillis (Дурнова, Белянина, 2001) соответствует обозначению плеч в кариотипе G. glaucus.

Анализ внутривидового полиморфизма изученных нами видов Glyptotendipes показал, что наиболее часто встречающимися перестройками являются парацентрические инверсии. Наиболее полиморфен бентосный вид G. barbipes (доля особей с гетерозиготными инверсиями 69-100%%; среднее число гетерозиготных инверсий на особь 1.25-1.70), наименее полиморфен высокоспециализированный минер макрофитов G. mancunianus (доля особей с гетерозиготными инверсиями 25-44%%; среднее число гетерозиготных инверсий на особь 0.25-0.44).

Род Endochironomus. Объективные сложности, возникающие при сравнительном кариотипическом анализе видов Endochironomus, обусловлены слабой гомологией рисунка дисков политенных хромосом.

Созданы цитофотокарты, составлены подробные описания кариотипа и хромосомного полиморфизма для E. tendens и E. albipennis. В кариофонде E.

tendens зарегистрированы и описаны 22 хромосомные последовательности, 19 из которых встречено нами в изученных водоемах. Число гетерозиготных инверсий на одну особь составило 1.37-2.35 (1.92). В кариофонде E.

albipennis зарегистрировано и описано 14 хромосомных последовательностей. Согласно нашим данным, средняя частота гетерозиготных инверсий на особь у этого вида составила 1.3-1.6 (1.5).

Род Synendotendipes. Созданы цитофотокарты, составлены подробные описания кариотипа и хромосомного полиморфизма для S. impar и S.

kaluginae. Для S. impar зарегистрировано 10 хромосомных последовательностей, число гетерозиготных инверсий на особь составило 1.2-1.4. Для S. kaluginae sp. n. впервые составлена цитофотокарта политенных хромосом. 2n=8. I=II=III›IV. Хромосомы III (AB), II (CD) и I (EF) – метацентрические, хромосома IV (G) – акроцентрическая. Описано хромосомных последовательностей; частота гетерозиготных инверсий на особь – 0.33-0.64 (0.51).

Род Polypedilum. Созданы цитофотокарты, составлены подробные описания кариотипа и хромосомного полиморфизма для Polypedilum sp. и Р.

sordens. В кариофонде P. sordens в настоящее время отмечено хромосомных последовательностей, из которых нами картировано 16. Число гетерозиготных инверсий на особь оказалось высоким во всех изученных популяциях – от 1.62 до 2.55. Для хромосомы I отмечена гетероморфность активных районов. Кариотип Polypedilum sp., морфологически сходного с P.

pedestre, описывается впервые. 2n=8. I(AB)>II(CD)III(EF)>IV(G).

Обнаружено 12 хромосомных последовательностей; число гетерозиготных инверсий на особь – 2.4. Выявлены две кариотипические формы P. sordens, отличающиеся гомозиготными инверсиями: личинки формы I заселяют разлагающиеся корневища и листья водных макрофитов, личинки формы II – живые листья макрофитов.

Род Kiefferulus. Кариотип личинок K. tendipediformis из России описывается впервые. 2n=8. Хромосомы I (АB) и II (CD) – субметацентрические; III (E) и IV (G) – акроцентрические, о чем свидетельствуют крупные блоки гетерохроматина (предположительно центромерного) на их концевых участках. Перестройки не зарегистрированы.

Род Phaenopsectra. Впервые описаны кариотипы двух видов. P.

flavipes: 2n=8, хромосомы I (АB) и II (CD) и III (EF) – субметацентрические;

хромосома IV (G) – акроцентрическая, центромеры представлены крупными блоками гетерохроматина. Phaenopsectra sp.: 2n=8, центромерные районы морфологически не выражены. По рисунку дисков политенных хромосомы эти виды существенно отличаются.

Род Demeijerea. Описан кариотип D. rufipes. 2n=6. В кариотипе имеется шесть хромосомных плеч, объединенных в хромоцентр, центромерные районы хромосом представлены гетерохроматиновыми блоками. Впервые проведено измерение хромосомных плеч и их обозначение, начиная с самого длинного плеча: rufA(IR)>rufB(IIIR)>rufC(IIR)>rufD(IL)rufE(IIL)>rufF(IIIL).

Хромосомные перестройки не зарегистрированы.

Род Xenochironomus. Впервые описан кариотип и создана цитофотокарта хромосом X. xenolabis. 2n=8. По-видимому, три длинные хромосомы являются субметацентрическими, четвертая короткая – телоцентрической. Из-за ассоциаций хромосом выяснить принадлежность каждого из плеч к определенной хромосоме не представляется возможным, только короткое плечо G может быть условно отнесено к хромосоме IV.

Хромосомные плечи: А= С >D>E>F>G. В кариотипе Xenochironomus sp.

В= имеется семь хромосомных плеч, которые объединены в хромоцентр;

Xenochironomus sp. хорошо отличается от X. xenolabis по рисунку дисков хромосом.

Род Stenochironomus. Впервые описан кариотип создана цитофотокарта хромосом S. gibbus. В кариотипе имеются три длинные и одна короткая хромосомы. I(AB)II(CD)II(EF)>IV(G). Центромеры морфологически не выражены. Во всех клетках слюной железы политенные хромосомы имеют относительно низкую степень политении. Хромосомные перестройки не зарегистрированы.

Род Parachironomus. Впервые описан кариотип создана цитофотокарта хромосом P. kuzini. 2n=8. В интерфазных ядрах клеток слюнных желез наблюдается объединение морфологически хорошо выраженных центромерных районов длинных хромосом. Зарегистрировано хромосомных последовательностей; частота гетерозиготных инверсий на особь составила 1.45.

Род Microtendipes. Описан кариотип и инверсионный полиморфизм M.

pedellus. Выявлено 12 хромосомных последовательностей; число гетерозиготных инверсий на особь – 1.2. Характерной особенностью изученных личинок является гетерозиготность по центромерному гетерохроматину в хромосоме I (AB).

5.2. Особенности пространственной организации политенных хромосом в интерфазных ядрах Рассмотрены некоторые особенности пространственной организации политенных хромосом 15-ти видов хирономид перифитона: относительное содержание прицентромерного и интеркалярного гетерохроматина, частота эктопических контактов между негомологичными хромосомами, наличие особых структурных элементов кариотипа – В-хромосом и хромосомных узлов («knobs»).

Glyptotendipes glaucus и G. pallens. 2n=8. Эктопические контакты хромосом в кариотипе этих видов редки (частота 2.0-2.5%%), при этом обнаружены только межхромосомные ассоциации типа теломера-теломера (Т-Т) между плечом G и плечами C, E, A и F. Коньюгация теломерных районов длинных хромосом выявлена только между плечами B и E.

G. gripekoveni. 2n=8. В хромосомах G. g. gripekoveni (кариоформа I) содержится относительно меньше прицентромерного гетерохроматина по сравнению с G. g. paragripekoveni (форма II); межхромосомные ассоциации у личинок этого подвида не обнаружены. Гомологи хромосомной пары IV иногда ассоциируют только терминально расположенными центромерами. У G. g. paragripekoveni выявлены частые хромосомные ассоциации разных типов, а также В-хромосомы и хромосомные узлы. Среди хромосомных ассоциаций наиболее часто (у 15% особей) наблюдались ассоциации типа центромера-центромера (Ц-Ц). У гибридов между подвидами обнаружена четкая картина гетерозиготности по центромерным районам – у гомолога, принадлежащего G. g. paragripekoveni, блок ГХ заметно крупнее.

G. mancunianus. 2n=8. Центромеры морфологически слабо выражены.

Ассоциации негомологичных хромосом не обнаружены.

G. imbecillis. 2n=8. Центромеры имеют вид крупных гетерохроматиновых блоков. Зарегистрированы ассоциации типа Ц-Ц.

Endochironomus tendens. 2n=6. Характерной особенностью этого вида являются частые ассоциации хромосом типа Т-Т. У личинок цитотипа II с высокой частотой встречаются разные варианты ассоциаций негомологичных хромосом (Т-Т с частотой 70-100%%, Ц-Ц – 6-11%%, Т-Ц – 9-13%%). У личинок цитотипа I обнаружены только ассоциации типа Т-Т, их частота не превышала 30%.

E. albipennis. 2n=6. Центромеры морфологически не выражены.

Обнаружены эктопические контакты Т-Т типа между плечами С и А, D и B, C и (EG).

Synendotendipes impar. 2n=8. Центромеры имеют вид толстых дисков.

Обнаружены эктопические контакты между теломерами разных хромосом, S. kaluginae sp. n. 2n=8. Центромеры морфологически не выражены.

Обнаружены эктопические контакты между теломерами разных хромосом, а также между обеими теломерами одной хромосомы.

Polypedilum sordens. 2n=6. Центромеры морфологически выражены слабо, эктопические контакты не выявлены. У 5.5% личинок из р. Красавки обнаружены В-хромосомы.

Kiefferulus tendipediformis. 2n=8. Центромеры гетерохроматизированы.

Обнаружены ассоциации между центромерами хромосом IV и II.

Stenochironomus gibbus. 2n=8. Центромеры морфологически не выражены. Характерной особенностью является меандрическая структура хромосом и слабая степень политении. Последнее, вероятно, обусловлено отсутствием необходимости строить ловчие сети и вырабатывать соответствующие секреты.

Demeijerea rufipes. 2n=6. Хромосомы объединены гетерохроматизированными центромерами в непрочный хромоцентр.

Xenochironomus xenolabis. 2n=8. Прицентромерные районы длинных хромосом и прицентромерный район акроцентрической хромосомы объединены в общий хромоцентр с прочной коньюгацией ассоциирующих районов. Хромоцентр образован пучками хромонем, объединяющих хромосомные плечи. По классификации Бауера (Bauer, 1936), такую организацию интерфазного ядра можно отнести к «типу Drosophila». По классификации Бауера (Bauer, 1936), такую организацию интерфазного ядра можно отнести к «типу Drosophila». По морфологической классификации (Шобанов, 2002), центромеры этого вида соответствуют с-центромерам.

Parachironomus kuzini. 2n=8. Хромосомы объединены центромерами в непрочный хромоцентр.

У изученных видов, личинки которых облигатно минируют ткани губок, наблюдается своеобразная пространственная организация интерфазного ядра, выражающаяся в относительно прочной ассоциации центромерных районов негомологичных хромосом как у Xenochironomus xenolabis (Белянина, Дурнова, 2002), или в менее прочной ассоциации, как у Demeijerea rufipes (Белянина, 1993). Вероятно, для стенотопных видов, находящихся в относительно постоянных условиях среды обитания, характерна упорядоченная пространственная организация хромосомного набора (образование хромоцентров), более низкая частота хромосомных перестроек и менее выраженная вариабельность кариотипа по сравнению с эвритопными видами.

У всех изученных видов, личинки которых обрастают или минируют растительные ткани, хромоцентр не обнаружен. В большинстве случаев эктопические контакты встречаются редко. Важно отметить, что ассоциации негомологичных хромосом – редкое явление как у эвритопного G. glaucus (около 2.5%), так и у высокоспециализированных минеров живых тканей растений – Glyptotendipes mancunianus и G. imbecillis (у этих видов выявлены единичные случаи эктопических контактов). Однако если у фитофильных видов наблюдается увеличение количества прицентромерного гетерохроматина, то, как следствие этого, у них резко увеличивается частота контактов между хромосомами – например, у Endochironomus tendens (кариотипическая форма I) и у Glyptotendipes gripekoveni (кариотипическая форма II).

ГЛАВА 6. Пути и механизмы внутривидовой и межвидовой дифференциации кариотипов у хирономид перифитона 6.1. Изменение массы прицентромерного гетерохроматина и хромосомные перестройки 6.1.1. Изменение количества гетерохроматина как один из путей эволюции кариотипа У хирономид известно несколько случаев дивергенции кариотипа за счет увеличения массы прицентромерного гетерохроматина (ГХ), например – при формировании видов-близнецов Chironomus plumosus и Ch. borokensis (Керкис и др., 1988), гомосеквентных видов Ch. agilis 1 и Ch. agilis (Кикнадзе и др., 1991а), видов-близнецов Glyptotendipes barbipes и G. salinus (Michailova, Nikolov, 1992). В нашем материале не обнаружено видов, отличающихся только по массе ГХ, однако, по нашим данным, у нескольких изученных нами таксонов в процессе межвидовой дифференциации, наряду с хромосомными перестройками, происходило изменение количества прицентромерного ГХ.

1. Подвиды Glyptotendipes gripekoveni gripekoveni и G. g.

paragripekoveni хорошо различаются не только по наличию гомозиготных инверсий, но и по содержанию прицентромерного ГХ – у G. g. gripekoveni центромерный район имеет вид толстого диска, а у G. g. paragripekoveni – это крупный шайбообразный гетерохроматиновый блок. При симпатрическом обитании, отсутствие репродуктивной изоляции приводит к появлению гибридов между подвидами. У гибридов в хромосоме I четко прослеживалась гетерозиготность по массе прицентромерного ГХ.

2. G. minutus sp. n. (2n=4) предположительно возник от близкого ему G.

paripes (2n=8). Процессы дивергенции и формирования нового вида сопровождались тандемными слияниями хромосомных плеч и увеличением массы прицентромерного ГХ. В процессе межвидовой дифференциации в кариотипе G. minutus появились два крупных блока прицентромерного ГХ, которых нет в кариотипе G. paripes.

6.1.2. Межхромосомные перестройки (транслокации и тандемные слияния) Уменьшение диплоидного числа хромосом за счет тандемных слияний считается одной из основных тенденций эволюции кариотипа в семействе Chironomidae (Bauer, 1945; Keyl, 1962; Steffan, 1966; Martin et al., 1974;

Белянина, 1983; Michailova, 1989а; Петрова, 1992; Кикнадзе и др., 1993;

Шобанов, 2004). При слиянии хромосом образуется структурно дицентрическая, но функционально моноцентрическая хромосома (Кикнадзе и др., 1993). Однако не исключается и противоположная ситуация, т. е.

возникновение кариотипов с 2n=8 и 2n=6 из исходных кариотипов с 2n=6 и 2n=4, соответственно (Петрова, 1983). Нами рассмотрена роль транслокаций в эволюции родов Glyptotendipes и Kiefferulus.

Роль транслокаций в эволюции рода Glyptotendipes По нашему мнению, кариотип G. minutus sp. n. с 2n=4 сформировался в ходе тандемных слияний хромосом типов Ц-Т и Т-Т в кариотипе предкового вида с 2n=8 (или 2n=6), а также внутрихромосомных перестроек в плечах A, B, C и D. Анализ рисунка дисков политенных хромосом G. minutus sp. n.

показал его значительное сходство c рисунком дисков в хромосомах G.

paripes, для которого характерно сочетание хромосомных плеч – AB (I), CD (II), EF (III), G (IV). Согласно нашей гипотезе, слияние двух длинных хромосом (II и III) теломерными участками привело к появлению у G.

minutus sp. n. комбинации их четырех плеч в хромосоме I (CDEF), а слияние теломеры длинной субметацентрической хромосомы I и центромеры короткой хромосомы IV привело к возникновению у G. minutus sp. n.

комбинации из трех плеч в хромосоме II (ABG).

Нами установлено, что наряду с небольшим числом хромосом (для большинства видов Glyptotendipes характерен кариотип с 2n=8), в кариотипе G. minutus sp. n. наблюдается резкое увеличение количества прицентромерного гетерохроматина по сравнению с близким ему G. paripes.

Предполагается, что увеличенное содержание гетерохроматина в геноме и относительно высокий уровень хромосомного полиморфизма (число гетерозиготных инверсий на особь – 0.80) позволяют G. minutus sp. n.

компенсировать низкую степень комбинативной изменчивости при малом числе хромосом.

Роль транслокаций в эволюции рода Kiefferulus В этом роде, K. tendipediformis имеет 2n=8, в то время как близкий ему вид Kiefferulus sp. – 2n=6 (Michailova et al., 2005). Особенностью кариотипа K. tendipediformis является присутствие длинной акроцентрической хромосомы, которая содержит крупный блок ГХ, расположенный дистально в плече Е. Можно предположить, что кариотип Kiefferulus sp. с 2n=6 возник в результате тандемного слияния хромосомы III (EF) и IV (G) в кариотипе исходного вида с 2n=8 (рис. 6).

В пользу этого предположения свидетельствуют обнаруженные нами у K. tendipediformis временные (неустойчивые) ассоциации негомологичных хромосом типа Ц-Ц между дистально расположенной центромерой плеча Е хромосомы III (EF) и центромерой метацентрической хромосомы I (AB).

Рис. 6. Схема центрического слияния хромосом в процессе видообразования Kiefferulus sp. (2n=6) от Kiefferulus tendipediformis Goetgh.

(2n=8) 6.1.3. Внутрихромосомные перестройки (инверсии, дупликации, делеции) Инверсионный полиморфизм – наиболее характерный тип хромосомного полиморфизма у хирономид в целом (Белянина, 1983;

Michailova, 1989а; Petrova, 1980; Керкис 1989; Кикнадзе и др., 1991б, 1996) и у перифитонных хирономид, в частности. Наиболее высокий уровень хромосомного полиморфизма, обусловленный гомо- и гетерозиготными инверсиями, демонстрируют эврибионтные виды, способные заселять разнообразные погруженные субстраты.

В отличие от кариотипической эволюции в пределах рода Chironomus (Полуконова, 2005), для видов которого характерны реципрокные транслокации целых хромосомных плеч, в пределах родов Polypedilum, Glyptotendipes и Endochironomus эволюционные преобразования были сопряжены с внутрихромосомными перестройками, сильно изменяющими рисунок дисков у близких видов одного рода. Следствием этого является трудность или невозможность установления гомеологии хромосомных плеч у видов одного рода, что, если и удается, то только по отдельным маркерным зонам.

6. 2. Межвидовая и внутривидовая гибридизация Гибридизация как один из механизмов хромосомной эволюции играла заметную роль в видообразовании хирономид (Полуконова, Белянина, 2002;

Полуконова, 2005). Чаще всего выявляются случаи интрогрессивной гибридизации, которая заключается в образовании естественных гибридов Fи их возвратном скрещивании с родительскими особями. При интрогрессивной гибридизации происходит частичное внесение генов одного вида в генотип другого. Известно несколько примеров интрогрессивной гибридизации видов Chironomus (Butler et аl., 1999; Полуконова, Белянина, 2002; Michailova, Petrova, 2004; Голыгина и др., 2007). К настоящему времени, в том числе с нашим участием (Белянина, Полуконова, Дурнова, 2003), обнаружены гибриды между некоторыми видами, относящимися к родам Glyptotendipes и Endochironomus (Michailova, 1989b, 1992, 1996a,b, 1998; Michailova, Belcheva, 1989; Michailova, Contreras-Lichtenberg, 1995).

Примеры гибридизации у хирономид-минеров Род Glyptotendipes (Glyptotendipes glaucus, G. pallens и гибриды Glyptotendipes glaucus G. pallens) Близкие виды Glyptotedipes glaucus и G. pallens длительное время не были дифференцированы, а их видовые названия считались синонимами (Goethebuer, 1937; Калугина, 1963б). Позднее были выявлены кариотипические и некоторые морфологические различия между G. glaucus и G. pallens (Michailova, Contreras-Lichtenberg, 1995) и отмечены случаи природной гибридизации между этими видами (Michailova, 1996b, 1998).

Во всех изученных нами водоемах доминировали личинки G. glaucus (gla), однако во всех пробах с разной частотой были обнаружены гибридные особи G. glaucus G. pallens (glapal) и очень редко – личинки G. pallens (pal). Так как кариотипы двух видов, в основном, отличаются двумя инверсиями в плечах D и G (Michailova, Contreras-Lichtenberg, 1995;

Michailova, 1996b), мы обозначили хромосомные последовательности следующим образом: glaD1 – D, плечо palD1 – D*, glaG1 – G, palG1 – G* (знаком* отмечены последовательности, принадлежащие G. pallens).

Встреченные нами у личинок разные сочетания хромосомных последовательностей у личинок указывают на то, что в большинстве водоемов Саратовской области происходили и происходят различные варианты скрещиваний G. glaucus и G. pallens (прямое скрещивание, возвратные скрещивания, скрещивание гибридов между собой). Мы проанализировали все возможные варианты скрещиваний (рассматривали только хромосомные плечи D и G):

1. Прямое скрещивание:

P: DDGG D*D*G*G* gla pal F1: DD*GG* гибрид F 2. Возвратные скрещивания:

а) P: DD*GG* DDGG гибрид F gla F2: DDGG; DD*GG*; DDGG*; DD*GG gla гибриды F б) P: DD*GG* D*D*G*G* гибрид F pal F2: D*D*G*G*; DD*GG*; D*D*GG*; DD*G*G*;

…..pal………………………….. гибриды F 3. Скрещивание гибридов F1 между собой:

P: DD*GG* DD*GG* гибрид F гибрид F 1 F2: 4DD*GG*; 2DDGG*; 2DD*GG; 2D*D*GG; 2DDG*G*; 1DDGG;

1D*D*G*G*; 1DD*G*G*; 1D*DGG гибриды F В плечах D и G были встречены все девять теоретически возможных вариантов сочетаний хромосомных последовательностей. Преобладающими оказались сочетания, возникающие при возвратном скрещивании (гибрид F1pal) и при скрещивании гибридов F1 между собой: DDGG* и DD*GG (0.40). Поскольку в изученной популяции по частоте встречаемости преобладали последовательности, принадлежащие G. glaucus, можно предположить, что этот вид «поглощает» G. pallens. Получая в результате интрогрессии ряд генов G. pallens, G. glaucus, вероятно, быстрее приспосабливается к условиям обитания.

2. Гибридизация между подвидами Glyptotendipes gripekoveni gripekoveni и G. g. paragripekoveni Оба подвида – G. g. gripekoveni и G. g. paragripekoveni широко распространены в водоемах Саратовской области и в ряде случаев обитают симпатрично. Образование гибридов ними рассматривается как пример интрогрессивной гибридизации.

Анализ хромосомных последовательностей у гибридов показал, что большинство из них (плечи A, C, D, E, F) принадлежат G. g. gripekoveni, но гомологи плеч B и G почти не коньюгируют между собой, так как в этом случае наблюдается сочетание последовательностей, принадлежащих разным подвидам: griA1 и paragriA1, griG1 и paragri G1. Вероятно, в данном случае подвидом-донором служит G. g. paragripekoveni, а подвидом-реципиентом G. g. gripekoveni. Так как эти подвиды еще не достигли уровня репродуктивной изоляции, многократные возвратные скрещивания между ними приводят в настоящее время к возникновению популяционных систем, состоящих из гибридных форм с сочетанием хромосомных последовательностей, наиболее оптимальным в данных условиях среды. Не исключена возможность того, что появление и массовое размножение гибридных форм представляет собой этап возникновения нового вида гибридного происхождения.

6.3. Соотношение морфологической и кариотипической дифференциации в процессе видообразования Соотношение морфологической и фенотипической дивергенции у перифитонных хирономид рассматривается нами на примере двух близких видов Glyptotendipes.

Анализ морфологической дивергенции личинок Glyptotendipes glaucus, G. pallens и гибридов между ними Личинки G. glaucus и G. pallens отличаются друг от друга по ряду качественных признаков. Личинка G. glaucus имеет коричневую головную капсулу, ланцетовидную щетинку под зубцами мандибулы; ее отростки на VIII брюшном сегменте имеют вид небольших валиков. У личинки G. pallens желтая головная капсула, заметные отростки на VIII брюшном сегменте, листовидная щетинка под зубцами мандибулы. Так как в изученных водоемах происходили многочисленные события межвидовой гибридизации, приводящие к появлению особей с промежуточными признаками, диагностика личинок с использованием только качественных морфологических признаков оказалась затруднена. В связи с этим, мы проанализировали 21 количественный признак личинок G. glaucus и G.

pallens. Девять признаков (ширина ментума, М2, высота срединного зубца ментума, высота первого бокового зубца ментума, длина мандибулы, AR, расстояние от основания антенны до кольцевого органа, длина 3-го членика антенны) позволяют отнести отдельную особь к одной из трех (включая гибридов) групп. Корректность отнесения личинки к G. pallens составила 100%, к G. glaucus и гибридам – 95% и 75%, соответственно (рис. 7).

Root 1 vs. Root --- G. glaucus - G. glaucus x pallens -6 -5 -4 -3 -2 -1 0 1 2 3 4 G. pallens Root Рис. 7. Графическое отображение результатов дискриминантного анализа морфологических различий Glyptotendipes glaucus, G. pallens и гибридов между ними (G. glaucus G. pallens).

Root Анализ цитогенетической дивергенции личинок Glyptotendipes glaucus, G. pallens и гибридов между ними С целью установления уровня дивергенции кариотипов изученных популяций был проведен сравнительный анализ частот последовательностей в плечах D и G и определены цитогенетические расстояния (Dcg) между всеми изученными пробами. Был также проведен комплексный анализ частот обнаруженных хромосомных последовательностей во всех хромосомных плечах и рассчитаны соответствующие цитогенетические расстояния (Dcg) между изученными пробами (рис. 8).

0,24 0,22 0,20 0,18 0,16 0,14 0,12 0,10 0,08 0,06 0,04 0,Рис. 8. Дендрограмма цитогенетических расстояний по критерию Нея (Nei, 1972) между выборками №№ 1-13 из различных популяций Glyptotendipes glaucus и G. pallens, построенная с учетом выявленных хромосомных отличий Среднее цитогенетическое расстояние между изученными пробами как по плечам D и G (0.279±0.053), так и по всем хромосомным плечам (0.092±0.0156) соответствует цитогенетическим расстояниям между популяциями одного вида, установленным на примере Chironomus (Голыгина, 1999; Гундерина, 2001).

Анализ частот последовательностей во всех хромосомных плечах G.

pallens и G. glaucus показал, что наибольшее значение имеют различия не только по плечам D и G, которые дифференцируют виды, но и по плечу В, в котором инверсионная последовательность В2 встречалась с высокой частотой как в гомо-, так и в гетерозиготном состоянии. При сравнении частот отдельных последовательностей между пробами из разных субстратов обнаружены достоверные отличия:

по плечу В – между пробами №1 (разлагающаяся древесина) и №(тростник) (при 5% уровне значимости), а также между пробами № (тростник) и №12 (ткани губок) (при 5% уровне значимости);

по плечу D – между пробами №4 и №12 (при 0.1% уровне значимости) и между пробами №1 и №12 (при 0.1% уровне значимости);

по плечу G – между пробами №4 и №12 (при 0.15% уровне значимости) и между пробами №1 и №12 (при 0.1% уровне значимости). Вероятно, можно говорить о селективном отборе в пользу инверсии В2, так как с высокой частой она встречалась у личинок G. glaucus, минирующих разлагающиеся растительные ткани, а с низкой частой – у личинок G. glaucus, заселяющих живые ткани макрофитов, а также у гибридов G. glaucus G. pallens.

Установлено, что в зависимости от соотношения в генотипе хромосомных последовательностей G. glaucus или G. pallens, личинки занимают различные экологические ниши. Так, населяя один водоем, личинки «pallens» и «glaucus» стремятся занять различные местообитания – в оз. Сазанка особи с преобладанием последовательностей «pallens» обитали в тканях губок, а особи с преобладанием последовательностей «glaucus» в разнообразных растительных субстратах. Однако имаго «pallens» и «glaucus» свободно скрещиваются друг с другом, давая плодовитое потомство.

Полученные данные позволяют высказать предположение, что в настоящее время уровень дифференциации между G. glaucus или G. pallens соответствует подвидовому статусу – G. glaucus glaucus и G. glaucus pallens.

ГЛАВА 7. Происхождение фитофильных хирономид по результатам анализа митохондриального гена COI 7.1. Построение дендрограммы Установлена нуклеотидная последовательность фрагмента гена мтДНК цитохром оксидазы I (COI) протяженностью 100-634 нп (всего 535 нп) у видов хирономид (Глава 2). Преимущество использования аминокислотной последовательности при реконструкции родственных связей надродовых таксонов хирономид было показано ранее (Демин и др., 2010), поэтому для построения дендрограммы все полученные нуклеотидные последовательности, а также последовательности, взятые из GeneBank, были транслированы в аминокислотные. Длина анализируемого фрагмента аминокислотной последовательности составила 138 ак.

Аминокислотная матрица включила 109 последовательностей, принадлежащих представителям 29 родов. Количество вариабельных сайтов составляет 38%, средний уровень различий между двумя анализируемыми последовательностями – 5%, что делает аминокислотную последовательность COI достаточно консервативным маркером при реконструкции родственных взаимосвязей как между филогенетически отдаленными, так и между близкими таксонами. В качестве внешней группы выбраны два представителя рода Culicoides, относящегося к наиболее близкому Chironomidae семейству Ceratopogonidae (Nematocera, Diptera) и Ogcodes basalis – представитель филогенетически удаленного от Chironomidae семейства Acroceridae (Brachicera, Diptera).

Из дистатных методов построения наибольшее значение бутстрепподдержки получила дендрограмма родственных связей хирономид, основанная на методе минимальной эволюции Minimum Evolution - MEдендрограммы (Демин и др., 2010). Для расчета генетических дистанций нами использовался алгоритм Number of differences. Полученная MEдендрограмма была линеаризирована и использована для расчета времени дивергенции фитофильных хирономид. Калибровка молекулярных часов проводилась по установленному Бертоне (Bertone, 2008) времени дивергенции семейств Chironomidae и Cheratopogonidae – 213 млн.л.н. Среди дискретных методов наибольшую поддержку и хорошую разрешающую способность продемонстрировал метод Байеса (Демин и др., 2010). Для оценки аминокислотных замен был использован алгоритм Poisson correction.

Параметры Markov Chain Monte Carlo: 1000000 генераций, отбор дерева проводился через каждые 10 генераций, количество типов замен – 1 (JC69 or F81). Полученная Байес-дендрограмма также была линеаризирована и использована для расчета времени.

Сравнение МЕ- и Байес-дендрограмм показало принципиальное сходство в кластеризации таксонов, что позволило использовать полученную топологию для оценки времени дивергенции. В итоговом варианте за базовую была принята ME-дендрограмма, так как на ней более четко дифференцированы рода Polypedilum, Sergentia и Stenochironomus (рис. 10).

Диапазон времени дивергенции узлов итоговой дендрограммы складывался из крайних значений времени дивергенции, рассчитанных для узлов на Байес-дендрограмме, и значений времени дивергенции для узлов ME-дендрограммы. На этой же дендрограмме в основных узлах приведены значения поддержки, рассчитанные для обеих дендрограмм.

7.2. Анализ МЕ-дендрограммы Проанализированы фитофильные представители двух подсемейств комаров-звонцов – Ortocladiinae и Chironominae, которые дифференцировались около 130-109 млн.л.н. (рис. 10). В подсемействе Ortocladiinae обрастателями погруженных субстратов (камней, растений, бревен) являются представители рода Orthocladius (Макарченко, 2006). В роде Cricotopus есть как обрастатели камней (C. trifascia и другие виды), так и фитофильные виды (C. sylvestris и C. glacialis) (Панкратова, 1983). По нашим данным, время дивергенции Orthocladius и Cricotopus составляет около 33-31 млн.л.н. Приблизительно 28-26 млн.л.н. начали дивергировать друг от друга представители рода Cricotopus, среди которых около 26-млн.л.н. происходит обособление от видов-обрастателей фитофильных видов C. sylvestris и C. glacialis. По-видимому, возникновение хирономид, обрастателей камней и других погруженных субстратов, в эволюционной ветви ортокладиин дало начало переходу личинок на водную растительность и массовому образованию видов-обрастателей высшей водной растительности, процветающих в настоящее время.

Рис. 10. Итоговая дендрограмма, иллюстрирующая время возникновения фитофильных хирономид подсемейств Orthocladiinae и Chironominae, основанная на аминокислотной последовательности фрагмента COI. Римскими цифрами обозначены кластеры родов в трибе Chironomini. В узлах дендрограммы через дефис указан диапазон времени дивергенции, в скобках через косую черту – значения поддержки узлов согласно МЕ- и Байес-дендрограммам Триба Chironomini четко подразделяется на два кластера, время дивергенции которых от общего предка – около 65-62 млн.л.н. В кластер I входят роды Glyptotendipes, Kiefferulus, Dicrotendipes и Xenochironomus, содержащие фитофильные виды G. imbecillis, G. mancunianus (минеры живой растительности), G. glaucus, G. gripekoveni (минеры и обрастатели растительности) и D. nervosus (обрастатель любых субстратов). В этот же кластер входят Xenochironomus sp. и X. xenolabus (минеры живых губок).

Четкая обособленность предковой формы Xenochironomus от других видов трибы Chironomini вызвана спецификой его образа жизни на стадии личинки – узкой специализацией к минированию такого древнего таксона животных как губки. Дивергенция предковой формы на Xenochironomus sp. и X.

xenolabis происходила только спустя 25 млн.л. (не ранее 11 млн.л.н.).

Очевидно, что уровень отличий по аминокислотным последовательностям у Xenochironomus sp. и X. xenolabis превышает внутривидовой уровень, что дает основания считать их разными видами. Кариотипически эти виды очень хорошо дифференцируются, гомология между политенными хромосомами почти отсутствует, но по морфологии личинок виды сходны между собой (Durnova, 2009). Кластер II включает роды Endochironomus и Polypedilum, содержащие фитофильные виды E. tendens, P. sordens (минеры живой и разлагающейся водной растительности), Synendotendipes kaluginae (минер разлагающейся водной растительности) и E. albipennis (обрастатель).

В кластере I наиболее древними являются минеры живых губок (виды рода Xenochironomus), дивергировавшие от остальных родов около 37-млн.л.н.. Наиболее молодые представители данной эволюционной ветви – виды-минеры и обрастатели живой растительности (Glyptotendipes), возникшие около 23-21 млн.л.н. Неспециализированные обрастатели водных субстратов (Dicrotendipes) возникли около 24-21 млн.л.н., то есть немного раньше появления видов-минеров живой растительности. В результате в данном кластере у хирономин, так же как и у ортокладиин, появление обрастателей предшествует возникновению минеров водной растительности.

Виды Dicrotendipes составляют в этой группе обособленную базальную ветвь, в связи с чем, можно предположить, что его предковая форма как обрастателя могла дать начало обрастателям различных субстратов, в т.ч. и высшей водной растительности.

В кластере II наиболее древним является менее специализированный Polypedilum sordens – обрастатель и минер разлагающейся водной растительности, возникший около 65-42 млн.л.н.. Наиболее молодыми (возникли около 11-10 млн.л.н.) являются более специализированные по субстратам представители: с одной стороны, вид-обрастатель Endochironomus albipennis, с другой – вид-минер живой и разлагающейся водной растительности E. tendens и вид-минер только разлагающейся водной растительности Synendotendipes kaluginae. Полученные данные свидетельствуют о наметившейся в данном кластере специализации.

Возникновение способности к минированию водной растительности у личинок комаров-звонцов происходило независимо в разных таксономических группах и в разное время – у хирономин: Р. sordens около 65-42 млн.л., Glyptotendipes, Kiefferulus и Dicrotendipes не ранее 24 млн.л.н., Endochironomus albipenis не ранее 11 млн.л.н.; у ортокладиин: Cricotopus около 37 млн.л.н.

Время дивергенции родов, включающих фитофильные виды и видыобрастатели, как среди хирономин (Dicrotendipes, Glyptotendipes, Kiefferulus), так и среди ортокладиин (Orthocladius, Cricotopus) – приблизительно около 28-21 млн.л., что совпадает с началом формирования озер эвтрофного типа – 23 млн.л.н. (Калугина, Жерихин, 1975).

Полученные нами данные подтверждают высказанное ранее предположение Калугиной (1960, 1963а,б), что у хирономид обрастание могло предшествовать переходу к минированию водной растительности.

Первые фитофильные виды-минеры водной растительности могли появиться уже 65 млн.л.н., а дивергенция предковых фитофильных родов (минеров водной растительности) Glyptotendipes и Kiefferulus от бентосных видов произошла около 23-21 млн.л.н..

Особое положение на дендрограммах занимает Stenochironomus gibbus (рис. 10), по морфологии относимый систематиками к трибе Chironomini подсемейства Chironominae (Панкратова, 1983; Pinder, Reiss, 1983;

Макарченко, 2006). По данным анализа аминокислотных последовательностей COI, предок этого вида возник одновременно с предковой формой, от которой дивергировали подсемейства Chironominae и Orthocladiinae. S. gibbus образует отдельную эволюционную ветвь, не примыкающую ни к кластеру Orthocladiinae, ни к кластеру Chironominae.

Обособление S. gibbus, личинки которого минируют погруженную древесину, и, по-видимому, истинного ксилобионта, происходило вместе с предковой формой Chironominae и Orthocladiinae около 178-130 млн.л.н. (рис.

10), что свидетельствует о его древнем происхождении. Личинки S. gibbus существенно отличаются от других представителей хирономид как по морфологии (Калугина, 1958а; Панкратова, 1983), так и по кариотипу (Дурнова, 2010). Вероятно, его образ жизни, связанный с узкой специализацией, способствовал сохранению определенного комплекса уникальных морфологических и кариотипических особенностей.

Образование минера древесины S. gibbus предшествовало возникновению как видов-обрастателей, так и видов-минеров растений и происходило в конце ранней меловой эпохи. Как известно (Калугина, Жерихин, 1975), в этот исторический период из растительности господствовали голосеменные, высшая водная флора практически полностью отсутствовала; преобладали водоемы олиготрофного типа, накопление донных осадков происходило крайне медленно. Такие условия олиготрофных водных экосистем служили серьезной преградой для формирования сообществ фитофильных и нехищных бентосных хирономид. Среди хирономид подсемейств Chironominae и Orthocladiinae, наряду с видамиобрастателями различных погруженных субстратов, могло происходить формирование преимущественно видов-минеров древесины. Минеры древесины к настоящему времени сформировали узкоспециализированные роды, став истинными ксилобионтами, в отличие от видов-минеров водной растительности, у которых биотопическая приуроченность только наметилась.

Переход личинок Chironоmidae, как и других двукрылых, к питанию за счет высших растений начался в относительно недавнее время, и фитофаги еще не обособились в отдельные роды (Нарчук, 1977). Наличие в одном роде (например, Glyptotendipes) как фитофильных видов-минеров и видовобрастателей, так и бентосных видов обусловлено тем, что для личинок многих современных представителей трибы Chironоmini характерен фильтрационный способ питания, хотя при выгрызании в тканях водного растения хода, или мины происходит частичное поглощение личинкамиминерами растительных тканей. Освоение личинками хирономид живых растений в качестве пищевого субстрата и дальнейшая специализация в этом направлении может привести к значительному расцвету фитофильных видов хирономид.

ВЫВОДЫ 1. По нашим данным, в зоне прибрежно-водных макрофитов водоемов Саратовской области встречаются 27 видов и 13 родов хирономид (из них видов описаны нами как новые для науки). 25 видов из 12 родов относятся к подсемейству Chironominae (Glyptotendipes, Endochironomus, Synendotendipes, Polypedilum, Kiefferulus, Dicrotendipes, Phaenopsectra, Microtendipes, Xenochironomus, Stenochironomus, Demeijerea и Parachironomus) и 2 вида рода Cricotopus – к подсемейству Orthocladiinae. Виды Glyptotendipes gripekoveni и Endochironomus tendens представлены каждый двумя цитотипами.

2. В зависимости от адаптаций личинок к минированию и/или обрастанию разнообразных погруженных субстратов можно выделить семь основных групп хирономид: обрастатели любых погруженных субстратов;

эвритопные виды, сочетающие обрастание с минированием; минеры преимущественно разлагающихся растительных тканей; минеры отмирающих и живых тканей макрофитов; минеры только живых макрофитов; минеры полуразложившейся древесины; облигатные и факультативные минеры тканей пресноводных губок (комменсалы).

3. Дифференциация близких видов на разных стадиях развития (особенно личинки и куколки) должна основываться не только на качественных, но и на количественных признаках внешней морфологии: для личинок – minLC, AR, M1, M2, толщина антенны на уровне RO, высота срединного и 1-го бокового зубца ментума, расстояние между внутренними углами VmP, VmPR; для куколок – форма шипов TVIII, AlW, AlL, ALR; для куколок рода Glyptotendipes – длина хитиновых пластинок на тергитах, ChPlR.

4. У представителей рода Glyptotendipes адаптации личинок к бентосному или минирующему образу жизни выражаются в особенностях строения ментума (крутизна дуги ментума, форма его зубцов) и строении зубцов в основании максилл. У видов, адаптировавшихся к минированию живых тканей макрофитов, по сравнению с бентосными видами, крутизна дуги ментума резко увеличена, зубцы ментума более острые, имеются длинные конические зубцы в основании максилл.

5. В диагностике близких видов на стадии личинки наиболее надежным маркером является рисунок дисков политенных хромосом. На основе рисунка дисков описаны два новых для науки вида (Synendotendipes kaluginae Durnova, 2010, Glyptotendipes minutus sp. n.) и выявлены еще четыре вида (Xenochironomus sp. n., Endochironomus sp. n., Polypedilum sp. n. и Phaenopsectra sp. n.). Впервые описаны кариотипы 4-х видов (Glyptotendipes imbecillis, Xenochironomus xenolabis, Stenochironomus gibbus, Phaenopsectra flavipes) и составлены подробные цитофотокарты политенных хромосом видов из 7 родов. Детально изучен хромосомный полиморфизм 13-ти массовых видов (из 5 родов) с детальным описанием инверсионных хромосомных последовательностей. Для семи видов рода Glyptotendipes (G.

glaucus, G. gripekoveni, G. barbipes, G. paripes, G. minutus, G. mancunianus, G.

imbecillis) установлена гомология хромосомных плеч и предложено их унифицированное обозначение.

6. Виды, приспособившиеся на стадии личинки к минированию тканей живых макрофитов, комменсализму или паразитизму, характеризуются относительной цитогенетической стабильностью; их политенные хромосомы часто объединены в хромоцентр, а уровень хромосомного полиморфизма значительно ниже, чем у менее специализированных видов.

7. Многочисленные случаи гибридизации между близкими видами G.

glaucus и G. pallens, между подвидами Glyptotendipes gripekoveni (Glyptotendipes g. gripekoveni и G. g. paragripekoveni) и между цитотипами Endochironomus tendens свидетельствуют о низком уровне дивергенции в каждой из перечисленных групп.

8. Среди изученных представителей Chironominae и Orthocladiinae (по результатам секвенирования гена COI) наиболее древним является минер древесины Stenochironomus gibbus, который образует отдельную эволюционную ветвь, обособившуюся около 178-130 млн. л. н. По морфологии личинки, S. gibbus существенно отличается от других представителей трибы Chironomini; его цитогенетическими особенностями являются низкая степень политении хромосом и отсутствие хромосомных перестроек.

9. Переход к обрастанию и минированию субстратов происходил в эволюции хирономид неоднократно в разных таксономических группах. По результатам секвенирования гена COI, у Chironominae наиболее древними, по сравнению с остальными обрастателями и минерами макрофитов, являются виды рода Polypedilum, возникшие предположительно около 65-42 млн. л. н.;

у Orthocladiinae – виды рода Cricotopus, возникшие около 28-26 млн. л. н..

10. Возникновение большинства фитофильных видов хирономид было приурочено к формированию водоемов с современной высшей водной растительностью. Так как переход к обрастанию и минированию прибрежноводных макрофитов произошел относительно недавно (в конце палеогенового – начале неогенового периода), четкая приуроченность к заселению определенных видов растений у хирономид пока не сформировалась.

СПИСОК ОПУБЛИКОВАННЫХ РАБОТ ПО ТЕМЕ ДИССЕРТАЦИИ Статьи в изданиях из списка ВАК РФ, рекомендованных для публикации материалов докторских диссертаций по биологическим наукам:

1. Белянина С.И., Дурнова Н.А. Морфология и хромосомы фитофильного Glyptotendipes glaucus (Diptera, Chironomidae) из водоемов Саратовской области. I. Морфологический анализ самки // Зоологический журнал. –1997. – Т. 76. №8. – C. 1421-1423.

2. Белянина С.И., Дурнова Н.А. Морфология и хромосомы фитофильного Glyptotendipes glaucus (Diptera, Chironomidae) из водоемов Саратовской области. II. Кариотипический анализ // Зоологический журнал. – 1998. – Т. 77, №2. – C. 243-251.

3. Белянина С.И., Дурнова Н.А., Шобанов Н.А. Особенности кариотипа и морфологии Glyptotendipes sp. (Diptera, Chironomidae) с хромосомным набором 2n=4 // Зоологический журнал. – 1999. – Т. 78, № 12.

– С. 1434-1440.

4. Дурнова Н.А., Белянина С.И. Кариотипы и хромосомный полиморфизм двух фитофильных видов хирономид – Glyptotendipes mancunianus и G. imbecillis (Diptera, Chironomidae) // Цитология. – 2001. – Т.

43, № 5. – С. 501-506.

5. Белянина С.И., Дурнова Н.А. Кариотип хирономиды Xenochironomus xenolabis (Diptera,Chironomidae) – облигатного минера пресноводных губок // Цитология. – 2002. – Т. 44, № 12. – С. 1227- 1232.

6. Белянина С.И., Дурнова Н.А. Внутривидовая дифференциация фитофильного комара-звонца Glyptotendipes gripekoveni (Diptera,Chironomidae) // Зоологический журнал. – 2004. – Т. 83, №10. – С.

1249-1260.

7. Белянина С.И., Дурнова Н.А. Кариотип и кариофонд хирономид Polypedilum (Pentapedilum) sordens (Diptera, Chironomidae) из водоемов Саратовской обл. // Цитология. – 2005. – Т. 47, № 4. – С. 366-372.

8. Дурнова Н.А. Хромосомный полиморфизм и цитотипы Endochironomus tendens F. (Diptera, Chironomidae) из водоемов Саратовской и Самарской областей // Цитология. – 2009. – Т. 51, № 7. – С. 592-601.

(Durnova N.A. Chromosome Polymorphism and Cytotypes of Endochironomus tendens F. (Diptera, Chironomidae) from Saratov and Samara Regions // Cell and Tissue Biology, – 2009. – Vol. 3, No 4. – P. 340-348).

9. Durnova N.A. Chromosome analysis of chironomids (Diptera:

Chironomidae) – obligatory miners of freshwater sponges (Porifera) // Comparative Cytogenetics. – 2009. – Vol. 3, № 1. – P. 25-31.

10. Дурнова Н.А. Цитогенетические особенности Stenochironomus gibbus F. (Diptera, Chironomidae) // Цитология. – 2010. – Т. 52, № 7. – С. 76-80.

Статьи в прочих изданиях и материалах конференций:

1. Дурнова Н.А. Белянина С.И. Морфологические и кариотипические особенности Glyptotendipes glaucus из новоузенской популяции Саратовской области // Труды Всероссийского съезда хирономидологов. Экология, эволюция и систематика хирономид. – Борок. – 1996. – C. 97-101.

2. Белянина С.И., Полуконова Н.В., Дурнова Н.А. Дифференциальный диагноз гомосеквентных видов Chironomus piger Strenzke и Ch. riparius Meigen // Экология, эволюция и систематика хирономид. – Тольятти, Борок. – 1996. – C. 109-115.

3. Белянина С.И., Дурнова Н.А. Кариотипические формы Glyptotendipes gripekoveni Kieffer из водоемов Саратовской области // Кариосистематика беспозвоночных животных. – Вып. 3. – М.: Изд.

Ботанического сада МГУ. – 1996. – С. 7-9.

4. Дурнова Н.А., Шобанов Н.А., Белянина С.И. Особенности морфологии и хромосом (2n=4) личинок бентосного вида рода Glyptotendipes Kieffer // Место и роль двукрылых насекомых в экосистемах. Материалы YI Всероссийского диптерологического симпозиума. – СПб.: ЗИН РАН. – 1997.

– С.45-46.

5. Дурнова Н.А., Занцинская Т.П., Морозова Н.В., Радюшкина Т.А.

Влияние трофических условий на рост личинок Glyptotendipes glaucus (Mg.) (Diptera, Chironomidae) // Место и роль двукрылых насекомых в экосистемах.

Материалы VI Всероссийского диптерологического симпозиума. – СПб.:

ЗИН РАН. – 1997. – C. 44-45.

6. Дурнова Н.А., Занцинская Т.П., Морозова М.В. Влияние условий среды на рост личинок Glyptotendipes glaucus (Mg.) (Diptera: Chironomidae) // Тезисы докл. Х Всероссийской конф. Молодых ученых «Проблемы экологии, биоразнообразия и охраны прибрежно-водных и водных экосистем. – Борок, 3-6 марта 1997 г. – С. 32-34.

7. Дурнова Н.А. К диагностике Glyptotendipes mancunianus (Diptera, Chironomidae) // Материалы Х Всероссийского съезда РЭО. – СПб. – 1997. – С. 124.

8. Дурнова Н.А. Хромосомный полиморфизм Glyptotendipes barbipes (Diptera, Chironomidae) из малых водоемов Саратовской области // Материалы Х Всероссийского съезда РЭО. – СПб. – 1997. – С. 125.

9. Белянина С.И., Сергеева И.В., Морозова Е.Е., Дурнова Н.А., Полуконова Н.В. Изменение видового состава некоторых групп хирономид Волги и придаточных водоемов в районе Саратова в связи с антропогенным воздействием // Гигиена окружающей среды и экология человека. – Саратов:

Изд-во СГМУ. – 1999. – C. 13-14.

10. Durnova N.A., Belyanina S.I. Comparative analysis of the karyotypes of nine Glyptotendipes species (Diptera, Chironomidae) from Russia // Biodiversity and dynamics in North Eurasia. – Novosibirsk. – 2000. – Vol. 1, part 3. Moleculargenetic bases of biodiversity (animals and plants). – P. 31-34.

11. Дурнова Н.А. Эколого-морфологические особенности личинок Glyptotendipes Kieffer, 1913 (Diptera, Chironomidae) // Энтомологические и паразитологические исследования в Поволжье. – Вып 1. – Саратов: Изд.

Сарат. ун-та, 2001. – С. 52-57.

12. Belyanina S. I., Durnova N. A. Microevolution differentiation of Glyptotendipes gripekoveni (Chironomidae, Diptera) populations // MAPEEG. The 3rd International Symposium. September 24-27, 2001. Institute of Marine Biology.

–Vladivostok Marine Biological Station. – P. 4.

13. Durnova N. A., Belyanina S. I. Karyofund of Glyptotendipes paripes (Chironomidae, Diptera) from Volga River // MAPEEG. The 3rd International Symposium. September 24-27, 2001. Institute of Marine Biology. – Vladivostok Marine Biological Station. – P. 6.

14. Белянина С.И., Дурнова Н.А., Алчинова И.Б. Кариотип и экологические особенности хирономиды Parachironomus kuzini (Diptera, Chironomidae) // Энтомологические и паразитологические исследования в Поволжье. – Вып. 1. – Саратов: Изд. Сарат. ун-та, 2001. – С. 25-29.

15. Дурнова Н.А., Белянина С.И. О роли гибридизации в видообразовании у хирономид (Diptera, Chironomidae) на примере рода Glyptotendipes Kieffer // Репродуктивная биология, генетика и селекция: Сб.

науч. тр., посвященный 90-летию со дня рождения проф. С.С. Хохлова. – Саратов: Изд-во Сарат. ун-та, 2002. – С. 125-128.

16. Дурнова Н.А., Белянина С.И. Симбиотические связи хирономид (Diptera,Chironomidae) // Тезисы докладов 12-го съезда Русского энтомол.

общества, 19-24 августа 2002 г. – С. 108.

17. Белянина С.И., Дурнова Н.А., Алчинова И.Б. Хромосомный анализ хирономид-минеров // Тезисы докладов 12-го съезда Русского энтомол.

общества, 19-24 августа 2002 г. – С. 37- 38.

18. Belyanina S.I., Polukonova N.V., Durnova N.A. Midge speciation by introgressive hybridization (Chironomidae, Diptera) // 15th International Symposium of Chironomidae, Minnesota 12-14 August 2003. P. 36.

19. Белянина С.И., Полуконова Н.В., Дурнова Н.А. Интрогрессивная гибридизация в видообразовании хирономид (Diptera, Chironomidae) // Новые данные по хирономидологии. – Борок: ИБВВ РАН. – 2003. – С. 1-11.

20. Дурнова Н.А. Видовой состав фитофильных хирономид перифитона некоторых водоемов Саратовской области // Вопросы биологии, экологии, химии и методики обучения. – Вып. 8. – Саратов, 2005. – С. 75-79.

21. Дурнова Н.А. Сравнительный анализ кариотипов и морфологии личинок близких видов Endochironomus – E. impar и E. sp. Ya7 (Diptera, Chironomidae) // Вопросы биологии, экологии, химии и методики обучения. – Вып. 8. – Саратов, 2005. – С. 79-83.

22. Дурнова Н.А. Современное состояние кариосистематики фитофильных хирономид рода Endochironomus (Diptera, Chironomidae) // Тезисы IV Международной конференции по кариосистематике беспозвоночных животных, 28-30 августа 2006 г. – С. 25.

23. Дурнова Н.А., Белянина С.И. Экологическая и хромосомная эволюция хирономид перифитона (Diptera, Chironomidae) // Тезисы IV Международной конференции по кариосистематике беспозвоночных животных, 28-30 августа 2006 г. – С. 26.

24. Белянина С.И., Полуконова Н.В., Дурнова Н.А. Хромосомная и экологическая дифференциация при разных способах видообразования в эволюции хирономид (Diptera: Chironomidae) // Материалы IX Международной научно-практической экологической конференции.

Белгород, 2-5 октября 2006. – Белгород: Изд-во ПОЛИТЕРРА. – 2006. – С.

22-23.

25. Белянина С.И., Полуконова Н.В., Белоногова Ю.В., Дурнова Н.А., Сигарева Л.Е. Реакция генома эукариот на воздействие факторов среды на примере хирономин (Diptera: Chironomidae) // Материалы IX Международной научно-практической экологической конференции. Белгород, 2-5 октября 2006. – Белгород: Изд-во ПОЛИТЕРРА. – 2006. – С. 21-22.

26. Дурнова Н.А. Личинки хирономид (Diptera, Chironomidae) – минеры пресноводных губок // Энтомологические и паразитологические исследования в Поволжье. – Вып 1. – Саратов: Изд. Саратовского ун-та. – 2006. – Вып. 5. – С. 55-60.

27. Дурнова Н.А. Кариотипический анализ Endochironomus stackelbergi Goetgh. // Энтомологические и паразитологические исследования в Поволжье. – Вып. 1. – Саратов: Изд. Саратовского ун-та. – 2006. – С. 10-13.

28. Beljanina S.I., Polukonova N.V., Durnova N.A. The conjugacy of chromosomal and ecological differentiation by various speciation modes in evolution of chironomids. Is it possible? // 16th International Chironomid Symposium. 25-28 July 2006. – Casa da Luz Museum Funchal, Madeira, Portugal.

– 2006. – P. 75-76.

29. Дурнова Н.А. Хромосомный полиморфизм Glyptotendipes glaucus (Mg.) и G.pallens (Mg.) из водоемов Саратовской области // Экологические проблемы урбанизированных территорий. Материалы научно-практической конференции. – Елец. Елецкий гос. университет им. И.А. Бунина, 20-21 марта 2007 г. – С. 90-96.

30. Дурнова Н.А., Воронин М.Ю. Цитогенетическая характеристика Glyptotendipes glaucus, G. pallens и их гибридов (Diptera, Chironomidae) в Саратовской области. // Проблемы и перспективы общей энтомологии.

Тезисы докладов XIII съезда Русского энтомологического общества. – Краснодар, 9-15 сентября 2007 г. Краснодар. – 2007. – С. 95-96.

31. Дурнова Н.А., Воронин М.Ю. Видовой состав хирономин (Diptera, Chironomidae, Chironominae) погруженных субстратов водоемов Саратовской области // Энтомологические и паразитологические исследования в Поволжье. – Вып. 1. – Саратов: Изд. Саратовского ун-та. – 2008. – Вып. 7. – С. 72 -75.

32. Дурнова Н.А., Полуконова Н.В. Проблема вида у комаров-звонцов (Diptera, Chironomidae) // Живые объекты в условиях антропогенного пресса.

Материалы X Международной научно-практической конференции. Белгород, 15-18 сентября 2008 г. – Белгород: ИПЦ «ПОЛИТЕРРА». – 2008. – С. 66-67.

34. Дурнова Н.А., Белянина С.И. Биотопическая приуроченность хирономин перифитона (Diptera, Chironomidae, Chironominae). // Труды Ставропольского отделения русского энтомологического об-ва. Материалы Международной научно-практ. конференции. Ставрополь. 10-12 сентября 2008 г. – Вып. 4. – Ставрополь «Аргус». – 2008. – С. 192-196.

35. Дурнова Н.А., Белянина С.И., Воронин М.Ю. Фитофильные хирономиды водоемов Саратовской области (Diptera, Chironomidae) // Материалы II Международной научно-практической конференции «Экология биосистем: проблемы изучения, идентификации и прогнозирования». – Астрахань, 25-30 августа 2009 г. – С. 52-56.

36. Дурнова Н.А., Мурсалова М.А. Новые данные по хромосомному полиморфизму Endochironomus albipennis Meigen (Diptera: Chironomidae) из водоемов Саратовской области» // Материалы Всероссийской научнопрактической конференции с международным участием «Экология, эволюция и систематика животных». – Рязань, 17-19 ноября 2009 г. – С. 7475.

37. Белянина С.И., Дурнова Н.А. Проблемы кариосистематического исследования рода Polypedilum Kieffer, 1913 (Chironomidae, Diptera) // Материалы международной конференции по кариосистематике беспозвоночных животных V. – Новосибирск. – 2010. – С. 19.

38. Полуконова Н.В., Дурнова Н.А., Демин А.Г. Направления эволюции личинок хирономид (Diptera) на основе анализа политенных хромосом и частичной аминокислотной последовательности первой субъединицы цитохром С оксидазы (COI) // Материалы международной конференции по кариосистематике беспозвоночных животных V. – Новосибирск. – 2010. – С. 65.

39. Дурнова Н.А., Воронин М.Ю. Филогения некоторых фитофильных хирономид (Diptera, Chironomidae) по морфологическим признакам личинок // Энтомологические и паразитологические исследования в Поволжье. – Вып.

1. – Саратов: Изд. Сарат. ун-та. – 2009. – Вып. 8. – С.14-20.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.