WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

РОССИЙСКАЯ АКАДЕМИЯ НАУК

УФИМСКИЙ НАУЧНЫЙ ЦЕНТР

ИНСТИТУТ БИОХИМИИ И ГЕНЕТИКИ

__________________________________________________________________

  На правах рукописи

ХИДИЯТОВА ИРИНА МИХАЙЛОВНА

ЭПИДЕМИОЛОГИЯ И МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ ОСНОВЫ НАСЛЕДСТВЕННЫХ ЗАБОЛЕВАНИЙ НЕРВНОЙ СИСТЕМЫ

В РЕСПУБЛИКЕ БАШКОРТОСТАН

03.00.15. генетика

Автореферат

диссертации на соискание ученой степени

доктора биологических наук

Уфа- 2008

Работа выполнена в Институте биохимии и генетики Уфимского научного центра РАН

Научный консультант:

  доктор биологических наук, профессор

Хуснутдинова Эльза Камилевна

Официальные оппоненты:

доктор биологических наук, профессор

Мустафина Ольга Евгеньевна

Институт биохимии и генетики УНЦ РАН

доктор биологических наук

Голденкова Ирина Васильевна

Институт общей генетики им. Н.И. Вавилова РАН

доктор медицинских наук, профессор

Петрин Александр Николаевич

Медико-стоматологический московский государственный

  университет МЗ РФ

Ведущее учреждение:

  ГУ Медико-генетический научный центр РАМН

 

Защита состоится  25 декабря 2008г. в __14.00____час.

на заседании Диссертационного совета ДМ 002.133.01 по адресу:

г.Уфа, 450054, Проспект Октября, 71

http://www.anrb.ru/molgen/dissov.html

С диссертацией можно ознакомиться в библиотеке  Уфимского научного центра РАН

Автореферат разослан «____»______________2008г.

Ученый секретарь Диссертационного совета

кандидат биологических наук С.М.Бикбулатова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

 

Актуальность проблемы Изучение молекулярно-генетической природы наследственных и наследственно предрасположенных заболеваний является основой для познания их патогенеза, разработки высокоточных методов ДНК-диагностики,  методов профилактики и лечения. В структуре моногенных заболеваний (МЗ) значительную часть составляют наследственные болезни нервной системы (НБНС),  более для 300 из которых полностью расшифрованы молекулярные дефекты или установлена хромосомная локализация мутантных генов. Большинство НБНС носит тяжелый прогрессирующий характер, часто приводит к ранней инвалидизации, а иногда и смерти больного, но эффективное лечение в настоящее время возможно лишь для некоторых из этих заболеваний.  Поэтому разработка наиболее эффективных методов медико-генетического консультирования (МГК), включающих ДНК-диагностику, в том числе пренатальную и пресимптоматическую, направленная на профилактику МЗ, имеет большое социально-экономическое значение.

Многие НБНС являются клинически и генетически гетерогенными, что значительно затрудняет их дифференциальную диагностику и, соответственно, медико-генетическое консультирование. Для большинства МЗ существуют популяционные различия, как по распространенности, так и по спектру и частоте мутаций в генах, детерминирующих их развитие.  Поэтому для обеспечения наиболее эффективного МГК необходимо изучение распространенности и молекулярно-генетических основ наследственных заболеваний (НЗ) в отдельных регионах и этнических группах. Причины распространения в регионе  тех или иных НЗ могут быть связаны как со структурными особенностями  ответственных генов, так и с генетической структурой популяций,  формирование которых происходит под воздействием различных факторов микроэволюции, среди которых в настоящее время наиболее значимыми могут являться дрейф генов и миграции. Изучение процессов изоляции и миграции возможно на основе анализа брачно-миграционной структуры популяций [Гинтер Е.К., Зинченко Р.А., 2006].

Актуальность популяционно-генетического исследования моногенной патологии, в частности, НБНС, в Республике Башкортостан (РБ) определялась  значительным своеобразием генофонда ее населения, формирование которого имеет длительную и сложную историю. Территория Южного Урала, где располагается РБ, как и всего Волго-Уральского региона,  находясь на границе двух частей света -  Европы и Азии, - с древнейших времен была ареной постоянных генетических контактов между сибирскими, индоевропейскими, среднеазиатскими и другими этническими образованиями. Сегодня  РБ имеет  многонациональный состав населения с общей  с численностью 4104336 человек. Коренное население республики – башкиры, численность которых, по данным переписи 2002г., составляет 1.2 млн. человек (29.8%); наиболее многочисленными представителями других национальностей являются русские (36.3%) и татары (24.1 %). На основании полученных нами ранее данных по изучению полиморфизма ядерной и митохондриальной ДНК в популяциях Волго-Уральского региона, в том числе в четырех этногеографических группах башкир, было установлено своеобразие генетической структуры народов этого региона,  определен вклад европеоидного и монголоидного компонентов в  их генофонд  и показана  их генетическая подразделенность [Хуснутдинова Э.К., Хидиятова И.М., Викторова Т.В. и др., 1991, 1993, 1994, 1998, 1999]. Эти и многие другие исследования по изучению разнообразия генома человека в популяциях, проведенные в рамках международных и национальных программ «Геном человека» в 90-х годах ХХ столетия, послужили основой для разработки нового направления в молекулярной генетике человека – этногеномики, - и определили основные перспективы его развития, среди которых важнейшее место занимает исследование молекулярной структуры наследственной патологии в различных популяциях. 

Частыми наследственными заболеваниями условно принято считать такие, распространенность которых составляет > 1: 50000 населения [Гинтер Е.К., Зинченко Р.А., 2006]. К ним относятся такие НБНС, как миотоническая дистрофия, хорея Гентингтона, миодистрофия Дюшенна/Беккера, моторно-сенсорные нейропатии, неравномерная распространенность которых в РБ была показана еще в 80-х годах проф. Магжановым Р.В. и сотрудниками кафедры неврологии БГМУ. С развитием  методов молекулярной генетики появилась возможность  изучения молекулярных основ этих заболеваний, выявления популяционного разнообразия их генетических форм и генетических механизмов распространения в популяциях.

Особый интерес для современной медицинской генетики представляют популяционные и молекулярно-генетические исследования  болезни Паркинсона (БП) - одного из наиболее частых заболеваний нервной системы,  чаще всего имеющего многофакторную природу со значительным вкладом генетического компонента. Актуальность этих исследований определяется нерешенностью проблемы генетической основы патогенеза БП,  существованием многочисленных моногенных форм заболевания, отсутствием информации о распространенности семейных и спорадических форм заболеваний в различных регионах и этнических группах.

В целом,  выявление этно-территориальных особенностей распространенности и  генетической природы наследственных и наследственно предрасположенных заболеваний является основой для создания эффективной системы их мониторинга и разработки методов диагностики и профилактики, оптимальных для конкретного региона.

  Цель и задачи исследования

Целью работы является изучение молекулярно-генетических основ, популяционно-демографических и генетических механизмов распространения  ряда частых наследственных заболеваний нервной системы в Республике Башкортостан и разработка оптимальных для региона подходов их ДНК-диагностики.

Для достижения поставленной цели были сформулированы следующие задачи:

  1. Провести анализ брачно-миграционной структуры в шести районах РБ и охарактеризовать основные демографические факторы формирования генетической структуры населения республики.
  2. Изучить распространенность и популяционно-генетические факторы распространения в РБ частых НБНС – миотонической дистрофии, хореи Гентингтона, моторно-сенсорных нейропатий,  семейных и спорадических форм болезни Паркинсона.
  3. В генах  DMPK  и HD (IT-15), ответственных за развитие  болезней «экспансии» - миотонической дистрофии Россолимо-Куршмана-Штейнерта-Баттена и хореи Гентингтона, соответственно, - исследовать полиморфизм числа тринуклеотидных повторов (ТНП) и ряда вариабельных внутригенных локусов у больных из РБ и в популяциях Волго-Уральского региона; определить  закономерности  экспансии ТНП, ее происхождение и механизмы распространения.
  4. Определить характерные для РБ спектры и частоты мутаций в генах НБНС: при мышечной дистрофии Дюшенна/Беккера – в гене дистрофина (DMD), при моторно-сенсорных нейропатиях – в генах периферического белка миелина (PMP22), структурного белка миелина (MPZ), коннексина 32 (GJB1),  EGR2 (early growth response gene-2); провести анализ полиморфизма ряда вариабельных локусов  исследованных генов.
  5. Провести поиск мутаций в генах -синуклеина (PARK1), паркина (PARK2)  и  дардарина (LRRK2) у больных с наследственными и спорадическими формами  болезни Паркинсона.
  6. Провести поиск маркеров генетической предрасположенности к спорадической форме болезни Паркинсона на основе анализа ассоциации заболевания с полиморфными вариантами генов ядерного генома  и исследования структурных особенностей  митохондриальной ДНК.
  7. Разработать оптимальные для РБ подходы  ДНК- диагностики исследованных неврологических заболеваний.

  Научная новизна и практическая значимость исследования

Впервые проведено комплексное популяционно-молекулярно-генетическое исследование ряда частых наследственных заболеваний нервной  системы  (миотонической  дистрофии, хореи Гентингтона, мышечной дистрофии Дюшенна/Беккера, наследственных моторно-сенсорных нейропатий) и многофакторного, наследственно предрасположенного заболевания - болезни Паркинсона в РБ, население которой характеризуется  этнической подразделенностью. Использование такого подхода позволило получить наиболее адекватные оценки распространенности заболеваний, выявить популяционно-демографические факторы формирования генетической структуры популяций, влияющие на распространение наследственной патологии, и провести углубленный анализ молекулярно-генетических основ исследуемых заболеваний.

Впервые проведенный анализ брачно-миграционной структуры населения шести районов РБ выявил преобладание  в них моноэтнических браков, положительную этническую брачную ассортативность башкир и татар, и высокий уровень эндогамности,  что способствует территориальной и этнической неравномерности распространения наследственной патологии.

Молекулярно-генетическое исследование болезней динамических мутаций – миотонической дистрофии и хореи Гентингтона, - позволило идентифицировать экспансию тринуклеотидных повторов в соответствующих генах практически у всех обследованных пациентов и во многих случаях выявить ее у родственников больных, не имеющих на момент обследования клинических признаков заболеваний. Впервые у больных из РБ определены гаплотипы, сцепленные с мутациями – экспансией тринуклеотидных повторов, -  в генах DMPK  и HD, что позволило установить единое происхождение миотонической дистрофии на территории РБ, ее распространение в результате эффекта основателя и дрейфа генов, и, как минимум, три источника происхождения хореи Гентингтона.  Выявлены генетические  факторы нестабильности тринуклеотидных повторов:  в гене DMPK нестабильными являются аллели с числом CTG повторов >19; в гене HD установлена  роль числа (CCG)n повторов  как цис-активного фактора, модифицирующего стабильность (CAG)n повторов. Впервые определены генетические и эпигенетические факторы, модифицирующие возраст манифестации хореи Гентингтона.

У больных миодистрофией Дюшенна/Беккера из РБ впервые определены спектр и частота делеций в гене дистрофина, выявлены две новые мутации - p.Thr134ThrfsX7 и p.Lys2210ArgfsX11.

Впервые для РБ установлены региональные и этнические  особенности распространенности наследственных моторно-сенсорных нейропатий, спектра и частоты мутаций в генах периферического белка миелина (PMP22), структурного белка миелина (MPZ), коннексина 32 (GJB1) и  EGR2 (early growth response gene-2). Определен вклад типов  НМСН 1А и НМСН 1Х в структуру НМСН в исследуемом регионе. Установлена высокая частота НМСН 1Х типа среди башкир, обусловленная мутацией p.Pro87Ala, распространившейся в популяции в результате эффекта основателя. В гене GJB1  выявлена ранее не описанная мутация p.Thr86Ile.

Впервые получены данные по распространенности болезни Паркинсона в РБ, показана этническая и территориальная неравномерность распространения заболевания. Проведено изучение генетических факторов риска развития БП с учетом этнической принадлежности. Впервые в качестве гена-кандидата исследован Alu-инсерционный полиморфизм гена калиевого канала KCNJ6 и обнаружена ассоциация Alu-инсерции с БП во всех исследованных этнических группах. Выявлена ассоциация с БП полиморфного варианта гена катехол-орто-метилтрансферазы, детерминирующего активную форму фермента. Впервые проведено углубленное исследование роли мтДНК в развитии БП, в результате которого  обнаружена ассоциация гаплогруппы Н мтДНК с БП у татар, выявлен гаплотип, протективный для развития заболевания. Впервые проведено полное секвенирование мтДНК у 4-х пациентов с БП, у двух из них обнаружены две точковые мутации, которые, предположительно, могут являться факторами развития заболевания у этих больных.

На основе полученных результатов разработаны оптимальные для населения РБ подходы ДНК-диагностики исследованных заболеваний. Выявление этиологической основы заболевания у больных, а также носителей мутантного гена способствует проведению ранних лечебно-профилактических мероприятий, позволяющих отсрочить клиническую манифестацию заболевания или замедлить темпы его прогрессирования. Кроме того, оно является необходимым условием для проведения пренатальной диагностики с целью профилактики повторных случаев заболевания в семьях. Полученные данные легли в основу созданных в РБ национальных автоматизированных регистров по всем исследованным заболеваниям, обеспечивающих  их эпидемиологический мониторинг и оптимизацию лечебно-диагностической и диспансерной работы врачей (неврологов, генетиков).

  Положения, выносимые на защиту

  1. Этническая подразделенность населения, преобладание моноэтнических браков и высокий уровень эндогамности в районах РБ способствуют сохранению имеющегося генетического разнообразия, территориальной  и этнической неравномерности  распространения наследственной патологии.
  2. Распространение миотонической  дистрофии  Россолимо-Куршмана-Штейнерта-Баттена в РБ связано с эффектом основателя и дрейфом генов. Локальное накопление заболевания среди башкир в отдельных районах Зауралья обусловлено доминантным типом его наследования, моноэтнической структурой населения  и высоким уровнем эндогамности этих районов. В локусе (CTG)n гена DMPK нестабильными являются аллели с числом тринуклеотидных повторов >19.
  3. Распространенность хореи Гентингтона  в Башкортостане сопоставима с таковой в европейских популяциях. Распространение ХГ на территории республики связано, как минимум, с тремя источниками происхождения  заболевания, о чем свидетельствуют три различных гаплотипа в гене  HD на мутантных хромосомах у больных из РБ.  (CCG)n –тракт, сцепленный с (CAG)n  повторами в гене HD, является цис - активным фактором, модифицирующим стабильность (CAG)n  -повторов.  Генетические и эпигенетические факторы, влияющие на возраст манифестации ХГ.
  1. Высокий уровень гетерозиготности локусов (CTG)n гена DMPK и (CAG)n  гена HD, неоднородный характер распределения частот их аллелей в популяциях Волго-Уральского региона, в том числе на уровне этногеографических групп одного этноса, свидетельствуют о возможности использования данных высокополиморфных  ДНК - локусов в качестве генетических маркеров популяций.
  2. Спектр и частота делеций и делеционных точек разрыва в гене дистрофина (DMD), две новые точковые мутации у больных мышечной дистрофией Дюшенна/Беккера из РБ. 
  3. Неравномерное территориально-этническое распространение наследственных моторно-сенсорных нейропатий (НМСН)  в РБ.  Региональные и этнические особенности спектра и частоты мутаций в генах периферического белка миелина (PMP22),  структурного белка миелина (MPZ), коннексина 32 (GJB1) и  EGR2 (early growth response gene-2). Вклад типов  НМСН 1А и НМСН 1Х в структуру НМСН в РБ. Среди башкир наиболее частой формой НМСН 1 типа является НМСН 1Х, обусловленная мутацией p.Pro87Ala, распространившейся в популяции в результате эффекта основателя. Новая мутация p.Thr86Ile в гене GJB1.
  4. Неравномерное территориально-этническое распределение болезни Паркинсона в РБ с эпидемиологическими характеристиками, сопоставимыми с современными показателями в мире. Ассоциация спорадической формы БП с мутациями  в генах паркина (PARK2) и дардарина (LRRK2, PARK8), а также с  полиморфными вариантами ряда генов-кандидатов ядерного и митохондриального геномов. Генетические факторы риска развития и характера течения спорадической БП в этнически подразделенных группах населения РБ.
  5. Разработка оптимальных для региона подходов ДНК-диагностики исследованных заболеваний.

  Апробация работы

Материалы исследования докладывались и обсуждались на Российских и международных совещаниях, конференциях и симпозиумах, таких как  II (IV)  и V съезд  Российского общества медицинских генетиков (Курск, 2000; Уфа, 2005); II и III съезд Российского общества генетиков и селекционенров им. Вавилова (Санкт-Петербург, 2000; Москва, 2004); 19-е Международное совещание по болезни Гентингтона (Копенгаген, 2001);  5-й и 7-й Балканский конгресс по генетике человека (София, 2002; Скопье, 2006); конференции Европейского общества генетиков человека (Лиссабон, 1998; Женева, 1999; Амстердам, 2000; Страсбург, 2002; Мюнхен, 2004; Прага, 2005; Амстердам, 2006; Ницца, 2007; Барселона, 2008); Международный конгресс по геному человека (Эдинбург, 2001; Берлин, 2004; Монреаль, 2007); IХ Всероссийском съезде неврологов (Ярославль, 2006); Международной научно-практической конференции «Актуальные проблемы диагностики и лечения наследственных нервно-мышечных заболеваний. Нейроортопедические аспекты» (Москва, 2008).

Публикации

По теме диссертации опубликовано 39 статей в рецензируемых научных журналах, получен  1 патент на изобретение.

Объем и структура диссертации

Работа изложена на 340 стр. машинописного текста, состоит из введения, обзора литературы, материалов и методов, результатов и обсуждения, выводов, заключения, списка литературы, приложения. Диссертация иллюстрирована 63 таблицами и 35 рисунками, список литературы состоит из 508 источников (92 отечественных и 416 зарубежных).

Благодарности Автор выражает глубокую благодарность заведующему кафедрой неврологии с курсами нейрохирургии и медицинской генетики Башкирского государственного медицинского университета д.м.н., профессору Магжанову Р.В. за консультативную помощь и организацию забора материала.

МАТЕРИАЛЫ И МЕТОДЫ

В работе использованы как материалы комплексного сплошного медико- и популяционно-генетического исследования населениия семи районов РБ, проведенного в период с 2005 по 2008 гг. совместно с Медико-генетическим научным центром РАМН (г. Москва), так и сведения о всех известных больных с исследуемыми патологиями, проживающими на территории РБ, полученные из базы данных Медико-генетической консультации РБ и из материалов ежегодных отчетов  неврологов всех городов и районов республики, собираемых на кафедре неврологии  с курсами нейрохирургии и медицинской генетики Башкирского государственного медицинского университета (БГМУ). Полученные таким образом сведения дополнительно уточнялись на момент исследования как путем целенаправленного запроса в центральные городские и районные больницы,  так и в процессе  экспедиционных выездов 1994-2004гг, проводимых нами совместно с сотрудниками кафедры неврологии БГМУ с целью дополнительного клинического осмотра больных и членов их семей, и забора крови для ДНК-анализа. Для клинико-эпидемиологического исследования были собраны данные о каждом пациенте, проживавшем на территории РБ за исследуемый период времени с 1 января 1994 по 1 января 2006 года.

Для сплошного популяционно-генетического исследования были выбраны 7 районов РБ: Абзелиловский, Баймакский, Бурзянский, - расположенные в юго-восточном Зауралье, - где почти 90% населения составляют башкиры; Архангельский, Салаватский,  Аскинский и  Балтаческий – это центральный, северо- восточный и северные районы, население которых полиэтнично. Исследование охватывало все население районов (201619 человек) независимо от национальности.

Исследование брачно-миграционной структуры населения, основанное на анализе брачных записей, проведено  в шести районах Республики Башкортостан (Абзелиловском, Бурзянском, Баймакском, Салаватском, Архангельском и Балтачевском) с общей численностью населения 177691 человек. Брачные записи изучены  за 4 временных периода: 1) начало 60-х годов ХХ века, 2) начало 80-х годов ХХ века, 3) конец 90-х годов ХХ века, 4) начало XXI века. Всего проанализировано 16135 брачных записей.

Сведения о  численности больных, обследованных молекулярно-генетическими методами, приведены в таблице 1.

Выборка здоровых доноров представлена коренными жителями Волго-Уральского- региона: башкирами Архангельского (50 чел), Абзелиловского (166 чел.), Баймакского (100 чел.), Бурзянского (100 чел.), Салаватского (100 чел.), Аскинского (100 чел.),  Илишевского (59 чел.) и Стерлибашевского (48 чел.) районов РБ, относящихся к разным исторически сложившимся этногеографическим группам: северо-восточной, юго-восточной, северо-западной и юго-западной; коми-зырянами Сысольского района Коми (70 чел.); татарами Елабужского района Татарстана (46 чел.); удмуртами Мало-Пургинского района Удмуртии (64 чел.); мордвой-мокшей Старошайгинского района Мордовии (45 чел); чувашами Моргаушского района Чувашии (56 чел.); луговыми мари Звениговского района Марий Эл (47 чел.) и русскими из различных районов РБ (31 чел.).

Забор крови производили после медицинского осмотра и получения информированного согласия у взрослых жителей, принадлежащих к разным семьям, что позволяет рассматривать выборки случайными для популяций.

Таблица 1. Численность больных (абс.) с наследственными и наследственно предрасположенными заболеваниями из Башкортостана, обследованных молекулярно-генетическими методами

Заболевание

Число больных/число неродств. семей

Число клинически здоровых родственников

Контроль

Миотоническая дистрофия

92/50

(72/36)*

84

(54)*

-

Хорея Гентингтона

59/46

127

91

Миодистофия

Дюшенна/Беккера

64/61

87

-

Наследственные моторно-сенсорные нейропатии

173/131

120

150

Болезнь Паркинсона:

Спорадическая форма

Семейная форма

341

8

-

10

360

Примечание:*-  идентификация экспансии (CTG)n – повторов в гене DMPK  проведена методом блот-гибридизации по Саузерну.

Для анализа частоты мутирования локуса CTG повторов в гене DMPK исследована передача аллелей данного локуса от родителей к детям в 300 семьях здоровых доноров (900 чел.) из Башкортостана различной этнической принадлежности.

Для оценки параметров, отражающих отдельные факторы популяционной динамики -  этнической брачной ассортативности,  индекса эндогамии, локального  инбридинга, - использованы стандартные методы популяционно-генетического анализа [Crow J.F., 1958; 1965; Cavalli-Sforza L.L., Bodmer W.F., 1971; Morton N.E., 1977].

Молекулярно-генетические исследования проведены с использованием стандартных методов: выделения ДНК; полимеразной цепной реакции синтеза ДНК (ПЦР); полиморфизма длины амплифицированных фрагментов (ПДАФ), полиморфизма длины рестрикционных фрагментов (ПДРФ),  блот-гибридизации по Саузерну;  конформационного полиморфизма однонитевой ДНК (SSCP)  и секвенирования .

Определение размера экспансии (CTG)n повторов в гене DMPK у больных миотонической дистрофией методом геномной блот-гибридизации с олигонуклеотидным зондом (CTG)9, а также  идентификация делеций экзонов в гене PARK2 методом анализа дозы гена у пациентов с болезнью Паркинсона было проведено на базе Института молекулярной генетики РАН (г.Москва) (зав. Отделом – д.б.н., проф. С.А. Лимборская).

Статистический анализ полученных данных проведен с использованием стандартных для популяционно-генетических и медицинских исследований методов  и соответствующего  программного обеспечения (Statistica 5.5,  SPSS 9.0,  GenePop 3.3, Fstat 2.9.3.1, Cervus 2.0,  Genetic Data Analysis 1.0).

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

ИССЛЕДОВАНИЕ ФАКТОРОВ ПОПУЛЯЦИОННОЙ ДИНАМИКИ, ВЛИЯЮЩИХ НА РАСПРОСТРАНЕННОСТЬ НАСЛЕДСТВЕННЫХ ЗАБОЛЕВАНИЙ В РЕСПУБЛИКЕ БАШКОРТОСТАН

Анализ этнической  брачной ассортативности  и ее временной динамики

Под этнической брачной ассортативностью понимают предпочтение заключения брака внутри своей национальности. Этническая ассортативность  обусловливает изолированность популяций по национальному признаку, влияя таким образом на формирование  их генетической структуры. Установлено, что этническая ассортативность в исследованных районах РБ  меняется в зависимости от представительства определенного этноса в районе (табл.2). Так, в Бурзянском районе, 95.3% населения которого составляют башкиры, их этническая ассортативность составляет 1.02, что характерно для моноэтнической популяции, а в Балтачевском районе, где численность башкир значительно  ниже,

Таблица 2. Этническая ассортативность (Н) в 6 районах Башкортостана (начало XXI века)

Район РБ

башкиры

русские

татары

Абзелиловский

1.11

5.81

-

Бурзянский

1.02

-

-

Баймакский

1.09

7.50

4.4

Балтачевский

2.71

-

1.30

Архангельский

1.93

2.14

5.99

Салаватский

1.15

5.09

2.47

ассортативность возрастает до 2.71. В том же Балтачевском районе этническая ассортативность татар составляет 1.30, а в других районах, где татар меньше, их этническая ассортативность выше. Для русских характерна та же тенденция – наиболее низкая этническая ассортативность русских в Архангельском районе (2.14), где их более 38%, наиболее высокая – в Баймакском (7.50), где они составляют 8.4% населения района.

Временная динамика этнической ассортативности (рис.1) рассчитывалась не для районов, а в совокупности для всей выборки, а процентное соотношение русских и татар – в целом для РБ. На протяжении последнего полувека этническая ассортативность башкир возрастает (от 8.97 в 60-е годы до 13.6 в 90-е годы XX в.), резко падая в начале XXI века (7.23). Этническая ассортативность русских является отрицательной на рубеже веков (0.50),  практически  не  меняясь за  четверть века. При этом,  для

Рисунок 1. Временная динамика этнической ассортативности

межэтнических русско-татарских и русско-башкирских браков выявлено резкое превышение ожидаемого  их числа над наблюдаемым, так что отрицательная ассортативность русских обеспечивается за счет браков с украинцами, белорусами, латышами, марийцами, чувашами, удмуртами и др., а не с башкирами и татарами, традиционно населяющими Башкортостан. Брачная  этническая ассортативность татар невысока, но положительна (1.67 на начало XXI века). Число башкиро-татарских браков превышает в общем числе зарегистрированных браков 10%-уровень; в течение второй половины ХХ века наблюдается устойчивый рост метисации башкир и русских  - от 0.85% до 4.15%. Основная доля браков (~80%) в исследованных районах РБ является моноэтнической. Исследования брачной этнической ассортативности были проведены ранее и в некоторых других республиках Волго-Уральского региона (Чувашия, Удмуртия), в которых так же прослеживается тенденция роста метисации коренного населения с русскими [Ельчинова Г.И. с соавт., 2003, 2006].

Анализ эндогамии и изоляции расстоянием

Индекс эндогамии, рассчитанный для трех этнических групп, оказался достаточно высоким  во всех исследованных районах: на начало XXI века для башкир – 0.58-  в Салаватском,  0.60 – в Архангельском, 0.71 –  в Баймакском, 0.86 –  в Бурзянском, 0.79 –  в Абзелиловском, 0.97 –  в Балтачевском районах. Для татар индекс эндогамии оказалось возможным рассчитать только по Балтачевскому району, где он составил 0,9, а для русских – по Архангельскому району – 0.68 на начало XXI века.  Устойчивое снижение индекса эндогамии зафиксировано только в Баймакском (0,80,  0.76,  0.71) и в Салаватском  (0.77,  0.72, 0.63,  0.58) районах. Согласно нашим исследованиям, брачные миграции башкир практически не выходят за пределы Республики. Исключение составляют части Челябинской и Оренбургской областей, примыкающие к Башкортостану, где традиционно проживают башкиры. Таким образом, Республика Башкортостан является популяцией высшего иерархического уровня для своего автохтонного населения. Аналогичная картина эндогамности характерна и для других республик Волго-Уральского региона, где проводились подобные исследования – Марий Эл [Гинтер Е.К., 2002], Чувашии [Гинтер Е.К., Зинченко Р.А.; 2006] и Удмуртии [Ельчинова Г.И. с соавт., 2006]. Подобная структура эндогамности, обусловленная реальной миграционной ситуацией, может приводить к территориальной неоднородности распространения наследственной патологии (НП).

Инбридинг

Параметры изоляции расстоянием, рассчитанные для шести исследуемых районов РБ,  отражены в таблице 3. В качестве обследуемой единицы выступает район. Из таблицы видно, что в трех районах  Зауралья основные параметры изоляции с течением времени меняются незначительно. Наименьшие изменения локального инбридинга а в Баймакском районе (от 0.00015 до 0.00012), чуть сильнее а падает в Абзелиловском (от 0.00025 до 0.00017) и Бурзянском (от 0.00049 до 0.00041) районах. Локальный инбридинг а невысок во всех этих трех районах (0.0001-0.0004), что, видимо,  в значительной степени обусловлено брачными традициями населения. В Бурзянском районе а (0.0004) несколько выше, чем в двух других, что обусловлено наименьшим эффективным размером популяции (5.5 тыс. чел), при этом в Бурзянском районе оказывается наиболее низкой степень изоляции расстоянием (0.009). В Балтачевском районе существенные изменения зафиксированы у показателя Ne. По-видимому, деление на татар и башкир в этом районе достаточно условно, уровень метисации составляет 21-26% за указанные периоды, поэтому мы рассчитали  параметры изоляции для совокупной выборки башкир и татар, и даже в этом случае изменение параметров изоляции расстоянием во времени оказывается более существенным, чем в зауральских районах. В Салаватском районе обнаружено незначительное снижение локального инбридинга во времени для башкир (с 0.0004 до 0.0003), а его увеличение вдвое для татар мы относим к разряду артефактов, обусловленных малым числом браков (n=62), зарегистрированных между татарами в начале XXI века и вошедшими в анализ. В Архангельском районе, так же, как и в Салаватском, установлено

Таблица 3. Параметры изоляции расстоянием Малеко (Ne –эффективный объем популяции; – средняя квадратичная миграция; а- локальный инбридинг, b – степень изоляции расстоянием)

Район

Временной интервал

Ne

a

b

Баймакский

(башкиры)

80-е годы ХХ века

14189

67.7

0.000151

0.011444

90-е годы ХХ века

15528

63.7

0.000152

0.010819

начало XXI века

16937

75.2

0.000118

0.010804

Абзелиловский

(башкиры)

80-е годы ХХ века

10979

55.4

0.000253

0.012789

1995-2004 гг

12687

62.8

0.000170

0.012048

Бурзянский

(башкиры)

80-е годы ХХ века

4508

73.3

0.000489

0.008947

1995-2004 гг

5509

65.8

0.000405

0.009207

Балтачевский

(башкиры)

80-е годы ХХ века

7931

31.4

0.001051

0.014886

90-е годы ХХ века

1833

16.4

0.002274

0.031522

начало XXI века

5766

6.7

0.000737

0.046674

Балтачевский

(татары)

80-е годы ХХ века

647

54.6

0.004056

0.021492

90-е годы ХХ века

4909

28.1

0.000824

0.025236

начало XXI века

1212

40.3

0.002909

0.020785

Балтачевский

(башкиры

и татары)

80-е годы ХХ века

8458

59.5

0.000335

0.017989

90-е годы ХХ века

6743

27.0

0.000570

0.025274

начало XXI века

6978

35.2

0.000446

0.026095

Архангельский

(русские)

80-е годы ХХ века

3595

82.0

0.000701

0.006416

90-е годы ХХ века

2751

77.2

0.001258

0.006003

начало XXI века

2570

69.9

0.000956

0.012862

Архангельский

(башкиры)

80-е годы ХХ века

3174

65.7

0.000838

0.007843

90-е годы ХХ века

2836

42.9

0.000831

0.014307

начало XXI века

3092

77.2

0.000694

0.008729

Салаватский

(башкиры)

80-е годы ХХ века

5181

73.9

0.000439

0.011388

90-е годы ХХ века

5178

91.9

0.000369

0.009490

начало XXI века

6364

83.0

0.000293

0.011011

Салаватский

(татары)

80-е годы ХХ века

2820

85.9

0.000925

0.009257

90-е годы ХХ века

2545

144.1

0.000872

0.004916

начало XXI века

2102

106.1

0.001700

0.003849

Примечание: учтены брачные миграции до 500 км

незначительное снижение локального инбридинга для башкир (с 0.0004 до 0.0003) и незначительное увеличение этого показателя для русских (с 0.0007

до 0.0009). Значения локального инбридинга сходны с таковыми для чувашей

в Республике Чувашия (0.0002-0.0005) [Гинтер Е.К., Зинченко Р.А.; 2006], Для марийцев в Республике Марий Эл (0.0002-0.0006) [Гинтер Е.К., 2002], для удмуртов Республики Удмуртия (0.0003-0.0006) [Ельчинова Г.И. с соавт., 2006] и для русских Костромской области (0.0001-0.0002 при учете миграций до 500 км) [Ельчинова Г.И., 2004]. Видимо, такой порядок локального инбридинга характерен для российского сельского населения, а небольшие различия обусловлены различиями эффективного размера популяции.

Средняя квадратичная миграция в исследованных районах варьирует достаточно сильно – от 6.7км для башкир Балтачевского района до 106  км  для татар Салаватского района. Малые миграционные расстояния для башкир в Балтачевском районе согласуются с наибольшим индексом эндогамии для башкир в этом районе (0.97), но, учитывая высокую степень метисации здесь башкир и татар,  более адекватным для данного района следует считать показатель дальности миграций, рассчитанный для совокупной выборки башкир и татар, равный 35.2 км. Во всех других исследованных районах средняя квадратичная миграция для башкир  различается незначительно – от 62.8 км в Абзелиловском районе до 83.0 в Салаватском.

Степень изоляции расстоянием b для башкир во всех исследуемых районах, кроме Балтачевского, различается очень незначительно (0.009-0.012). В Балтачевском районе как для башкир, так и для совокупной выборки башкир и татар, этот показатель имеет более высокие значения – 0,047 и 0,026, соответственно. Степень изоляции расстоянием b в других популяциях Волго-Уральского региона имеет схожие значения [Гинтер Е.К., 2002; Гинтер Е.К., Зинченко Р.А.; 2006; Ельчинова Г.И. с соавт., 2006].

Таким образом, для исследованных популяций башкир характерны высокий уровень эндогамности при невысоком локальном инбридинге, существенного изменения основных параметров брачно-миграционной структуры за четверть века не зафиксировано. Наибольшее сходство по эндогамности и локальному инбридингу наблюдается для зауральских башкир. Моноэтнический характер браков и высокий уровень эндогамности населения отдельных районов РБ являются популяционно-демографическими факторами генетической изоляции и могут приводить к территориальной неоднородности распространения наследственной патологии. 

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ ИССЛЕДОВАНИЯ

Миотоническая дистрофия

Миотоническая дистрофия (МД) - аутосомно-доминантное мультисистемное заболевание, характеризующееся исключительной вариабельностью клинических проявлений, среди которых - миотония, прогрессирующая мышечная слабость, поражения сердца, катаракта, эндокринные нарушения. Частота МД  варьирует в разных популяциях и составляет 2.2 – 5.5 : 100000 населения в Западной Европе [Harper P., 1989], 5.5:100000 – в Японии [Davies J. et al., 1992], реже заболевание  встречается в странах Южной Азии и практически отсутствует в Южной и Центральной Африке [Ascizawa T., Epstein H., 1991]. В Башкортостане частота МД крайне неоднородна среди отдельных этнических групп: для русских она составляет 1.94: 100000, для татар – 3.21: 100000, для башкир – 5.21: 100000,  в среднем -  3.01: 100000 населения [Ахмадеева Л.Р., 2001]. Более трети семей с МД происходят из предгорной и горной зон Южного Урала [Магжанов Р.В., 1989]. По нашим данным, в Баймакском и Абзелиловском  районах РБ распространенность ее составляет, соответственно, 40 и 30 на 1000000 населения.

Молекулярной причиной подавляющего  большинства случаев МД  является увеличение числа (CTG)n-повтора в 3’-нетранслируемой области гена DM (DMPK), локализованного на хромосоме 19 (q13.2-13.3)  [Mahadevan M. et al., 1992, Shelbourne P. et al., 1992]. У здоровых людей число CTG-триплетов (n) в гене DM  варьирует от 5 до 30 - 35, тогда как у больных оно составляет от 50 - 100 до 1000 при классическом течении, с дебютом во взрослом возрасте, и может достигать нескольких тысяч при врожденных формах заболевания [Harris S. et al., 1996]. Ген DM кодирует белок миотонин-протеинкиназу (Mt-PK), имеющий серин-треонин-киназную ферментативную активность [Вrook J. et al., 1992; Dunne P. et al., 1994].

Нами была исследована экспансия (CTG)n- повторов у  72 больных МД  и 54 членов их семей, проживающих в РБ, методом блот-гибридизации по Саузерну. Экспансия обнаружена у 67 (93% ) больных. Минимальный размер аллеля с экспансией составил 400 п.н. (около 130 единиц повтора), максимальный - 5000 п.н. (около 1500-1600 триплетных единиц).  Большинство  (60) больных имели классическую взрослую форму МД, 8 – классическую юношескую, 3 – раннюю детскую, 1 – врожденную. Максимальное число (CTG)n-повторов - свыше 1000 копий,- обнаружено у 22 больных МД, в том числе у всех пациентов с ранней детской и врожденной формами заболевания.  В этой группе наблюдалось резкое уменьшение возраста дебюта заболевания (в среднем 14.8 года), некоторое утяжеление церебральных (р=0.081) и  достоверное усиление экстраневральных (р=0.0139) проявлений, парезов (р=0.0168),  по сравнению с группами больных, содержащих в мутантных хромосомах менее 1000 копий CTG-триплетов.  В целом, полученные данные  подтвердили известные факты о прямой зависимости  от  размера экспансии тяжести заболевания и об обратной зависимости  - возраста  его манифестации,  но корреляция генотипа и фенотипа при МД не являлась абсолютной, поскольку на развитие и течение заболевания, по-видимому, оказывают влияние и другие генетические и эпигенетические факторы.

Сравнительный анализ экспансии (CTG)n -повторов при передаче из поколения в поколение в 17 семьях выявил как случаи увеличения экспансии, (70.6%), так и ее сохранения на исходном уровне (11.8%) или снижения (17.6%). В 10 случаях больной являлась мать, а в 7 случаях - отец. Оказалось неожиданным, что все случаи уменьшения размера экспансии обнаружены при передаче мутации по материнской линии (в этом случае они составляют 30%), тогда как при передаче по линии отца только в одном случае зафиксировано сохранение числа повторов на исходном уровне. Проведенный простой и множественный регрессионный анализ влияния на величину экспансии пола родителя и размера передающегося аллеля, как в отдельности, так и в сумме этих факторов, отчетливых закономерностей не выявил (табл.4).

Таблица 4. Зависимость между величиной мутации и размером исходного (CTG)n аллеля у мужчин и женщин

Передача по линии

R

R2

p

материнской

0.439

0.193

0.205

отцовской

0.011

0.001

0.981

В целом

0.181

0.033

0.487

В результате сравнения числа (CTG)n повторов, возраста начала и формы заболевания в 15 парах сибсов, страдающих МД, не установлено зависимости уровня экспансии (CTG)n -повторов гена DMPK от порядкового номера потомка в семье.

Таким образом, полученные нами результаты анализа наследования экспансии (CTG)n -повторов гена DMPK в семьях больных не соответствуют аналогичным данным, полученным другими авторами. Возможно, это связано с недостаточно большим количеством наблюдений, поэтому, пока не делая обобщающих выводов,  мы предлагаем рассматривать данный факт только как отдельное наблюдение.

При изучении причин и механизмов экспансии (CTG)n-повтора в гене DMPK, закономерными становились вопросы о разнообразии и частоте нормальных аллелей данного генного локуса, о характере их нестабильности, а также о  происхождении и распространении миотонической дистрофии.  В связи с этим полиморфизм  (CTG)n- локуса в гене DMPK был исследован во многих популяциях мира, а также проведен анализ неравновесного сцепления МД с другими полиморфными внутригенными и фланкирующими ген DMPK локусами [Иващенко Т.Э. и др., 1997; Сломинский П.А., 2000; Davies J. et al., 1992; Goldman A.et al., 1995;  Deka R. et al., 1996;  Yamagata H. et al., 1998; Tishkoff S.et al., 1998; Pan H. et al., 2001; Segel R. et al., 2003]. По распределению частот аллелей локуса (СTG)n-повторов в гене DMPK  выявлена значительная популяционная неоднородность. Кроме того, было сделано предположение, что аллели с числом CTG-повтора 5 и >19 являются более нестабильными, предрасполагающими к DM-мутации, по сравнению с группой более стабильных аллелей с числом повторов 11-17. 

В популяциях Волго-Уральского региона нами обнаружено 28 аллелей, соответствующих повторам с 4—34 тринуклеотидами; отмечается два пика частот  (рис. 2). По распределению частот всех аллелей области (CTG)n- повторов в гене DMPK между некоторыми исследованными популяциями, в том числе между отдельными этногеографическими группами башкир выявлена достоверная неоднородность. Установлено, что в целом по распределению частот аллелей CTG- повтора в гене DMPK, Волго-Уральский регион занимает промежуточное положение между популяциями Европы и Азии, тяготея в большей степени в сторону последних.

С целью изучения закономерностей нестабильности  локуса (CTG)n- повторов мы провели ряд исследований. Так,  наши данные позволили проверить гипотезу  о нестабильности аллелей с числом CTG повторов >19 и взаимосвязи между частотой таких аллелей и распространенностью МД в популяциях на примере трех субпопуляций зауральских башкир – Абзелиловского, Баймакского и Бурзянского районов,  для каждой из которых методами популяционной демографии нами была показана значительная обособленность. В Абзелиловском и Баймакском районах РБ установлена наибольшая распространенность МД – (30 - 40 на 100000), тогда как в Бурзянском районе не выявлено ни  одного случая заболевания. Однако по распределению частот аллелей (CTG)n- локуса эти три группы башкир являются однородными, а аллели с высоким числом (>30) повторов обнаружены как в Абзелиловском, так и в Бурзянском районах. В популяциях Волго-Уральского региона частота аллелей (CTG)>19  варьировала от 6% среди удмуртов, чувашей и мордвы, до 15% среди татар. В популяциях башкир в целом она составила 9%, являясь наиболее низкой  среди абзелиловских, баймакских и бурзянских башкир (~6%). Таким образом, данное исследование не выявило  корреляции частоты нормальных аллелей с высоким числом CTG- повторов в гене DMPK с частотой  МД в популяции.

С целью дальнейшего изучения вопроса о причинах распространения МД в Башкортостане был проведен анализ сцепления мутации с определенными гаплотипами, установленными по двум полиморфным внутригенным локусам, сцепленным с геном DMPK (intron 5, nt pos 6043 -Hha1 и intron 9, nt pos10693 -  Hinf1 рестрикционные полиморфизмы). В 24 из 37 семей с МД  (64.8%) у больных на мутантной хромосоме выявлен одинаковый гаплотип: Hha1(-) - Hinf1(+), характерный для больных МД из большинства исследованных популяций мира. В этих 24  семьях гаплотип был установлен на основе  семейного анализа или гомозиготного состояния исследуемых локусов у отдельных больных. В оставшихся 13 семьях данный гаплотип не исключен, т.к. больные имели гетерозиготное состояние по обоим локусам, а данные для семейного анализа отсутствовали. Таким образом, мы предполагаем, что все больные МД из Башкортостана имеют одинаковый гаплотип на мутантной хромосоме, что указывает на распространение заболевания в регионе в результате эффекта основателя.

Рисунок 2. Распределение частот аллелей локуса (CTG)n гена DMPK в популяциях Волго-Уральского региона.

Далее,  также с целью исследования нестабильности (CTG)n - повторов гена DM мы провели анализ их наследования в 300 здоровых семьях, из трех человек каждая. Из них в трех семьях (1 % или 0.5% от числа переданных хромосом) было выявлено изменение числа CTG-повторов при передаче как от матери к ребенку (два случая), так и от отца к ребенку (один случай). В одном случае нестабильным оказался аллель CTG22, он перешел в CTG26; в другом случае аллель CTG19 изменился до CTG22, в третьем случае - аллель CTG32  изменился до CTG20. Во всех трех случаях кровное родство родителей и детей было подтверждено анализом ряда высокополиморфных ДНК-маркеров. Эти данные подтверждают гипотезу о нестабильности аллелей гена DM с числом CTG повторов > 19, а частота их мутаций составляет  5х10-3, что в значительной степени соответствует известным данным о скорости мутаций в микросателлитных районах, равной 2х10-3 [Горбунова В.Н., Баранов В.С., 1997].

Таким образом, наше исследование показало, что в гене DMPK «нормальные» аллели с числом CTG повторов >19, действительно, являются наиболее нестабильными,  подверженными к изменению числа триплетных повторов, причем, как в сторону увеличения, так и в сторону уменьшения. Вероятно, что именно такие аллели и являются определенным резервом в популяциях, на основе которого, скорее всего, могут возникнуть новые случаи экспансии (CTG)n повторов, а следовательно, и миотонической дистрофии.  Но при этом,  в реальности, корреляции между частотой «нормальных» аллелей с большим числом триплетов и распространенностью заболевания в популяциях не наблюдается. В РБ миотоническая дистрофия распространилась в результате эффекта основателя и дрейфа генов. Очевидно, что такой же путь распространения является причиной  накопления  заболевания и в других популяциях. В связи с этим,  с точки зрения практической медицины, остается актуальным мониторинг заболевания в конкретных регионах и своевременное генетическое консультирование семей, включающее проведение ДНК-диагностики, в том числе пренатальной, направленной на предотвращение рождения больных детей. В ходе данного исследования, проводившегося более 10 лет, была получена информация практически о всех семьях с МД, проживающих в Республике Башкортостан, большинству больных и членов их семей проведена ДНК-диагностика; на основе этих данных создан автоматизированный генетический регистр [Ахмадеева Л.Р., 1998], оптимизирующий диспансерную работу врачей.

Хорея Гентингтона

Хорея Гентингтона  (ХГ) - тяжелое прогрессирующее нейродегенеративное заболевание, наследуемое по аутосомно-доминантному типу.  Заболевание характеризуется распространенными гиперкинезами, прогрессирующим снижением интеллекта, вплоть до развития глубокой деменции, и нарушениями в эмоционально-волевой сфере [Hayden M., 1981]. ХГ имеет крайне неравномерное распространение  в различных регионах мира. Наибольшая частота ее отмечается в североевропейских популяциях (4-10 : 100000), наиболее низкая – в странах Азии и Африки (0,4 -1 : 100000) [Simpson S. et al., 1989; Pavoni M. et al., 1990; James C. et al., 1994; Adachi Y., Nakashima K. et al., 1999]. По нашим данным, в РБ этот показатель на сегодняшний день составляет 2,57 :100000 населения.

Молекулярной основой развития ХГ является  экспансия (CAG)n-повторов в первом экзоне гена HD (IT15), локализованного на коротком плече 4-й хромосомы в области  4p16.3 [Gusella J. et al., 1983; HDCRG, 1993]. Соответственно, кодируемый геном  белок гентингтин содержит длинный полиглютаминовый тракт. Нормальные аллели гена HD содержат от 9 до 35 CAG-повторов, а мутантные – от 36 до 180 [Kremer B.et al., 1994]. 

При консультировании семей с ХГ решающее значение имеет прямая ДНК-диагностика, основанная на определении числа (CAG)n- повторов  в гене IT15. При этом до сих пор актуальной остается проблема поиска и других генетических факторов, действующих в комплексе с основной мутацией и влияющих на развитие и течение заболевания.

В состав гена HD входит ряд полиморфных участков, сцепленных с (CAG)n-повторами. К таким участкам относятся (CCG)n-повторы, почти непосредственно прилежащие к (СAG)n-тракту в первом экзоне гена. В экзоне 58 на расстоянии ≈ 150 т.п.н. от полиморфного (СAG)n-участка в ряде случаев обнаруживается нейтральная делеция одного из четырех GAG-кодонов, кодирующих пролин, - del2642. Исследование распределения частот аллелей локуса, содержащего (CAG)n-повторы, и сцепленных с ним других полиморфных маркеров, в различных популяциях может способствовать выяснению условий возникновения, распространения и сохранения мутантных аллелей и, в целом, способствовать оценке риска развития патологии на популяционном уровне.

С целью определения закономерностей экспансии (СAG)n-повторов в гене HD и происхождения ее у больных хореей Гентингтона в РБ, мы проанализировали полиморфизм (СAG)n-, (CCG)n-повторов и делеции del2642 гена HD в 11 популяциях Волго-Уральского региона, а также  в  46 семьях с ХГ из Башкортостана, включающих 59 больных и 127 их близких родственников.

В популяциях Волго-Уральского  региона было выявлено 26 аллельных вариантов  СAG - локуса  с числом триплетов от 9 до 36 (рис.3). Распределение частот аллелей соответствует нормальному одномодальному, с пиком в (CAG)17, что согласуется с данными других исследователей [Rubinsztein D. et al.,  1994; Kremer B. et al., 1994; Watkins W. et al., 1995].

Рисунок 3. Распределение частот аллелей локуса (CAG)n повторов гена HD в популяциях Волго-Уральского региона. По оси абсцисс – число (CAG)n повторов, по оси ординат – частоты аллелей.

“Переходные” аллели,  содержащие более 29 триплетов CAG, составляющие резерв для развития из них мутации,  с частотой <1% обнаружены  в популяциях русских, чувашей, мордвы и удмуртов. Среди башкир, татар, марийцев и коми не найдены аллели (CAG)29-35. Проведенный нами анализ распространенности хореи Гентингтона в Башкортостане показал, что наименьший ее показатель  имеют башкиры - 0.89 на 100000 жителей, в то время как среди русских и татар степень распространенности достигает 4.02 и 5.14 на 100000 жителей, соответственно. Однако в популяции башкир Илишевского района у человека 65 лет без клинических проявлений хореи Гентингтона, и в семье которого не было случаев ХГ,  обнаружен аллель с 36 CAG-повторами, т.е. экспансия триплетного повтора, что встречается исключительно редко. Возраст проявления заболевания у таких пациентов приходится, как правило, на 6-7 декаду жизни. Следует отметить, что по данным Медико-генетического центра г. Уфы, за 26 лет не было ни одного случая хореи в Илишевском районе Башкортостана. Таким образом, обнаруженная нами экспансия повтора – это, фактически, новый случай хореи.

По характеру распределения частот аллелей локуса (CAG)n-повторов в гене HD наблюдается значительная популяционная неоднородность. По этим показателям популяции Волго-Уральского региона в большей степени сопоставимы с популяциями Европы.

В локусе  (CCG)n-повторов обнаружено 6 вариантов аллелей,  содержащих от 6 до 12 триплетов, за исключением аллеля (CCG)11. Во всех популяциях самыми частыми являются аллель (CCG)7, встречающийся в среднем с частотой 0.603, и (CCG)10– его частота составляет в среднем 0.333.

В результате регрессионного анализа сцепления полиморфных участков (CAG)n и (CCG)n, для популяций Волго-Уральского региона в целом установлена обратная нелинейная зависимость между числом повторов в этих участках на одной хромосоме. Аллели с семью CCG-повторами сцеплены с аллелями, содержащими в среднем 19.2 ± 3.8 CAG-повторов, а (CCG)10 - с аллелями, содержащими 17.3 ± 1.5 CAG-повторов (табл. 5).

Таблица 5. Среднее число (CAG)n повторов на хромосомах с различными вариантами аллелей (CCG)n и del2642 в популяциях Волго-Уральского региона

Аллели

(CCG)7

(CCG)10

del

del+

Число (CAG)n повторов

19.20±3.8

17.30±1.5

17.92±3.00

19.75±5.26

Число хромосом

1204

182

Достовер-ность различий

Сравне-ние средних1

U=109678.50, Z=7.05, p<<0.00001

U=661.00, Z= –2.04, p=0.0418

ANOVA

F=18.606, р<<0.001 2

H=4.42, р=0.0355 3

Примечания: 1непараметрический ранговый критерий Манна-Уитни, 2однофакторный дисперсионный анализ (ANOVA) для аллелей (CCG)6, (CCG)7, (CCG)8, (CCG)9, (CCG)10 и (CCG)12, 3ранговый непараметрический ANOVA Крускала-Уоллеса, так как в выборке не соблюдалась нормальность распределения согласно тесту Шапиро-Уилка.

При исследовании  нейтральной полиморфной делеции  del2642 гена HD в популяциях Волго-Уральского региона установлена ее достоверная ассоциация с аллелями (CAG)n локуса, содержащими  в среднем 19.75±5.26 CAG -повторов, а отсутствие делеции (del–) – с аллелями, содержащими 17.92±3.0 CAG –повторов (см. табл. 5). Эти данные подтверждают предположение о возникновении данной делеции преимущественно на хромосомах с числом CAG повторов ≥20 [Almqvist E. et al., 1995; Иллариошкин С.Н., 2002].

В результате прямой молекулярно-генетической диагностики у 57 из 59 больных хореей Гентингтона выявлена экспансия (CAG)n- повторов в 1 экзоне гена HD. Число (CAG)n-повторов на мутантных хромосомах у больных ХГ варьировало от 39 до 75, составляя в среднем 46.47±5.70.

С целью изучения характера генетической нестабильности (CAG)n повторов проведен анализ передачи их аллелей с экспансией в поколениях  в 17 семьях больных ХГ, показавший, что величина мутации зависит от величины исходного аллеля в большей степени при передаче по материнской линии и в меньшей степени – по отцовской.

Установлено сцепление экспансии (CAG)n – повторов с полиморфным вариантом (CСG)7 и нейтральной делецией del2642.  В результате определения гаплотипов (анализ по трем исследуемым локусам оказался возможным в  39 семьях больных ХГ) у  больных ХГ из Башкортостана выявлено три основных гаплотипа, сцепленных с мутацией: (CCG)7/del– (48.72% семей), (CCG)7/del+ (46.15%) и (CCG)10/del– (5.13%), что позволяет предполагать, как минимум, три различных источника  происхождения хореи Гентингтона в республике. Выявленное неравновесие по сцеплению экспансии (CAG)n повторов с (CCG)7, и ассоциация в популяциях Волго-Уральского региона  аллелей (CAG)n>20  с аллелем (CCG)7 свидетельствуют не только о различных источниках заболевания, но и о том, что (ССG)n тракт может играть роль цис-активного фактора, модифицирующего стабильность  (CAG)n повторов. Исходя из полученных данных, можно предположить, что новые случаи экспансии, возникающие из переходных аллелей, будут появляться на хромосомах, имеющих определенный гаплотип: (CCG)7/del- или (CCG)7/del+. Подтверждению этому может служить случайно обнаруженная мутация de novo - (CAG)36 в ходе популяционного анализа у индивида в возрасте 65 лет, не имевшего клинических признаков ХГ и с отрицательным семейным анамнезом по этому заболеванию. В данном случае экспансия была ассоциирована именно с гаплотипом (CCG)7/del-.

Проведен также анализ роли ряда генетических факторов на возраст появления первых признаков ХГ (табл.6). Установлено, что кроме величины экспансии CAG повторов (которая чем больше, тем раньше проявляется хорея), на возраст манифестации влияют также пол родителя – при передаче аллеля с экспансией от отца заболевание дебютирует, в среднем, на 4. 72 года раньше, чем при передаче от матери;  наличие  del2642 на хромосоме с экспансией (CAG)n, определяет более позднюю манифестацию ХГ. С возрастом появления первых клинических признаков заболевания ассоциированы и определенные генотипы локуса АроЕ: наличие генотипа 23 приводит к достоверному увеличению этого показателя. Вышеупомянутые факторы объясняют 88.71% возраста манифестации ХГ.

Таблица 6. Регрессионный анализ зависимости между возрастом манифестации ХГ и размером нормального аллеля, путем вертикальной передачи, наличием делеции del2642 и генотипом АроЕ с учетом размера экспансии (CAG)n повторов

Зависимые переменные (Х)

Сводка регрессии

N

R

R2

p(X)

B0

BX

B(CAG)exp 1

(CAG)n

О  2

31

0.8695

0.7560

0.8255

97.772

.1145

–1.339

М 3

17

0.8458

0.7154

0.7968

141.39

–.0785

–2.110

В целом

54

0.8228

0.6770

0.5140

110.888

0.1776

–1.599

Передача (CAG)exp

48

0.8700

0.7570

0.0086

125.402

–4.719

–1.479

del2642

46

0.8738

0.7635

0.0067

114.725

4.842

–1.661

ApoE

54

0.8335

0.6947

0.0542

110.009

1.521

–1.565

Примечание: 1р для (CAG)n во всех случаях <0.00001, 2передача аллеля с экспансией от отца, 3передача аллеля с экспансией от матери.

Комплексное определение этих факторов у носителей мутантного ХГ-аллеля, не имеющих  клинических проявлений заболевания, может способствовать повышению эффективности медико-генетического консультирования и ведения таких пациентов.

Прогрессирующая мышечная дистрофия Дюшенна-Беккера

Прогрессирующие мышечные дистрофии Дюшенна и Беккера– наиболее распространенные наследственные заболевания нервно-мышечной системы.  Их частота составляет, соответственно, 1:3500 и 1:20000 рожденных мальчиков [Emery A. 1991]. Миодистрофия Дюшенна (МДД)  - более тяжелая форма болезни, она начинается в возрасте 2-5 лет со  слабости мышц тазового пояса и проксимальных отделов ног, быстро прогрессирует, приводя к  обездвиженности. Большинство больных (около 90%) умирают до 20 лет от сопутствующих  респираторных осложнений, связанных с нарушением дыхания [Гринио Л.П., 1976; Темин П.А. и др., 1997; Emery A. 1993; Specht L., Kunkel L., 1993]. Мышечная дистрофия Беккера (МДБ) - более «мягкая» форма МДД, характеризующаяся более поздним дебютом (в 10-20 лет) и доброкачественным течением.

Миодистрофии Дюшенна и Беккера  обусловлены мутациями в гене дистрофина (DMD) и являются аллельными формами заболевания  [Kingston H. et al., 1983; Goodfellow P. et al., 1985; Monaco A. et al., 1986; Hoffman E., Kunkel L., 1989]. Ген DMD  локализован на коротком плече хромосомы X (p21), он состоит из 2.5 млн.п.н. и содержит 79 коротких экзонов и 78 длинных интронов [Koenig M. et al., 1987; Roberts R. et al., 1992]. Основной функцией дистрофина является участие в  поддержании целостности мембраны при сокращении мышечного волокна. Известно, что от 25% до 70% всех мутаций гена дистрофина составляют крупные делеции, захватывающие от одного до нескольких экзонов и расположенные обычно в двух «горячих» точках – в области 5’-конца гена (6-19 экзоны) и в 3’-конце (40-53 экзоны). Около 6% мутаций составляют  крупные дупликации, а остальные мутации являются точковыми. Примерно в 30% случаев крупные  делеции гена дистрофина  возникают de novo, поэтому в 2/3 семей заболевание носит изолированный характер.

С использованием мультиплексной полимеразной цепной реакции синтеза ДНК нами изучен спектр делеций и распределение делеционных точек разрыва (ДТР) в гене дистрофина у 70 больных из 63 семей, проживающих в РБ (из 63 неродственного больного: русских –20 (31.7%); татар – 23 (36.6%); башкир – 12 (19.0%); чувашей – 3 (4.7%); марийцев – 2 (3.17%); украинцев – 2 (3.17%) и 1 кабардинец (1.59%).  В 60 семьях больные имели диагноз МДД, в 3 – МДБ.  «Семейная» форма МДД была точно зафиксирована в 10 из 63 обследованных семей (15.87%), в остальных 53 случаях заболевание носило изолированный характер. 

Из 63 неродственных больных делеции длиной от одного до девяти экзонов обнаружены у 20 (русских - 4, татар - 11, башкир - 2, марийцев – 1; украинцев – 1;  1 - кабардинец), что составило 31.75% . 13 делеций (65.0%) локализовались в 3’-конце гена, 7 (35.0%) - в 5’-“горячем” районе гена: соотношение делеций в дистальном и проксимальном районах «горячих» точек составило 1.86:1. Участки локализации ДТР также распределились в районах двух «горячих» точек гена: в 5’-районе (до 19 экзона) зафиксировано 30% ДТР, в 3’ – районе – 70%  (рис.4).

Рисунок 4.  Распределение делеционных точек разрыва в гене DMD у больных МДД из Башкортостана

Выявленные нами относительно высокие частоты ДТР в регионах гена между экзонами 44-45, 45-47 и 50-52 говорят об обоснованности применения известных высокополиморфных маркеров STR-44, STR-45, STR-49, STR-50  [Clemens P. et al., 1991] не только для косвенной, но и для прямой диагностики носительства делеций у родственниц больных с делециями.

Мы провели диагностику носительства делеций в 13 семьях с использованием  внутригенных маркеров DYS ΙΙ [Feener C. et al.,], STR-44, 45, 49, 50 [Clemens P. et al.,1991], а также  диаллельных маркеров pERT-878/TaqI,  pERT-8715/ BamHI и 17 exon/TaqI [Евграфов О.В., Макаров В.Б., 1987, Евграфов О.В. и др., 1991],  в результате которой  носительство мутации подтверждено у 11 и отвергнуто у 14 родственниц больных.

У 43 больных МДД/МДБ без крупных делеций в гене DMD проведен поиск точковых мутаций  методом SSCP-анализа и последующего секвенирования в тех же 20 участках гена, которые исследовались на их наличие/отсутствие. В результате этого исследования  были идентифицированы две новые, ранее не описанные  мутации  и один известный полиморфизм.  В 6-м экзоне  у трех больных из двух неродственных семей русской этнической принадлежности выявлена делеция 4-х нуклеотидов - c.401_404delCCAA, приводящая к сдвигу рамки считывания и образованию стоп-кодона через 7 кодонов после мутации, терминирующего дальнейший синтез белка - (p.Thr134ThrfsX7) (рис. 5)  Частота этой мутации в выборке неродственных больных из РБ составила 3.17%.

  CAAACCAACAGTGAAAAGATTCTCCTGAGC

Рисунок 5. SSCP-анализ и секвенирование 6-го экзона гена DMD: выделенные фрагменты – образец с измененной подвижностью однонитевой ДНК; мутация c.401_404delCCAA (курсором отмечен нуклеотид, следующий за делецией); внизу – нормальная последовательность фрагмента ДНК

В 46-м экзоне  у одного больного татарской этнической принадлежности выявлена делеция аденина в 6626 положении нуклеотидной последовательности гена -  с.6626delA (рис. 6), приводящая  к сдвигу  рамки

  GAACAAAAGAATA

Рисунок 6. SSCP-анализ и секвенирование 46-го экзона гена DMD: выделенный фрагмент – образец с измененной подвижностью однонитевой ДНК; мутация 6626delA ; внизу- нормальная последовательность фрагмента

считывания и образованию стоп-кодона через 11 кодонов в аминокислотной последовательности белка - p.Lys2210ArgfsX11.  Частота данной мутации в выборке больных из РБ составила 1.6%.

В 53 экзоне гена DMD у одного больного выявлена ранее описанная нуклеотидная замена – с.7728T>C, обусловливающая синономичную замену в аминокислотной последовательности белка -  Asn2575Asn. Функциональное значение данной нуклеотидной замены не установлено, скорее всего, она представляет собой  нормальный полиморфизм.

Таким образом, в целом, с помощью доступных нам  методов,  для больных с миодистрофией Дюшенна/Беккера из РБ установлен несколько более низкий процент делеций в гене дистрофина, по сравнению с европейскими странами, но выявлены две новые мутации в неродственных семьях, в различных этнических группах.  Выявление точковых мутаций в гене дистрофина в настоящее время имеет особое значение, т.к. именно для таких случаев уже сейчас разрабатываются методы генной терапии.

Наследственные моторно-сенсорные нейропатии

Наследственные моторно-сенсорные нейропатии, НМСН (болезнь Шарко-Мари-Тута, ШМТ) – генетически гетерогенная группа заболеваний периферической нервной системы. Основными клиническими проявлениями большинства форм НМСН являются  прогрессирующая слабость и атрофия мышц дистальных отделов  ног и, на поздней стадии - рук, угнетение сухожильных рефлексов, деформация стоп по типу pes cavus (полая стопа, «стопа Фридрейха»), расстройства чувствительности по полиневритическому типу [Harding A., 1980].  В основе болезни лежат дегенеративные изменения миелиновой оболочки или аксонов двигательных и чувствительных волокон периферических нервов и спинномозговых корешков. Соответственно этому, выделяют два основных типа заболевания: НМСН I – димиелинизирующий и НМСН II – аксональный, клиническая дифференциация которых возможна только на основе электронейромиографического исследования, выявляющего скорость проведения импульса (СПИ) по срединному нерву. Среди обоих типов НМСН  встречаются аутосомно-доминатные, аутосомно-рецессивные и X-наследуемые формы [Dyck P. et al., 1993]. В настоящее время картировано более 25 локусов НМСН, идентифицировано 22 гена.  Распространенность всех форм НМСН в разных популяциях мира различна, составляет от 10 до 40:100000 населения [Skre H., 1974;  Emery A., 1991,  Ionasescu V., 1995].

В Республике Башкортостан распространенность всех форм НМСН составляет 10,3 на 100000 населения, установлена ее территориальная и этническая неравномерность. 

Молекулярно-генетическое исследование проведено на выборке, представленной 173 больными НМСН из 131 семьи. По этнической принадлежности исследуемые  семьи распределялись следующим образом: 42 русских, 37 татарских, 27 башкирских, 3 украинских, по одной семье чувашской, марийской и азербайджанской принадлежности. В 19-ти семьях пробанды происходили из межнациональных браков.

Дупликация гена PMP22, являющаяся наиболее частой причиной заболевания в большинстве европейских стран,  обнаружена у 46 больных из 35 неродственных семей. В пересчете на неродственных больных, частота данной мутации составила 26.72% из НМСН всех типов. Несколько чаще она встречалась среди татар – 37.14% и русских – 31.43%,  реже – среди  башкир – 14.78%. У двух пациентов (1.53%) выявлена делеция гена PMP22, ведущая к развитию наследственной нейропатии со склонностью к параличам от сдавления.

В семьях больных без дупликации гена РМР22  проведен поиск точковых мутаций во всех кодирующих областях генов PMP22, MPZ, GJB1 и EGR2, также часто ответственных за развитие НМСН, причем, как 1-го, так и  2-го типа.

В гене PMP22 обнаружена одна новая нуклеотидная замена в области 3-го интрона- с.309-29 G>A. В гене MPZ у двух пациентов татарской этнической принадлежности обнаружена ранее описанная, но редкая миссенс - мутация - р.Ser88Ley (c.263С>G), у двух пациентов – синонимичная замена р.Ser238Ser. В гене EGR2 у  наших больных изменений не обнаружено.

В гене коннексина 32 (GJB1), связанном с Х-сцепленной доминантной формой НМСН 1Х, в настоящее время известно > 300 различных мутаций. У больных из РБ  были выявлены 4 различных  мутации. С высокой частотой (10%) - обнаружена трансверсия c.259С>G, приводящая к замене аминокислоты пролина на аланин в 87 положении белка Сх32 (р. Pro87Ala).  Наиболее часто данная миссенс-мутация встречается среди  башкир – 33%,  реже – среди русских (10%), и практически  не обнаруживается среди татар. Анализ неравновесия по сцеплению мутации р.Pro87Ala с аллелями 5-и полиморфных микросателлитных ДНК-локусов, сцепленных с геном GJB1, показал, что  у неродственных больных на 10 из 13 хромосом,  несущих данную мутацию, обнаружен общий гаплотип по маркерам DXS8111-DXS983-DXS8107-DXS8052,  что свидетельствует о ее распространении на территории РБ в результате эффекта основателя. 

Вторая мутация – новая, ранее не описанная – нуклеотидная  замена с.257С>Т, приводящая к замене треонина на изолейцин  в 86 положении аминокислотной  последовательности  белка (р.Thr86Ile)  (рис.7).  Данная мутация обнаружена в одной татарской семье у больного с клиническим диагнозом НМСН и у его тети, внешне не имеющей выраженных признаков заболевания. В контрольной выборке (n=150) данная нуклеотидная замена не обнаружена.  Относительно функциональной роли этой нуклеотидной замены мы предполагаем, что, скорее всего, она может оказывать определенное влияние на структуру и функцию белка Сх32, т.к. полярная аминокислота треонин, способная формировать сложные водородные связи в структуре молекулы белка, заменяется на неполярную аминокислоту изолейцин, обладающую, благодаря наличию углеводородного радикала,

1 2 3  4  5 6

Рисунок 7. SSCP – анализ и секвенирование образца ДНК с  мутацией с.257C>T (р.Thr86Ile) в гене GJB1. Дорожка 4 – одноцепочечный фрагмент ДНК больного НМСН с измененной  электрофоретической подвижностью; 1,2, 3, 5, 6 - образцы ДНК без мутации.

гидрофобными свойствами. Данное предположение основывается  также  на том, что известны и другие миссенс-мутации 86-го кодона, приводящие к заболеванию (р.Thr86Ala, р.Thr86Ser, р.Thr86Asn) [www.molgen.ua.ac.be/CMTMutations]. 

Третья мутация – с.65G>A (р. Аrg22Gln), -  обнаружена у трех больных из двух  татарских семей.  Ранее эта мутация была описана в семьях из разных стран, а также из России. Четвертая мутация - с.44G>A (Аrg15Gln) -, идентифицирована у двух неродственных больных. В целом,  мутации в гене GJB1были выявлены у 18 из 131 неродственного больного НМСН, что составило 13.7%.  В европейских популяциях НМСН 1Х также составляет 10-20% среди всех НМСН [Ionasescu V.et al., 1993].

Таким образом, анализ 4-х генов у больных из РБ позволил выявить своеобразный спектр и частоту мутаций для отдельных этнических групп данного региона (рис.8), что необходимо учитывать при проведении ДНК-диагностики. Всего мутации были выявлены в 61 неродственной семье (47%). В этих семьях возможно проведение пресимптоматической и  пренатальной  ДНК-диагностики.

Рисунок 8. Спектр и частота мутаций в генах PMP22, GJB1 и MPZ в выборке неродственных больных НМСН  из РБ (n=131)

Болезнь Паркинсона

Болезнь Паркинсона (БП) – это хроническое прогрессирующее нейродегенеративное заболевание головного мозга, избирательно поражающее дофаминергические нейроны компактной части черной субстанции в среднем мозге, приводящее к дефициту дофамина в стриатуме и нарушению функционирования подкорково-корковых систем, регулирующих двигательные функции и проявляющееся в виде сочетания гипокинезии с ригидностью и/или тремором покоя и, в более поздней стадии, постуральной неустойчивостью. В популяциях мира БП встречается с частотой 60–187 на 100 000 населения, а среди лиц старше 50 лет  частота заболевания составляет 2-4% [Голубев В.Л., 1999].

В Республике Башкортостан распространенность БП составила 68.6 на 100 000 взрослого населения. Частота семейных форм – 5.95%,-  в значительной  степени соответствует среднемировым показателям.

Главным  патогенетическим механизмом гибели дофаминергических нейронов считается  повышенный уровень апоптоза, обусловленный развитием в клетках окислительного стресса, Среди причин развития здесь окислительного стресса рассматриваются нарушения внутриклеточной убиквитин-зависимой деградации поврежденных белков и блокада митохондриального комплекса I, приводящие к накоплению в клетках свободных радикалов, источниками которых могут являться различные эндогенные и экзогенные нейротоксины [Крыжановский Г.Н. с соавт., 2002]. В большинстве случаев болезнь Паркинсона носит спорадический характер и имеет многофакторную природу с определенной генетической предрасположенностью. Существуют и моногенные формы заболевания. В настоящее время картировано 11 генных локусов, связанных с отдельными наследственными формами БП, в шести из них идентифицированы гены.

Молекулярно-генетическое исследование болезни Паркинсона в РБ включало: 1) поиск у всех обследуемых больных мутаций в генах, связанных с моногенными формами БП - -синуклеина (PARK1), паркина (PARK2)  и  дардарина (LRRK2); 2) анализ ассоциации спорадической БП с полиморфными вариантами ряда генов-кандидатов (Yb8NBC36 Alu-инсерционного локуса гена клиевого канала KCNJ6;  делеционного полиморфизма генов глутатионтрансфераз GSTM1(0/0) и GSTT1(0/0); рестрикционных полиморфизмов Ile462Val гена цитохрома семейства р-450 CYP1A1,  Gln191Arg  гена параоксоназы 1 (PON1), Val108Met гена катехол-О-метилтрансферазы (COMT); 3’VNTR-полиморфизма гена дофаминового транспортера (DAT1), (TCAT)n-повторов в 1  экзоне гена тирозингидроксилазы (ТН)); 3) анализ мтДНК у пациентов с БП и в контрольных группах,  включающий определение гаплогрупп мтДНК, поиск мутаций в гене цитохрома b;  а также полное секвенирование мтДНК у 4-х больных с определенными гаплогруппами мтДНК.

При анализе частот генотипов и аллелей каждого локуса учитывались этническая принадлежность больных и здоровых доноров, а также возраст манифестации, форма заболевания и его тяжесть, определенная на основании унифицированной шкалы, предложенной Хеном и Яром (Hoehn and Yahr Rating Scale) и унифицированной оценочной шкалы болезни Паркинсона (Unified Parkinson’s Disease Rating Scale).

В гене альфа-синуклеина (PARK1) проведен скрининг двух известных мутаций -  р.Ala53Thr и р.Ala30Pro, - у 200 больных  со спорадической и 8-и неродственных больных с наследственными формами БП: данные мутации у обследованных больных не обнаружены.

В гене белка паркина (PARK2), ответственного за развитие ювенильной рецессивной формы БП, проведен поиск мутаций во всех его кодирующих областях (12 экзонов). Методом полуколичественного анализа дозы отдельных экзонов у двух неродственных больных со спорадической БП, этнических русских,  была выявлена не описанная ранее делеция 12-го (последнего) экзона  в гетерозиготном состоянии. 12-й экзон гена кодирует С-концевой участок  паркина,  отвечающий за связывание паркина с убиквитин-конъюгирующим ферментом Е2, т.е. за один  из наиболее важных моментов в процессе  убиквитин-зависимого протеолиза.  Исходя из этого, было сделано предположение о возможной роли гетерозиготного носительства  найденной делеции в развитии  спорадической БП.

С помощью SSCP-анализа и последующего секвенирования  у 31 из 200 пациентов с БП выявлено 5 типов  изменений нуклеотидной последовательности – в трех экзонах и двух интронах, однако все они были признаны нейтральными полиморфизмами как на основании сопоставления с литературными данными, так и на основании того, что они встречаются и в контрольной выборке (табл. 7). 

Таблица 7. Изменения нуклеотидной последовательности в гене PARK2 у пациентов со спорадической формой идиопатической болезни Паркинсона

Локализация мутации

Изменения нуклеотидной последователь-ности

Изменения в структуре белка

Частота (%)

Больные N=200

Контроль N=200

4-й экзон

С.601G>A

p.Ser167Asn

2

1

7-й экзон

с.866С>Т

-

0.5

-

11-й экзон

с.1281G>A

p.Asp394Asn

4

2.5

2-й интрон

IVS2+25T>C

-

9

6

4-й интрон

IVS4 -25 delA

-

4.5

3.5

В гене LRRK2 (leucine-rich repeat kinase 2), связанном с аутосомно-доминантной формой БП, проведен скрининг трех известных, наиболее частых, мутаций у 341 пациента со спорадической БП (русских -129, татар – 156, башкир – 56) и у 360 человек из группы контроля (русских – 103, татар- 131, башкир -126).  В результате данного исследования мутация Gly2019Ser в гетерозиготном состоянии (рис. 9) была выявлена у одной больной башкирской этнической принадлежности, имеющей акинетико-ригидно-дрожательную форму БП с манифестацией заболевания  в 63 года. Частота данной мутации составила для башкир 1.79% (1/56). Примерно с такой же частотой данная мутация выявлена в популяциях Европы [Di Fonzo A. et al., 2006]. В контрольной выборке данная мутация не обнаружена.

Замена Gly2385Arg обнаружена у двух больных татарской этнической принадлежности с частотой 1.28% среди татар. В исследуемой  группе контроля  данный полиморфный вариант не выявлен. Одна из этих больных имела ригидно-дрожательную форму заболевания с манифестацией в 62 года, другой больной – акинетико-ригидно-дрожательную форму БП с манифестацией в 36 лет. В исследуемой  группе контроля  данный полиморфный вариант не  обнаружен. Полиморфизм Gly2385Arg ранее был описан, он выявлен как  среди  больных, так и среди контроля в Тайване [Di Fonzo A. et al., 2006] и  Сингапуре [Tan E. et al., 2007].

а)  б)

Рисунок 9. Секвенирование гена LRRK2: а) мутация 6055G>A (Gly2019Ser);

б) Gly2385Arg

Мутация Ile2020Thr в наших выборках пациентов с БП и контроля не обнаружена.

В результате исследования в группах больных и контроля полиморфизма 8-и указанных выше ядерных генов-кандидатов БП выявлена ассоциация заболевания с  полиморфными вариантами трех генов.

Во всех исследованных этнических группах обнаружена ассоциация БП с инсерцией Yb8NBC36 гена калиевого канала KCNJ6: у пациентов с БП русской, татарской и башкирской этнической принадлежности  по сравнению с соответствующими контрольными группами чаще встречался генотип *I/*I (62.96% и 38.38%, 76% и 37.08%, 72.22% и 32.40% соответственно) (рис.10). Различия оказались статистически значимыми для всех трех сравниваемых групп (р=0.007, OR=2.73, 95%CI=1.30-5.74; р=0.0005, OR=5.37, 95%CI=2.74-10.62; р=0.0059, OR=5.42, 95%CI=1.54-20.10, соответственно). Эта же закономерность верна и для аллеля *I: при р<0.05 для русских OR=1.95, 95%CI=1.07-3.62; для татар  OR=3.36, 95%CI=1.92-5.93; для башкир OR=3.17, 95%CI=1.08-9.93.

Кроме того,  генотип  *I/*I и аллель *I достоверно  (р<0.01) преобладают при всех клинических формах заболевания по сравнению с контролем, а также для всех степеней тяжести заболевания. При разделении пациентов по возрасту начала БП статистически значимые отличия обнаружены в группах  старше 40 лет. Мы пришли к заключению, что  генотип *I/*I и аллель *I являются генетическими маркерами повышенного риска развития БП для людей разной этнической принадлежности (русских, татар и башкир) из республики Башкортостан.

Рисунок 10. Распределение частот генотипов Alu- инсерционного локуса Yb8NBC36 гена KCNJ6 у пациентов БП и в контроле в разных этнических группах

Теоретически, инсерция Alu-повторов  может изменять транскрипцию гена путем изменения статуса метилирования его промотора, нарушения структуры промотора или внедрения добавочных регуляторных последовательностей, таких как связывающие сайты рецепторов стероидных гормонов, которые содержатся у некоторых членов Alu-семейств. Мы предполагаем, что Alu-инсерция Yb8NBC36 может изменять экспрессию гена KCNJ6, нарушая в какой-то степени функцию калиевого канала.

При исследовании роли генов дофаминовой системы выявлена ассоциация БП с полиморфными вариантами гена катехол-орто-метилтрансферазы (COMT) у татар. Частота генотипа  *Н/*Н, детерминирующего активную форму фермента, была достоверно выше среди больных (45.54%) по сравнению с контролем (19.18%) (OR=3.52, 95%CI=1.95-6.38), так же, как и частота аллеля *Н – 65.63% и 51.,03%, соответственно (OR=1.83; 95%CI=1.26-2,67). Частота генотипа *L/*H, детерминирующего синтез фермента с промежуточным уровнем активности, среди больных составила 40,18%, среди контроля - 63,7% (OR=0,38, 95%CI=0.22-0.65). Следует отметить, что и в других исследуемых этнических группах (русских и башкир) наблюдается аналогичное изменение распределения частот и генотипов (увеличение частоты генотипа *Н/*Н и уменьшение частоты генотипа*L/*H), и аллелей (увеличение частоты аллеля *Н и уменьшение частоты аллеля *L) среди больных, по сравнению с контролем, хотя и не  достигающее статистической значимости. Таким образом, можно предполагать, что генотип *Н/*Н и аллель *Н гена СОМТ являются факторами генетического риска, а генотип *L/*H и аллель*L – протективными факторами для  развития болезни Паркинсона  не только для татар, но и для  других жителей Республики Башкортостан.

При анализе числа тетрануклеотидных повторов (TCAT)n в интроне 1 гена тирозингидроксилазы (TH) показана ассоциация генотипа *6/*8  с акинетико-ригидной формой БП (2=7.39, P=0.007, OR=4.75, 95%CI=1.43-15.33), третьей (2=4.53, P=0.03, OR=3.12, 95%CI=1.08-8.96) и четвертой степенями тяжести заболевания (2=5. 94, P=0.015, OR=3,04, 95%CI=1.21-7.70).

В результате исследования полиморфизма мтДНК, основанного на секвенировании гипервариабельного сегмента I и рестрикционном анализе 11 однонуклеотидных полиморфизмов кодирующего региона,  в выборках татар (157 больных и 183 контроля)  были выявлены достоверные различия, характеризующиеся значительным преобладанием среди больных гаплогруппы H (39.5% больных и у 20.0% контроля  (OR=2.58, CI= 1.55-4.30,  P=0.0008) и уменьшением частоты гаплогруппы U (16.6% и 34.4%, соответственно), (OR=0.38, CI= 0.22-0.66 P=0.0002). Протективные свойства гаплогрупп U, K, J, T для развития БП были показаны ранее и другими авторами [van der Walt J. et al., 2003; Wallace D., 2005].  Ассоциация гаплогруппы H с БП, выявленная нами только в популяции татар, ранее не описана.

В результате секвенирования гена митохондриального цитохрома В в выборках больных (n=58) и контроля (80) татарской этнической принадлежности было выявлено 16 миссенс-мутаций и 9 синонимичных нуклеотидных замен. Достоверно значимое различие было показано для мутации T15693C, обнаруженной только в контроле и не выявленной у больных, а также установлен гаплотип 15693С-15218А-14793А, ассоциированный с гаплогруппой U, который можно считать протективным для БП в популяции татар (OR=0.04, CI=0.006-0.65)

С целью более углубленного исследования природы выявленных ассоциаций гаплогрупп мтДНК с БП мы провели полное секвенирование мтДНК (16569 пн) у 4-х пациентов татарской этнической принадлежности, двое из которых имели гаплогруппу H, двое –  кластер гаплогрупп UK; полученные результаты секвенирования сравнивались с Кембриджской последовательностью мтДНК (rCRS). Наиболее интересным результатом, на наш взгляд, оказалась выявленная у носителя субгаплогруппы H2 в гомоплазмическом состоянии миссенс-мутация 4659G>A (Ala64Thr) в высококонсервативном сайте гена ND2.  А у пациента с гаплогруппой Uk1 была выявлена миссенс-мутация 7637G>A/G (Glu18Lys) в гене COII в гетероплазмическом состоянии (рис. 11). Обе эти мутации, предположительно, имеют функциональную значимость и могут обусловливать предрасположенность к БП у данных пациентов.

а)  б)

Рисунок 11. Секвенирование мтДНК: а) мутация 7637G>A/G (Glu18Lys)  в гене COII у пациента БП с гаплогруппой Uk1; б) мутация 4659G>A (Ala64Thr)  в гене ND2 у пациента БП с субгаплогруппой H2

Таким образом, выявленные этноспецифические структурные особенности генов наиболее частых наследственных заболеваний нервной системы, определение демографических и генетических механизмов их распространения на территории РБ позволили разработать наиболее оптимальные для региона подходы их  ДНК-диагностики. На основе этих результатов в РБ уже созданы и действуют национальные генетические регистры (компьютерные базы данных) по всем представленным заболеваниям, что реально способствует повышению эффективности медико-генетического  консультирования в семьях больных.

ВЫВОДЫ

1. Республика Башкортостан является популяцией высшего иерархического уровня для своего автохтонного населения. В исследованных районах установлены высокие показатели индекса эндогамии - от 0.58 до 0.97.  Основная доля браков в РБ является моноэтнической. Суммарно по шести районам, положительная этническая брачная ассортативность  установлена для башкир (Н=13.6 на конец ХХ в.) и татар (Н=1.09), отрицательная – для русских (0.45).  Этническая подразделенность населения и высокий уровень эндогамности  в районах РБ являются основными факторами, способствующими сохранению имеющегося генетического разнообразия и территориальной неравномерности распространения наследственной патологии.

2. Высокая распространенность миотонической дистрофии Россолимо-Куршмана-Штейнерта-Баттена среди зауральских башкир (35 - 40 на 100000 населения) обусловлена эффектом основателя и дрейфом генов, о чем свидетельствует общий гаплотип, сцепленный с экспансией (CTG)n повторов в гене миотонинпротеинкиназы (DMPK) ((Hha1(-)/Hinf1(+)/CTGexp)). Корреляции между частотой нормальных аллелей с высоким числом тринуклеотидных повторов ((СTG)19-35) и распространенностью заболевания в популяциях не выявлено. На основании анализа наследования данного локуса в семьях здоровых доноров подтверждена нестабильность аллелей с числом CTG повторов >19,  частота мутирования составила 5х10-3.

3. Распространенность хореи Гентингтона в Башкортостане составляет 2.6 на 100000 населения, что соответствует таковой в среднем в европейских популяциях. Экспансия (CAG)n повторов в гене хореи Гентингтона (HD) обнаруживает практически полное неравновесие по сцеплению с аллелем (CCG)7  и делецией del2642.  На мутантных хромосомах выявлено три гаплотипа: (CCG)7/del-, (CCG)7/del+ и (CCG)10/del-, что позволяет предположить, как минимум, три различных источника происхождения ХГ в Республике Башкортостан. Показана роль (CCG)n тракта как цис-активного фактора, модифицирующего стабильность (CAG)n повторов. Величина и вектор мутации зависят от исходного числа (CAG)n повторов  и от пола больного родителя: более выраженная экспансия наблюдается при наследовании ХГ от отца. Наличие делеции del2642 на хромосоме с экспансией и аллеля 2 гена АpoE ассоциировано с более поздним началом болезни. 

4. Анализ распределения частот  генотипов и аллелей высокополиморфных локусов (CTG)n в гене DMPK и (CAG)n в гене HD у народов Волго-Уральского региона выявил высокий уровень их гетерозиготности и значительную неоднородность  исследованных популяций как на уровне этносов, так и на уровне этногеографических групп одного этноса (башкир). По характеру полиморфизма локуса (CTG)n популяции Волго-Уральского региона занимают промежуточное положение между  популяциями Европы и Азии,  а по локусу (CAG)n выявляют значительное сходство с популяциями Европы.

5. У больных мышечной дистрофией Дюшенна из Башкортостана частота делеций в гене дистрофина  составляет 31.75%. Определен спектр и частота делеционных точек разрыва гена, высокая частота которых в регионах между экзонами  44-45(10%), 45-47(13%) и 50-52(23%) обосновывает применение высокополиморфных маркеров STR-44, STR-45, STR-49 и  STR-50 для прямой диагностики носительства делеций у родственниц больных. Выявлены две новые мутации: c.401_404delCCAA (p.Thr134ThrfsX7), с частотой 3.17% во всей выборке больных (10% среди русских) и с.6626delA (p.Lys2210ArgfsX11) (1.59%  во всей выборке  и 4.35% - среди татар).

6. Распространенность наследственных моторно-сенсорных нейропатий различных типов в Республике Башкортостан составляет 10.3 на 100000 населения. На основании молекулярно-генетического исследования установлено, что среди всех типов НМСН частота НМСН 1А типа составляет 26%, НМСН 1Х типа – 13.7%.  Установлены региональные и этнические особенности спектра и частот мутаций в генах периферического белка миелина (PMP22), структурного белка миелина (MPZ) и коннексина 32 (GJB1).  В гене MPZ  выявлена миссенс-мутация  р. Ser88Ley (с. 263С>G) (0.8%) и синонимичная замена  р.Ser238Ser (с.714C>T) (1.6%).  В гене GJB1 обнаружены 4 миссенс-мутации: p.Pro87Ala (c.259C>G) (10%), p.Arg22Gln (c.65G>A) (2.98%); p.Arg15Gln (c.44G>A) (1.5%) и p.Thr86Ile (c.257C>T) (0.8%), последняя из которых ранее не описана. Частая мутация Pro87Ala, наиболее распространенная среди башкир (33% среди всех случаев НМСН), сцеплена с общим гаплотипом, что свидетельствует о ее распространении в РБ в результате эффекта основателя.

7.  Распространенность болезни Паркинсона в Республике Башкортостан (68.6 на 100 000 взрослого населения) и частота семейных форм (5.95%),- сопоставимы с современными показателями в мире. Установлено неравномерное территориально-этническое распределение заболевания,  преобладание среди пациентов лиц татарской этнической принадлежности.

8. Показано, что мутации в генах, ответственных за моногенные формы БП, вносят определенный вклад в развитие спорадической БП: в

гене PARK2 выявлена новая мутация – делеция 12-го экзона в гетерозиготном состоянии с частотой 5.26%; в гене  LRRK2 обнаружены миссенс-мутация  р.Gly2019Ser (1.79% среди башкир), и р.Gly2385Arg (1,28% среди татар).

Генетическим фактором риска развития БП для всех исследованных этнических групп населения Башкортостана является  Alu–инсерция Yb8NBC36 гена калиевого канала KCNJ6 (генотип *I/*I и аллель *I). У татар маркерами повышенного риска развития БП являются  генотип *Н/*Н и аллель *Н гена катехол-орто-метилтрансферазы, детерминирующие активную форму фермента. Генотип *6/*8 полиморфного локуса (TCAT)n гена тирозингидроксилазы  ассоциирован с акинетико-ригидной формой заболевания.

9. Установлено, что в популяции татар гаплогруппа H мтДНК является генетическим маркером повышенного риска, а гаплогруппа U  - маркером пониженного риска развития спорадической формы болезни Паркинсона. В гене митохондриального цитохрома В выявлен  гаплотип  15693C-15218A-14793A, ассоциированный с гаплогруппой U, не обнаруженный у пациентов с БП.  В результате полного секвенирования мтДНК у 4-х пациентов БП татарской этнической принадлежности у носителя субгаплогруппы H2 выявлена мутация Ala64Thr в гене ND2 в гомоплазмическом состоянии, а у носителя гаплогруппы Uk1- мутация Glu18Lys в гене COII в гетероплазмическом состоянии.

10. На основе полученных результатов разработаны оптимальные для этнически подразделенного населения Республики Башкортостан алгоритмы ДНК-диагностики моногенных заболеваний нервной системы (миотонической дистрофии, хореи Гентингтона, мышечной дистрофии Дюшенна/Беккера, наследственных моторно-сенсорных нейропатий); и спорадической формы болезни Паркинсона.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ РАБОТЫ В РЕЦЕНЗИРУЕМЫХ НАУЧНЫХ ЖУРНАЛАХ

  1. Хидиятова И.М., . Хуснутдинова Э.К., Иващенко Т.Э., Рафиков Х.С ПДРФ-анализ локусов МЕТ и D7S23, сцепленных с геном муковисцидоза, в популяции башкир и коми // Генетика. 1993.  N 12. С. 329-334.
  2. Khusnutdinova E.K., Khidiyatova I.M., Ivachenkо Т.E. et al..Polymorphism of MET and D7S23 loci linked to the cystic fibrosis gene in Bashkir and Komi populations.// Human Heredity. 1994. V.44. P.191-195..
  3. Хуснутдинова Э.К., Хидиятова И.М., Просняк М.И., Лимборская С.А. Анализ полиморфизма ДНК, выявляемого методом геномной дактилоскопии на основе ДНК фага М13, в популяциях башкир и коми // Генетика. 1994. N 12. С. 1621-1625.
  4. Хуснутдинова Э.К., Хидиятова И.М., Погода Т.В., Просняк М.И., Лимборская С.А Анализ аллельных вариантов гипервариабельного локуса аполипопротеина В в популяциях башкир и коми.//Генетика.1994.№7.С.995-1000.
  5. Каlnin V.V., Kalnina O.V.,  Khidiyatova I.M., Prosnjak M.I., Limborska S.A., Khusnutdinova E.K..Use of DNA fingerprints for human population genetic studies.// Molecular and General Genetics. 1995. V. 247. P.488-493.
  6. Хуснутдинова Э.К., Хидиятова И.М., Галеева А.Р., Гринчук О.В., Лимборская С.А Анализ полиморфизма гипервариабельного локуса гена аполипопротеина- В в популяциях народов Волго-Уральского региона.//  Генетика. 1996. Т. 32. № 12. С.1678-1682.
  7. Хуснутдинова Э.К., Викторова Т.В.,  Хидиятова И.М., Фатхлисламова Р.И., Иващенко Т.Э..Аллельный полиморфизм ДНК-локусов МЕТ и D7S23, сцепленных с геном муковисцидоза, в популяциях Волго-Уральского региона.// Генетика. 1997. Т.33. № 9. С. 1290-1296. 
  8. Хуснутдинова Э.К., Хидиятова И.М., Фатхлисламова Р.И.,  Викторова Т.В., Гринчук О.В Рестрикционно-делеционный полиморфизм V-области митохондриальной ДНК в популяциях Волго-Уральского региона.// Генетика. 1997. Т.33. № 7. С. 996-1001.
  9. Гринчук О.В.,  Киселев А.В., Хидиятова И.М., Магжанов Р.В., Хуснутдинова Э.К Анализ делеций в гене дистрофина у больных мышечной дистрофией Дюшенна в Башкортостане // Генетика. 1999. T. 35. №4. C. 551-555.
  10. Хуснутдинова Э.К., Хидиятова И.М.,  Викторова Т.В., Фатхлисламова Р.И., Лимборская С.А. Анализ полиморфизма ДНК, выявляемого методом геномной дактилоскопии на основе фага М13, в популяциях Волго-Уральского региона// Генетика. 1999. T. 35. №4 C. 509-515.
  11. Хуснутдинова Э.К., Хидиятова И.М., Викторова Т.В., Фатхлисламова Р.И Рестрикционный полиморфизм главной некодирующей области митохондриальной ДНК в популяциях народов Волго-Уральского региона// Генетика. 1999. T. 35. №5. C. 695-702.
  12. Хуснутдинова Э.К.,  Хидиятова И.М., Викторова Т.В., Фатхлисламова Р.И., Галеева А.Р., Лимборская С.А. Оценка генетических расстояний и таксономический анализ популяций народов Волго-Уральского региона на основе данных о полиморфизме ДНК // Генетика. 1999. T. 35. № 7. C. 982-987.
  13. Фатхлисламова Р.И.,  Хидиятова И.М., Попова С.Н., Сломинский П.А., Хуснутдинова Э.К., Лимборская С.А.. Анализ полиморфизма CTG-повторов в гене миотонической дистрофии в популяциях Волго-Уральского региона // Генетика. 1999. T. 35. №7. C. 988-993.
  14. Хидиятова И.М., Р.И.Фатхлисламова, Р.В.Магжанов, С.Н.Попова, П.А.Сломинский, С.А.Лимборская, Э.К.Хуснутдинова.  Изучение экспансии и частоты мутирования CTG повторов гена миотонической дистрофии. //Генетика.-2000.- V.36.-№10.-С.1181-1183.
  15. Хидиятова И.М., Фатхлисламова Р.И., Магжанов Р.В., Попова С.Н., Сломинский П.А., Лимборская С.А., Хуснутдинова Э.К. Анализ CTG повторов гена миотонинпротеинкиназы у больных миотонической дистрофией из Башкортостана. // Журнал неврологии и психиатрии.- 2001.№3.С.54-59.
  16. Хидиятова И.М, Джемелева Л.У., Хабибуллин Р.М., Хуснутдинова Э.К. Анализ частоты мутации 35delG в гене коннексина 26(GJB2) у больных с несиндромальной аутосомно-рецессивной глухотой из Башкортостана и в популяциях народов Волго-Уральского региона. // Молекулярная биология. 2002, том 36, №3, с.438-441.
  17. Dzhemileva L.U., Khidiyatova I.M., Khabibullin R.M., Khusnutdinova E.K. Novel mutations and haplotype analysis of genomic polymorphisms of GJB2 and GJB3 genes associated with profound and moderately severe hearing loss in patients from Bashkortostan// Balkan Journal of Medical Genetics. 2003. V.6. P.43-46.
  18. П.А.Сломинский, Милосердова О.В., Попова С.И., Гилязова И.Р., Хидиятова И.М., Магжанов Р.В., Хуснутдинова Э.К., Лимборская С.А. Анализ делеционных мутаций в гене паркина у больных идиопатической формой болезни Паркинсона //Генетика.2003 №2. С.223-228.
  19. Кутуев И.А., Фатхлисламова Р.И., Хидиятова И.М., Хуснутдинова Э.К. Анализ полиморфных локусов гена IT15 у народов Волго-Уральского региона //Молекулярная биология 2003. Т.37. №6. С.961-970.
  20. Хидиятова И.М., Хуснутдинова Э.К. Геномная структура и ДНК-диагностика наследственных моногенных заболеваний в Волго-Уральском регионе //Молекулярная биология. 2004. Т.38. №1. С.139-149.
  21. Хидиятова И.М., Ишмухаметова А.Т., Хуснутдинова Э.К. Анализ полиморфизма гена HLA-DRB1 в популяциях Волго-Уральского региона //Генетика. 2004. Т.40. №2. С.203-208.
  22. Кутуев И.А., Хусаинова Р.И., Хидиятова И.М., Магжанов Р.В., Хуснутдинова Э.К. Анализ гена IT15 в семьях больных хореей Гентингтона //Генетика. 2004. Т.40. № 8. С.919-926.
  23. Хидиятова И.М., Гилязова И.Р., Байтимеров А.Р., Магжанов Р.В., Хуснутдинова Э.К. Поиск мутаций в генах PARK1 и PARK2 у пациентов со спорадической и наследственными формами болезни Паркинсона из Башкортостана //Медицинская генетика. 2004. № 6. C.280-284.
  24. Кутуев И.А., Хусаинова Р.И., Хидиятова И.М., Хуснутдинова Э.К. Анализ взаимодействия повторяющихся последовательностей в гене хореи Гентингтона//Медицинская генетика. 2004. №9. С.451-455.
  25. Ишмухаметова А.Т., Хидиятова И.М., Магжанов Р.В., Хуснутдинова Э.К. Анализ ассоциации миастении с полиморфиными локусами (AT)n, +49A/G, -318C/T гена белка 4 цитотоксических Т-лимфоцитов (CTLA4) //Медицинская генетика. 2005. Т.4. №3. С.128-133.
  26. Хуснутдинова Э. К., Хидиятова И. М., Хусаинова Р.И., Карунас А.С., Исламгулов Д.В., Валиев Р.Р., Мурзабаева С.Ш. Молекулярно-генетическое изучение наследственной патологии в Волго-Уральском регионе // Вестник ВОГиС. 2005. №6. С. 102-123.
  27. Ишмухаметова А.Т., Мусин Р.Г., Хидиятова И.М., Магжанов Р.В, Хуснутдинова Э.К. Эпидемиологическое исследование миастении Гравис в Республике Башкортостан // Неврологический журнал. 2006. № 6. С. 16-21.
  28. Крупина Н.Б., Хидиятова И.М., Латыпова Э.Г., Сайфуллина Е.В., Магжанов Р.В., Хуснутдинова Э.К. Клинико-эпидемиологическое исследование наследственных моторно-сенсорных нейропатий и скрининг дупликации гена PMP22 у больных в Республике Башкортостан // Медицинская генетика. 2006. №11. С. 126-128.
  29. Gilyazova I., Khidiyatova I. Akhmetova V., Baitimerov A., Magzhanov R., Khusnutdinova E. Alu-insertion Yb8NBC36 of KCNJ6 gene is a risk factor for Parkinson’s disease development // Balkan Journal of medical genetics. 2006. V.9. (1&2). P.33-37.
  30. Зинченко С.П., Кириллов А.Г., Абрукова А.В., Сорокина Т.В., Шаронова Е.И., Хидиятова И.М., Джемилева Л.У., Шокарев Р.А., Близнец Е.А., Зинченко Р.А., Гинтер Е.К. Генетико-эпидемиологическое исследование наследственных (изолированных и синдромальных) нарушений слуха в Республике Чувашии // Медицинская генетика. 2007. Т.6. №5. С. 19-29. 
  31. Ельчинова Г.И., Хидиятова И.М., Тереховская И.Г., Хуснутдинова Э.К., Зинченко Р.А. Индекс эндогамии и его изменение во времени в некоторых популяциях Волго-Уральского региона // Генетика, 2007, Т.43., №8. – С.1146-1148.
  32. Зинченко Р.А., Морозова А.А., Галкина В.А.,  Хидиятова И.М., Хлебникова О.В., Кононов А.Б., Федотов В.П., Хуснутдинова Э.К., Гинтер Е.К. Медико-генетическое изучение населения  Республики Башкортостан. Сообщение I. Отягощенность наследственной патологией в трех районах Республики // Медицинская генетика, 2007. – Т.6, № 6. – С. 17-22.
  33. Зинченко Р.А., Морозова А.А., Галкина В.А., Хидиятова И.М., Хлебникова О.В., Кононов А.Б., Федотов В.П., Хусаинова Р.И., Ахметова В.Л., Джемилева Л.У., Щагина О.А., Хуснутдинова Э.К.,  Гинтер Е.К.  Медико-генетическое изучение населения  Республики Башкортостан. Сообщение II. Разнообразие наследственной патологии в трех районах Республики // Медицинская генетика, 2007. – Т.6, №7. – С. 18-25.
  34. Ельчинова Г.И., Хидиятова И.М., Морозова А.А., Тереховская И.Г., Хуснутдинова Э.К., Зинченко Р.А. Медико-генетическое изучение населения  Республики Башкортостан. Сообщение III. Временная динамика этнической ассортативности зауральских башкир // Медицинская генетика, 2007. – Т.6, №7. – С. 43-47.
  35. Тереховская И.Г., Ельчинова Г.И., Хидиятова И.М., Морозова А.А., Хуснутдинова Э.К., Зинченко Р.А. Медико-генетическое изучение населения  Республики Башкортостан. Сообщение IV. Репродуктивные характеристики популяций семи сельских районов // Медицинская генетика, 2007. – Т.6, № 8. – С. 14-21.
  36. Ельчинова Г.И., Хидиятова И.М., Морозова А.А., Тереховская И.Г., Хуснутдинова Э.К., Зинченко Р.А. Медико-генетическое изучение населения республики Башкортостан. Сообщение V. Эндогамия и изоляция расстоянием зауральских башкир // Медицинская генетика, 2007. – Т.6, № 9. – С. 42-45.
  37. Хидиятова И.М., Багаутдинова Э.Г., Галиева Д.В., Крупина Н.Б., Щагина О.А., Тибрукова Т.Б., Магжанов Р.В., Поляков А.В., Хуснутдинова Э.К. Спектр и частота мутаций в гене коннексина 32 (GJB1) у больных с наследственной моторно-сенсорной нейропатией 1Х типа из Башкортостана // Генетика, 2008. – Т.44, №10. – С.1385-1391.
  38. Гилязова И.Р.,  Хидиятова И.М., Ахметова В.Л., Байтимеров А.Р., Магжанов Р.В., Хуснутдинова Э.К. Исследование ассоциации полиморфных вариантов ряда генов метаболизма дофамина с идиопатической болезнью Паркинсона в Республике Башкортостан// Медицинская генетика, 2008. - №1. – С. 39-49.
  39. Khusnutdinova E., Gilyazova I., Ruiz-Pesini E., Derbeneva O., Khusainova R., Khidiyatova I., Magzhanov R. and Wallace D.  A Mitochondrial Etiology of Neurodegenerative Diseases: Evidence from Parkinson’s Disease //Annals of the New York Academy of Sciences, 2008 – V3, N11.- P. 447-467. 
  40. Джемилева Л.У., Хуснутдинова Э.К., Хидиятова И.М., Хабибуллин Р.М., Тазетдинов А.М. Способ выявления мутаций в гене GJB2, сопровождающихся развитием несиндромальной аутосомно-рецессивной глухоты. Патент на изобретение №2317547. - Зарегистрировано  в Гос.реестре изобретений РФ 20 февраля 2008г.





© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.