WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

ТАЛАНОВА Вера Викторовна

ФИТОГОРМОНЫ КАК РЕГУЛЯТОРЫ УСТОЙЧИВОСТИ РАСТЕНИЙ К НЕБЛАГОПРИЯТНЫМ ФАКТОРАМ СРЕДЫ

03.00.04 – биохимия 03.00.12 – физиология и биохимия растений

АВТОРЕФЕРАТ

диссертации на соискание ученой степени доктора биологических наук

Петрозаводск – 2009

Работа выполнена в лаборатории экологической физиологии растений Института биологии Карельского научного центра РАН

Научный консультант: член-корреспондент РАН, доктор биологических наук, профессор Титов Александр Федорович

Официальные оппоненты: член-корреспондент РАН, доктор биологических наук, профессор Жиров Владимир Константинович доктор биологических наук, профессор Шакирова Фарида Миннихановна доктор биологических наук Моралев Сергей Николаевич

Ведущая организация: Институт биохимии им. А.Н. Баха РАН

Защита диссертации состоится 27 марта 2009 г. в ч на заседании Диссертационного Совета ДМ 212.087.02 при Карельском государственном педагогическом университете по адресу: Петрозаводск, ул. Пушкинская, 17.

С диссертацией можно ознакомиться в библиотеке Карельского государственного педагогического университета.

Автореферат разослан « » февраля 2009 г.

Ученый секретарь диссертационного совета, кандидат медицинских наук А.И. Малкиель

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Фитогормоны принимают активное участие в регуляции многих биохимических и физиологических процессов в растениях, осуществляя свои функции как в обычных (нормальных) условиях, так и при различных неблагоприятных воздействиях. Это особенно важно, поскольку в природных условиях растения постоянно или периодически подвергаются действию тех или иных неблагоприятных факторов внешней среды, в частности, абиотических. В последние годы глобальные изменения климата привели к усилению его нестабильности, выражающейся, в том числе, в резких перепадах температуры. С другой стороны, постоянно возрастающая антропогенная нагрузка на природную среду приводит к увеличению количества засоленных территорий и к загрязнению окружающей среды тяжелыми металлами. В силу этого проблема устойчивости растений к неблагоприятным факторам внешней среды абиотической природы не только не потеряла своей остроты, но и заметно актуализировалась. Не случайно во многих странах мира ее активно изучают и к настоящему времени накоплен весьма обширный и разнообразный экспериментальный материал. Однако, несмотря на очевидные успехи, данная проблема все еще далека от окончательного решения.

Как показывают исследования, формирование устойчивости растений к неблагоприятным абиотическим факторам представляет собой сложный, многокомпонентный процесс, включающий как специфические, так и общие (неспецифические) реакции (Титов и др., 1983; 2006, 2007; Дроздов и др., 1984;

Александров, 1985; Удовенко, 1979; Кузнецов, 1992; Шакирова, 2001; Чиркова, 2002; Кузнецов, Дмитриева, 2006; Гончарова, 2007; Ершова, 2007; Жиров и др., 2007). К числу последних относят, в частности, изменения баланса фитогормонов (Тарчевский, 2001; Шакирова, 2001; Чиркова, 2002). Фитогормоны, являясь важными компонентами регуляторной системы растений, могут играть ключевую роль не только в ростовых и морфогенетических процессах, но и в адаптивных реакциях, связанных с воздействием неблагоприятных факторов (Гуревич, 1979; Кулаева, Чайлахян, 1984; Кораблева, 1989; Жолкевич, Пустовойтова, 1993; Кудоярова, 1996; Hare et al., 1999; Полевой и др., 1997; Шакирова, 1999, 2001; Чиркова, 2002; Фархутдинов, 2005; Gusta et al., 2005; Ершова, 2007). Некоторые из них, и, прежде всего, стрессовые гормоны – абсцизовая кислота (АБК) и этилен – способны действовать как регуляторы, определяя ответ растительных клеток на неблагоприятные воздействия. Выявлению роли фитогормонов в регуляции устойчивости растений к действию абиотических факторов посвящено довольно большое число работ. Однако при этом недостаточно внимания уделяется их участию в повышении устойчивости растений в начальный период действия неблагоприятных факторов, хотя результаты ряда исследований указывают на то, что именно в этот период в клетках и тканях растительного организма могут происходить весьма важные, если не главные, события, во многом предопределяющие весь последующий ход формирования устойчивости (Титов и др., 2006). Поэтому изучение основных закономерно стей формирования устойчивости растений к действию неблагоприятных факторов среды и участия фитогормонов в этом процессе является весьма важным аспектом данной проблемы.

Цель и задачи исследований. Цель работы состояла в выявлении участия и роли фитогормонов в физиолого-биохимических механизмах формирования повышенной устойчивости растений к действию неблагоприятных факторов среды абиотической природы.

Для достижения намеченной цели были поставлены следующие задачи:

1) исследовать основные закономерности формирования устойчивости растений к неблагоприятным факторам среды абиотической природы (низкие и высокие температуры, хлоридное засоление, тяжелые металлы) в зависимости от интенсивности и продолжительности их действия, уделяя при этом особое внимание начальному периоду воздействия;

2) выявить специфическую и неспецифическую составляющие повышения устойчивости растений в ответ на действие неблагоприятных факторов среды абиотической природы на основании изучения характера изменения устойчивости к действию низких и высоких температур, засоления и тяжелых металлов в процессе кросс-адаптации; особенностей некоторых физиологобиохимических реакций растений на действие разных стресс-факторов; формирования повышенной устойчивости на фоне подавления биосинтеза белков;

3) изучить закономерности динамики эндогенного уровня АБК в период формирования повышенной устойчивости растений к действию неблагоприятных факторов среды разной природы;

4) исследовать влияние экзогенной АБК на устойчивость растений к неблагоприятным факторам среды разной природы;

5) изучить действие неблагоприятных факторов среды разной природы и АБК на экспрессию генов;

6) исследовать изменение эндогенного уровня ИУК в период формирования повышенной устойчивости растений к действию низких и высоких температур и эффекты экзогенной ИУК на устойчивость;

7) установить влияние цитокининов на устойчивость растений к действию неблагоприятных факторов среды.

Основные положения, выносимые на защиту:

1) Формирование повышенной устойчивости растений к неблагоприятным факторам абиотической природы (низкие и высокие температуры, хлоридное засоление, тяжелые металлы) сопряжено с быстрым транзитным изменением уровня отдельных фитогормонов и, в частности АБК, а также их баланса, что обеспечивает переключение клеток с программ нормального развития (ростовой и онтогенетической) на адаптивные, которое происходит уже в начальный период действия стрессора.

2) Изменения в гормональной системе, происходящие в начальный период действия на растения неблагоприятных факторов среды абиотической природы, играют важную роль в неспецифическом (общем) повышении устойчивости, благодаря которому растение получает возможность в случае пролонгированного действия стрессора включить механизмы долговременной адаптации и таким образом обеспечить свою выживаемость в этих условиях.

3) Участие стрессового гормона АБК в формировании повышенной устойчивости растений к неблагоприятным факторам абиотической природы связано как с его способностью оказывать регулирующее влияние на различные физиолого-биохимических процессы, так и с активацией экспрессии отдельных генов (в частности, контролирующих транскрипционный фактор CBF, RAB-белки, белки холодового шока).

4) Фитогормоны, наряду с генетической системой, играют ключевую роль в защитно-приспособительных реакциях растений на действие неблагоприятных факторов абиотической природы.

Научная новизна работы. Показана способность растений при действии одного из неблагоприятных факторов среды абиотической природы (низкая температура, высокая температура, хлоридное засоление, тяжелые металлы) повышать устойчивость к другим стресс-факторам, при этом впервые выявлен различный характер изменения устойчивости растений к нескольким факторам: постоянное увеличение устойчивости к действующему стрессору и транзитное – к другим факторам.

Впервые установлено, что значительные изменения эндогенного уровня АБК и ИУК в начальный период действия неблагоприятных факторов предшествуют росту устойчивости растений, что свидетельствует об участии этих гормонов в ее формировании. Показано, что положительное влияние цитокининов на устойчивость растений обусловлено индукцией транзитного накопления АБК.

Впервые показана способность экзогенной АБК повышать устойчивость не только к действующему в данный момент на растение стрессору, но и одновременно к ряду других стресс-факторов.

Впервые выявлена зависимость между повышением устойчивости листьев и уровнем АБК в них при локальном действии закаливающих температур на корневую систему растения.

Впервые обнаружено, что один из возможных молекулярных механизмов индуцирования АБК устойчивости растений огурца к низкой и высокой температуре, а также к хлориду натрия связан с ее регуляцией экспрессии гена транскрипционного фактора CBF1.

Впервые показано, что механизмы повышения холодоустойчивости растений пшеницы под влиянием низкой закаливающей температуры связаны с активацией экспрессии гена транскрипционного фактора WRKY.

Впервые показано, что повышение холодоустойчивости растений пшеницы в начальный период действия низкой температуры связано с экспрессией АБК-зависимых генов (Wrab17 и Wrab19) и cor-генов (Wcor15 и Wcs120), а при более продолжительном ее действии – прежде всего с экспрессией генов Wcor15 и Wrab17.

Практическая значимость работы. Выявленные общие закономерности реакции растений на действие неблагоприятных факторов среды разной природы и результаты исследования участия фитогормонов в процессах адаптации имеют важное значение для понимания принципов и механизмов формирования повышенной устойчивости, позволяющей противостоять этим воздействиям. Данные о роли фитогормонов в регуляции устойчивости к действию низких и высоких температур, хлоридного засоления и тяжелых металлов расширяют и углубляют представления о природе устойчивости и позволяют наметить пути для поиска новых способов и методов ее повышения. Основные результаты и выводы работы могут быть использованы при чтении курсов лекций по экологической биохимии, физиологии растений, а также отдельных спецкурсов.

Апробация работы. Основные результаты работы доложены на Международных, всесоюзных и российских конференциях и симпозиумах: «Молекулярные механизмы генетических процессов» (Москва, 1983, 1987), «Механизмы криоповреждения и криозащиты биологических объектов» (Харьков, 1984), «Физиолого-биохимические механизмы регуляции адаптивных реакций растений и агроценозов» (Кишинев, 1984), «Экологическая генетика растений и животных» (Кишинев, 1987), «Биологически активные вещества в сельском хозяйстве» (Ленинград, 1988), «Конференция по регуляторам роста и развития растений» (Киев, 1989), «Иммуноферментный анализ регуляторов роста растений. Применение в физиологии растений и экологии» (Уфа, 1990), Съезд Всесоюзного общества физиологов растений (Минск, 1990), «Рhуsiоlоgу оf Absсisiс Aсid. 30 yеаrs оf Disсоvеrу» (Пущино, 1993), «Регуляторы роста и развития растений» (Москва, 1993, 1995, 1997), «Моlесulаr Rеsроnsеs оf Plаnts tо Biоtiс аnd Abiоtiс Strеssеs» (Хельсинки, 1994, 1996, 1997), «Физикохимические основы физиологии растений и биотехнология» (Москва, 1997), «Биоиндикация и оценка повреждения организмов и экосистем» (Петрозаводск, 1997), «Молекулярные механизмы стрессовых реакций у растений» (Москва, 1998), «Karelia and Norway: the Main Trends and Prospects of Scientific Cooperation» (Петрозаводск, 1998), «Биологические основы изучения, освоения и охраны животного и растительного мира, почвенного покрова Восточной Фенноскандии» (Петрозаводск, 1999), «Signalling Systems of Plant Cells» (Москва, 2001), «Plants under Environmental Stresses» (Москва, 2001), «Актуальные вопросы экологической физиологии растений в XXI веке» (Сыктывкар, 2001), «Карелия и РФФИ» (Петрозаводск, 2002), «Наземные и водные экосистемы Северной Европы: управление и охрана» (Петрозаводск, 2003), «Регуляция роста, развития и продуктивности растений» (Минск, 2003, 2005), «Проблемы физиологии растений Севера» (Петрозаводск, 2004), «Структурнофункциональные особенности биосистем Севера (особи, популяции, сообщества)» (Петрозаводск, 2005), «Физиологические и молекулярно-генетические аспекты сохранения биоразнообразия» (Вологда, 2005), «Северная Европа в XXI веке: природа, культура, экономика» (Петрозаводск, 2006), VI Съезд Общества физиологов растений России (Сыктывкар, 2007); XII Съезд Русского ботанического общества (Петрозаводск, 2008); XVI Congress of the Federation of European Societies of Plant Biology (Тампере, Финляндия, 2008).

Публикации. По материалам диссертации опубликовано 60 работ, в том числе 2 монографии и 30 статей в рецензируемых журналах, входящих в перечень изданий, рекомендуемых ВАК.

Структура и объем диссертации. Диссертационная работа состоит из введения, обзора литературы, экспериментальной части, включающей 4 главы, заключения, выводов и списка цитируемой литературы (595 работ, в том числе 416 иностранных). Работа изложена на 377 страницах, содержит 98 рисунков и 27 таблиц.

Работа выполнена в соответствии с планами НИР Института биологии КарНЦ РАН по темам № г.р. 01.86.0084488, 01.91.0022161, 01.94.0002678, 01.99.0008968, 01.20.0411718 при поддержке грантов РФФИ № 94-04-12981, 97-04-49209, 98-04-03516р, 00-04-48305, 02-04-97519р, 05-04-97515р, 06-0449107.

Благодарности. Автор выражает глубокую благодарность своему учителю чл.-корр. РАН А.Ф. Титову за постоянную и неоценимую поддержку, помощь и внимание, оказываемые на всех этапах выполнения диссертационной работы. Автор искренне признательна всем сотрудникам лаборатории экологической физиологии растений, а также сотрудникам группы молекулярной биологии Л.В. Топчиевой и И.Е Малышевой за помощь в проведении экспериментов. Особую благодарность автор выражает чл.-корр. РАН Н.Н. Немовой за всестороннюю подержку и ценные советы.

2. ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЙ Объекты исследований. В качестве объектов исследований использовали растения озимой пшеницы (Тritiсum аеstivum L.) сортов Мироновская 808 и Московская 39, ячменя (Hordeum vulgare L.) сорта Отра, огурца (Сuсumis sаtivus L.) сортов Алма-Атинский 1 и Зозуля, сои (Glycine max [L.] Merr.) сортов Амурская 310, Бурые масличные, Венгерка, Волна, Гизо, Добруджанка 18, Кубанская 4958, Ранняя 10 и Чиатурская, томата (Lycopersicon esculentum Mill.) сортов Московский осенний 3405 и Грунтовый Грибовский 1180.

Выращивание растений проводили в течение 7–14 сут на модифицированном питательном растворе Кнопа (рН 6.2–6.4) в рулонах фильтровальной бумаги (или в керамических сосудах с песком) в камере искусственного климата при постоянных условиях среды: температуре воздуха 22–25°С (в зависимости от объекта), его относительной влажности 60–70%, интенсивности света 170 мкмоль фотонов м-2·с-1 и фотопериоде 14 ч.

Действие низких и высоких температур на растения осуществляли в камерах искусственного климата, сохраняя прочие условия неизменными. Локальное действие температуры 38°С на побег или корни растений осуществляли в специально сконструированной установке.

Хлоридное засоление создавали, помещая растения на растворы NaCl от 17 мМ до 1.38 М (сохраняя прочие условия неизменными).

Воздействие тяжелых металлов на растения проводили, помещая их на растворы CdBr2.4H2O или Pb(NO3)2 в концентрациях от 0.001 до 20 мМ.

Комбинированное действие стресс-факторов на растения проводили по следующим схемам: холодовое закаливание тепловое закаливание, холодовое (тепловое) закаливание действие NaCl, холодовое (тепловое) закаливание действие Pb(NO3)2.

Обработку растений фитогормонами проводили, помещая их на растворы АБК (Serva, Sigma, IСN), синтетических аналогов цитокинина – кинетина (КИН) и 6-бензиламинопурина (БАП) (IСN), ИУК (Colnbrook Bucks, IСN).

Обработку растений ингибиторами транскрипции и трансляции проводили, помещая их на растворы актиномицина Д (АКТ), циклогексимида (ЦГ) и хлорамфеникола (ХФ).

Устойчивость растений к низким и высоким температурам оценивали по реакции клеток высечек из листьев на тестирующее промораживание в микрохолодильнике ТЖР-0.2/-20 («Интерм») (Дроздов и др., 1976) или прогрев в водном термостате (Александров, 1963). В качестве критерия устойчивости служила температура (ЛТ50), при которой в 50% клеток паренхимы листа наблюдали деструкцию хлоропластов и коагуляцию цитоплазмы с помощью светового микроскопа. Теплоустойчивость корня оценивали по температуре (ЛТ50) гибели 50% клеток эпидермиса после прогрева в водном термостате (Балагурова и др., 1999). В ряде опытов устойчивость оценивали по выживаемости растений после их тестирующего охлаждения или прогрева.

Устойчивость растений к засолению оценивали по величине осмотического давления раствора NаСl (ЛОД50), вызывающего гибель 50% клеток листа (Балагурова и др., 2001), а в ряде опытов – по выживаемости растений.

Устойчивость растений к действию тяжелых металлов оценивали по их выживаемости, изменению линейных размеров корней и побегов, накоплению биомассы.

Содержание фитогормонов в растениях определяли с помощью твердофазного иммуноферментного анализа (Кудоярова и др., 1986, 1990; Veselov et al., 1992).

Оводненность тканей анализировали весовым методом, высушивая растительные образцы в термостате до постоянного веса при 105°С.

Интенсивность транспирации, устьичную проводимость и интенсивность СО2-газообмена листьев регистрировали с помощью портативной фотосинтетической системы НСМ-1000 («Walz»).

Содержание хлорофиллов и каротиноидов в листьях определяли спектрофотометрически после их экстракции 80%-ным ацетоном (Шлык, 1971).

Интенсивность дыхания листьев определяли манометрически в аппарате Варбурга по поглощению О2 (Семихатова, Чулановская, 1965).

Содержание растворимых белков в листьях анализировали спектрофотометрически после окрашивания Кумасси G-250 (Serva) (Bradford, 1976).

Содержание свободного пролина в листьях растений определяли по методу Л. Бейтс с соавт. (Bates et al., 1973).

Экспрессию генов транскрипционных факторов и стрессовых белков изучали после выделения из листьев растений тотальной РНК с помощью набора AquaPure RNA Isolation Kit (Bio-Rad) и обработки ДНКазой (Силекс).

Полимеразную цепную реакцию (ПЦР) в режиме реального времени проводили на приборе iQ5 (Bio-Rad), используя набор iScript One-Step RT-PCR Kit, в котором ПЦР совмещена с обратной транскрипцией. Для ПЦР использовали прямой и обратный праймеры (Синтол): Wcor15 – GGGAGCAACCTCTTCCATAGTGT и CCAACCATCACAACCCTTCACTA; Wrab1 – CGGGATGGGAGGAGACAAGTGAG и GGAATAGCGAAACAGAAGGAGGG; Wrab– CAACCAGAACCAGGCGAGCTACG и CGGCTGTCTCTACGGCCTTCTGCTT; Wcs1– CACGGCACTGGCGAGAAGAAAGG и TGATGTTCTCCATGACGCCCTTC; WRKY – CCGTTCAAGCCCAACAAGAAGAGG и CGAGGATGTCCTTCTGGCCGTAC; CBF1 – TGTTTGGGATGCCGACTTTGTTG и GTCACCATCTCCTTCGCCGTCAT; Actin – GGGACCTCACGGATAATCTAATG и AACCTCCACTGAGAACAACATTAC. Условия ПЦР: синтез кДНК 10 мин при 50°С, инактивация обратной транскриптазы мин при 95°С, 40 циклов ПЦР: денатурация 10 с при 95°С, отжиг праймеров и элонгация цепи 30 с при 55°С. Специфичность продукта проверяли плавлением амплифицированных фрагментов ДНК.

Повторности и статистическая обработка данных. Повторность в пределах отдельного варианта 3–6-кратная (20–60-кратная – при анализе ростовых показателей и выживаемости). Каждый опыт повторяли не менее 3 раз. Обработку экспериментальных данных проводили с помощью общепринятых методов вариационной статистики, используя программу Microsoft Excel. Достоверность различий оценивали на основании t-критерия Стьюдента. В таблицах и на рисунках приведены средние арифметические значения и их стандартные ошибки. В работе обсуждаются величины, достоверные при P0,05.

3. ЗАКОНОМЕРНОСТИ ФОРМИРОВАНИЯ И ВАРЬИРОВАНИЯ УСТОЙЧИВОСТИ РАСТЕНИЙ К НЕБЛАГОПРИЯТНЫМ ФАКТОРАМ СРЕДЫ В ЗАВИСИМОСТИ ОТ ИНТЕНСИВНОСТИ И ПРОДОЛЖИТЕЛЬНОСТИ ИХ ДЕЙСТВИЯ Растения в период активной вегетации часто подвергаются воздействию различных неблагоприятных факторов окружающей среды абиотической природы, таких как низкие или высокие температуры, засуха, гипоксия, засоление, тяжелые металлы, ионизирующее излучение, что приводит к замедлению их роста и развития, а иногда и гибели. В ответ на экстремальные воздействия в растениях происходят разнообразные перестройки биохимических и физиологических процессов, направленные на адаптацию организма к новым условиям и повышение устойчивости.

Низкие и высокие температуры Устойчивость растений к действию низких и высоких температур варьирует в довольно широких пределах в зависимости от объекта (генотипа) и ус ловий окружающей среды, прежде всего, температурных (Александров, 1975, 1985; Трунова, 1979, 2007; Титов и др., 2006). Проведенное нами исследование холодоустойчивости растений в процессе холодового закаливания позволило установить, что заметное ее повышение у устойчивых к низким температурам видов (пшеница) происходит уже через 1 сут от начала их действия, а максимальных значений она достигает через 5 сут (табл. 1). Сходные изменения устойчивости отмечены и у теплолюбивых видов (томат, огурец), с той лишь разницей, что процесс холодовой адаптации занимал у них меньше времени, как правило, 3–4 дня.

Таблица 1. Особенности формирования холодо- и теплоустойчивости растений при действии низких и высоких закаливающих температур Устойчивость, % от максимального Темприроста Вид, сорт перапродолжительность закаливания, ч тура 3 9 24 72 12°С 0 25 620 90 1Пшеница с. Мироновская 808* 40°С 38 82 100 100 110°С 0 20 38 100 1Огурец с. Алма-Атинский 1* 38°С 65 96 100 100 18°С 0 18 44 86 1Томат с. Московский осенний 3405** 40°С 41 90 100 100 1Соя с. Чиатурская*** 40°С 100 100 100 100 1* – фаза проростков,** – фаза 3-х настоящих листьев,***– фаза простых листьев.

Характер изменения теплоустойчивости растений при действии высоких закаливающих температур оказался сходным с изменением холодоустойчивости при холодовом закаливании, однако для достижения максимального уровня устойчивости в первом случае обычно требовалось несколько часов (табл.

1). У всех изученных видов скорость закаливания и уровень достигаемой устойчивости в значительной степени зависят от интенсивности и продолжительности температурного воздействия, а также от видовых и сортовых особенностей растений. В целом процесс формирования устойчивости растений под влиянием низких температур, как правило, завершается в течение нескольких дней, а при действии высоких температур – в течение нескольких часов.

Повышение холодо- и теплоустойчивости растений сопровождалось изменением интенсивности темнового дыхания листьев, снижением скорости нетто-фотосинтеза, некоторым снижением оводненности листьев, изменением концентрации хлорофиллов, накоплением водорастворимых белков (данные в диссертации). Полученные результаты позволяют сделать вывод, что характер изменения устойчивости и физиолого-биохимических показателей (и процессов) обусловлен реализацией у растений под влиянием закаливающих температур адаптивых программ, направленных на повышение устойчивости.

Хлоридное засоление Засоление почв вызывает подавление роста и развития растений, нарушение многих физиологических и биохимических процессов, что приводит к снижению их продуктивности и даже гибели (Строгонов, 1983; Moons, 2003).

Токсическое действие засоления на растения в значительной степени определяется его дозой. Нами установлено, что обработка проростков огурца хлоридом натрия в концентрации 0,8–1% вызывала резкое снижение их выживаемости. У проростков пшеницы негативное действие NaCl проявлялось при более высоких концентрациях. Степень воздействия NaCl зависела от его продолжительности: обработка 0,9%-ным NaCl в течение 1–6 ч практически не влияла на выживаемость проростков огурца, а 2–3-суточная экспозиция приводила к их полной гибели (рис. 1). Сходные данные получены на пшенице. Таким образом, характер реакции проростков пшеницы и огурца на засоление оказался однотипным, но пшеница отличалась более высокой устойчивостью.

Рис.1. Влияние NaCl на выживаемость проростков огурца с. АлмаАтинский 1 (А) и пшеницы с. Мироновская 808 (Б). Концентрация NaCl: 1 – 0.9, 2 – 1.6, 3 – 4.5, 4 – 6.5%. Здесь и далее бары у оси ординат:

НСР05 (наименьшая существенная разность).

Тяжелые металлы Тяжелые металлы относятся к числу наиболее опасных химических веществ, которые даже в небольших количествах способны оказывать токсическое действие. Установлено, что свинец и кадмий ингибируют рост корней и надземной части растений, накопление их биомассы, а в высоких концентрациях – приводят к их гибели. Токсический эффект металлов усиливался с увеличением их концентрации, причем был заметно большим у кадмия, чем у свинца (табл. 2).

Таблица 2. Влияние тяжелых металлов на выживаемость растений ячменя с. Отра Выживаемость проростков, % Металл концентрация, мМ 0 3 6 12 18 Свинец 100 100 100 75±11 56±6 5±Кадмий 100 73±6 50±8 8±3 0 Отмеченное более значительное ингибирование роста корней, чем побегов при действии тяжелых металлов связано с их преимущественным накоплением в корнях. Например, нами показано, что в корнях щетинника зеленого аккумулируется 85–92% свинца (Лайдинен и др., 2004).

Действие свинца и кадмия в неповреждающих концентрациях сопровождалось снижением транспирации и интенсивности фотосинтеза растений огурца, накоплением в тканях листьев водорастворимых белков и свободного пролина – осморегулятора, защищающего белки от денатурации, что указывает на активизацию защитных механизмов. Кроме того, результаты изучения реакции растений огурца, пшеницы и ячменя на последовательное действие кадмия или свинца в низких и высоких концентрациях показали, что под влиянием низких концентраций металла у растений происходит активизация адаптивных процессов, в результате чего формируется повышенная устойчивость, позволяющая им переносить без губительных последствий действие более высоких концентраций металла (данные в диссертации). Таким образом, в зависимости от дозы воздействия тяжелые металлы или не оказывают влияния на растения, или вызывают стимуляцию их защитных механизмов, или, действуя в высоких концентрациях, приводят к повреждению их клеток и тканей.

В целом, в реакции растений на действие неблагоприятных факторов среды абиотической природы (низкие и высокие температуры, хлоридное засоление, тяжелые металлы) природы выявлены общие закономерности, указывающие на зависимость характера ответа от дозы воздействия. При этом обнаружен целый ряд сходных физиолого-биохимических изменений, происходящих в растениях при действии различных стресс-факторов и, очевидно, играющих важную роль в процессах формирования повышенной устойчивости.

4. СПЕЦИФИЧЕСКОЕ И НЕСПЕЦИФИЧЕСКОЕ ПОВЫШЕНИЕ УСТОЙЧИВОСТИ РАСТЕНИЙ В ОТВЕТ НА ДЕЙСТВИЕ НЕБЛАГОПРИЯТНЫХ ФАКТОРОВ СРЕДЫ РАЗНОЙ ПРИРОДЫ Сравнительное изучение природы адаптивных реакций растений на действие различных стресс-факторов указывает на существование как общих (неспецифических), так и специализированных механизмов устойчивости к ним (Удовенко, 1979; Титов и др., 1983; 1989; Кузнецов и др., 1990). В пользу функционирования общих механизмов свидетельствуют данные о том, что действие одного неблагоприятного фактора может приводить к повышению устойчивости к другому фактору (Кислюк, 1962; Александров, 1975; Дроздов и др., 1984; Кузнецов и др., 1990). Это явление, названное «кросс-адаптацией», известно довольно давно (Hale, 1969), однако до сих пор его механизмы остаются неясными (Sabehat et al., 1998; Кузнецов, Дмитриева, 2006).

Кросс-адаптация растений к действию неблагоприятных факторов среды разной природы Наши исследования показали, что растение реагирует на действие стрессфактора в неповреждающей дозе повышением устойчивости не только непосредственно к нему, но и к ряду других стрессоров. Например, у пшеницы низкая закаливающая температура 2°С в начальный период воздействия помимо повышения холодоустойчивости индуцирует рост устойчивости к высокой температуре, хлориду натрия и свинцу (рис. 2). С увеличением продолжительности низкотемпературного воздействия характер изменения этих видов устойчивости различался: холодоустойчивость продолжала возрастать и достигала максимума на пятые сутки закаливания, в то время как устойчивость к действию высокой температуры, NaCl и Pb2+ постепенно снижалась.

Рис. 2. Влияние холодового (2°С) и теплового (40°С) закаливания на холодо- (1), тепло- (2), соле- (3) и металлоустойчивость (4) проростков пшеницы с. Мироновская 8Высокая закаливающая температура (40°С) вызывала не только увеличение теплоустойчивости, но и в начальный период действия – повышение холодо-, соле- и металлоустойчивости (рис. 2). В дальнейшем на фоне стабильно высокого уровня теплоустойчивости, сохраняющегося до конца эксперимента, холодо-, соле- и металлоустойчивость снижались. Следует отметить, что действие NaCl и соли свинца, в свою очередь, приводило к кратковременному повышению холодо- и теплоустойчивости растений.

Таким образом, при действии стресс-факторов повышение устойчивости растений к ним в ряде случаев имело постоянный характер (например, холодоустойчивости при действии охлаждения), а в других – кратковременный, транзитный характер (холодоустойчивости при действии высокой температуры, NaCl, свинца). Это позволяет считать, что повышение устойчивости растений в первом и втором случаях связано с разными механизмами.

Сходные результаты получены при комбинированном (последовательном) действии стресс-факторов разной природы (данные в диссертации). Так, не продолжительная тепловая предобработка или холодовая предобработка существенно ускоряли процесс формирования повышенной устойчивости при последующей адаптации растений к холоду или теплу, соответственно. Краткосрочное воздействие низких или высоких температур способствовало повышению резистентности растений к ионам свинца, а краткосрочное действие ионов свинца вызывало увеличение теплоустойчивости проростков. Длительная предобработка как солью свинца, так и низкой или высокой температурой приводила к снижению устойчивости. Приведенные результаты свидетельствуют в пользу функционирования общих механизмов устойчивости к действию свинца и неблагоприятных температур. Поскольку защитная реакция наблюдается лишь при краткосрочном воздействии первого из факторов, то можно заключить, что неспецифические механизмы устойчивости функционируют лишь в начальный период их действия. На более поздних этапах, по-видимому, включаются специфические механизмы устойчивости, которым, очевидно, принадлежит определяющая роль в формировании и поддержании адаптированного состояния растений к тому или иному стрессу. В частности, к специфическим механизмам адаптации к действию тяжелых металлов могут быть отнесены: их связывание металлотионеинами и фитохелатинами (Титов и др., 2007).

Формирование устойчивости растений к действию неблагоприятных температур на фоне ингибирования синтеза белка Важную роль в механизмах повышения устойчивости растений к неблагоприятным факторам среды играют изменения в экспрессии генов и, соответственно, прекращение (снижение) синтеза обычных белков и индукция так называемых стрессовых белков (Thomashow, 1998; Войников и др., 2004). Учитывая это, нами с использованием ингибиторов транскрипции и трансляции, блокирующих повышение устойчивости (Трунова, Зверева, 1977; Титов и др., 2002), изучена зависимость между процессом формирования устойчивости растений и активностью белоксинтезирующей системы.

Показано, что ингибитор транскрипции АКТ (табл. 3), а также ингибиторы трансляциии ЦГ и ХФ препятствовали повышению устойчивости растений при действии на них низких и высоких закаливающих температур. Как следует из полученных данных, формирование повышенной холодоустойчивости растений при низкой температуре и теплоустойчивости при высокой температуре связано с активностью белоксинтезирующей системы и синтезом белков de novo.

Таблица 3. Влияние АКТ (2 мг/л) на холодо- и теплоустойчивость проростков томата с. Московский осенний 3405 при действии низкой и высокой температур Устойчивость клеток листа к 5- Устойчивость клеток листа к Вариант мин промораживанию (ЛТ50), °С 5-мин прогреву (ЛТ50), °С контроль АКТ контроль АКТ 25°С, 1 сут -6,5±0,05 -6,5±0,04 52,0±0,06 52,0±0,8°С, 3 сут -7,8±0,08 -6,8±0,10 53,2±0,05 53,3±0,40°С, 1 сут -7,1±0,04 -7,1±0,07 58,8±0,09 53,5±0,Напротив, рост холодоустойчивости при высокой закаливающей температуре, а также теплоустойчивости при низкой закаливающей температуре не зависит (или зависит в незначительной степени) от активности белоксинтезирующей системы, поскольку их уровень при обработке растений АКТ не отличался от контрольного варианта (закаливание без АКТ) (табл. 3).

Подобного рода данные рассматриваются нами как подтверждение возможности функционирования у растений специфических и неспецифических механизмов устойчивости к действию стресс-факторов разной природы. Судя по полученным результатам и данным литературы, специфическое реагирование на действие экстремальной температуры связано с экспрессией генов и синтезом соответствующих стрессовых белков, хотя при охлаждении и нагреве могут индуцироваться не только специфические, но и одинаковые белки (Войников и др., 1987; Кузнецов и др., 1987; Sabehat et al., 1998; Rizhsky et al., 2002). Неспецифическое реагирование проявляется в первую очередь в начальный период действия стресс-факторов. На более поздних этапах адаптации, когда включается механизм специфического реагирования, происходит постепенное снижение неспецифической устойчивости. Следовательно, наиболее важным может оказаться вклад неспецифических реакций в адаптацию именно в начальный период действия абиотических факторов.

5. АБСЦИЗОВАЯ КИСЛОТА КАК ГОРМОН СТРЕССА И ЕЕ УЧАСТИЕ В МЕХАНИЗМАХ УСТОЙЧИВОСТИ РАСТЕНИЙ К ДЕЙСТВИЮ НЕБЛАГОПРИЯТНЫХ ФАКТОРОВ СРЕДЫ РАЗНОЙ ПРИРОДЫ В исследованиях реакции растений на действие различных неблагоприятных факторов среды особое место принадлежит абсцизовой кислоте (Косаковская, Майдебура, 1989; Шакирова, 2001; Чиркова, 2002), в частности, показано ее накопление под влиянием обезвоживания (Cowan et al., 1995), засоления (Moons et al., 1997), низких (Janowiak et al., 2002) и высоких температур (Фархутдинов, 2005). Наше внимание было сосредоточено на одновременном изучении содержания АБК в растениях и их устойчивости прежде всего в начальный период действия неблагоприятных факторов разной природы.

Изменение уровня эндогенной АБК в растениях и их устойчивости при действии неблагоприятных факторов среды Низкие температуры. Сравнительное изучение динамики содержания эндогенной АБК у контрастных по отношению к температурному фактору видов растений, с одной стороны, и динамики их устойчивости к низким температурам, с другой стороны, позволило установить, что закаливающие температуры, оптимальные для формирования повышенной устойчивости холодостойкого (пшеница) и теплолюбивого (огурец) видов растений, вызывали значительное накопление свободной АБК в тканях листьев уже в начальный период их действия. Так, содержание АБК в листьях пшеницы при действии температуры 2°С возрастало уже через 1–8 ч холодового закаливания и продолжало увели чиваться (после снижения к концу первых суток) в течение 3 сут, а затем снижалось (рис. 3). Что касается холодоустойчивости, то ее заметный прирост наблюдали через 8–24 ч от начала закаливания и затем она возрастала и достигала максимума на 4–5 сут (рис. 3). Под влиянием кратковременного воздействия температуры 10°С в листьях проростков огурца также наблюдалось значительное увеличение содержания АБК, которое было временным, транзитным и в дальнейшем (на 5 сут) происходило его возвращение к исходному значению, в то время как устойчивость оставалась на достигнутом уровне.

Следовательно, формирование холодоустойчивости как у холодостойких, так и у теплолюбивых растений под влиянием низких закаливающих температур сопровождается достаточно быстрым накоплением АБК в листьях. Причем наблюдаемое повышение содержания гормона в листьях в начальный период холодовой адаптации опережало по времени рост устойчивости растений. Необходимо подчеркнуть и еще один важный момент. После довольно быстрого и значительного повышения уровня эндогенной АБК в листьях растений в дальнейшем происходило его постепенное снижение, хотя устойчивость при этом продолжала возрастать. Таким образом, полученные нами данные свидетельствуют о быстром, но временном, транзитном возрастании уровня свободной АБК в листьях растений при действии низких закаливающих температур, в отличие от постоянного (монотонного) повышения холодоустойчивости в этих условиях. По-видимому, обнаруженное нами накопление АБК, предшествующее повышению холодоустойчивости, может служить в качестве триггера для последующего процесса адаптации растений к низким температурам.

Рис. 3. Динамика холодоустойчивости листьев и содержания в них свободной АБК при действии низких закаливающих температур на проростки пшеницы с. Мироновская 808 (А) и огурца с. Алма-Атинский 1 (Б) Таким образом, формирование повышенной устойчивости к низким температурам как холодостойкого, так и теплолюбивого видов растений связано со значительным возрастанием уровня АБК в их листьях.

Высокие температуры. При тепловом закаливании проростков пшеницы содержание АБК в листьях уже через 10 мин от начала действия температуры 40°С возрастало примерно в 2 раза, продолжало увеличиваться в течение первых 2 ч закаливания, а спустя 7 ч температурного воздействия – снижалось (рис. 4). В этом случае первоначальное повышение теплоустойчивости проростков наблюдали только через 1–2 ч закаливания, и в дальнейшем она возрастала в течение 7 ч. Таким образом, увеличение содержания АБК предшествовало повышению теплоустойчивости проростков пшеницы, наблюдаемому в начальный период закаливания, а следовательно, формирование повышенной устойчивости при действии закаливающих температур связано с быстрым накоплением этого гормона. Сходные результаты получены на огурце.

Рис. 4. Динамика теплоустойчивости листьев и содержания в них свободной АБК при действии высоких закаливающих температур на проростки огурца с. Алма-Атинский 1 (А) и пшеницы с. Мироновская 808 (Б) Быстрое возрастание уровня свободной АБК в растениях может быть обусловлено как ее высвобождением из связанных форм (Веселов, 2001), так и усилением ее биосинтеза (Taylor et al., 2000). Как показали наши исследования, предобработка проростков огурца АКТ или ЦГ до начала воздействия температуры 38°С не только подавляет процесс тепловой адаптации, но и блокирует индуцируемое тепловой закалкой накопление АБК в листьях (рис. 5). Следовательно, можно полагать, что в этом случае ингибиторы транскрипции и трансляции подавляют биосинтез ферментов, участвующих в биосинтезе АБК, что приводит к снижению ее аккумуляции и соответственно перестройке метаболизма, индуктором которой она выступает.

В целом, быстрое и значительное возрастание уровня АБК в растениях в начальный период действия высоких закаливающих температур позволяет сделать вывод об участии этого гормона в формировании теплоустойчивости.

При этом АБК проявляет себя как триггер, запускающий процесс повышения устойчивости.

Рис. 5. Влияние АКТ и ЦГ на теплоустойчивость листьев (А) проростков огурца с.

Алма-Атинский 1 и содержание свободной АБК (Б) в них при действии температуры 38°С. 1 – контроль (без ингибитора), 2 – АКТ (2 мг/л), 3 – ЦГ (0,8 мг/л).

Хлоридное засоление. Установлено, что воздействие NaCl в субповреждающей (150 мМ) и повреждающей (265 мМ) концентрациях в течение 1–6 ч приводило к значительной аккумуляции свободной АБК в листьях проростков огурца (рис. 6). Продолжительная экспозиция растений в условиях засоления снижала их выживаемость и уровень АБК, особенно при более высокой концентрации. Из этого следует, что устойчивость огурца к непродолжительному действию хлоридного засоления связана с повышенным уровнем АБК.

Рис. 6. Влияние NaCl на выживаемость проростков (А) огурца с. Алма-Атинский 1 и содержание свободной АБК в их листьях (Б). Концентрация NaCl: 1 – 150, 2 – 265 мМ.

Необходимо подчеркнуть, что накопление АБК в проростках огурца при действии засоления было временным, а в дальнейшем происходило его снижение. Очевидно, что и при действии засоления на растения АБК проявляет себя или в качестве триггера, запускающего процессы формирования повышенной устойчивости, или в качестве одного из непосредственных участников, обеспечивающих увеличение устойчивости в первые часы воздействия этого фактора.

Тяжелые металлы. Воздействие на проростки огурца кадмия и свинца в концентрациях, не вызывающих их повреждения, приводило к значительному увеличению содержания свободной АБК в листьях в течение 1–4 ч. Отметим, что в начальный период действия тяжелых металлов они еще не проникали в листья, и их влияние на уровень АБК было опосредованным. В то же время при более длительном воздействии CdBr2 на проростки огурца содержание АБК в их листьях также оставалось на довольно высоким уровне (рис. 7).

Рис. 7. Влияние ионов свинца (А) и кадмия (Б) на содержание свободной АБК в листьях проростков огурца с. АлмаАтинский 1. Концентрация Pb(NO3)2 – 0,1 мМ, CdBr2 – 0,05 мМ.

Полученные результаты позволяют предполагать, что отмеченное нами повышение уровня АБК в листьях и корнях связано с адаптивными реакциями растений на воздействие тяжелых металлов. В пользу этого свидетельствуют и результаты экспериментов, проведенных с использованием постепенно повышающихся концентраций тяжелых металлов, в которых формирование устойчивости растений огурца к возрастающему действию свинца и кадмия коррелировало с аккумуляцией эндогенной АБК (данные в диссертации).

Таким образом, накопление эндогенной АБК в листьях растений в ответ на воздействие свинца и кадмия можно рассматривать в качестве одного из индукторов перестройки метаболизма, направленной на повышение устойчивости растений к тяжелым металлам.

Локальное действие неблагоприятных температур. Действию неблагоприятных факторов среды зачастую подвергается не все растение, а лишь его отдельные органы (части), хотя это может отражаться на функционировании других органов (частей), не испытавших такого воздействия (Моторина и др., 1964; Кудоярова и др., 1999; Митриченко, 1999). Ранее было показано, что действие высоких закаливающих температур на корневую систему или надземную часть растения индуцирует изменение устойчивости клеток не только прогретых органов, но и органов, которые непосредственно не подвергались прогреву (Акимова и др., 1991). Учитывая это, нами изучена динамика содер жания АБК в листьях и корнях проростков огурца и их устойчивости при локальном действии высокой температуры.

Полученные результаты показали, что прогрев листьев при 38°С вызывал у них не только повышение теплоустойчивости, но и уровня АБК (рис. 8). Высокая скорость накопления АБК, наблюдаемая в начальный период прогрева, свидетельствует о вовлечении этого гормона в процесс формирования повышенной устойчивости листьев. Однако в дальнейшем содержание АБК в листьях снижалось, хотя их устойчивость продолжала возрастать. Очевидно, АБК в листьях проявляла себя как триггер, запускающий процесс повышения устойчивости, а в дальнейшем он развивался независимо от уровня гормона.

Прогрев корней, в отличие от листьев, вызывал повышение уровня АБК в их тканях, но приводил к снижению их теплоустойчивости. Из этого следует, что АБК не индуцирует повышения устойчивости корней.

Сравнение реакции листьев на прогрев корней, с одной стороны, и реакции корней на прогрев листьев, с другой, показало следующее. Локальный прогрев корней (рис. 8) вызывал в листьях те же изменения, что и прогрев самих листьев: временное повышение уровня АБК и монотонно нарастающее увеличение теплоустойчивости. Следовательно, прогретые корни направляли в побег какой-то сигнал о ее повышении, хотя теплоустойчивость самих корней снижалась. Прогрев листьев хотя и не повышал теплоустойчивость корней, но и не вызывал ее снижения, при этом содержание АБК в корне возрастало. Очевидно, прогретые листья посылали в корни сигнал к их адаптации, которая была меньше, чем в листьях и выражалась не в повышении устойчивости, а только в ее стабилизации. Функцию дистанционного сигнала при локальном действии температуры может выполнять электрический (Ретивин, Опритов, 1993) или гидравлический импульс (Полевой и др., 1997), который предшествует гормональному ответу.

Рис. 8. Влияние прогрева (38°С) надземной части (А, Б) и корневой системы (В, Г) проростков огурца с. АлмаАтинский 1 на содержание АБК (1) в листьях (А, В) и корнях (Б, Г) и их теплоустойчивость (2) Полученные результаты согласуются с имеющимися сведениями о быстром изменении уровня АБК в одних органах растения в ответ на действие высокой (или низкой) температуры на другие его органы (Полевой и др., 1997;

Фархутдинов, 2005). Таким образом, наши данные свидетельствуют о быстрых и значительных колебаниях уровня эндогенной АБК в растениях при локальном действии температуры, что указывает на существование у них оперативного механизма, обеспечивающего изменения содержания этого гормона.

Таким образом, можно заключить, что быстрое повышение уровня АБК в листьях проростков огурца не только при их прогреве, но и при действии высокой температуры на корни выступает в качестве фактора, участвующего в формировании теплоустойчивости листьев. Кроме того, быстрые изменения уровня АБК, наблюдаемые в органах (частях) проростка, пространственно удаленных от места локального действия неблагоприятной температуры, подтверждают важную роль этого гормона в интеграции защитноприспособительных реакций в системе целого растения.

Резюмируя представленные в данном разделе результаты, считаем, что накопление АБК в растениях под влиянием неблагоприятных факторов среды может служить универсальным «сигналом тревоги», не зависящим от природы стрессора. Различные стресс-факторы (низкие и высокие температуры, хлоридное засоление, тяжелые металлы) вызывают однотипные изменения уровня эндогенной АБК. Поскольку ее накопление в листьях растений происходит в начальный период действия указанных стрессоров, логично предположить, что рост устойчивости при действии каждого из них связан в той или иной мере с повышенным уровнем этого гормона. По-видимому, быстрое повышение уровня АБК представляет собой неспецифическую защитноприспособительную реакцию, имеющую важное значение для процессов адаптации растений. Вместе с тем, обращает на себя внимание тот факт, что возрастание уровня эндогенной АБК в растениях при действии различных по своей природе стресс-факторов носит транзитный характер. По-видимому, происходящие сдвиги в уровне АБК вносят свой вклад не только в процессы адаптации в начальный период действия стресс-факторов, но и в переключение функциональной активности клеток на так называемые «адаптивные программы», действующие на более поздних этапах этого процесса.

Влияние экзогенной АБК на устойчивость растений к действию неблагоприятных факторов среды Влияние АБК на устойчивость при действии низких и высоких температур. При изучении механизмов действия фитогормонов использование экзогенных гормонов, благодаря простоте и эффективности этого приема, делает его удобным инструментом при решении различных задач (Кулаева, 1973). В исследованиях роли АБК как возможного индуктора устойчивости растений к неблагоприятным температурам основное внимание исследователей было направлено на изучение защитного действия экзогенной АБК при низких (Rikin et al., 1979) и высоких (Gong et al., 1998) повреждающих температурах. Однако не меньший интерес представляют данные, показывающие возможность модификации с помощью АБК холодового закаливания (Chen et al., 1983). Кроме того, к началу нашей работы практически ничего не было известно относительно влияния АБК на устойчивость растений к высоким температурам. Учитывая это, нами проведено изучение влияния экзогенной АБК на холодо- и теплоустойчивость растений в условиях холодового и теплового закаливания.

На растениях томата показано, что эффекты АБК не зависят от срока ее введения в растения и, следовательно, от уровня их устойчивости. Например, обработка проростков АБК до закаливания, в ходе этого процесса (через 6 ч после его начала) или по его завершению (через 3 сут) приводила к одинаковому результату: повышению устойчивости независимо от того, был ли уже достигнут к этому времени максимальный ее уровень в контроле (закалка без АБК) или процесс повышения устойчивости еще продолжался (рис. 9). Таким образом, экзогенная АБК не только эффективна в отношении незакаленных растений, но и способна индуцировать дополнительный прирост устойчивости в той или иной степени адаптированных растений.

Рис. 9. Динамика тепло- и холодоустойчивости проростков томата с. Московский осенний 3405 при температуре 40°С в зависимости от сроков обработки АБК. К – контроль (без АБК), АБК – 0.1 мМ. Начало экспозиции с АБК обозначено стрелкой: А – за 6 ч до закаливания, Б – через 6 ч, В – через 3 сут после начала закаливания.

Принимая во внимание, что адаптация растений при холодовом закаливании сопровождается увеличением теплоустойчивости, а при тепловом закаливании – ростом холодостойкости, мы изучали влияние АБК на теплоустойчивость при холодовом закаливании и на холодоустойчивость при тепловом закаливании, поскольку можно было ожидать, что обработка растений гормоном будет одновременно индуцировать рост холодо- и теплоустойчивости при холодовом и тепловом закаливаниях. Проведенные эксперименты подтвердили это предположение. Так, при тепловом закаливании томата без АБК его холодостойкость в течение первых суток несколько повышалась, а затем постепенно снижалась до уровня, близкого к исходному (рис. 9). АБК повышала холодоустойчивость (если вводилась перед закаливанием) или препятствовала ее снижению (при обработке в ходе закаливания или по его завершению). Причем величина прироста устойчивости, индуцированная АБК, во всех случаях была примерно одинаковой. Следовательно, при действии закаливающих температур АБК индуцирует повышение устойчивости как к холоду, так и к теплу.

Отметим, что краткосрочное действие на растения высокой закаливающей температуры вызывало не только увеличение их холодоустойчивости, но и солеустойчивости, которая при пролонгировании закаливания постепенно снижалась (рис. 10). В этом случае АБК не только способствовала дополнительному приросту солеустойчивости проростков в начальный период действия высокой температуры, но и сохранению ее высокого уровня в дальнейшем.

Рис. 10. Влияние АБК на теплоустойчивость и солеустойчивость проростков огурца с. Зозуля при действии температуры 38С.

1 – контроль (без АБК), 2 – АБК (0,1 мМ).

Таким образом, повышенный в результате экзогенной обработки уровень АБК в растениях способствовал при действии низкой и высокой закаливающей температуры дополнительному увеличению устойчивости к различным стрессорам. Эти результаты позволяют предполагать непосредственное участие данного гормона в неспецифических механизмах повышения устойчивости к действию низких и высоких температур, по крайней мере, на начальном этапе процесса адаптации (первые минуты и часы воздействия стрессора).

По-видимому, влияние АБК на устойчивость к неблагоприятным факторам может проявляться как через ингибирование и/или индукцию синтеза белков, так и через механизмы, не требующие изменений в функционировании генома. С целью проверки справедливости этого предположения нами было проведено исследование совместного действия АБК и ингибиторов синтеза мРНК (АКТ) и белков цитоплазмы (ЦГ) на устойчивость растений.

Установлено, что в условиях холодового закаливания проростков томата экзогенная АБК вызывала дополнительное повышение их холодоустойчивости даже в присутствии АКТ и ЦГ, хотя достигаемый уровень устойчивости был несколько ниже, чем при обработке только АБК (рис. 11). Сходным образом изменялась теплоустойчивость проростков томата в случае совместного действия АБК и ингибиторов белкового синтеза. Следовательно, АБК не только не препятствует синтезу белков, но и, как показывают исследования других авторов, способна вызывать изменения в наборе синтезируемых в условиях небла гоприятной температуры белков (Xiong et al., 1999; Larkindale, Knight, 2002).

Рис. 11. Влияние АБК и ингибиторов синтеза РНК и белка на холодо- (А) и теплоустойчивость (Б) проростков томата с. Московский осенний 3405 при действии низкой (А) и высокой (Б) закаливающих температур.

А: 8°С, 3 сут; Б: 40°С, 1 сут.

1 – контроль, 2 – АБК (0.1 мМ), 3 – АКТ (мг/л), 4 – АБК+ АКТ, 5 – ЦГ (2 мг/л), 6 – АБК + ЦГ.

Исходя из вышеизложенного, логично думать, что действие экзогенной АБК на устойчивость растений связано с ее способностью индуцировать экспрессию генов и синтез белков.

Одним из наиболее вероятных физиологических механизмов, через которые АБК участвует в повышении холодо- и теплоустойчивости растений, выступает также ее влияние на водный обмен (Dodd, 2003; Pospilov, 2003). В частности, АБК препятствует обезвоживанию тканей растений благодаря снижению устьичной проводимости и транспирации, о чем свидетельствуют наши данные, полученные на огурце (Таланова и др., 2006).

Влияние АБК на устойчивость в условиях хлоридного засоления. Имеющиеся в литературе сведения о влиянии АБК на устойчивость растений к засолению единичны (Amzallag et al., 1990). Учитывая это, нами проведено изучение эффектов экзогенной АБК на устойчивость растений к действию хлорида натрия. Установлено, что АБК вызывает заметное повышение солеустойчивости проростков огурца уже в начальный период (первые 2–6 ч) воздействия NaCl (рис. 12). Уровень теплоустойчивости растений, подвергнутых действию АБК и NaCl, был также значительно выше, чем в контроле. Таким образом, предобработка АБК растений в условиях хлоридного засоления способствовала повышению как соле-, так и теплоустойчивости клеток листьев.

Исходя из полученных результатов, можно предположить, что более высокий уровень солеустойчивости проростков огурца при действии хлоридного засоления связан с повышенным уровнем АБК в них. Очевидно, АБК при действии NaCl проявляет себя в качестве одного из участников процесса адаптации, обеспечивающих неспецифическое повышение устойчивости растений в первые часы неблагоприятного воздействия.

Негативное воздействие хлоридного засоления на растения прежде всего связано с возникающим дефицитом воды и токсическим влиянием ионов натрия и хлора (Munns, 2002). Засоление вызывает снижение устьичной проводимости и транспирации, что, в свою очередь, влияет на поступление в лист углекислого газа и на интенсивность фотосинтеза (Posphilov, 2003). Нами было установлено, что обработка проростков огурца АБК заметно снижала устьичную проводимость и транспирацию, а также интенсивность неттофотосинтеза как в обычных условиях, так и при засолении (табл. 4). Снижение устьичной проводимости при засолении проростков огурца приводило к уменьшению потери воды за счет транспирации. Очевидно, что снижение устьичной проводимости листьев способствует поддержанию уровня водного обмена при засолении растений, а следовательно, защищает их от излишней потери воды. Таким образом, АБК принимает участие в защитных реакциях растений на засоление, снижая устьичную проводимость и скорость транспирации, что благоприятно для растения в данных условиях.

Рис. 12. Влияние АБК на соле- и теплоустойчивость проростков огурца с. Зозуля при последовательном действии температуры 38°С и NaCl (154 мМ).

1 – контроль (без АБК), 2 – АБК (0,1 мМ).

Таблица 4. Влияние АБК и NaCl на транспирацию и нетто-фотосинтез проростков огурца с. Зозуля* Интенсивность Устьичная Интенсивность Вариант транспирации, проводимость, нетто-фотосинтеза, ммоль м-2 с-1 ммоль м-2 с-1 мкмоль м-2 с-Контроль 1,05±0,08 102,4±6,4 5,16±0,NaCl, 120 мM 0,20±0,06 20,2±2,4 2,61±0,АБК, 0.01 мМ 0,57±0,05 40,9±3,5 3,10±0,АБК + NaCl 0,11±0,02 7,0±0,6 1,78±0, * экспозиция на АБК и NaCl – 5 ч.

Выявленное нами повышение теплоустойчивости растений огурца при действии засоления, наряду с подобного рода данными других авторов (Kuznetsov et al., 1999), свидетельствует о функционировании в растениях общих механизмов устойчивости к указанным факторам. Для установления роли АБК в этих механизмах нами проведено изучение эффектов комбинированного действия хлоридного засоления и высоких температур.

Показано, что одновременное действие NaCl и температуры 38°С на проростки огурца приводило к повышению их теплоустойчивости (рис. 13). При этом уровень теплоустойчивости, достигнутый в первые 2 ч воздействия двух стрессоров, превышал таковой при действии только температуры 38°С, однако при более продолжительном (6 и 24 ч) воздействии – заметно уступал. Таким образом, экзогенная АБК способствует дополнительному приросту соле- и теплоустойчивости при комбинированном действии хлоридного засоления и высокой температуры. Полученные данные свидетельствуют об участии этого гормона в неспецифических механизмах формирования устойчивости к действию стресс-факторов разной природы.

Рис. 13. Влияние АБК (0,05 мМ) на теплоустойчивость проростков огурца c. Зозуля при одновременном действии температуры 38°С и NaCl (120 мМ).

1 – 38°С; 2 – 38°С+АБК; 3 – 38°С+NaCl; 4 – 38°+ NaCl +АБК.

Исходя из вышеизложенного, можно заключить, что в процессы адаптации растений к действию хлоридного засоления и высокой температуры вовлечена АБК, которая выступает в качестве триггера, запускающего процессы формирования повышенной устойчивости.

Влияние неблагоприятных факторов среды и АБК на экспрессию генов транскрипционных факторов и стрессовых белков Транскрипционный фактор CBF. Реакция растений на действие различных по своей природе стресс-факторов связана с экспрессией определенных генов (Thomashow, 1999). Например, экспрессия генов семейства транскрипционных факторов CBF/DREB (C-repeated binding factor/dehydration response elements binding protein) индуцируется у арабидопсиса обезвоживанием (Kume et al., 2005), низкими температурами (Thomashow, 1999) и ионами кадмия (Suzuki et al., 2001). В свою очередь, CBF факторы активируют экспрессию генов ряда стрессовых белков (Knight et al., 2004). Учитывая это, нами изучена экспрессия гена CBF1 у растений при действии стресс-факторов и АБК.

Установлено, что действие на проростки огурца температуры 10°С вызывает повышение уровня экспрессии гена транскрипционного фактора CBF1 и их холодоустойчивости. Экзогенная АБК стимулировала экспрессию данного гена уже при температуре 25°С, однако при холодовом закаливании в ее присутствии дополнительного увеличения уровня экспрессии гена по сравнению с вариантом “холодовое закаливание без АБК” не происходило. В условиях высокой закаливающей температуры 38°С увеличение теплоустойчивости клеток листа огурца сопровождалось повышением уровня экспрессии гена CBF1 (рис.

14). Предобработка проростков АБК способствовала дополнительному росту теплоустойчивости при закаливании и усиливала экспрессию данного гена в начальный его период.

Рис. 14. Влияние температуры 38°С и АБК (0,1 мМ) на теплоустойчивость (А) и экспрессию гена транскрипционного фактора CBF1 (Б) в листьях проростков огурца с.

Зозуля 1 – 38°С, 2 – 38°С+АБК.

Аналогично влиянию закаливающих температур, краткосрочное (1 ч) и более длительное (24 ч) воздействие NaCl (120 мМ) на проростки огурца вызывало усиление экспрессии гена транскрипционного фактора CBF1, при этом возрастала их устойчивость к засолению (рис. 15).

Рис. 15. Влияние NaCl (120 мМ) и АБК (0.мМ) на солеустойчивость (А) и экспрессию гена CBF1 (Б) у проростков огурца с. Зозуля.

1 – NaCl, 2– NaCl + АБК.

Полученные данные позволяют предполагать, что повышение неспецифической устойчивости растений огурца под влиянием низкой и высокой закаливающих температур и хлорида натрия связано с увеличением уровня экспрессии гена транскрипционного фактора CBF1, а один из возможных механизмов положительного действия АБК в отношении устойчивости связан с ее влиянием на экспрессию данного гена.

Транскрипционный фактор WRKY и cтрессовые белки. Повышение холодоустойчивости растений связывают с индукцией низкими температурами экс экспрессии Сor-генов (cold regulated genes), кодирующих COR-белки (Thomashow, 1999; Трунова, 2007). Нами изучена экспрессия гена недавно открытого транскрипционного фактора WRKY и Сor-генов белков у пшеницы при действии низкой температуры.

Сопоставление динамики холодоустойчивости клеток листьев и экспрессии генов транскрипционного фактора WRKY у проростков пшеницы указывает на существование определенной зависимости между уровнем экспрессии этого гена и формированием повышенной устойчивости в условиях действия низкой закаливающей температуры. В частности, нами обнаружено быстрое и значительное (в десятки раз по сравнению с исходным уровнем) увеличение экспрессии гена транскрипционного фактора WRKY, предшествующее росту холодоустойчивости проростков пшеницы (рис. 16). Из полученных данных следует, что повышение устойчивости связано с индукцией экспрессии гена WRKY в начальный период низкотемпературной адаптации. Предполагается, что транскрипционные факторы WRKY регулируют экспрессию генов, участвующих в ответе растений на различные неблагоприятные воздействия, через их связывание с cis-элементами W-блока промотера (Euglem et al., 2000). Однако, поскольку в наших опытах уровень экспрессии гена WRKY и холодоиндуцируемых генов Wcor15, Wrab17, Wrab19 и Wcs120 у растений пшеницы начинает повышаться практически одновременно (в первые 15 мин действия низкой температуры), то, очевидно, транскрипционный фактор WRKY не участвует в регуляции экспрессии указанных генов (рис. 17).

Б А 0,25 0,5 1 5 24 48 144 10,25 0,5 1 5 24 48 144 1Экспозиция, ч Экспозиция, ч Рис. 16. Изменение уровня экспрессии гена WRKY в зависимости от времени действия низкой закаливающей температуры (4°С) и АБК на проростки пшеницы с. Московская 39. А – 4°С; Б – 4°С+ АБК (0,1 мМ).

Уровень экспрессии гена Wcor15 повышался уже в первые минуты действия температуры 4°С и достигал наибольшей величины на 2-е сут закаливания (рис. 16), когда холодоустойчивость уже была близка к максимуму (рис. 17).

Индукция экспрессии генов Wrab17, Wrab19 и Wcs120 в листьях пшеницы также происходила довольно быстро. Таким образом, формирование повышенной устойчивости растений пшеницы, обнаруженное в наших опытах, сопряжено с более быстрой экспрессией Cor-генов (рис. 18). Важно отметить, уровень экспрессии Относительный Относительный уровень экспрессии что увеличение холодоустойчивости пшеницы при краткосрочном действии низкой температуры связано с экспрессией всех изученных генов – Wcor15, Wrab17, Wrab19 и Wcs120, а при продолжительном ее действии – прежде всего с экспрессией генов Wcor15 и Wrab17.

Рис. 17. Динамика холодоустойчивости пшеницы с. Московская 39 при действии закаливающей температуры (4°С) и АБК. 1 – 4°С; 2 – 4°С+ АБК (0,1 мМ).

Один из возможных механизмов защитного действия АБК заключается в регуляции экспрессии генов транскрипционных факторов и стрессовых белков (Gusta et al., 2000). АБК-индуцируемые гены содержат в промоторной области последовательность нуклеотидов ABRE (ABA-responsive element), вовлеченную в экспрессию генов. К числу индуцируемых АБК регуляторных белков относят транскрипционные факторы bZIP, MYC/MYB (Bhatnagar-Mathur et al., 2008). В отличие от этого, транскрипционные факторы CBF/DREB считают АБК-независимыми, хотя по некоторым данным экзогенная АБК способна индуцировать накопление транскриптов CBF-генов, но в значительно меньшей степени, чем низкая температура (Knight et al., 2004). В проведенных нами экспериментах экзогенная АБК подавляла экспрессию гена транскрипционного фактора WRKY проростков пшеницы при холодовом закаливании и не индуцировала аккумуляцию транскриптов при обычной температуре. Таким образом, экспрессия холодоиндуцируемого гена транскрипционного фактора WRKY у растений не является АБК-зависимой.

В присутствии экзогенной АБК в первые минуты низкотемпературного воздействия на проростки пшеницы отмечено значительное усиление экспрессии гена Wcor15, а через 2 сут от его начала – экспрессии генов Wcor15, Wrab17 и в меньшей степени Wrab19 (рис. 18). В отличие от этого, АБК ингибирует экспрессию гена Wcs120 при холодовом закаливании. Таким образом, положительное влияние АБК на холодоустойчивость растений пшеницы, отмеченное нами, очевидно связано с ее способностью регулировать экспрессию генов Wcor15, Wrab17 и Wrab19.

Б А 0,25 0,5 1 5 24 48 144 10,25 0,5 1 5 24 48 144 1Экспозиция, ч Экспозиция, ч Г В 8 6 4 2 0 0,25 0,5 1 5 24 48 144 168 0,25 0,5 1 5 24 48 144 1Экспозиция, ч Экспозиция, ч Е Д 2 1 0 0,25 0,5 1 5 24 48 144 168 0,25 0,5 1 5 24 48 144 1Экспозиция, ч Экспозиция, ч З Ж 0 0,25 0,5 1 5 24 48 144 168 0,25 0,5 1 5 24 48 144 1Экспозиция, ч Экспозиция, ч Рис. 18. Изменение уровня экспрессии генов Wcor15, Wrab17, Wrab19 и Wcs120 в зависимости от времени действия низкой закаливающей температуры (4°С) и АБК на проростки пшеницы с. Московская 39. А, Б – Wcor15; В, Г – Wrab17; Д, Е – Wrab19; Ж, З – Wcs120. А, В, Д, Ж – 4°С; Б, Г, Е, З – 4°С + АБК (0.1 мМ).

экспрессии Относительны й уровень экспрессии Относительный уровень экспрессии экспрессии Относительный уровень Относительный уровень экспрессии экспрессии Относительный уровень Относительный уровень экспрессии экспрессии Относительный уровень Относительный уровень В целом, приведенные данные позволяют считать, что действие АБК в начальный период воздействия неблагоприятных факторов среды направлено на индукцию и/или стимуляцию процессов, определяющих формирование повышенной устойчивости. Важно, что именно в начальный период действия стрессора, когда в растениях увеличивается эндогенный уровень гормона, у растений может повышаться устойчивость не только к действующему фактору, но и к ряду других факторов, тогда как при пролонгированном его действии отмечено ее снижение до исходных значений, происходящее на фоне уменьшения концентрации АБК. В то же время предобработка АБК до начала действия стрессора вызывала одновременное повышение устойчивости растений к нескольким стрессорам. На основании совокупности полученных данных можно сделать вывод об участии АБК в формировании повышенной устойчивости к различным стресс-факторам, а учитывая особенности динамики этого процесса, можно предполагать, что АБК способна выступать в качестве одного из триггерных механизмов для процесса формирования устойчивости.

6. РОЛЬ АУКСИНОВ И ЦИТОКИНИНОВ В МЕХАНИЗМАХ УСТОЙЧИВОСТИ РАСТЕНИЙ К ДЕЙСТВИЮ НЕБЛАГОПРИЯТНЫХ ФАКТОРОВ СРЕДЫ Изменение уровня эндогенной ИУК в растениях при действии низких и высоких температур Имеющиеся в литературе сведения о динамике содержания ауксинов в растениях в условиях низкой температуры обычно указывают на его уменьшение в этих условиях (Michaeli et al., 1999; Лукаткин, 2002), при этом подчеркивается необходимость инактивации ауксинов и снижения, тем самым, ростовой активности растений, как условия увеличения устойчивости (Гуревич, 1979).

Между тем, обратная зависимость между уровнем активности ауксинов и устойчивостью отмечается далеко не всегда (Волкова и др., 1991). Учитывая это, нами была изучена динамика уровня эндогенной ИУК растений в начальный период действия низких и высоких закаливающих температур.

На холодостойком (пшеница) и теплолюбивом (огурец) видах растений показано, что характер изменения уровня ИУК в начальный период действия низких закаливающих температур и при их длительном действии может различаться: рост холодоустойчивости в течение первых суток действия температуры 10°С происходил на фоне повышенного содержания ИУК в листьях, и только начиная со 2-х суток, уровень гормона снижался. В отличие от холодового, тепловое закаливание растений осуществлялось на фоне довольно высокого содержания свободной ИУК, характерного для растений, находящихся в обычных температурных условиях: после небольшого повышения в первые 0.5–1 ч воздействия температуры 38°С, в дальнейшем (в течение суток) содержание гормона сохранялось на уровне, характерном для незакаленных растений (рис. 19).

Рис. 19. Холодо- и теплоустойчивость клеток листьев и содержание в них ИУК при холодовом (А) и тепловом (Б) закаливании проростков огурца с.

Алма-Атинский В целом, формирование повышенной устойчивости сопровождается некоторым возрастанием количества ИУК в листьях в начальный период закаливания и последующем его снижением в более поздние периоды холодового закаливания или возвращением к исходному уровню при тепловом закаливании.

Таким образом, двухфазный характер изменения уровня эндогенных ауксинов в листьях в начальный период действия низких и высоких температур позволяет предполагать их участие в адаптивных реакциях растений. При продолжительном же действии неблагоприятных температур изменения в содержании ИУК, скорее всего, связаны, с необходимостью торможения ростовых процессов и снижения уровня метаболической активности растения.

Влияние экзогенной ИУК на холодо- и теплоустойчивость растений при действии низких и высоких температур На растениях пшеницы нами показана возможность осуществления теплового закаливания в присутствии экзогенной ИУК как в низких, так и относительно высоких (10–100 мг/л) концентрациях. Более того, выявлена зависимость процесса повышения устойчивости при тепловом закаливании не только от концентрации экзогенного ауксина, но и от времени его введения в растения. В частности, обработка проростков пшеницы за 1 сут до воздействия температуры 40°С ИУК в высоких концентрациях (10–100 мг/л) снижала закаливающий эффект на 14–18% по отношению к варианту «закаливание без ИУК» (табл. 5). При концентрации ИУК 1 мг/л величина ингибирования закалки составляла около 10%, а при использовании концентрации менее 1 мг/л процесс закаливания не подавлялся вообще. При введении ауксина непосредственно перед закаливанием диапазон его концентраций, при которых тепловая адаптация протекала успешно, заметно расширялся. Обработка ИУК спустя 6 ч от начала действия температуры 40°С (когда формирование устойчивости завершалось) вызывала ингибирование закалки лишь при применении гормона в концентрации 1 мг/л. Следовательно, обработка растений ИУК в довольно широком диапазоне концентраций не препятствует процессу их тепловой адаптации.

Таблица 5. Влияние ИУК на устойчивость проростков пшеницы с. Мироновская 808 при тепловом закаливании (1 сут при 40°С) Степень ингибирования закаливания, % Время концентрация ИУК, мг/л обработки ИУК 0 0.01 0.1 1 10 1За 1 сут до закалки 0 0 3* 11* 18 Перед закалкой 0 2* 3* 6 18 – Через 6 ч от начала закалки 0 7 14 21 – – * – различия с контролем (закалка без ИУК) недостоверны при Р 0,05.

Таким образом, то обстоятельство, что обработка растений ИУК не препятствует успешному протеканию процесса адаптации, позволяет думать, что этот гормон участвует в перестройке метаболизма, направленной на повышение устойчивости растений. Ауксины способны активировать или подавлять экспрессию десятков генов, в том числе ранних генов и генов вторичного ответа (Abel, Theodologis, 1996; Веселов, 2001). Учитывая это, логично предполагать, что быстрое повышение его уровня в начальный период действия закаливающих температур может прямо или опосредованно участвовать в запуске системы индуцированного синтеза белков. С другой стороны, быстрое действие ауксинов связано не только с влиянием на экспрессию генов, но и с изменением проницаемости мембран (Napier, Venis, 1995), активацией биосинтеза АБК (Hansen, Grossmann, 2000). В целом, несомненным является вывод об участии ауксина в контроле над адаптивными реакциями растений на действие неблагоприятных температур.

Влияние экзогенных цитокининов на устойчивость растений к действию неблагоприятных температур и хлоридного засоления Цитокинины, наряду с другими фитогормонами могут участвовать в реакциях растений, связанных с воздействием на них неблагоприятных факторов среды (Hare et al., 1997; Лукаткин, 2002; Фархутдинов, 2005; Ершова, 2007). В настоящем разделе приведены экспериментальные данные, полученные при изучении влияния экзогенных цитокининов на устойчивость растений при физиологически нормальной температуре и в процессе холодового и теплового закаливания, а также при действии хлорида натрия.

Низкие и высокие температуры. Установлено, что экспозиция проростков томата на растворе кинетина при температуре 25°С вызывала увеличение устойчивости клеток листьев к краткосрочному охлаждению и прогреву, одновременно повышалась выживаемость проростков после тестирующего прогрева или охлаждения (табл. 6).

Экзогенные цитокинины способны повышать эффективность как холодового, так и теплового закаливания. Наиболее выраженным позитивным действием в отношении закаливания обладал синтетический аналог цитокинина – БАП (рис. 20).

Таблица 6. Влияние кинетина (0,1 мг/л) на устойчивость проростков томата с. Московский осенний 3405 к действию низких и высоких температур Вариант Устойчивость клеток листа Выживаемость проростков (%) (ЛТ50, °С) к 5-минутному после тестирующего охлаждению прогреву охлаждения* прогрева* Контроль -6,5 ± 0.03 51,6 ± 0.04 42,3 ± 6.0 37,4 ± 5.Кинетин -7,2 ± 0.02 52,1 ± 0.03 78,5 ± 5.2 92,0 ±6. * тестирующее охлаждение и прогрев: 2°С, 3 сут; 45°С, 20 ч.

Рис. 20. Влияние БАП на теплоустойчивость листьев проростков огурца с. АлмаАтинский 1 и содержание в них АБК при температуре 38°С.

К – контроль (без обработки БАП), БАП – 3 мкМ.

Нами было высказано предположение, что повышение устойчивости к неблагоприятным температурам с помощью экзогенных цитокининов связано с активацией работы белоксинтезирующего аппарата (Титов и др., 1986). В связи с этим весьма показательны результаты опытов по изучению совместного влияния ингибиторов белкового синтеза (АКТ, ЦГ) и цитокинина на устойчивость растений. Так, у незакаленных растений томата кинетин увеличивал устойчивость клеток к низким и высоким температурам, АКТ и ЦГ не влияли на их устойчивость, но в значительной степени снижали прирост устойчивости, вызываемый цитокинином. При холодовом закаливании контрольных (без ингибиторов и гормона) проростков их холодоустойчивость увеличивалась, обработка кинетином приводила к дополнительному приросту устойчивости, а АКТ и ЦГ препятствовал ее повышению. В то же время в вариантах «кинетин+АКТ» и «кинетин+ЦГ» ингибиторы снижали стимулирующее действие гормона на холодоустойчивость. При тепловом закаливании АКТ и ЦГ ингибировали рост устойчивости, вызываемый кинетином.

На основании полученных нами результатов и данных литературы (Кулаева, 1982; Hare, van Staden, 1997; Шакирова, 2001; Кулаева, Кузнецов, 2002) можно заключить, что при повышении устойчивости растений к холоду или теплу в присутствии цитокинина активизируется система биосинтеза белка.

Очевидно, при действии на растения низких и высоких закаливающих температур цитокинины, стимулируя работу аппарата биосинтеза белка, тем самым создают более благоприятную внутриклеточную обстановку не только для идущих в это время конститутивных синтезов (как это наблюдается при оптимальных температурах), но и одновременно с этим для биосинтезов стрессовых белков. Вместе с тем, нельзя не отметить, что действие цитокининов на устойчивость растений может осуществляться и через иные механизмы. В частности, БАП способствует открыванию устьиц и усиливает транспирацию как в нормальных температурных условиях, так и при неблагоприятных температурах (Pospiilov, 2003). Нами на проростках огурца выявлено повышение транспирации в присутствии БАП не только при действии температуры 25°С, но и в начальный период теплового закаливания при 38°С. Усиление транспирации в начальный период действия повышенных температур приводит к снижению температуры листьев, что благоприятно для растения в этих условиях.

Помимо этого, положительные эффекты цитокинина на растения в условиях неблагоприятных температур связаны с индукцией им накопления стрессового гормона АБК (рис. 20), который, по-видимому, выступает в качестве интермедиата в реализации антистрессового действия цитокининов.

Хлоридное засоление. В литературе имеются лишь единичные и к тому же противоречивые сведения о влиянии экзогенных цитокининов на растения в условиях засоления (Kirkham et al., 1974; Аbdullah, Ahmad, 1990). Проведенное нами изучение влияния БАП на солеустойчивость проростков огурца показало, что обработка этим гормоном приводила к ее повышению уже в начальный период (первые часы) действия (табл. 7). При этом действие БАП было связано с его влиянием на процесс транспирации: в отсутствии стресса гормон заметно повышал интенсивность транспирации листьев проростков огурца на фоне практически неизменной устьичной проводимости. В начальный период засоления происходило значительное снижение устьичной проводимости и интенсивности транспирации, а обработка проростков БАП препятствовала их снижению (табл. 7).

Таблица 7. Влияние БАП на солеустойчивость, нетто-фотосинтез, транспирацию и устьичную проводимость проростков огурца с. Зозуля при действии NaCl (5 ч) Солеустойчи- Нетто- Интенсивность Устьичная Вариант вость фотосинтез, транспирации, проводимость, (ЛОД50), МПа мкмоль м–2 с-1 моль м–2 с-1 моль м–2 с-Контроль 0,75±0,05 5,06±0,18 0,68±0,06 82,5±5,NaCl, 120 мM 0,85±0,04 2,76±0,20 0,15±0,04 15,2±2,БАП, 4 мкМ 0,81±0,06 5,61±0,22 0,95±0,08 89,8±8,БАП + NaCl 0,90±0,04 3,78±0,15 0,27±0,03 24,6±2,Учитывая обнаруженную нами способность БАП оказывать положительное влияние на процессы транспирации и фотосинтеза в первые часы действия хлорида натрия на растения, можно заключить, что цитокинины принимают активное участие в защитных реакциях растений, наблюдаемых в начальный период засоления.

В целом, полученные данные позволяют сделать заключение о том, что как в нормальных условиях, так и при действии неблагоприятных температур и засоления позитивный эффект цитокининов в отношении устойчивости растений обеспечивается за счет их стимулирующего влияния на биосинтез белка и ряд физиолого-биохимических процессов, участвующих в поддержании структурной и функциональной целостности клеток, благодаря чему увеличивается их устойчивость.

ЗАКЛЮЧЕНИЕ Анализ результатов проведенных исследований позволил установить наиболее общие закономерности реакции растений на действие неблагоприятных факторов среды абиотической природы (низкие и высокие температуры, хлоридное засоление и тяжелые металлы). Все изученные факторы в невысоких (закаливающих, субповреждающих) дозах вызывают повышение устойчивости, а в более высоких (повреждающих) дозах – снижение устойчивости, повреждение и гибель растений.

Обнаруженное нами сходство в реакции растений на действие различных стресс-факторов, а также возможность одновременного повышения различных видов устойчивости в начальный период их действия указывают на участие и важную роль в формировании повышенной устойчивости растений наряду со специфическими неспецифических (общих) механизмов.

Результаты проведенных исследований указывают на ключевую роль в механизмах формирования специфической устойчивости растений к действию неблагоприятных факторов среды белоксинтезирующей системы клеток. Об этом, в частности, свидетельствует тот факт, что подавление белкового синтеза с помощью ингибиторов транскрипции или трансляции препятствует росту холодо- и теплоустойчивости растений в условиях действия низких или высоких закаливающих температур. Кроме того, обнаруженное значительное (в десятки раз) увеличение экспрессии гена транскрипционного фактора WRKY, а также Cor-генов (Wcor15, Wrab17, Wrab19 и Wcs120) уже в начальный период действия на растения пшеницы низкой закаливающей температуры позволяет предполагать их участие в повышении устойчивости.

При анализе механизмов неспецифического реагирования растений наше внимание было сосредоточено на участии в этих процессах фитогормонов – АБК, ауксинов и цитокининов. Как оказалось, низкие и высокие закаливающие и повреждающие температуры, а также хлорид натрия и ионы свинца вызывают значительное транзитное накопление АБК уже в начальный период их действия. Важно, что аккумуляция АБК происходит не только при действии неблагоприятных факторов на целое растение, но и при их локальном воздействии (высокой температуры) только на корневую систему или побег. Кроме того, в условиях закаливающих температур происходит быстрое, но незначительное по величине, повышение уровня другого гормона – ИУК, которое сменяется его снижением при пролонгировании воздействия. Вероятно, подобные быстрые сдвиги в гормональной системе в начальный период действия неблагоприятных факторов представляют собой неспецифическую защитноприспособительную реакцию, имеющую важное значение для переключения функциональной активности клеток с обычных программ (ростовой и онтогенетической) на адаптивную(ые).

Об этом же свидетельствует и то, что экзогенные фитогормоны (АБК, ИУК и цитокинины) способны заметно изменять уровень устойчивости растений к неблагоприятным факторам среды. Так, экзогенная АБК положительно влияет на холодо-, тепло- и солеустойчивость растений. Более того, при действии одного из стрессоров экзогенная АБК приводит к одновременному повышению устойчивости к другим стресс-факторам.

Таким образом, результаты изучения динамики уровня АБК при действии различных стресс-факторов и данные об увеличении с помощью экзогенной АБК устойчивости растений к холоду и теплу позволяют заключить, что этот гормон играет важную роль в защитно-приспособительных реакциях растений на действие неблагоприятных факторов абиотической природы. При этом не исключено, что именно накопление АБК может выступать в качестве одного из триггерных механизмов процесса формирования повышенной устойчивости растений.

Как показано нами, эффекты АБК на устойчивость могут быть связаны как с ее влиянием на различные физиолого-биохимические процессы, определяющие неспецифическую устойчивость растений, так и с усилением экспрессии холодоиндуцируемых генов Wrab17 и Wrab19 и Wcor15, а также гена транскрипционного фактора CBF1. Однако, независимо от того, какой механизм повышения устойчивости реализуется в присутствии АБК, несомненным является вывод о том, что данный гормон является эффективным индуктором устойчивости растений к неблагоприятным факторам среды.

К этому необходимо добавить, что не только АБК, но и другие гормоны, в частности, ауксины также участвуют в адаптивных процессах, происходящих в растении под влиянием того или иного стрессора. Об этом, в частности, свидетельствуют наши данные об изменении уровня эндогенной ИУК в растениях при действии низких и высоких температур Цитокинины, наряду с АБК и ИУК, также принимают активное участие в физиологических реакциях, связанных с воздействием на растения различных по своей природе стресс-факторов. Нами было установлено, что экзогенные кинетин и БАП способны повышать эффективность как холодового, так и теплового закаливания растений. Цитокинины, как известно, стимулируют работу белоксинтезирующей системы (Кулаева, Кузнецов, 2002), поэтому повышение устойчивости растений к действию низких и высоких закаливающих температур, а также хлоридного засоления под влиянием экзогенных цитокининов может быть связано с активацией работы белоксинтезирующего аппарата клеток. В этом случае цитокинины, стимулируя работу аппарата биосинтеза белка, создают тем самым более благоприятную внутриклеточную обстановку и для биосинтеза адаптивных (стрессовых) белков. В то же время положительные эффекты цитокининов на устойчивость связаны с индукцией ими накопления АБК, которая выступает в этом случае в качестве интермедиата в реализации их антистрессового действия.

В целом проведенные исследования позволяют заключить, что фитогормоны активно участвуют в формировании повышенной устойчивости растений к действию неблагоприятных факторов среды абиотической природы. Очевидно, что при адаптации растений к неблагоприятным условиям существовавший до этого гормональный баланс изменяется и устанавливается новый, который способствует созданию в клетках и тканях наиболее благоприятных условий для осуществления процессов, связанных с адаптацией. Обнаруженный однотипный характер изменений эндогенных АБК и ауксинов в начальный период действия различных стресс-факторов позволяет предполагать их активное участие в ранних этапах процесса адаптации. При этом не исключено, что именно накопление АБК может выступать в качестве одного из триггерных механизмов для процесса повышения устойчивости растений. По-видимому, АБК способна влиять на экспрессию генетических программ в клетках и подавлять синтез мРНК и соответствующих им белков, характерных для нормальных условий, и одновременно с этим индуцировать работу генов, контролирующих синтез белков, имеющих значение для формирования повышенной устойчивости. Изменение баланса фитогормонов в сторону снижения уровня стимуляторов (в том числе ИУК) и накопления ингибиторов (АБК) в более поздние периоды адаптации также имеет важное значение, поскольку приводит к торможению ростовых процессов, в результате чего энергетические и пластические ресурсы не тратятся на рост, а направляются на поддержание структур клетки в новых, неблагоприятных для жизнедеятельности растений условиях.

Таким образом, фитогормоны вносят важный вклад в физиологобиохимические механизмы перестройки клеток, происходящей уже в начальный период действия неблагоприятных факторов среды абиотической природы, а следовательно, наряду с генетической системой, играют ключевую роль в адаптивных реакциях, способствующих формированию повышенной устойчивости растений.

ВЫВОДЫ 1. Характер реакции растений на воздействие неблагоприятные факторов среды абиотической природы (низкие и высокие температуры, хлоридное засоление, тяжелые металлы) зависит от его интенсивности и продолжительности: в невысоких (закаливающих, субповреждающих) дозах указанные стрессоры вызывают увеличение устойчивости, а в более высоких (повреждающих) дозах – снижение устойчивости, повреждение и гибель растений.

2. В начальный период действия на растения каждого из изученных стрессоров (низкие и высокие температуры, хлоридное засоление, тяжелые металлы) происходит одновременное повышение устойчивости к нескольким другим стресс-факторам. В дальнейшем устойчивость к действующему стрессору продолжает возрастать до достижения стационарного уровня, в то время как первоначальное повышение устойчивости к другим стресс-факторам сменяется возвратом к исходному уровню. Способность к одновременному увеличению различных видов устойчивости в начальный период действия конкретного стрессора указывает на функционирование в растениях неспецифических (общих) механизмов повышения устойчивости.

3. Значительное транзитное повышение уровня эндогенной АБК в тканях растений в начальный период действия низких и высоких температур, хлорида натрия и тяжелых металлов предшествует увеличению устойчивости растений, что указывает на участие этого гормона в неспецифическом повышении устойчивости к различным стресс-факторам.

4. Аккумуляция АБК в листьях и корнях растений происходит не только при действии неблагоприятного фактора (высокой температуры) на целое растение, но и при его локальном действии на корневую систему и надземную часть растения, что может сопровождаться повышением устойчивости органов, не подвергавшихся указанному воздействию.

5. В начальный период действия низких и высоких закаливающих температур в тканях растений происходит небольшое транзитное увеличение уровня ИУК, предшествующее повышению устойчивости, в дальнейшем он снижается (при низкой температуре) или сохраняется на уровне незакаленных растений (при высокой температуре).

6. Экзогенная АБК вызывает повышение устойчивости растений не только к действующему в данный момент стрессору, но и одновременно к нескольким другим стресс-факторам. Экзогенная АБК и цитокинины, повышая устойчивость к действию стресс-факторов абиотической природы, оказывают разнонаправленное действие на некоторые физиологические процессы (интенсивность транспирации и скорость нетто-фотосинтеза). В то же время положительные эффекты цитокининов на устойчивость связаны с индукцией ими накопления АБК, которая выступает в качестве интермедиата в реализации их антистрессового действия.

7. В начальный период действия низких закаливающих температур на растения холодостойкого вида (пшеница) обнаружено значительное увеличение уровня экспрессии гена транскрипционного фактора WRKY, предшествующее росту устойчивости, что указывает на его непосредственное участие в формировании повышенной холодоустойчивости. Увеличение устойчивости в начальный период действия низкой закаливающей температуры на растения пшеницы также связано с экспрессией АБК-зависимых генов (Wrab17, Wrab19) и Cor-генов (Wcor15, Wcs120), в то время как при длительной низкотемпературной адаптации – прежде всего с экспрессией генов Wrab17 и Wcor15.

8. Показано, что повышение неспецифической устойчивости теплолюбивого вида растений (огурец) под влиянием низкой и высокой закаливающих температур и хлорида натрия связано с увеличением уровня экспрессии гена транскрипционного фактора CBF1, а один из возможных механизмов положительного действия АБК в отношении устойчивости связан с ее влиянием на экспрессию данного гена.

9. Совокупность полученных экспериментальных данных позволяет заключить, что формирование повышенной устойчивости растений в начальный период действия стресс-факторов абиотической природы (низкие температуры, высокие температуры, хлорид натрия, тяжелые металлы) представляет собой сложный многокомпонентный процесс, сопряженный с быстрым изменением уровня фитогормонов, и прежде всего АБК, а также их баланса, что приводит к переключению функциональной активности клеток с обычных программ (ростовой, онтогенетической) на адаптивную(ые), обеспечивая тем самым выживаемость растений в неблагоприятных условиях.

СПИСОК ОСНОВНЫХ РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ Монографии:

1. Титов А.Ф., Акимова Т.В., Таланова В.В., Топчиева Л.В. Устойчивость растений в начальный период действия неблагоприятных температур. М.: Наука.

2006. 143 с.

2. Титов А.Ф., Таланова В.В., Казнина Н.М., Лайдинен Г.Ф. Устойчивость растений к тяжелым металлам. Петрозаводск: Карельский научный центр РАН.

2007. 172 с.

Статьи в рецензируемых журналах, рекомендуемых ВАК:

3. Титов А.Ф., Дроздов С.Н., Таланова В.В., Критенко С.П. К вопросу о функциональной автономности систем, контролирующих закаливание теплолюбивых растений к холоду и теплу // Доклады АН СССР. 1982. Т. 263. № 3. С.

766–768.

4. Титов А.Ф., Таланова В.В., Дроздов С.Н. Влияние специфических ингибиторов транскрипции и трансляции на холодовое и тепловое закаливание растений томата // Физиология растений. 1982. Т. 29. Вып. 4. С. 790–793.

5. Дроздов С.Н., Титов А.Ф., Таланова В.В. О термоадаптивных возможностях растений томата // Сельскохозяйственная биология. 1982. Т. 17. № 4. С. 463– 469.

6. Титов А.Ф., Дроздов С.Н., Критенко С.П., Таланова В.В. О роли специфических и неспецифических реакций в процессах термоадаптации активно вегетирующих растений // Физиология растений. 1983. Т. 30. Вып. 3. С. 544–551.

7. Таланова В.В., Дроздов С.Н., Титов А.Ф., Акимова Т.В. Действие и последействие экстремальных температур на дыхательную активность листьев Lусореrsiсоn еsсulеntum Мill. (Sоlаnасеае) // Ботанический журнал. 1983. Т. 68. № 8. С. 1073–1078.

8. Drоzdоv S.N., Тitоv А.F., Таlаnоvа V.V., Кritеnkо S.Р., Shеrudilо Е.G., Аkimоvа Т.V. Тhе еffесt оf tеmреrаturе оn соld аnd hеаt rеsistаnсе оf grоwing рlаnts. I.

Сhilling-sеnsitivе sресiеs // Jоurnаl оf Ехрerimental Воtаnу. 1984. V. 35. № 160.

P. 1595–1602.

9. Титов А.Ф., Дроздов С.Н., Таланова В.В., Критенко С.П. Влияние абсцизовой кислоты на устойчивость активно вегетирующих растений к низким и высоким температурам // Физиология растений. 1985. Т. 32. Вып. 3. С. 565–572.

10. Титов А.Ф., Дроздов С.Н., Акимова Т.В., Таланова В.В. Реакция теплолюбивых растений на действие повышенных температур: динамика тепло- и холодоустойчивости // Журнал общей биологии. 1986. Т. ХLVII. № 3. С. 374–380.

11. Титов А.Ф., Дроздов С.Н., Таланова В.В., Акимова Т.В. Скорость теплового закаливания как критерий оценки теплоустойчивости сортов сои // Сельскохозяйственная биология. 1986. № 4. С. 64–66.

12. Титов А.Ф., Дроздов С.Н., Таланова В.В., Акимова Т.В. О механизмах повышения теплоустойчивости растений при краткосрочном и длительном действии высоких температур // Физиология растений. 1987. Т. 34. Вып.1. С. 173– 177.

13. Титов А.Ф., Дроздов С.Н., Акимова Т.В., Таланова В.В. Исследование реакции растений сои на действие температуры. Границы температурных зон // Физиология растений. 1987. Т. 34. Вып. 2. С. 350–355.

14. Титов А.Ф., Таланова В.В., Акимова Т.В. Изменения теплоустойчивости проростков томата при комбинировании краткосрочных и длительных закалок // Физиология растений. 1988. Т. 35. Вып. 1. С. 158–164.

15. Волкова Р.И., Титов А.Ф., Таланова В.В., Дроздов С.Н. Изменения в системе ауксинов в начальный период теплового и холодового закаливания вегетирующих растений // Физиология растений. 1991. Т. 38. Вып. 3. С. 538–544.

16. Таланова В.В., Титов А.Ф., Боева Н.П. Изменение уровня эндогенной абсцизовой кислоты в листьях растений под влиянием холодовой и тепловой закалки // Физиология растений. 1991. Т. 38. Вып. 5. С. 991–997.

17. Таланова В.В., Титов А.Ф., Минаева С.В., Солдатов С.Е. Раздельное и комбинированное действие засоления и закаливающих температур на растения // Физиология растений. 1993. Т. 40. Вып. 4. С. 584–588.

18. Таlаnоvа V.V., Тitоv А.F. Еndоgеnоus аbsсisiс асid соntеnt in сuсumbеr lеаvеs undеr thе influеnсе оf unfаvоurаblе tеmреrаturеs аnd sаlinitу // Journal of Ехрerimental Воtany. 1994. V. 45. № 276. P. 1031–1033.

19. Титов А.Ф., Таланова В.В., Боева Н.П., Минаева С.В., Солдатов С.Е. Влияние ионов свинца на рост проростков пшеницы, ячменя и огурца // Физиология растений. 1995. Т. 42. № 3. С. 457–462.

20. Таланова В.В., Титов А.Ф., Боева Н.П. Реакция растений на ионы свинца и неблагоприятную температуру // Доклады РАСХН. 1996. N 5. C. 5–7.

21. Тitоv А.F., Таlаnоvа V.V., Воеvа N.Р. Grоwth rеsроnsеs оf bаrlеу аnd whеаt sееdlings tо lеаd аnd саdmium // Вiоlоgiа Рlаntаrum. 1996. V. 38. N 3. P. 431–436.

22. Таланова В.В., Титов А.Ф., Боева Н.П. Влияние ионов кадмия и свинца на рост и содержание пролина и АБК в проростках огурца // Физиология растений. 1999. Т. 46. № 1. С. 164–167.

23. Таланова В.В., Титов А.Ф., Боева Н.П. Влияние возрастающих концентраций тяжелых металлов на рост проростков ячменя и пшеницы // Физиология растений. 2001. Т. 48. № 1. С. 119–123.

24. Таланова В.В., Титов А.Ф., Боева Н.П. Влияние свинца и кадмия на проростки ячменя // Физиология растений. 2001. Т. 33. № 1. С. 33–37.

25. Talanova V.V., Titov A.F., Boeva N.P. Effect of increasing concentrations of lead and cadmium on cucumber seedlings // Biologia Plantarum. 2000. V. 43. № 3.

P.441–444.

26. Титов А.Ф., Таланова В.В., Акимова Т.В. Динамика холодо- и теплоустойчи вости растений при действии различных стресс-факторов на их корневую систему // Физиология растений. 2003. Т. 50. № 1. С. 94–99.

27. Таланова В.В., Акимова Т.В., Титов А.Ф. Динамика содержания АБК в листьях и корнях проростков огурца и их теплоустойчивости под влиянием общего и локального прогрева // Физиология растений. 2003. Т. 50. Вып. 1. С. 100– 104.

28. Лайдинен Г.Ф., Таланова В.В., Титов А.Ф., Казнина Н.М. Влияние свинца на рост и развитие Setaria viridis (L.) Beauv. // Растительные ресурсы. 2004. Т. 40, вып. 3. С. 53–59.

29. Таланова В.В., Таланов А.В., Титов А.Ф. Динамика фотосинтеза и транспирации проростков огурца в начальный период хлоридного засоления и при действии фитогормонов // Доклады РАСХН. 2006. № 2. С. 10–13.

30. Таланова В.В., Топчиева Л.В., Титов А.Ф. Влияние абсцизовой кислоты на устойчивость проростков огурца к комбинированному действию высокой температуры и хлоридного засоления // Известия РАН. Сер. биологическая. 2006.

№ 5. С. 757–761.

31. Таланова В.В., Титов А.Ф., Топчиева Л.В., Малышева И.Е. Влияние стрессфакторов на экспрессию гена транскрипционного фактора CBF у растений огурца // Доклады Академии наук. 2008. Т. 423. № 2. С. 283–285.

32. Таланова В.В., Титов А.Ф., Топчиева Л.В., Малышева И.Е., Венжик Ю.В., Фролова С.А. Экспрессия генов транскрипционного фактора WRKY и белков холодового шока у растений пшеницы при холодовой адаптации // Доклады Академии наук. 2008. Т. 423. № 4. С. 567–569.

Другие публикации:

33. Дроздов С.Н., Акимова Т.В., Таланова В.В., Титов А.Ф. Дыхательный газообмен листьев огурцов и томатов в зависимости от температуры // Физиология и биохимия культурных растений. 1982. Т. 14. № 6. С. 579–583.

34. Таlаnоvа V.V., Тitоv А.F., Drоzdоv S.N., Аkimоvа Т.V. Еffесt оf tеmреrаturе оn thе thеrmоrеsistаnсе аnd rеsрirаtiоn оf tоmаtо lеаvеs (Lусореrsiсоn еsсulеntum Мill.) // Вiосhеmiе und Рhуsiоlоgiе dеr Рflаnzеn. 1983. V. 178. № 8. Р. 601–605.

35. Титов А.Ф., Таланова В.В., Дроздов С.Н. Модификация процессов холодового и теплового закаливания растений томата с помощью экзогенных фитогормонов // Биологические науки. 1984. № 10. С. 88–91.

36. Титов А.Ф., Акимова Т.В., Таланова В.В., Критенко С.П. Физиологическая адаптация огурцов и томатов к холоду и повышенным температурам // Физиология и биохимия культурных растений. 1984. Т. 16. № 6. С. 589–593.

37. Акимова Т.В., Таланова В.В., Титов А.Ф. Динамика физиологобиохимических процессов в листьях томата при последовательной смене режимов холодового и теплового закаливания // Терморезистентность и продуктивность сельскохозяйственных растений. Петрозаводск, Карельский филиал АН СССР. 1984. С. 23–30.

38. Титов А.Ф., Дроздов С.Н., Критенко С.П., Таланова В.В., Шерудило Е.Г.

Влияние цитокининов на холодо- и теплоустойчивость активно вегетирующих растений // Физиология и биохимия культурных растений. 1986. Т. 18. № 1. С.

64–69.

39. Титов А.Ф., Шерудило Е.Г., Таланова В.В., Критенко С.П. Влияние цитокининов на устойчивость незакаленных растений к экстремальным температурам и процессы температурной адаптации и реадаптации // Термоадаптация и продуктивность растений. 1986. Петрозаводск, Карельский филиал АН СССР. С.

80–90.

40. Титов А.Ф., Дроздов С.Н., Таланова В.В., Акимова Т.В. Влияние актиномицина Д и циклогексимида на процесс адаптации сои к высокой температуре // Физиология и биохимия культурных растений. 1987. Т. 19. № 2. С. 146–149.

41. Таланова В.В., Акимова Т.В., Титов А.Ф., Критенко С.П., Шерудило Е.Г. Раздельное и совместное влияние фитогормонов и ингибиторов белкового синтеза на холодо- и теплоустойчивость растений // Влияние факторов среды и физиологически активных веществ на продуктивность и устойчивость растений.

Петрозаводск, Карельский филиал АН СССР. 1988. С. 89–97.

42. Таланова В.В., Титов А.Ф. Действие экзогенных гормонов и ингибиторов синтеза белка при повреждающих низких и высоких температурах // Физиология и биохимия культурных растений. 1989. Т. 21. № 1. С. 45–48.

43. Таланова В.В., Кудоярова Г.Р., Титов А.Ф. Динамика содержания абсцизовой и индолилуксусной кислот в листьях растений огурца при тепловой адаптации // Физиология и биохимия культурных растений. 1990. Т. 22. № 2. С. 153–157.

44. Таланова В.В., Кудоярова Г.Р., Титов А.Ф. Динамика содержания эндогенных АБК и ИУК в листьях растений огурца при тепловой адаптации // Иммуноферментный анализ регуляторов роста растений. Применение в физиологии растений и экологии. Уфа. 1990. С. 89–97.

45. Волкова Р.И., Таланова В.В. Влияние экзогенного ауксина на теплоустойчивость растений озимой пшеницы при адаптации к высоким температурам // Эколого-физиологические аспекты устойчивости, роста и развития растений.

Петрозаводск, КНЦ АН СССР. 1990. С. 26–35.

46. Таланова В.В., Титов А.Ф. Влияние актиномицина Д и циклогексимида на уровень абсцизовой кислоты в листьях проростков огурца при тепловой адаптации // Влияние внешних факторов на устойчивость, рост и развитие растений. Петрозаводск, КНЦ РАН. 1992. С. 52–59.

47. Тitоv А.F., Таlаnоvа V.V., Аkimоvа Т.V., Кritеnkо S.Р., Кruрnоvа I.V., Shеrudilо Е.G. Сhаrасtеrizаtiоn оf ассlimаtiоn-dеассlimаtiоn рrосеssеs tо high аnd lоw tеmреrаturеs in сrор рlаnts // Моlесulаr rеsроnsеs оf рlаnts tо biоtiс аnd аbiоtiс strеssеs. University оf Неlsinki. Рubl. № 43. 1994. P. 42–44.

48. Таланова В.В., Титов А.Ф., Минаева С.В. Сравнительное изучение реакции растений пшеницы на действие неблагоприятных факторов разной природы // Адаптация, рост и развитие растений. Петрозаводск, КНЦ РАН. 1994. С. 22– 29.

49. Акимова Т.В., Таланова В.В., Топчиева Л.В., Титов А.Ф. Динамика содержания абсцизовой кислоты в листьях проростков огурца и ячменя при высоких закаливающих и повреждающих температурах // Физиология и биохимия культурных растений. 1995. Т. 27. № 4. С. 298–302.

50. Тitоv А., Таlаnоvа V., Аkimоvа Т., Ваlаgurоvа N., Shеrudilо Е., Воуеvа N., Торсhiеvа L. Рlаnt rеsistаnсе tо strеss fасtоrs // Моlесulаr rеsроnsеs оf рlаnts tо biоtiс аnd аbiоtiс strеssеs. University оf Неlsinki. Рubl. № 45. 1996. P. 19–20.

51. Тitоv А.F., Таlаnоvа V.V., Воуеvа N.Р. Еаrlу diаgnоstiсs оf рlаnts dаmаgе bу hеаvу mеtаls thrоugh рhуsiоlоgiсаl аnd biосhеmiсаl indехеs // Вiоindiсаtiоn аnd еvа еvаluаtiоn оf dаmаgе in оrgаnisms аnd есоsystеms. Рrосееding оf first intеrnаtiоnаl соnfеrеnсе оf Ваrеnts Еurо-Аrсtiс rеgiоn. Реtrоzаvоdsk. 1997. P. 276–277.

52. Тitоv А.F., Таlаnоvа V.V., Воуеvа N.Р. Studу оf рhуsiоlоgiсаl аnd biосhеmiсаl mесhаnisms оf рlаnt rеsроnsе tо hеаvу mеtаls // Моlесulаr rеsроnsеs оf рlаnts tо biоtiс аnd аbiоtiс strеssеs. University оf Неlsinki. Рubl. № 50. 1997. P. 11–12.

53. Таланова В.В., Титов А.Ф. Влияние стресс-факторов разной природы на содержание АБК и ИУК в тканях растений // Иммуноанализ регуляторов роста в решении проблем физиологии растений, растениеводства и биотехнологии.

Уфа. 2000. С. 148–151.

54. Таланова В.В., Топчиева Л.В., Титов А.Ф. Влияние абсцизовой кислоты на устойчивость проростков огурца к высокой температуре и хлоридному засолению // Физиология и биохимия культурных растений. 2003. Т. 33. № 2. С. 124– 130.

55. Титов А.Ф., Акимова Т.В., Балагурова Н.И., Таланова В.В., Топчиева Л.В., Шерудило Е.Г. Устойчивость активно вегетирующих растений к низким и высоким температурам. I. Закономерности варьирования устойчивости // Наземные и водные экосистемы Северной Европы: Управление и охрана. Материалы международной конференции, посвященной 50-летию Института биологии Карельского научного центра РАН. Петрозаводск. 2003. С. 138–144.

56. Титов А.Ф., Акимова Т.В., Таланова В.В., Топчиева Л.В., Шерудило Е.Г., Мешкова Е.А. Устойчивость активно вегетирующих растений к низким и высоким температурам. II. Роль белоксинтезирующей системы и АБК в механизмах устойчивости // Наземные и водные экосистемы Северной Европы:

Управление и охрана. Материалы международной конференции, посвященной 50-летию Института биологии Карельского научного центра. Петрозаводск.

2003. С. 145–151.

57. Таланова В.В., Топчиева Л.В., Титов А.Ф. Влияние комбинированного действия высокой температуры и засоления на устойчивость огурца // Физиологические аспекты продуктивности растений. Ч. 1. Орел. 2004. С. 114–118.

58. Таланова В.В., Таланов А.В., Титов А.Ф. Фотосинтез и транспирация проростков огурца в условиях хлоридного засоления // Структурно-функциональные особенности биосистем Севера (особи, популяции, сообщества). Материалы конференции. Ч. 2. Петрозаводск. 2005. С. 163–166.

59. Таланова В.В., Титов А.Ф. О роли ауксинов в механизмах адаптации растений к действию низких и высоких температур // Северная Европа в XXI веке: природа, культура, экономика. Материалы Междунар. конф., посвященной 60летию КарНЦ РАН. Секция «Биологические науки». Секция «Науки о Земле».

Петрозаводск: Изд-во КарНЦ РАН, 2006. С. 212–214.

60. Kaznina N.M., Titov A.F., Laidinen G.F., Talanov A.V., Talanova V.V. Effect of cadmium on Poaceae plants // Physiologia Plantarum. XVI Congress of the Federation of European societies of plant biology (Tampere, Finland, 2008). 2008. V. 133, № 3. P09-083.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.