WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

На правах рукописи

ГРИШАНИН

АНДРЕЙ  КОНСТАНТИНОВИЧ

ЦИТОГЕНЕТИЧЕСКОЕ ИССЛЕДОВАНИЕ ДИМИНУЦИИ ХРОМАТИНА У ПРЕСНОВОДНЫХ РАКООБРАЗНЫХ НОВЫЙ ПОДХОД К ИЗУЧЕНИЮ ПАРАДОКСА РАЗМЕРА ГЕНОМА ЭУКАРИОТ

Специальность 03.00.15. – генетика

Автореферат

диссертации на соискание ученой степени

доктора биологических наук

Москва – 2008

Работа выполнена в Институте биологии внутренних вод им. И.Д. Папанина РАН и в Институте общей генетики им. Н.И. Вавилова РАН

Научные консультанты:

доктор биологических наук, профессор 

Акифьев Алексей Павлович

заслуженный деятель РФ, доктор биологических наук, профессор

Бродский Всеволод Яковлевич

Официальные оппоненты:

доктор биологических наук, профессор Митрофанов Владимир Григорьевич

доктор биологических наук, профессор Богданов Юрий Федорович

доктор биологических наук, профессор Кузнецова Валентина Григорьевна

Ведущая организация:

Институт молекулярной биологии им. В.И. Энгельгардта РАН

Защита состоится__________________ 2008 года в ________ часов на заседании диссертационного совета Д 002.238.01 при Институте биологии развития им. Н.К. Кольцова РАН

по адресу:  г. Москва,  ул. Вавилова, 26.

E-mail: idbras@bk.ru,

Факс: (499)135-80-12,

http://idbras.comcor.ru

С диссертацией можно ознакомиться в библиотеке Института биологии развития им. Н.К. Кольцова РАН.

Автореферат разослан ________ 2008 года

Ученый секретарь

диссертационного совета  Е.Б. Абрамова

кандидат биологических наук

Введение

Актуальность проблемы

Диминуция хроматина – общее название клеточных генетических процессов, в ходе которых соматические клетки многоклеточных животных или соматические ядра простейших теряют большую или меньшую часть генетического материала, присутствующего в клетках зародышевой линии многоклеточных животных или в генеративных ядрах простейших.

Диминуция хроматина (ДХ), открытая более 100 лет тому назад Т. Бовери (Boveri, 1887), остается и до сих пор мало изученным феноменом. У абсолютного большинства видов животных ДХ отсутствует, а размеры геномов соматических клеток и клеток зародышевой линии совпадают. Среди эукариот ДХ обнаружена всего у нескольких десятков видов среди  простейших, нематод, насекомых, миксин, пресноводных ракообразных. К началу наших исследований данные о механизмах ДХ у пресноводных ракообразных и самом этом феномене были фрагментарными. Ни у одной из групп животных, у которых наблюдается ДХ, не была изучена ультраструктура хромосом и интерфазных ядер в соматических клетках до и после ДХ. Ничего не было известно об ультраструктуре гранул элиминируемого хроматина и о ДНК, заключенной в эти гранулы. Было неясно, зачем немногим видам животных нужна ДХ. До нашей работы не была отмечена связь между ДХ и так называемым парадоксом размера генома эукариот, отсутствием прямой зависимости между сложностью организации вида и величиной генома по массе ДНК; отсутствовали исследования по внутривидовой вариабельности цитогенетических признаков у пресноводных ракообразных. Актуальность изучения ДХ также определяется значимостью для биологии развития инактивации генов в онтогенезе.

Цель работы и задачи исследования

Цель диссертационной работы состоит в изучении механизма диминуции хроматина, еe эволюционного значения и поиске новых подходов к решению проблемы парадокса размера генома эукариот.

Для достижения этой цели были поставлены следующие задачи:

1. Исследовать процесс диминуции хроматина методами цитогенетики, цитофотометрии и электронной  микроскопии.

2. Изучить структуру последовательностей ДНК, элиминируемых в процессе диминуции хроматина.

3. Определить частоту аберраций хромосом у видов с близкими величинами геномов и равным диплоидным числом хромосом, но различающихся по наличию диминуции хроматина в раннем эмбриогенезе. 

4. Выявить цитогенетические характеристики ряда видов циклопов.

Научная новизна

Диминуция хроматина (ДХ) впервые обнаружена и исследована у пресноводных ракообразных Cyclops kolensis и Paracyclops affinis. Обнаружен подвид Cyclops strenuus strenuus, у которого диплоидное количество хромосом, а также картина и график диминуционных процессов  отличаются  от описанных ранее для вида Cyclops strenuus Берман. У видов Acanthocyclops viridis, Macrocyclops albidus, Еucyclops serrulatus, Termocyclops crassus, Cyclops insignis, Acanthocyclops vernalis диминуция хроматина не выявлена. Обнаружена и описана мембрана, окружающая гранулы элиминируемого хроматина. Обнаружены высокополиплоидные ядра у некоторых видов циклопов. Из гранул элиминируемого хроматина выделена ДНК и выявлены признаки упорядоченности ее структуры: мозаичная организация повторяющихся последовательностей, высокий консерватизм повторов ДНК, сохраняющихся в поколениях только в клетках зародышевой линии.  Показан высокий уровень консервативности элиминируемой в результате диминуции фракции генома. Выявлены значительные отличия в радиочувствительности до- и последиминуционных хромосом. Обнаружены внутривидовые отличия у ряда видов Cyclopoida по отдельным цитогенетическим характеристикам: диплоидное число хромосом, величина генома, наличие или отсутствие ДХ,  особенности процесса ДХ.

Научно-практическая значимость исследования заключается в возможности использования для таксономии отряда Cyclopoida таких цитогенетических характеристик как: наличие или отсутствие ДХ, количество ядерной ДНК в клетках зародышевой и соматической линии,  хронология процесса ДХ,  распределение гранул элиминируемого хроматина в анафазе диминуционного деления. Результаты и выводы, сделанные при обсуждении данного исследования, могут использоваться в курсах лекций по зоологии беспозвоночных и общей генетике.

 

Публикации. Основные  результаты  исследований,  представленные в диссертационной работе, изложены в 22 статьях, опубликованных в рецензируемых российских и зарубежных журналах, из них 17 статей опубликованы в журналах, рекомендованных ВАК.

Апробация работы.  Основные материалы диссертационной работы были доложены  на научных семинарах и на заседании Ученого совета Института биологии внутренних вод им. И.Д. Папанина РАН (1991-1995) ,  на  научных семинарах Института химической физики им. Н.Н. Семенова РАН (1991-1993), Института общей генетики им. Н.И. Вавилова РАН (1994), Института молекулярной генетики РАН (1995), Института цитологии РАН (1994); на заседании Санкт-Петербургского отделения ВОГиС, посвященном 90-летию  со  дня рождения А.А. Прокофьевой-Бельговской (30 марта 1993); на международной конференции  "Эволюционная генетика  и  адаптация",  посвященной памяти Ж. Моно (Оссуа, Франция, 25-29 сентября 1995), на III-м Съезде ВОГиС «Генетика в XXI- веке: современное состояние и перспективы развития». Москва, 6-12 июня 2004; на III Международной конференции «Вид и видообразование», Томск, Томский государственный университет, 2004; на III Международной конференции “Генетические последствия чрезвычайных радиационных ситуаций”, Россия, Дубна, 4-7 октября 2005; на IY-й Международной конференции по кариосистематике беспозвоночных животных 28–30 августа 2006, Санкт–Петербург, Россия.

Структура и объем диссертации

Диссертация состоит из введения, обзора литературы, описания материалов и методов, результатов исследования, их обсуждения, заключения, выводов и списка литературы. Текст диссертации изложен на 142 страницах машинописного текста и содержит 19 таблиц и 41 рисунок. Список литературы включает 187 источников.

Содержание работы

Введение

Во введении рассмотрена история исследования диминуции хроматина, актуальность и перспективы ее исследования. Сформулированы цели и задачи работы.

Материал и методы исследования

Виды Cyclops kolensis Lill. и Cyclops insignis Claus были пойманы в  пруду на Воробьевых горах (Москва, Россия), а также на о. Байкал. Особи Cyclops strenuus strenuus Fischer были  выловлены в пруду д. Заломы  Некоузского  р-на  Ярославской обл. Особи Acanthocyclops viridis Jurine, Macrocyclops albidus Jurine, Eucyclops macruroides Lill. и Paracyclops affinis Sars были пойманы в о. Доббентайх (Германия). Eucyclops serrulatus Fischer и Thermocyclops crassus Fischer, были пойманы в п. Борок, Вологодской обл. Особи Acanthocyclops vernalis, были собраны в водоемах штата Висконсин.

При решении поставленных задач использовались общепринятые методы цитогенетики, цитофотометрии ДНК, электронной микроскопии. Все эксперименты, связанные с очисткой и анализом нуклеиновых кислот выполняли методами, изложенными в руководстве Sambrook et al.(1989). Микродиссекцию гранул и создание библиотеки эДНК выполняли по методу, описанному в статьях (Telenius et al., 1992; Rubtzov et al., 1996). Флуоресцентную гибридизацию in situ (FISH) и детекцию сигнала (авидин-FITS/биотинилированный антиавидин/авидин-FITS) проводили по стандартным методикам (Lichter et al., 1988; Karamysheva et al., 2001). Для оценки гомологии нуклеотидных последовательностей элиминируемой ДНК применяли тест на множественное сравнивание (AliBee-MultipleAlignment: http://www.genebee.msu.su/services/malign_reduced.html).  Для анализа последовательностей нуклеотидов в ДНК использовали компьютерные программы: DNASIS (Hitachi Software Engeneering Co. LTD, 1984, 1989); DNA Strider V 1.2 (CEA); MAR-Finder (Singh et al., 1997) на сервере http://www.ncgr.org/MarFinder/; BLAST v.2.0 (Altschul et al., 1997) на сервере http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST.

Результаты исследований и их обсуждение

1. Диминуция хроматина в клетках исследованных видов Cyclopoida

1. 1. Содержание ядерной ДНК

Одним из основных результатов данной работы стало обнаружение диминуции хроматина у московской популяции C. kolensis во время 4-го деления дробления. Количество элиминируемого хроматина и характер его распределения в анафазе диминуционного деления не варьируют, эти признаки были строго постоянными у всех исследованных нами особей (более 400) на стадии 4-го деления дробления.

Цитологическое исследование зародышей байкальской популяции С. kolensis во время ранних делений показало, что процесс ДХ у них происходит также во время 4-го деления дробления. Измерение количества ядерной ДНК в додиминуционных пресоматических клетках зародыша московской и байкальской популяций C. kolensis, а также в последиминуционных клетках зародышей и в соматических клетках взрослого циклопа московской и байкальской популяций C. kolensis после ДХ показало уменьшение ядерной ДНК в клетках соматической линии в 16 раз.

Диминуция хроматина в исследованной нами российской популяции Cyclops strenuus strenuus проходит во время 5-го и 6-го делений дробления. Количество ДНК в геноме клеток  соматической  линии (1С) C. s. strenuus уменьшается в результате ДХ в 5-м делении на 40%, и в 6-м делении  на 35%  от количества ДНК в додиминуционном зародышевом геноме (Табл. 1).

Мы  провели измерение количества ДНК(1С) у эмбрионов и взрослых животных ряда видов Cyclopoida:  Acanthocyclops viridis, Macrocyclops albidus, Paracyclops affinis, Еucyclops serrulatus, Termocyclops crassus, Cyclops insignis, Acanthocyclops vernalis (Табл. 2). ДХ была выявлена только у P. affinis.

Таблица 1. Сопоставление характеристик ДХ у C. kolensis  и C. s. strenuus.

ВИД

C. kolensis

C. kolensis

C. s. strenuus

популяция

московская популяция

байкальская популяция

Число хромосом (2n)

22

22

24

Длительность интервалов

между делениями:

  • 1-2
  • 2-3
  • 4-5;
  • 5-6;
  • 6-7
  • 7-8

70-90 мин

70-90 мин

8-9 час

50-60 мин

50-60 мин

70-80 мин

70-80 мин

9-10 час

50-60 мин

50-60 мин

40-50 мин

40-50 мин

170-190 мин

80-90 мин

35-40 мин

35-40 мин

Содержание ядерной ДНК

1С (M±m) в клетках:

  • до диминуции;
  • после диминуции.

2,30±0,03 (N=70)

0,14±0,01 (N=70)

2,30±0,04 (N=93)

0,085±0,002(N=289)

0,72±0,05 (N=54)

0,18+0,02(N=68)

Доля элиминируемой ДНК

94%

96%

75%

Примечание: N – количество исследованных клеток; (18-20°С).

Таблица 2. Содержание ядерной ДНК пг (M ± m) в эмбриональных, соматических и зародышевых клетках исследованных видов.

Вид

Эмбриональ-

ные клетки  до 4-го деления (1C)

N

Взрослая особь

(1C)

N

Спермии

(1С)

N

Eucyclops serrulatus

0,55±0,02

95

0,55±0.01

65

Cyclops insignis

2,15±0,05

403

2, 10±0.04

154

Acanthocyclops viridis

2,10±0,02

67

2,15±0,04

121

Acanthocyclops vernalis

0,74±0,07

2120

0,70±0,06

525

Macrocyclops albidus

1,1± 0,03

173

1,10±0,02

78

Thermocyclops crassus

1,2±0,02

68

1,20± 0,02

103

Paracyclops affinis

0,70±0,02

58

0,40±0,02

77

Примечание: N – число исследованных клеток.

1.2. Кинетика диминуции хроматина и особенности раннего эмбрионального  развития

Первые три деления дробления зародыша C. kolensis проходят с высокой степенью синхронности с промежутками между делениями 70-90 мин. Интервал между 3-м и 4-м делениями дробления резко увеличивается до 7-8 часов, в 6  раз  превышая интервалы между первыми тремя делениями  и в 9-10 раз интервалы между последующими тремя последиминуционными делениями клеток соматической  линии  за счет  увеличения  длительности  преддиминуционной  интерфазы (Табл. 1). Диминуция хроматина (ДХ) у C. kolensis проходит во время 4-го деления дробления в шести клетках из восьми и характеризуется тем, что в конце значительно удлиненной интерфазы появляются мелкие Фельген-положительные гранулы. В седьмой клетке ДХ проходит с некоторым опозданием, когда вышеуказанные шесть клеток уже входят в 5-е деление. В восьмой клетке диминуционные процессы не происходят вовсе. Описанная асинхронность делений дроблений у зародышей C. kolensis после 3-го деления имеет закономерный характер и наблюдалась у всех зародышей (более 400), изученных на этой стадии. По окончании диминуционного деления в шести клетках зародыша в интерфазном ядре 7-й клетки также появляются гранулы, затем эта клетка проходит диминуционное деление. Клетка зародышевого пути первой из восьми клеток зародыша C. kolensis вступает в 4-е деление и делится без редукции генома.

Подсчет гранул элиминируемого хроматина, появляющихся в конце преддиминуционной интерфазы, показал, что по мере прохождения диминуционного деления их число уменьшается (500-600 в интерфазе,  150 в метафазе, 15-40 в телофазе), по-видимому, за счет слияния, поскольку размеры  гранул при этом увеличиваются с 0,5  до 3-4 мкм.  Описываемые гранулы четко окрашиваются как по Фельгену, так и ацетоорсеином.

Мы не обнаружили гранулы элиминируемого хроматина в интерфазных ядрах во время 4-го деления дробления, при этом количество ДНК в этих ядрах было равно 4С, следовательно, процесс вырезания элиминируемого хроматина из додиминуционных хромосом пресоматических клеток C. kolensis, и формирование гранул элиминируемого хроматина происходит после репликации ДНК.

Во всех клетках соматической линии всех изученных нами зародышей С. kolensis мы наблюдали одинаковую картину распределения гранул элиминируемого хроматина в анафазе диминуционного деления: большая часть гранул перемещается к полюсам веретена деления раньше хромосом, затем расходятся хромосомы, часть гранул остается в области «экватора» веретена деления. Материал гранул не подвергается декомпактизации во время телофазы 4-го деления дробления.  По окончании 4-го деления  гранулы  элиминируемого хроматина перемещаются в цитоплазму. По окончании 6–го деления дробления гранулы с  эДНК быстро исчезают.

Цитологическое исследование зародышей байкальской популяции C. kolensis во время ранних делений дробления показало, что основные признаки, характеризующие процесс ДХ в этой популяции C. kolensis, полностью совпадают с таковыми у московской популяции (Табл.1).

Диминуция хроматина у исследованного нами подвида C. strenuus strenuus проходит в два этапа: в 5-м и 6-м делениях дробления. До 4-го деления клетки зародыша делятся синхронно через каждые 45-50 мин. После 4-го деления дробления  клетки  зародыша начинают делиться  асинхронно.  Перед  5-м и 6-м делениями зародышевых соматических клеток продолжительность  интерфазы возрастает, что приводит к увеличению интервалов между 4-м и 5-м делениями в 4 раза, а между 5-м и 6-м в 2 раза (Табл.1). В то время как 14 клеток соматической линии зародышей C. s. strenuus,  вступающие в 5-е деление дробления, находятся на стадии преддиминуционной интерфазы, две клетки делятся путем обычного митоза, не сопровождающегося потерей хроматинового материала.  Одна из них - клетка зародышевого пути, в которой ДХ не наблюдается.  Вторая клетка после деления дает клетку зародышевого пути и клетку соматической линии; последняя в дальнейшем претерпевает два последовательных диминуционных деления. Следовательно, ДХ у C. s. strenuus проходит последовательно во время 5–го и 6–го делений дробления, в результате чего в зародыше циклопа оказывается 58 клеток соматической линии и 6 клеток зародышевого пути. В интерфазных  ядрах зародышевых соматических клеток перед диминуционными делениями  появляются мелкие  гранулы в количестве 60-80, которые хорошо окрашиваются как по Фельгену, так и ацетоорсеином. В анафазе 5-го и  6-го  делений  эти гранулы  сосредоточены на «экваторе» клетки,  однако из-за ассоциации части гранул трудно достоверно определить их количество.  В телофазных ядрах этих же клеток гранулы легко подсчитать,  их число колеблется от 15  до 20. 

Асинхронность делений  дробления, наблюдаемая  при развитии всех изученных нами зародышей C. kolensis  и  состоящая в феномене четко  фиксированного  во  времени сдвига начала диминуционного деления одной из пресоматических клеток и задержки деления клетки  зародышевого  пути,  а также двухэтапность  диминуционного  процесса  у С. s. strenuus,  по-видимому,  жестко запрограммирована в онтогенезе  и связана со спецификой механизма регуляции прохождения ДХ у пресоматических клеток развивающихся зародышей. Очевидно, что резкое увеличение длительности интерфазы диминуционного деления происходит вследствие не исследованных пока процессов, связанных с вырезанием элиминируемого хроматина.

Гранулы элиминируемого хроматина, появляющиеся вследствие процесса ДХ у циклопов, по крайне мере у изученных нами C. kolensis и C. s. strenuus,  являются особыми  внутриклеточными структурами, существующими относительно непродолжительный отрезок времени в течение двух последующих делений после ДХ. Характерная особенность гранул элиминируемого хроматина – наличие плотной однослойной лишенной пор мембраны, что резко отличает их и от микроядер, которые частично окружены ядерной мембраной, обладающей порами (Gregoire et al., 1983), и от таких клеточных органелл как ядро или митохондрии, имеющие двухслойную мембрану с  порами (Бродский, 1965), через которые осуществляются обменные процессы. Хроматин, заключенный в гранулы, благодаря наличию лишенной пор мембраны, по-видимому, надежно изолирован от внутриклеточной среды и не вовлекается в обменные процессы.

1.3. Структура интерфазного ядра

Наши исследования в световом микроскопе показали, что интерфазные ядра эмбриональных клеток С. kolensis во время первых  4-х делений имеют относительно большие размеры и слабую гомогенную окраску; гетерохроматинизированные структуры и хромоцентры отсутствуют, что проявляется на препаратах, окрашенных как по методу Фельгена, так и ацетоорсеином. При последующих делениях, начиная с 16 бластомеров, структура интерфазных ядер у C. kolensis изменяется: их объем редуцируется, а в дальнейшем гетерохроматиновые сегменты не декомпактизуются в течение интерфазы, появляются хромоцентры.

Препараты  додиминуционных  зародышей С. kolensis,  изученных в трансмиссионном электронном микроскопе, показали, что хроматин в ядрах этих клеток высокодиспергирован по всему объему ядра в виде тонких фибрилл, толщиной 10, 25–30, и 80–100 нм.  Изучение в электронном микроскопе интерфазных ядер клеток соматической линии зародышей С. kolensis после ДХ показало, что они имеют структуру, свойственную большинству эукариотических клеток: диспергированный во всем объеме хроматин перемежается с участками высококонденсированного хроматина, часть хромоцентров тесно примыкает к ядерной мембране. Подобная картина обычна при описании интерфазного ядра эукариотической клетки, но не зародышевой, а дифференцированной (Ченцов, Поляков, 1974). Таким образом, диминуционные  процессы  у зародышей С. kolensis,  по-видимому,  определяют этап, после которого ядра клеток соматической линии  приобретают  структуру, свойственную дифференцированным клеткам взрослого организма. Поэтому мы считаем, что ДХ у Cyclopoida  представляет собой наиболее четкий сигнал разделения клеток восьмиклеточного эмбриона на соматические, которые в будущем дадут все типы тканевых клеток, и зародышевые, предназначенные исключительно для связи поколений.

1.4. Митотические хромосомы

1.4.1. Хромосомные числа и размеры хромосом.

Исследование, проведенное при помощи светового микроскопа, позволило установить, что  кариотип  C. kolensis включает 2n=22. Число хромосом не  изменяется после ДХ, хотя после 4-го деления дробления в 7 из 8 клеток зародыша длина анафазных хромосом уменьшается с 11-20 до 2,6-7 мкм, а диаметр с 1 до 0,5 мкм.

Диплоидное число хромосом у C. s. strenuus равно 24 и после ДХ  также не изменяется.  Длина анафазных хромосом при этом уменьшается примерно в 2 раза:  с 4,5-12,5 мк до 2,8-5,4 мк. 

Мы впервые определили число хромосом у Termocyclops crassus (n=7) при изучении профазы мейоза у самок. Хиазмы при этом обнаружены не были.  Нами было выявлено диплоидное число хромосом, 2n=12, у популяции Acanthocyclops viridis из Германии.  Гаплоидное число хромосом n=11 было нами определено при изучении мейоза у самок российской популяции Cyclops insignis на стадии метафазы-II.

1.4.2. Особенности структурной организации митотических хромосом 

Сравнительное изучение в ТЭМ додиминуционных хромосом, последиминуционных хромосом и хромосом клеток зародышевого пути C. kolensis показало, что плотность хроматина в додиминуционных хромосомах значительно меньше, чем в хромосомах клеток зародышевого пути и в хромосомах соматических клеток после ДХ. Этим фактом можно объяснить разницу в диаметре хромосом клеток зародышевого пути (0.5–0.7 мкм) и додиминуционных хромосом (0.8–1.0 мкм). Диаметр хромосом клеток соматической линии после ДХ при измерении в ТЭМ оказался равен 0.2–0.3 мкм. Так как фиксация в глутаровом альдегиде и четырехокиси осмия позволяет лучше сохранить структуры клетки, чем фиксация в уксусной кислоте и спирте (Бронштейн и др., 1965), то эти измерения можно считать более точными, чем сделанные нами при помощи светового микроскопа.

Интересным и крайне необычным фенотипическим признаком обладают митотические хромосомы C. kolensis на стадии 3-го деления дробления: без какой-либо предфиксационной обработки при окраске ацетоорсеином в них четко выявляется чередование темных и светлых полос,  весьма сходное с G- или R- (но не С)- окраской в хромосомах млекопитающих. Количество таких полос в отдельных хромосомах колеблется от 20 до 40. Необходимо заметить, что в митотических хромосомах клеток зародыша C.kolensis на стадии 1-го и 2-го делений дробления, а также в последиминуционных хромосом клеток соматической линии такой четкой  исчерченности  не было обнаружено.

Мы предполагаем, что участки компактизованного хроматина в хромосомах зародышей C. kolensis,  которые придают им G-подобную сегментацию во время 3-го деления дробления, представляют собой каким-то образом маркированную ДНК, предназначенную в последующем диминуционном делении для эксцизии и элиминации. Это предположение подтверждает и тот факт, что диплоидное число хромосом у исследованных нами видов в результате ДХ не изменяется, хотя при этом значительно редуцируется длина хромосом. Следовательно, районы хромосомных разрывов, по которым идет вырезание элиминируемого хроматина во время ДХ, должны быть равномерно распределены по додиминуционным хромосомам этих видов.

1.5. Полиплоидные клетки

В теле взрослых особей C. kolensis мы насчитали 18-20 тыс. соматических клеток, среди которых обнаружили 80 высокополиплоидных клеток с содержанием ДНК в каждой из них  равным  примерно 1700 последиминуционным гаплоидным геномам (1700С). В теле взрослых особей C. s. strenuus мы обнаружили 50  высокополиплоидных клеток с содержанием ДНК в каждой из них около 340С, т.е. равным 340 последиминуционным гаплоидным геномам, а у особей C. insignis 20 высокополиплоидных клеток с содержанием ДНК в каждой из них 30-45С. Нами были обнаружены зародыши изолиний CD60 и CD69 A. vernalis, все клетки которых были полиплоидными. Указанные зародыши обладали разной степенью плоидности: 32, 40, 56 и 60 хромосом. Диплоидное число у этих изолиний обычно варьировало и составляло 2n=8,9 или 10. В теле одной из взрослых самок изолинии S.142 A. vernalis были обнаружены полиплоидные клетки на стадии метафазы с 36-40 хромосомами (при n=4).

2. Структура последовательностей ДНК, элиминируемых в процессе диминуции хроматина у особей московской популяции C. kolensis.

Из элиминируемой ДНК были клонированы и секвенированы 90 фрагментов, длина которых варьировала от 129 до 650 п.н. (средняя длина составила 351 п.н., их общая длина – 31564 п.н.). Данные клоны были названы CkD (Cyclops kolensis Drop). При анализе суммарного нуклеотидного состава мы выявили преобладание АТ-пар (61.1%) по сравнению с GC-парами (38.9%). Последовательность нуклеотидов каждого фрагмента была переведена в аминокислотную последовательность во всех шести рамках считывания. Сравнение их с соответствующими банками данных существенной гомологии не выявило. Это результат вполне ожидаемый, он свидетельствует о том, что в той минорной части эДНК, которую мы изучали, структурных генов, по-видимому, нет.

Несмотря на то, что клонированная и секвенированная ДНК, выделенная из гранул элиминируемого хроматина, составляет лишь небольшую часть от всего объема элиминируемой ДНК, выделенные последовательности представлены во всех хромосомах клеток зародышевой линии, как свидетельствуют результаты гибридизации in situ.

Было обнаружено, что фрагменты эДНК C. kolensis насыщены довольно короткими повторами, от 7 до 34 п.н. Кроме праймерных последовательностей в составе каждого фрагмента обнаружены от 1 до 3 семейств коротких повторов, причем некоторые семейства имеют до 13 копий. Так во фрагменте 94 (470 п.н.) присутствует наибольшее число повторов – 17 (без учета праймерных повторов); они состоят из 3 семейств: 7 п.н. – 2 копии; 8 п.н. – 2 копии: прямая и инвертированная; 15 п.н. – 13 копий, среди них 1  инвертированная. Консенсусная последовательность этого повтора: -GGAACAAGAAAACAA-. Средняя степень гомологии между членами этого семейства равна 89%; имеются копии со 100% гомологией по отношению к консенсусной последовательности. Промежутки между повторами (спейсеры) варьируют по длине от 1 до 52 п.н. Фрагмент 55 (537 п.н.) содержит 7 повторов, принадлежащих 3 семействам (7, 8, 14 п.н.). Особенностью этого фрагмента является полная (100%) гомология составляющих его повторов. Длина спейсеров колеблется от 13 до 128 п.н. Фрагмент 133 (478 п.н.) содержит наибольшее число повторов одного семейства. Последовательность 5′-ACGGAAGAAGA-3′ длиной 11 п.н. повторена 11 раз, причем одна копия инвертирована по отношению к остальным. Гомология с консенсусной последовательностью составляет от 90 до 100%. Длина спейсеров в данном фрагменте составляет от 2 до 48 п.н. Фрагмент 6970 (331 п.н.) выделяется тем, что включает в себя 7 копий одного из наиболее протяженных повторов – 29 п.н. Данная последовательность отличается высокой степенью гомологии: в среднем – 94%, 3 повтора на 100% гомологичны консенсусу. Длина спейсеров в этом фрагменте составляет от 2 до 16 п.н.

Остальные фрагменты качественно не отличаются от описанных выше: они также состоят из чередующихся повторов и спейсеров, причем размеры тех и других варьируют весьма значительно. Во многих фрагментах встречаются повторы с высокой, нередко 100% гомологией.        

Используя праймеры к повтору CkD55, который содержится в эДНК московской популяции C. kolensis,  мы решили выяснить: присутствует ли данный повтор в геноме байкальской популяции C. kolensis, и удаляется ли он полностью во время прохождения диминуции в клетках циклопов как московской, так и байкальской популяций.  Нами были получены консенсусные последовательности ДНК, присутствующие в додиминуционном геноме C. kolensis из московской (glCkM) и байкальской (glCkB) популяций (Рис.1).

Сравнительный анализ данных консенсусов показал, что, во-первых, данный повтор присутствует как в геноме московской, так и в геноме байкальской популяции C. kolensis и является консервативным (97-98% гомологии), и, во-вторых, данный повтор не полностью элиминируется во время диминуции хроматина и присутствует в геноме соматических клеток обеих популяций, причем гомология нуклеотидной последовательности для московской популяции до и после диминуции составляет 100% , а для байкальской популяции 99,1%. Это означает, что, несмотря на огромное число поколений, прошедших между разделением C. kolensis на московскую и байкальскую популяции (не менее 25 млн.), данные последовательности успешно противостояли факторам естественного мутационного процесса.

CkD55 GGAGGAGGTTGAGGTTGAGGATTGACCAGAAGGTGTTGGAAGTGTTCTTGTAGAGCAGGATAGTGTT

glCkM GGAGGAGGTTGAGGTTGAGGATTGACCAGAAGGTGTTGGAAATGTTCTTGTAGAGCAGGGATAGTTT

glCkB GGAGGAGGTTGAGGTTGAGGATTGACCAGAAGGTGTTGGAAGTGTTCTTGTAAAGCAGGATAGTGTT

CkD55 TTAGTTCAGTAGGACACGAGTACACTAGGATGTATGAACAGGGATCAAATTCCACATAGGGGTCACC

glCkM TGAGTTCAGTAGGACACGAGTACACTAGGATGTATGAACAGGGATCAAATTCCACATAGGGGTCACC

glCkB TGAGTTCAGTAGGACATGAGTACACTAAGATGTAGGAACAGGGATCAAATTCCACATAGGGGTCACC

CkD55 TGTTAACACTATGTTTCTTTCTTGAAAGGATAAGTTTTCCAAAAATTTTCTTCTGTTATGGATCCAA

glCkM TGTTAACACTATGTTTCTTTCTTGAAAGGATAAGCTTTCCAAAAATTTTCTTCTGTTATGGATCCAA

glCkB TGTTAACACAATGTTTCTTTCTTGGAAGGATAAGCTTTCTAAAAATTTTCTTCTGTTGTGGATCCAA

CkD55 GCTGGCTGTTTAACAGTTGGTAATTTGTGTGGAAGGCCAAAGTCGTCATATTCGTACCTTGGTCCAA

glCkM GCTGGCTGTTTAACATTTGGTAATTTGTGTGGAAGGCCAAAGTCGTCACATTCGTACCTTGGTCCAA

glCkB GCTGGTTGTTTAACATTTGGCAATTTGTGTGGAAGGCCAAAGTCGTCACATTCGTACCTTGGTCCAA

CkD55 TTTGATTTGGTTGCCAGCCTCTTTCGATGAGTGTTGTTGCCCAGATATTTGTTTCTTTTGCCACACT

glCkM TTTGATTTGGTTGCCAGCCTCTTTCGATGAGTGTTGTTGCCCAGAGTTTTGTTTCTTTTGCCACACT

glCkB TTTGATTTGGTTGCCAGCCTCTTTCGATGAGTGTTGTTGCCCAGAGTTTTGTTTCTTTTGCCACACT

CkD55 TTCTTGTAGAGATGCCCACTGTTTGGCATTCAACTTGAGGATGGCCTCTCTACTCCTTTTTGCTTTT

glCkM TTCTTGTAGAGATGCCCACTGTTTGGCATTCAACTTGAGAATGGCCTCTCTACTCCTTTTTGCTTTT

glCkB TTCTTGCAGAGATGCCCACTGTTTGGCATTCAACTTGAGAATGGCCTCTCTACTCCTTTTTGCTTTT

CkD55 TGAAATCGAGTTTTGAGAGCATCCAAACCCGC

glCkM TGAAATCGAGTTTTGAGAGCATCCAAACCCGC

glCkB TGAAATCGAGTTTTGAGAGCATCCAAACCCGC

Рис. 1. Сравнительный анализ консенсусов последовательностей ДНК, присутствующих в додиминуционном геноме C. kolensis из московской (glCkM)и байкальской (glCkB) популяций, с фрагментом эДНК CkD55.

Серым цветом указаны области гомологии между тремя последовательностями. Жирным шрифтом выделены отличающиеся нуклеотиды.

Следовательно, «избыточная» для соматических клеток ДНК, возможно, служит фактором генетической изоляции.

Можно также предположить, что столь жесткое сохранение некодирующих последовательностей обусловлено их ролью в организации ядер зародышевой линии эукариотических клеток.

3. Особенности радиационного мутагенеза у Cyclops kolensis и Cyclops insignis.

Уровень спонтанного мутагенеза у C. kolensis практически одинаково низкий как до ДХ, так и после ДХ и достоверно не отличается от такового у С. insignis (Табл. 3, 4). Выход аберраций хромосом (АХ) у зародышей, облученных на додиминуционых этапах развития, растет с увеличением дозы при 90-минутном интервале между облучением и фиксацией (Табл. 3). При изучении препаратов зародышей C. kolensis, облученных во время последиминуционных  делений дробления, обращает на себя внимание резкое снижение числа АХ, приходящихся на 1 клетку, по сравнению с зародышами, которые были облучены на додиминуционных этапах развития (Табл. 4). Анализ зародышей C. kolensis, облученных на додиминуционных этапах развития дозой 5 Гр, показал появление более 5 АХ в каждой делящейся клетке: мостов от 1 до 5, фрагментов от 1 до 12 (Табл. 3).

Таблица 3. Частота аберраций хромосом (АХ) у зародышей C. kolensis,

облученных до и после ДХ, в зависимости от дозы –излучения (фиксация через 90 мин. после облучения) (1С =2.3 пг до ДХ, 1С == 0.14 пг после ДХ).

Стадии развития, на которых проводили облучение

доза (Гр)

2–3 деление  (до ДХ)

5–6 деление (после ДХ)

9–10 деление (после ДХ)

n

N

n

АХ

N

n

АХ

N

Кон-троль

186

2

0.010±0.003

209

1

0.005±0.002

196

2

0.01±0.004

1

71

7

0.1±0.08

264

4

0.015±0.006

198

10

0.05±0.02

2

99

169

1.7±0.05**

91

6

0.07±0.03*

3

114

223

1.95±0.1**

124

5

0.04±0.02

136

7

0.05±0.017

5

116

619

5.3±0.8**

94

9

0.1±0.03**

72

11

0.15±0.06*

Примечание: n – количество исследованных клеток; N – число АХ на клетку; АХ – количество обнаруженных аберраций хромосом. Достоверные отличия от контроля: * p< – 0,05;  ** p< – 0,001.

Различия между частотами АХ в клетках додиминуционных зародышей C. kolensis при различных интервалах (от 60 до 180 мин) между облучением и фиксацией незначительны и статистически недостоверны. Также статистически недостоверны различия между частотами АХ в  клетках последиминуционных зародышей C. kolensis при различных интервалах между облучением и фиксацией (от 60 до 180 мин). Если бы клетки додиминуционных зародышей C. kolensis при интервале 120 и 180 минут между облучением и фиксацией не входили в следующий цикл деления вследствие повреждения -излучением (как это должно было бы быть, учитывая, что интервалы между делениями в клетках у додиминуционных зародышей C. kolensis равны 70-90 минут), то частота АХ при вышеуказанных интервалах была бы значительно выше, чем при интервале между облучением и фиксацией в 60 мин. Это позволяет предположить, что в облученных додиминуционных зародышах процесс цитокинеза замедляется.

Облучение зародышей C. insignis во время 2-3 делений дробления, которые соответствуют додиминуционным делениям дробления у C. kolensis, и во время 7-8 делений дробления, соответствующих последиминуционным делениям дробления у C. kolensis, показало близкие частоты АХ (Табл. 4). Эти частоты на порядок ниже, чем у додиминуционных зародышей C. kolensis, но в 3-4 раза выше, чем у последиминуционных зародышей C. kolensis. 

Таблица 4. Частота АХ у зародышей C. insignis, облученных на ранних стадиях

развития. (2с = 4.3 пг; ДХ у российской популяции C. insignis отсутствует)

1–2–3 деление

7–8 деление

n

АХ

N

n

АХ

N

Кон-троль

156

1

0.008 ± 0.003

178

2

0.01 ± 0.005

2

256

90

0.35 ± 0.1*

320

86

0.27 ± 0.08*

5

221

97

0.44 ± 0.12*

280

126

0.45 ± 0.09*

Примечание: n – количество исследованных клеток; N – число АХ на клетку; АХ – количество обнаруженных аберраций хромосом. Достоверные отличия от контроля: * p< – 0,05. В каждом варианте опыта использовали зародыши не менее чем от 5 особей.

Сравнение радиочувствительности хромосом в клетках с различной величиной генома обычно проводилось между организмами, принадлежащими к видам из одной или разных таксономических групп. Уникальную возможность исследования радиочувствительности хромосом в клетках организма, принадлежащего к одному и тому же виду, но с различной величиной генома исследователи получают только при работе с видами, у которых в ходе онтогенеза проходит диминуция хроматина (ДХ). В этом отношении особый интерес для цитогенетиков представляет вид C. kolensis, у которого после исключения 94% ДНК из хромосом клеток соматической линии во время 4-го деления дробления сохраняется диплоидное число хромосом, что позволяет производить корректное сравнение частот АХ.

Полученные в настоящей работе результаты во многом представляются необычными. Число хромосомных аберраций во время последиминуционных делений дробления у C. kolensis в 30-50 раз меньше, чем во время додиминуционных делений дробления. Это позволяет предположить наличие в клетках C. kolensis мощной системы противомутагенной защиты, обеспечивающей высокую точность процесса ДХ. Возможно, что основной причиной здесь является исключительно эффективная работа ферментов репарации, цель которой состоит в безошибочном лигировании фрагментов хромосом после вырезания элиминируемого хроматина в ходе ДХ. Поэтому и нужна дополнительная система антимутагенной защиты, направленная в первую очередь против свободных радикалов и химических мутагенов.

Во-вторых, полученные нами результаты резкого снижения числа АХ, приходящихся на одну клетку, после диминуции по сравнению с зародышами, которые были облучены на додиминуционных этапах развития,  не укладываются в рамки классической теории индукции АХ. Исходя из этой гипотезы частота АХ в клетках зародышей у  С. kolensis  до ДХ и у  C. insignis должна быть примерно одинаковой по той причине, что одна и та же доза излучения должна индуцировать сходную частоту АХ в равных по величине геномах.  Однако частоты АХ в зародышевых  клетках  C. insignis и в клетках C. kolensis до ДХ различаются в 11 раз. Также, при редукции додиминуционного генома  С. kolensis в 15 раз, частота АХ должна уменьшаться соответственно в 15 раз или близко к этой величине. Однако частоты АХ у зародышевых клеток C. kolensis до и после ДХ различаются в 50 раз.  Мы предполагаем, что участки хромосом, в которых происходит вырезание элиминируемого хроматина, связаны с ядерным матриксом. Согласно  представлениям ряда исследователей (Заичкина и др., 1991; Акифьев и др., 1995),  около 50% аберраций хромосом формируется в минорной части генома, связанной с ядерным  матриксом.  Если предположить разницу в  числе точек контакта ДНК с ядерным матриксом в ядрах  зародышевых клеток С. insignis и C. kolensis в  11 раз, то частота АХ должна различаться также в 11 раз, что и показали наши эксперименты. Можно также предположить, что после диминуции хроматина происходит уменьшение точек контакта ядерной ДНК пресоматических клеток C. kolensis с ядерным матриксом в 50 раз,  в результате чего частота АХ редуцируется во столько же раз. 

       

4. Цитогенетическое исследование популяций видов Cyclopoida

Исследование видов Cyclopoida позволило нам обнаружить масштабную перестройку генома у некоторых видов этого семейства, при отсутствии видимых морфологических изменений. Проведя исследование российских популяций  видов Cyclopoidae: С. kolensis, C. s. strenuus, C. insignis мы обратили внимание на различия между российскими и германскими популяциями этих видов по ряду цитогенетических признаков и хронологии диминуционных процессов. В нашем исследовании установлено, что ДХ у С. kolensis происходит во время  4-го  деления  дробления, а у C. s. strenuus в 5 и 6-м делениях  дробления. Согласно данным Берман ДХ у C. s. strenuus происходит в 4-м делении дробления  (Beermann,1977), а ДХ у С. kolensis проходит во время 5-го деления дробления (Einsle, 1993).  У российской популяции C. s. strenuus во время ДХ элиминируется 75% ДНК, у C. s. strenuus из Германии  56%; гранулы элиминируемого хроматина у российской популяции C. s. strenuus сосредоточены на "экваторе" клетки, а не на полюсах как у популяции C. s. strenuus из Германии.  Кроме  этого  диплоидное  число  хромосом  у C. strenuus в  нашем  исследовании равно 24.  Согласно данным Берман (Beermann,  1977) у C. s. strenuus 2n=22. По  данным Айнсле (Einsle,1993) ДХ у C. kolensis наблюдается во время 5-го деления дробления, а гранулы элиминируемого хроматина в анафазе диминуционного деления аккумулируются в области экватора. ДХ у российской популяции C. kolensis, согласно нашим исследованиям, проходит во время 4-го деления дробления, а гранулы элиминируемого хроматина аккумулируются в основном на полюсах веретена деления и малое их количество на «экваторе» клеточного веретена деления. Цитогенетические различия наблюдаются и между российской и германской популяциями C. insignis. Если у российской популяции C. insignis, согласно нашим данным, ДХ отсутствует, то у германской популяции C. insignis, исходя из данных Айнсле (Einsle, 1993) ДХ происходит в 5-м делении дробления.

Как было показано в наших исследованиях, такие признаки как наличие или отсутствие ДХ в онтогенезе, различия в диплоидном числе хромосом у исследованных  видов  циклопов, различия в ряде характеристик процесса ДХ (хронология ДХ, распределение гранул элиминируемого хроматина в анафазе диминуционного деления и другие особенности ДХ), наследуются и жестко детерминированы в онтогенезе. Если у какого-либо вида в цикле развития имеется ДХ, то она без каких-либо заметных популяционных вариаций повторяется в каждом репродуктивном цикле. В таком случае диминуцию следует рассматривать как жестко контролируемый инвариантный мономорфный признак (Алтухов, Абрамова, 2000). По нашим представлениям, все перечисленные выше цитогенетические признаки являются видоспецифическими.

Масштабная перестройка генома у видов Cyclopoida при отсутствии видимых морфологических изменений, как мы видим при сравнении величин геномов вьетнамской и российской популяций Termocyclops crassus, возможна и без появления ДХ.  Количество ядерной ДНК в клетках особей российской популяции T. сrassus (согласно нашим данным, 1С=1,2пг) почти втрое превышает подобную величину у особей вьетнамской популяция T. crassus, 1С=0,42пг, по данным Г. Вингард и Э. Раш (Wyngaard and Rasch, 2000). Мы предполагаем, что вьетнамская и российская популяции T. crassus также являются морфологически сходными криптическими видами, видовые различия между которыми обусловлены редукцией генома. В этом случае механизм видообразования, возможно, связан с изменением структуры интерфазного ядра, которое не может не произойти вследствие изменения размера генома. Это предположение основано на гипотезе Стегния (1993), согласно которой изменения в архитектонике интерфазного ядра могут играть важную роль в видообразовании и могут проходить при разделении криптических видов, обладающих сходной морфологией, но различающихся между собой по цитогенетическим характеристикам.

В.И.Монченко (2003) отмечает малую роль макроморфологических признаков в видовом обособлении циклопообразных, приводящем к появлению криптических видов. Мы предлагаем рассматривать процесс ДХ как механизм, способный привести к появлению криптических видов у Cyclopoida, которые могут отличаться наличием или отсутствием ДХ, особенностями процесса ДХ, а также другими цитогенетическими характеристиками. Криптическими видами, по нашему предположению, являются российская популяция C. insignis, особи которой не имеют ДХ в онтогенезе и германская популяция C. insignis, обладающая ДХ; российская популяция C. kolensis из Марьинского пруда (Москва), исследованная нами, и фенотипически сходная с ней популяция C. kolensis из Германии, выловленная и изученная У. Айнсле (1993); российская популяция C. s. strenuus, исследованная нами, и фенотипически сходная с ней популяция C. s. strenuus из Германии, изученная C. Берман (1977);  популяция A. vernalis, исследованная А.П. Акифьевым (1974) и группа криптических видов, предположительно скрывающихся под видовым названием A. vernalis из штата Висконсин, исследованных автором диссертации с коллегами из США. Мы предполагаем также, что московская и байкальская популяции С. kolensis представляют собой один вид, учитывая полное сходство их цитогенетических характеристик. 

Согласно нашим исследованиям (Табл.2) ДХ происходит  у видов с относительно малым геномом, как, например, у Paracyclops affinis,  и в тоже время ДХ не наблюдается у видов с относительно большими геномами: Cyclops insignis, Acanthocyclops viridis и др. Следовательно, причина появления ДХ в онтогенезе, по-видимому, не связана с необходимостью удаления из генома соматических клеток избыточной ДНК, накопившейся вследствие экспансии генома. При этом надо заметить, что, несмотря на масштабную реорганизацию генома при появлении в онтогенезе ДХ, фенотип, свойственный данному виду, практически не изменяется, что видно при сравнении C. insignis из Марьинского пруда (Москва), исследованного нами, и фенотипически сходного с ним C. insignis из Боденского озера, изученного У. Айнсле (Einsle, 1993) (Табл.5).

Следовательно, огромные преобразования генома в ходе ДХ, равно как и само наличие или отсутствие ДХ в онтогенезе могут никак не сказаться на фенотипе организма. Это означает, что развитие циклопов происходит практически одинаково, как на основе постоянного, так и реорганизованного во время диминуции генома. Мы имеем дело с тем же эффектом, что и преобразования генома в ходе эволюции. Таким образом, исследование ДХ показывает независимость эволюции генома и фенотипа.

 

Таблица 5. Цитогенетические характеристики и особенности раннего эмбриогенеза у  некоторых видов Cyclopoida

Характерис-

тики

C. kolensis

C. strenuus strenuus

C. insignis

A. vernalis

Россия

Герма-ния*

Россия

Герма-ния **

Рос-сия

Герма-ния *

США

Рос-сия

Число хромосом (n)

11

11

12

11

11

-

3-5

-

Наличие ДХ

есть

есть

есть

есть

нет

есть

нет

есть

Количество ядерной ДНК (пг) в клетке (1С): 

до ДХ

после ДХ

2,3

0,14

Нет дан-

ных

0,72

0,18

2,2

0,9

2,1

Нет данных

0,74

Нет дан-ных

Локализация элиминируе-мой ДНК

«полю-

са» клетки

«эква-

тор»

клетки

«эква-тор»

клетки

«полю-са»

клетки

-

«эква-тор»

клетки

-

Гономерия

нет

нет

нет

есть

нет

Нет данных

нет

Нет дан-ных

Эмбриональ-ные деления, во время которых происходит ДХ

4-е

5-е

5-е и

6-е

4-е

-

  5-е

-

  4-е

Длитель-

ность интерфазы перед ДХ

7-9 часов

перед 4-м деле-нием

-

3 часа перед 5-м дел,

1,5 часа перед 6-м деле-нием

8-9 часов перед

4-м деле-нием

  -

-

-

-

Примечание: *- U. Einsle, 1993;  **-S. Beermann, 1977.

  В своих исследованиях мы придерживались наиболее известной и общепринятой концепции вида (Dobzhansky, 1937; Mayr, 1963; Тимофеев–Ресовский, 1977; Wiley, 1978), в которой главным критерием,  разделяющим виды, в том числе и виды–двойники, служит репродуктивная изоляция. Окончательное заключение о видовом статусе исследованных популяций видов Cyclopoida можно сделать только после экспериментов по гибридизации. Подобный эксперимент мы осуществили на примере вида Acanthocyclops vernalis. 

4.а.  Исследование генетической структуры вида Acanthocyclops vernalis

Мы остановили свой выбор на виде Acanthocyclops vernalis, основываясь на ряде причин. Во-первых, у A.  vernalis была обнаружена диминуция хроматина (Акифьев, 1974; Standiford, 1989).  Во-вторых, изучение вида  A. vernalis методами цитогенетики показало широкий разброс данных по числу хромосом  от 2n=10 (Braun, 1909; Rusch, 1960) до 2n=4 (Chinnappa 1980), и до настоящего времени не было предпринято попыток определить статус разных хромосомных форм вида A. vernalis.

Нами была поставлена задача: собрать из разных водоемов особей этого вида, получить изолинии от каждой из полученных особей, определить у них диплоидное число хромосом, определить степень возможной репродуктивной изоляции разных хромосомных форм и географически изолированных популяций путем их скрещивания, а также определить количество ядерной ДНК у особей, представляющих выделенные нами изолинии. Самки циклопов с яйцевыми мешками (я/м) были получены из 4-х водоемов штата Висконсин (США), находящихся друг от друга на расстоянии от 150 метров до 300 км. Мы изолировали каждую из 150 полученных самок  с  я/м в отдельный стакан, получили потомство от каждой самки и определили количество хромосом у эмбрионов каждой самки. Были исследованы родительские изолинии и их первое поколение, а также  20-е поколение двух родительских линий (F20 S102, F20 S115). Гибридные изолинии были исследованы в 3-м и 20-м поколении: F3 (S102XS115), F20(S102XS115). Нами была обнаружена широкая вариабельность диплоидного числа хромосом, которое варьировало от 6 до 10. Данные, полученные при исследовании хромосом в мейозе, подтвердили результаты исследований эмбриональных митозов. Изученные изолинии разделились на популяции с постоянным диплоидным числом хромосом и линии,  которые были полиморфны по диплоидному числу хромосом (Табл. 6).

Несмотря на различия в диплоидном числе хромосом мы не нашли статистически значимых различий в содержании ядерной ДНК (2С) соматических клеток взрослых особей исследованных 9 изолиний (Табл. 7).

Для дальнейшей работы мы выделили 9 изолиний A. vernalis, которые отличались либо местообитанием, либо диплоидным числом хромосом. Была принята рабочая гипотеза, согласно которой выделенные нами изолинии представляют различные популяции A. vernalis, существующие в природе. Морфологический анализ 120 взрослых самок, проведенный нами,  обнаружил, что признаки, использовавшиеся ранее для разделения видов в группе A. vernalis-robustus, ненадежны, потому что при проверке обнаруживают фенотипическую пластичность и зависят от условий среды (температура и питание). В относительно  малой степени вариации признаков зависят от ошибок измерения и ассиметрии.

Таблица 6. Хромосомные числа для исходных родительских и гибридных изолиний самок A. vernalis.

Лабораторная изолиния самок

Диплоидное число хромосом (2n)

Число исследован-ных клеток

Гаплоид-ное число хромосом

(n)

Число исследованных клеток

Число исследован-ных особей (m+n)

Cd60

Cd61

Cd69

Tre1

S102

S115

S130

S142

Pa26

F3 S102XS115)

F20(S102XS115)

F20 S102

F20 S115

8;  9;  10

8;  9;  10

8;  9;  10

6; 7

10

8

8

8

9; 10

8; 9

8

10

8

16

10

26

7

20

13

9

6

10

9

4

12

6

4; 5

-

4;  5

-

5

4

4

4

4; 5

6

-

12

-

6

2

3

3

2

12+1

10+0

19+5

3+0

3+1

6+2

8+2

5+3

6+2

2

3

3

4

Примечание: m – число особей, у которых были исследованы клетки соматической линии;

n – число особей, у которых были исследованы клетки полового пути. 

Таблица 7. Количество ядерной ДНК в клетках изолиний A. vernalis.

Место вылова

Изоли-ния

Пол

Размер генома (пг)

Соматические клетки (2C)

M ± m

n

Спермии (1C)

M ± m

n

1

S102

1.43± 0.06

183

1.46± 0.04

78

0.67± 0.01

61

S115

1.48± 0.02

129

1.48± 0.02

117

0.70+0.02

40

S130

1.42± 0.07

80

1.42± 0.10

149

0.67± 0.06

114

S142

1.35± 0.02

85

1.47± 0.01

50

0.70±0.04

25

2

CD60

1.56+ 0.03

26

1.57± 0.02

81

0.74± 0.07

50

CD61

1.45+0.12

53

1.53± 0.09

85

0.70+0.02

82

CD69

1.54± 0.12

133

1.60± 0.01

160

0.76± 0.01

76

3

PA26

1.46± 0.01

52

1.55± 0.01

222

0.75± 0.02

52

4

Tre1

1.43+0.09

83

1.55+0.01

59

0.83± 0.06

25

Примечание: места вылова: пруды штата Висконсин. 1 – Short-1, 2 – Cleveland Road Ditch, 3 – Parejko Pond, 4 – пруд Tre1; n – число исследованных клеток.

Для определения степени репродуктивной изоляции между географически изолированными популяциями, обладающими разными значениями диплоидного числа хромосом, нами были поставлены 11 типов реципрокных скрещиваний изолиний, в каждом варианте скрещивания мы использовали 10 самок и 10 самцов.

Контрольные скрещивания были проведены для всех 9 изолиний. Мы разработали индекс репродуктивной изоляции (IRI) от 0 до 5, учитывавший уровни презиготической и постзиготической изоляции, пониженную жизнеспособность эмбрионов, пониженную плодовитость и нормальный уровень плодовитости с жизнеспособным плодовитым потомством (Табл. 8).

Таблица 8. Индексы репродуктивной изоляции (IRI), разработанные для оценки результатов скрещивания между изолиниями самок A. vernalis

IRI

Копуляция

Количест-во эмбрионов в кладке

Жизнеспособ-ность эмбрионов

Жизнеспособность на личиночных стадиях

Репродуктивный барьер

0

1

2

3

4

5

Полная

Полная

Полная

Полная

Сомни-

тельная

нет

30-60

4-10

4-10

5-10

0

0

Жизнеспособные

Жизнеспособные

некоторые эмбрионы нежизнеспо-

собны

нежизнеспособ-ные;

эмбрионов нет

----

Жизнеспособные

Пониженная плодовитость;

Пониженная жизнеспособность (иногда в F1 были только самцы); 

--------

--------

--------

Отсутствует;

Постзиготичес-

кий

пост-  и презиготический

презиготический

презиготический

презиготический

Результаты скрещивания между изолиниями показали высокий уровень репродуктивной изоляции в 8 вариантах скрещиваний из 11 (Табл. 9). Все варианты скрещиваний, в которых участвовали изолинии из разных водоемов, показали полную репродуктивную изоляцию этих изолиний, при этом надо отметить, что полная репродуктивная изоляция наблюдалась как между географически удаленными популяциями A. vernalis, так и между популяциями из близко расположенных водоемов. Изолинии, полученные из одного водоема, при скрещивании показали значения IRI от 0 до 5: от полного отсутствия репродуктивной изоляции при скрещивании изолиний S130 и S142 и изолиний CD61 и CD69, до максимального уровня репродуктивной изоляции при скрещивании изолиний S130 и S102 (Табл. 9).

Неожиданный результат был получен при скрещивании изолиний S102 и S115. Низкий индекс репродуктивной изоляции при скрещивании изолиний S102 и S115 сравним с таковым в контрольных скрещиваниях изолиний S102 и S115. Количество эмбрионов в яйцевом мешке у гибридов колебалось от 4 до 10, в то время как у родительских линий количество эмбрионов в яйцевом мешке было в пределах 40-60.

Таблица 9. Реципрокное скрещивание ( Х ) между изолиниями A. vernalis.

Варианты кроссов

М.О.

Кроссы

2n

для линий кросса

Среднее

IRI

1A

1 х 4

S130 X Tre1

8 Х 6(7)

3.5

1B

S130 Tre1

4.8

2A

1 х 3

S130 x Pa26

8 Х 10(9)

4.8

2B

S130 x Pa26

3.8

3A

1 х 1

S130 x S102

8 Х 10

5.0

3B

S130 x S102

4.9

4A

1 х 2

S130  x CD61

8 Х 8(9,10)

3.9

4B

S130 x CD61

5.0

5A

3 х 2

Pa26 x CD69

10(9) Х

4.8

5B

Pa26 x CD69

8(9,10)

4.8

6A

1 х 2

S115 x CD69

8 Х 8(9,10)

3.9

6B

S115 x CD69

3.7

7A

1 х 2

S142 x CD60

8 Х 8(9,10)

3.7

7B

S142 x CD60

4.0

8A

1 х 2

S102 x CD61

10 Х

3.6

8B

S102 x CD61

8(9,10)

4.0

9A

1 х 1

S102 X S115

10 Х 8

2.5

9B

S102 x S115

3.9

10A

1 х 1

S130 x S142

8 Х 8

0

10B

S130 x S142

0.8

11A

2 х 2

CD69 x CD61

8(9,10) Х  8(9,10)

0

Примечание: направление скрещивания указано “A” и “B. “2n” – диплоидное число хромосом; М.О.– местообитание (1 = Short’s 1 Pond; 2 = Cleveland Ditch Road Pond; 3= Parejko Pond; 4 = Trek Pond); IRI – индекс репродуктивной изоляции (среднее значение IRI рассчитывалось исходя из значений IRI для отдельного кросса пары скрещиваемых особей).

Скрещивания самцов изолиний S102 и самок изолинии S115 показали более высокий уровень IRI (Табл. 9): только у одной пары появились яйцевые мешки, но в них находились нежизнеспособные эмбрионы.

Гибридное потомство F3, которое было получено в 5 вариантах скрещивания между самками изолинии S102 и самцами изолинии S115, имело диплоидное число хромосом 8 или 9. В некоторых случаях наблюдалось необычное расположение хромосом в диакинезе у самок F3: вместо обычных бивалентов мы наблюдали униваленты, соединенные конец в конец и формирующие мультивалентное кольцо. Зародыши гибридного потомства F20 обладали только диплоидным числом хромосом равным 8. Необходимо отметить, что одна хромосома из пары наиболее крупных метацентрических хромосом вдвое превосходила по длине другие хромосомы, что предполагает нереципрокную транслокацию или слияние двух хромосом в линии клеток зародышевого пути у гибридного потомства. Появление жизнеспособного и фертильного потомства при скрещивании изолиний S102 и S115 доказывает, что генетическая программа, обеспечивающая успешное прохождение мейоза, не нарушена, несмотря на появление необычной конфигурации хромосом в 1-м мейотическом делении.

Измерение содержания ДНК в ядрах клеток соматической и зародышевой линии показало редукцию генома гибридных особей по сравнению с геномом родительских изолиний. Если самки гибридного потомства в F1 и F2 имели содержание ядерной ДНК  практически  равное родительскому геному, то содержание ДНК в клетках самок F3 было значительно ниже, чем в клетках родительских изолиний (t = 5,9; df = 106; P < 0,001), и это редуцированное количество ядерной ДНК сохранилось в клетках особей поколения F15 (Табл. 10). 

Таблица 10. Содержание ДНК в клетках изолиний S102 и S115 A. vernalis и их гибридного потомства в 1-м, 2-м и 15-м поколениях

 

Изолиния

Содержание ДНК, 2С*

n

Содержание ДНК, 1С**

n

S102 

1,45±0,03

52

0,73±0,03

16

S115 

1,46±0,03

51

0,68±0,03

18

F1 

1,43±0,03

1,47±0,02

52

55

0,67±0,04

10

F2 

1,39±0,03

39

F3 

1,25±0,02

1,31±0,03

56

60

0,61±0,02

33

F15 

1,24±0,03

1,31±0,03

50

52

0,62±0,04

10

Примечание: (2С)* содержание ДНК в соматических клетках зародышей и взрослых особей;  (1С)** содержание ДНК в спермиях или во 2-м полярном тельце; n – количество исследованных клеток.

Подобное уменьшение содержания ядерной ДНК в клетках соматической линии и в половых клетках мы наблюдали и у самцов от F1 к  F3 (t=1,8; df=113; P < 0,05).

Обратное скрещивание гибридного потомства F20 с родительскими изолиниями S102 и S115 A. vernalis продуцировало жизнеспособное, фертильное потомство в 4 из 26 пар скрещиваемых особей (Табл. 11). Эти успешные бэккроссы были результатом скрещивания гибридных самцов и обеих родительских изолиний.

Таблица 11. Обратное скрещивание гибридного потомства  F20 (2n=8) от скрещивания изолиний S102 и S115 A. vernalis (2n=8) с родительскими изолиниями S102 и S115 вида A. vernalis.

Скрещиваемые изолинии

2n скрещиваемых линий

IRI

S115 Х гибрид

S115  Х гибрид

8 Х 8

8 Х 8

1(2), 3(2)

3(3), 5(3)

S102 Х гибрид

S102  Х гибрид

10 Х 8

  10 Х 8

0(2), 3(5), 4(1)

3(6), 5(2)

Анализируя результаты скрещивания, кариологического анализа и цитофотометрии комплекса изолиний A. vernalis, мы приходим к выводу, что данный комплекс обнаруживает значительную вариабельность цитогенетических признаков при неизменной величине генома.

Наши исследования дали два необычных результата: особи некоторых изолиний обладали различным диплоидным числом хромосом, и особи изолиний с разным числом хромосом могли в ряде случаев давать жизнеспособное и фертильное потомство. Вариабельность в диплоидном числе хромосом в пределах одной популяции может быть следствием полового диморфизма (линии Tre1 и Pa26). Наличие в ооцитах одной самки линии CD69 пяти бивалентов примерно одинаковой длины, а в других четырех, из которых  один был почти вдвое больше других, мы объясняем  как следствие тандемного или Робертсоновского слияния двух пар хромосом и инактивации лишней центромеры в стволовых клетках зародышевого пути. 

Появление плодовитого потомства в результате скрещивания этих линий показывает, что различия в диплоидном числе хромосом не создает постзиготических барьеров изоляции, и не препятствует нормальным процессам эмбриогенеза и морфогенеза. Полученный гибрид был жизнеспособен и продуцировал 60 поколений.

Для объяснения результатов эксперимента по гибридизации изолиний S102 и S115 A. vernalis мы предложили модель хромосомной реорганизации гибридного кариотипа (Рис. 2а, б, в).

Рис. 2а.

Этап 1. (Рис. 2а). Две изолинии с различным гаплоидным числом хромосом, но одинаковым размером генома скрещиваются и дают гетерозиготный кариотип. Например, гибрид F1 (S102 и S115) получает материнский (n=5) и отцовский (n=4) наборы хромосом. Гибридный набор хромосом обладает количеством ДНК, равным сумме родительских геномов.

Рис. 2б.

Этап 2 (Рис. 2б). Гибрид F1 с 2n=9 дает два типа гамет (n=5 и n=4), которые при слиянии продуцируют зиготы с диплоидным набором хромосом равным 8, 9 и 10.

Рис. 2в.

Этап 3 (Рис. 2в.). У особей гибридного потомства в клетках зародышевого пути проходят реципрокные транслокации с образованием ацентрических фрагментов, которые при последующих клеточных делениях могут быть утеряны, следствием чего является наблюдаемая в эксперименте редукция гибридного генома в F3 и F15.

По-видимому, наиболее жизнеспособным вариантом в гибридном потомстве оказался гибрид с 2n=8, так как в F20 особи с другим кариотипом не были обнаружены.

Мы сконструировали эту модель, чтобы объяснить результаты лабораторных скрещиваний между популяциями с различным диплоидным числом хромосом. Мы предполагаем, что эти лабораторные исследования отражают процессы, которые существуют в природе и ведут к появлению новых видов. Наша модель обеспечивает правдоподобное объяснение существования популяций A. vernalis с диплоидным числом хромосом 8; 9 и 10.

5. Биологическая роль и механизм диминуции хроматина.         

Процесс диминуции хроматина можно рассматривать как вторичную форму клеточной дифференцировки на соматическую и зародышевую линии.  С удалением 94% ДНК из клеток соматической линии происходит полная потеря большей части избыточной ДНК у зародышей этого вида, в то время как у подавляющей части эукариот избыточная ДНК инактивируется путем гетерохроматинизации и подавления транскрипции. Процесс возникновения механизма ДХ пока неизвестен. Можно предположить, что особи предкового вида, который дивергировал на два криптических вида C. insignis с ДХ и C. insignis без ДХ, в ходе эволюции имели возможность оптимального выбора  пути онтогенетического развития (сайленсинг избыточной ДНК путем компактизации хроматина или диминуции хроматина) в интересах целостной развивающейся системы нового вида. Путь этот, возможно, определялся необходимостью создания надежных барьеров для генетической изоляции видов-двойников. Возможно, что виды, различающиеся наличием/отсутствием ДХ в раннем эмбриогенезе,  при скрещивании не будут давать потомства.  Например, можно предположить, что при скрещивании особей вида, имеющего в онтогенезе ДХ с особями криптического вида, не имеющего ДХ, будет нарушен нормальный ход ранних этапов эмбриогенеза, связанных с  готовностью или неготовностью гибридного генома к осуществлению последовательных этапов ДХ. Подобное нарушение приведет к многочисленным ошибкам при вырезании фрагментов эДНК, удалению жизненно важных генов или изменению транскрипционной активности генов в случае неправильного соединения фрагментов хромосом после вырезания элиминируемой ДНК, и другим возможным негативным последствиям.

Можно предложить и другую причину появления ДХ у циклопов. Функциональная потребность в умножении ряда последовательностей наталкивается на необходимость многократного умножения генетического материала, который никогда не будет востребован в дифференцированных соматических клетках. Поэтому для организма выгодно удалить избыточную ДНК генома в ходе ДХ, а затем многократно воспроизвести  геном соматических клеток. Действительно, амплификация постдиминуционного генома C. kolensis или C. s .strenuus является намного более эффективной, чем амплификация генома C. insignis.  Это следует из сравнения содержания ДНК в высокополиплоидных клетках C. kolensis, C. s. strenuus (видов с ДХ), и содержания ДНК в высокополиплоидных клетках C. insignis (вида без ДХ) (Табл.12). Простые расчеты показывают, что число копий генов в высокополиплоидных клетках у видов с ДХ (C. kolensis и C. s. strenuus) в десятки раз больше, чем в высокополиплоидных клетках вида без ДХ (C. insignis), так как величины последиминуционных геномов видов C. kolensis и C. s. strenuus значительно меньше величины генома C. insignis.

Таблица 12. Сравнительные характеристики высокополиплоидных клеток C. kolensis и C. s. strenuus (ДХ имеется),  C. insignis (ДХ отсутствует).

Вид

N

ВК (пг)  1С

Плоидность клетки

СК (пг) 1С

C. kolensis

80

150-230

1000-1700С

0,14

C. s. strenuus

50

50-70

270-380С

0,18

C. insignis

17

60-90

30-45С

2,15

N – число клеток в теле взрослого циклопа; ВК – содержание ДНК в высокополиплоидной клетке в теле взрослого циклопа; СК – содержание ДНК в  соматической клетке взрослого циклопа

Снижение частоты аберраций хромосом в клетках соматической линии C. kolensis после диминуции хроматина также можно рассматривать как один из признаков, дающих преимущество виду, у которого появляется ДХ. Действительно, при уменьшении генома соматических клеток C. kolensis в 15 раз вследствие ДХ, происходит уменьшение частоты аберраций хромосом в клетках сомы в 50 раз, что, предположительно, дает преимущество этому виду, позволяя противостоять постоянно действующему мутационному процессу и обеспечивая высокую консервативность генома вида.

Мы предполагаем, что у циклопов должны быть генетически детерминированы следующие этапы диминуции хроматина: 1) подготовка к процессу ДХ большей части генома пресоматических клеток, с чем, по-видимому, связано значительное увеличение продолжительности преддиминуционной интерфазы. Появление G-подобных полос в хромосомах 3-го деления дробления у C. kolensis, предшествующего диминуционному делению, может быть также связано с проявлением процессов репрограммирования функционально активной части генома, что проявляется на уровне хромосомного  фенотипа;  2) приведение в состояние «готовности» районов хромосомных разрывов (РХР), которые определяют участки хроматина, вырезаемого из хромосом пресоматических клеток. Мы предполагаем, что РХР локализованы в участках, ассоциированных с ядерным матриксом; 3) разрезание по сайтам РХР и вырезание элиминируемого хроматина, представленного в виде петель. Сразу после вырезания элиминируемой ДНК происходит восстановление нити хромосомной ДНК, контакт интерфазной хромосомы с ядерным матриксом при этом теряется, происходит воссоединение концов вырезанной петли с образованием колец ДНК; 4) компактизация элиминируемой ДНК и заключение ее в гранулы. Формирование мембраны гранул, отличительным свойством которой является отсутствие пор; 5) деградация элиминируемой ДНК внутри гранулы  в течение 2-3-х последующих делений.

Таким образом, в процессе ДХ, вероятно, участвуют многие гены, и нарушение координированной работы этих генов, обуславливающих каждый из обозначенных этапов, неминуемо приведет к искажению процесса ДХ, и как следствие к ошибкам индивидуального развития и дифференцировки организма, которые, скорее всего, станут причиной летального исхода для данной особи. По нашему предположению, появление процесса ДХ происходит уже на основе существующих генов, которые включаются одновременно гипотетическим ферментом, синтезированным на матрицах иРНК задолго до диминуционного деления, возможно еще при созревании ооцита.

6. Парадокс размера генома эукариот с позиции данных, полученных при исследовании ДХ у Cyclopoida

Уникальным объектом для решения парадокса величины эукариотического генома, по нашему мнению, может стать представитель отряда копепод C. kolensis, у которого во время 4-го деления дробления из хромосом клеток соматической линии вырезается 94% ДНК, диплоидное количество хромосом при этом остается неизменным. В дальнейшем для выполнения всех необходимых функций в ходе развития взрослого организма достаточно оставшихся 6% генома. Элиминируемые 94% ДНК у C. kolensis бесспорно могут рассматриваться как избыточная ДНК для соматических клеток, так как отсутствие в них этой части генома не препятствует нормальному ходу онтогенетических процессов.

В настоящее время среди молекулярных биологов преобладает точка зрения, согласно которой избыточная ДНК является селективно нейтральной (Charlesworth, et al., 1994; Elder, Turner, 1995; Kreitman, 1996) и накапливается в ходе эволюции в результате мутационного давления. Эта концепция, по сути, сходна с гипотезой «мусорной» ДНК (Ohno, 1972). Согласно этим гипотезам избыточная ДНК не несет кодирующих и регуляторных функций, и хотя является для организма некоторым метаболическим грузом, все-таки не элиминируется отбором. Отсюда следует, что во фракции избыточной ДНК, по крайней мере, у эволюционно «старых» видов, должны преобладать последовательности c достаточно высокой  степенью дивергенции. В элиминируемой ДНК у C. kolensis, которую мы рассматриваем как избыточную для клеток соматической линии, обнаруживается сложная организация различных повторяющихся последовательностей, обусловленная характерным чередованием повторов и спейсеров, сложной структурой многих повторов, наличием слабодивергировавших, а нередко на 100% тождественных консенсусу прямых и инвертированных повторов, присутствующих как в одном и том же фрагменте, так и в разных областях генома. Это ясно указывает на то, что элиминируемую во время диминуции хроматина ДНК нельзя рассматривать как «мусорную». Именно такое понимание функций избыточной ДНК позволяет объяснить причины сохранения элиминируемой части генома в клетках зародышевого пути на протяжении сотен тысяч поколений не только у московской, но и у байкальской популяции C. kolensis. 

Проведенные нами исследования по сравнительной радиочувствительности хромосом  C. kolensis до и после ДХ, а также вида C. insignis, у которого ДХ отсутствует, не укладывается в рамки концепции, приписывающей избыточной ДНК защитные функции. Как видно из наших экспериментов, если бы избыточная ДНК у C. kolensis выполняла защитные функции, то частота АХ после ДХ не уменьшилась бы в 50 раз (Табл. 4), а наоборот увеличилась. Данные по радиочувствительности хромосом C. insignis также противоречат концепции защитной функции избыточной ДНК, так как частота АХ в клетках C. insignis значительно выше, чем у C. kolensis во время соответствующих делений дробления (Табл. 4, 6).

Предположение, согласно которому роль избыточной ДНК заключается в репрессии генов, которая возникает при гетерохроматинизации негенной ДНК, вовлекающей в этот процесс соседние участки эухроматина (Zuckerkandl, 1997), с позиции полученных нами данных маловероятно. Элиминация 94% ДНК клеток  соматической линии C. kolensis свидетельствуют против этой гипотезы, так как морфогенез, для осуществления  которого, согласно гипотезе Цукеркэндла (Zuckerkandl, 1997), необходима негенная ДНК для управления работой генов путем компактизации и декомпактизации хроматина, начинается после того, как завершилась диминуция хроматина. Элиминация 94% генома клеток соматической линии C. kolensis и 75% генома  пресоматических клеток  C. s. strenuus  позволяет сделать вывод о том, что элиминируемая ДНК не несет значительных кодирующих и регуляторных функций. Учитывая факт сохранения полноразмерного генома в клетках зародышевой линии, мы предполагаем, что некоторые элиминируемые последовательности, удаляемые в процессе ДХ из клеток соматической линии, но сохраняющиеся в клетках зародышевого пути, необходимы для нормального хода мейоза и созревания половых клеток.

ЗАКЛЮЧЕНИЕ

В работе проведено комплексное исследование процесса диминуции хроматина методами цитогенетики, цитохимии, молекулярной генетики и электронной микроскопии. Обнаруженные факты наличия ДХ у C. kolensis, во время которой  из хромосом пресоматических клеток удаляется 94% ДНК, при сохранении диплоидного числа хромосом  после ДХ, позволяют рассматривать элиминируемую ДНК  как избыточную  для клеток соматической линии,  так как отсутствие в них этой части генома не препятствует нормальному ходу онтогенеза. В то же время,  редукция 94% генома клеток  соматической линии C. kolensis в результате ДХ,  позволяет утверждать, что элиминируемая ДНК не несет никаких значительных кодирующих и регуляторных функций. Сохранение после  ДХ нередуцированного генома в клетках зародышевой линии позволяет  предположить, что последовательности, удаляемые в процессе диминуции из клеток соматической линии, необходимы для нормального хода мейоза и созревания половых клеток, а сам процесс ДХ  представляет собой механизм генетической изоляции между криптическими видами, у одного из которых ДХ отсутствует.

Полученные в данном исследовании результаты показывают, что процесс ДХ представляет собой  альтернативную форму регуляции клеточной дифференцировки на соматическую и зародышевую линии путем полной потери избыточной части генома, в то время как у подавляющей части эукариот эта часть генома инактивируется путем гетерохроматинизации. Сохранение избыточной ДНК в клетках зародышевой линии C. kolensis, элиминируемой из клеток соматической линии, сложная организация повторяющихся последовательностей этой ДНК, обусловленная характерным чередованием повторов и спейсеров, наличием слабодивергировавших,  нередко на 100% тождественных прямых и инвертированных повторов, а также сходство цитогенетических и молекулярных характеристик московской и байкальской популяций C. kolensis, ясно указывают на то, что элиминируемую во время ДХ ДНК нельзя рассматривать как "паразитическую", "эгоистическую" или «мусорную».

Результаты, полученные методами количественной цитофотометрии, показали, что причина появления ДХ в онтогенезе не связана с необходимостью удаления из генома соматических клеток избыточной ДНК. 

Данные, полученные нами при изучении видов Cyclopoida методами цитогенетики, показали значительную вариабельность цитогенетических признаков у популяций изученных видов пресноводных копепод, что позволило высказать предположение о видовом статусе этих популяций.

ВЫВОДЫ

1. Обнаружен и исследован механизм диминуции хроматина у Cyclops kolensis и Paracyclops affinis. У ряда видов циклопов выявлены  высокополиплоидные  клетки. Высказано положение о том, что процесс ДХ представляет собой  альтернативную форму регуляции клеточной дифференцировки на соматическую и зародышевую линию, во время которой происходит полная потеря избыточной части генома; в то время как у подавляющей части эукариот эта часть генома инактивируется путем гетерохроматинизации.

2. Установлено изменение ультраструктуры интерфазных ядер клеток соматической линии у C. kolensis в результате ДХ, связанное с появлением  компактизованного хроматина, но не найдено принципиальных различий в структуре хромосом клеток соматической линии до и после ДХ.  В гранулах  элиминируемого хроматина у C. kolensis обнаружена плотная лишенная пор  мембрана.

3. Показано, что последовательности ДНК из гранул элиминируемого хроматина являются АТ-богатыми и локализованы во всех додиминуционных хромосомах.  Среди фрагментов элиминируемой ДНК обнаружены семейства повторов с высоким уровнем гомологии внутри семейств. Один из фрагментов элиминируемой ДНК московской популяции C. kolensis  присутствует в додиминуционном геноме байкальской популяции C. kolensis и является высококонсервативным. Данный повтор не полностью элиминируется во время ДХ, его копии  присутствуют в геноме соматических клеток взрослых циклопов как московской, так и байкальской популяций.

4. Определено, что частота аберраций хромосом в клетках зародышей C. kolensis до ДХ превышает таковой показатель для клеток соматической линии зародышей C. kolensis после ДХ более чем в 50 раз. Частота аберраций хромосом в клетках зародышей C. insignis (вида без ДХ) не изменяется в ходе эмбриогенеза. 

5. Выявлена внутривидовая изменчивость у Cyclops kolensis, C. s. strenuus, C. insignis, Termocyclops сrassus и Acanthocyclops vernalis по следующим признакам: диплоидное число хромосом, величина генома, картина и хронология диминуционных процессов. Показано, что наличие ДХ в онтогенезе у циклопов не связано с величиной генома. Высказана гипотеза, что процесс ДХ является механизмом генетической изоляции между криптическими видами, у одного из которых ДХ отсутствует. 

6. При исследовании различных популяций вида Acanthocyclops  vernalis установлено:

а) изменчивость диплоидного числа хромосом при неизменной величине генома;

б) полная репродуктивная изоляция всех изолиний самок, полученных из разных водоемов, и двух изолиний самок, полученных из одного водоема, независимо от диплоидного числа хромосом;

в) частичная репродуктивная изоляция двух изолиний самок, полученных из одного водоема и обладающих разным диплоидным числом хромосом.

7.  На основании полученных результатов предложено рассматривать ДНК, элиминируемую у C. kolensis в результате диминуции хроматина, как избыточную для клеток соматической линии. Высказано предположение, что элиминируемая в ходе диминуции ДНК не несет значительных кодирующих и регуляторных функций, так как ее отсутствие в клетках сомы не препятствует нормальному ходу онтогенеза, а сам процесс диминуции хроматина появился как механизм генетической изоляции между видами-двойниками.

Работа была поддержана грантами РФФИ и грантом РАН «Генетические аспекты эволюции биосферы».

Список статей, опубликованных по теме диссертации

а)  в изданиях согласно перечню ВАК:

1. Гришанин А.К., Акифьев А.П. Диминуция хроматина и организация хромосом у Cyclops strenuus strenuus // Генетика. 1993. Т. 29(7). С. 1099 - 1107.

2. Гришанин А.К., Бродский  В.Я., Акифьев А.П. Соматические клетки Cyclops strenuus (Copepoda, Crustacea) теряют при диминуции хроматина более 90% генома // Доклады РАН. 1994. Т. 338(5). С. 708 - 710.

3. Гришанин А.К.  Сравнительное изучение хромосом и интерфазных ядер в клетках зародыша Cyclops kolensis (Copepoda, Crustacea) до и  после диминуции  хроматина  при  помощи  электронной микроскопии // Онтогенез. 1995. Т. 26 (3). С. 188 - 195.

4. Гришанин А.К., Худолий Г.А., Шайхаев З.Г.О., Бродский В.Я., Макаров В.Б., Акифьев А.П. Диминуция хроматина у Cyclops kolensis и Cyclops strenuus strenuus (Copepoda, Crustacea)– уникальный пример генной инженерии в природе // Генетика. 1996. Т. 32. С. 492 - 499

5. Гришанин А.К.  Изучение  элиминируемого хроматина в клетках зародыша Cyclops kolensis с помощью сканирующей электронной микроскопии // Цитология.1996. Т. 38(10). С. 115 - 117.

6. Гришанин А.К.  К вопросу о цитотаксономии видов Cyclops  strenuus  и Cyclops kolensis  (Copepoda, Cyclopidae) // Зоологический журнал. Т. 75. С. 1887 - 1891.

7. Акифьев А.П., Беляев И.Я., Гришанин А.К., Дегтярев С.В., Худолий Г.А. Аберрации хромосом, диминуция хроматина и их значение для понимания молекулярно-генетической организации эукариотических хромосом. Радиационная биология. Радиоэкология // 1996. Т. 36. С. 789 - 797.

8. Акифьев А.П., Гришанин А.К., Дегтярев С.В. Диминуции хроматина, сопровождающиеся реорганизаций молекулярной структуры генома: эволюционные аспекты // Генетика. 1998. Т. 34. С. 709 - 718.

9. Дегтярев С.В., Гришанин А.К., Белякин С.Н., Рубцов Н.Б., Жимулев И.Ф., Акифьев А.П..  Нуклеотидные последовательности ДНК, элиминируемые в процессе диминуции хроматина из хромосом соматических клеток Cyclops kolensis // Доклады РАН. 2002. Т. 384. (2). С. 255 - 258.

10. Акифьев А.П., Гришанин А.К., Дегтярев С.В. Диминуция хроматина – ключевой процесс для объяснения парадокса размера генома эукариот и некоторых механизмов генетической изоляции // Генетика. 2002. Т. 38. С.  595 - 606.

11. Гришанин A.K., Дегтярев С.В., Акифьев А.П. Радиочувствительность хромосом в связи с диминуцией хроматина у циклопов (Crustacea, Copepoda) // Генетика. 2002. Т. 38. С. 468 - 472.

12. Sergei Degtyarev, Tatiana Boykova, Andrei Grishanin, Stepan Belyakin, Nikolai Rubtsov, Tatiana Karamysheva, Grigory Makarevich, Alexei Akifyev, and Igor Zhimulev. The molecular structure of the DNA fragments eliminated during chromatin diminution in Cyclops kolensis // Genome Research. 2004. V. 14. P. 2287 - 2294.

13. Акифьев А.П., Гришанин А.К. Некоторые заключения о роли избыточной ДНК и механизмах эволюции эукариот, которые можно сделать на основании изучения диминуции хроматина у Cyclopoida // Генетика. 2005. Т. 41(4). С. 466 - 479.

14. Гришанин А.К., Акифьев А.П. Особенности радиационного мутагенеза у Cyclops kolensis и Cyclops insignis (Crustacea, Copepoda) // Радиационная биология. Радиоэкология. 2005. Т. 45(3). С. 294 - 298.

15. Grishanin A.K., Rasch E.M., Dodson S.I., Wyngaard G.A.  Origins and continuity in variability in genetic architecture of the cryptic species complex of Acanthocyclops vernalis (Crustacea: Copepoda). II. Evidence from crossbreeding experiments and cytogenetics // Evolution. 2006. V. 60(3). P. 247 - 256.

16. Гришанин А.К., Шеховцов А.К., Бойкова Т.В., Акифьев А.П., Жимулев И.Ф.. Проблема диминуции хроматина на рубеже ХХ и XXI веков // Цитология. 2006. N. 5. C. 379 - 397. 

17. Гришанин А.К., Бойкова Т.В., Маршак Т.Л., Мельник Н.Г., Наумова Е.Ю., Загоскин М.В., Акифьев А.П., Жимулев И.Ф.  Консерватизм структуры генома в двух популяциях Cyclops kolensis (Copepoda, Crustacea), обитающих в прудах г. Москва и о. Байкал // Доклады РАН. 2006. 408(5). С. 684 - 687.

б) в других научных изданиях:

1. Акифьев А.П., Гришанин А.К. Некоторые биологические аспекты диминуции хроматина // Журнал общей биологии. 1993. Т. 54(1). С. 5 - 16.

2. Grishanin A.K., Akifyev A.P. Interpopulation differentiation within C. kolensis and C. strenuus strenuus (Crustacea: Copepoda): evidence from cytogenetic methods // Hydrobiology. 2000. V. 417. P. 37- 42.

3. Dodson, S.I., Grishanin A.K., Gross K., and Wyngaard G. Morphological analysis of some cryptic species in the Acanthocyclops vernalis complex from North America // Hydrobiologia. 2003. V.500. P. 131­ 143.

4. Grishanin A.K., Akifyev A.P., Dahms H.U. Nuclear DNA and remarks on chromatin diminution of cyclopoid copepods // Zoological Studies. 2004. V. 43(2). P. 300 - 303.

5. Grishanin A. K., Rasch E.M., Dodson S.I. and Wyngaard G.A. Variability in genetic architecture of the cryptic species complex of Acanthocyclops vernalis (Copepoda). I. Evidence from karyotypes, genome size, and ribosomal DNA sequences // Journal of Crustacean Biology. 2005. V. 25(3). P. 375 - 383.

6. Акифьев А. П., Бойкова Т.В., Гришанин А.К.,  Зоткевич Е.В., Жимулев И.Ф. Диминуция хроматина у циклопов как модель эволюционного преобразования геномов. Эволюционная биология. Сборник работ по материалам III Международной конференции "Проблемы вида и видообразования". 2005. Т. 3. С. 133 - 143.






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.