WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

На правах рукописи

Франк Людмила Алексеевна

БИОЛЮМИНЕСЦЕНТНЫЙ МОЛЕКУЛЯРНЫЙ МИКРОАНАЛИЗ НА ОСНОВЕ Са2+-РЕГУЛИРУЕМОГО ФОТОПРОТЕИНА ОБЕЛИНА

03.00.23 – биотехнология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени доктора биологических наук

Красноярск, 2009

Работа выполнена в Институте биофизики Сибирского отделения Российской академии наук.

Научный консультант: доктор медицинских наук, академик РАН Гительзон Иосиф Исаевич

Официальные оппоненты: доктор биологических наук, чл.-корр. РАН Рубин Андрей Борисович доктор биологических наук, чл.-корр. РАН Нетесов Сергей Викторович доктор медицинских наук, профессор Савченко Андрей Анатольевич

Ведущая организация: Химический факультет Московского государственного университета имени М.В. Ломоносова

Защита состоится «24» ноября 2009 г. в 10 час. на заседании диссертационного совета Д 003.007.01 в Институте биофизики СО РАН по адресу: 660036, г. Красноярск, Академгородок, д.50, стр.50.

С диссертацией можно ознакомиться в библиотеке Института биофизики СО РАН

Автореферат разослан « » 2009 г.

Вр. и.о. ученого секретаря диссертационного совета, д.ф.-м.н. Кудряшева Н.С.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Одной из важнейших задач современной биотехнологии является поиск новых высокоэффективных аналитических инструментов, способных отвечать нуждам медицинской диагностики, микробиологии, геномики, экологии и т.д.

Ключевыми элементами аналитических систем являются системы регистрации специфических взаимодействий аффинных комплексов. Основными требованиями, предъявляемыми к этим системам, являются их надежность, стабильность, простота мечения и детекции, а также способность обеспечить выявление сверхмалых количеств биомолекул-мишеней.

В настоящее время на отечественном рынке наблюдается явная потребность в чувствительных и высокоэффективных диагностических наборах. Радиоизотопные (РИА) диагностикумы и иммуноферментные (ИФА) диагностикумы на базе колориметрических меток, использующиеся в клиникодиагностической практике, обладают рядом недостатков, оказывающих существенное негативное влияние как на результаты таких анализов, так и на возможности широкого их использования в клинической диагностике. Для ИФА-методов, основанных на колориметрической детекции продукта, характерны значительная вариабельность результатов измерений и, как следствие, зачастую пониженная эффективная чувствительность. РИА-метод, оставаясь «золотым стандартом» в лабораторных исследованиях, требует соблюдения особых условий его использования, включая получение специальных разрешений (лицензии) на работу с радиоактивными веществами.

Применение импортных аналитических приборов и наборов реактивов существенным образом отражается на стоимости анализа и делает отечественное здравоохранение зависимым от импортных поставок и состояния мирового рынка. В этом аспекте разработка отечественных высокочувствительных, надежных и относительно недорогих диагностикумов является чрезвычайно актуальной задачей.

Одним из решений этой задачи может стать разработка диагностикумов на основе светоизлучающих белков и, в частности, на основе Са2+-регулируемых фотопротеинов. Эти белки представляют собой стабильный фермент субстратный комплекс из белковой глобулы (односубъединичного полипептида с молекулярной массой около 20 кДа) и нековалентно иммобилизованного внутри нее окисленного субстрата – пероксицелентеразина.

Биолюминесцентная реакция фотопротеинов происходит при присоединении ионов Са2+ с излучением света в голубой области (max = 470-485 нм). Высокий квантовый выход – 0,25-0,35 позволяет обнаруживать эти белки в аттомольных количествах. Клонирование кДНК нескольких апофотопротеинов и получение рекомбинантных фотопротеинов – в частности, акворина медузы Aquorea victoria – обеспечили проведение широкомасштабных исследований по его применению в качестве репортеров в молекулярном анализе. Показано его успешное использование в качестве высокочувствительного репортерного белка в иммуноанализе ряда биологически важных соединений, а также в гибридизационном анализе для решения целого ряда задач – от изучения механизмов регуляции экспрессии генов в ответ на различные стимулы до определения генмодифицированных источников в пищевых продуктах. Эти исследования проводятся исключительно за рубежом с применением рекомбинантного акворина, производимого несколькими фирмами, к примеру, Prolume, Molecular Probes (США), стоимость которого высока, что сильно ограничивает перспективы его практического использования.

В России в Институте биофизики СО РАН на протяжении последних лет велись интенсивные исследования биолюминесцентной системы гидроидного полипа Obelia longissima, обитающего в водах Белого моря.

Свечение этого организма обусловлено наличием белка обелина, также принадлежащего семейству Са2+-регулируемых фотопротеинов. К началу наших исследований был получен в чистом виде и изучен природный обелин, клонирован ген апообелина, получены генетические конструкции для экспрессии рекомбинантного апообелина в клетках E.coli. Это обеспечило постоянный источник белка для проведения всесторонних исследований – от изучения его структурно-функциональной организации до разработки способов его использования как репортера в аналитических системах in vivo и in vitro.

Представляемая работа является комплексным исследованием рекомбинантного Са2+-регулируемого фотопротеина обелина применительно к биоаналитическим задачам, конечной целью которой является создание на его основе отечественных высокочувствительных надежных и простых для рутинного применения биолюминесцентных диагностикумов для определения социально-важных заболеваний и инфекций.

Целью настоящего исследования было создание биотехнологической основы нового направления молекулярного высокопроизводительного микроанализа с использованием рекомбинантного Са2+-регулируемого фотопротеина обелина и его генетически модифицированных аналогов в качестве биолюминесцентных репортеров.

Достижение поставленной цели требовало решения следующих задач:

1. Разработать высокоэффективную технологию получения рекомбинантного обелина и его генетически модифицированных аналогов в высокоочищенном виде.

2. Разработать способы получения производных обелина – химических коньюгатов и генноинженерных химер – с различными биоспецифичными молекулами, пригодных для использования в качестве высокочувствительных репортеров в анализе in vitro.

3. Показать перспективность применения обелиновых репортеров в иммуноанализе и ДНК-зондировании и обосновать конкурентоспособность предлагаемого нового направления биолюминесцентного молекулярного микроанализа.

Цель работы и комплекс задач сформулированы впервые. Их решение обеспечило получение новых фундаментальных знаний по различным аспектам биотехнологии рекомбинантных Са2+-регулируемых фотопротеинов и является основой для практического применения этих белков в различных молекулярнобиологических исследованиях.

Научная новизна.

Впервые проведены комплексные исследования рекомбинантного Са2+регулируемого фотопротеина обелина и его генетически модифицированных аналогов как высокочувствительных репортеров для биолюминесцентного молекулярного микроанализа.

Разработан эффективный способ получения рекомбинантного обелина в гомогенном виде с выходом около 50% от экспрессированного апобелка.

Изучены основные физико-химические свойства рекомбинантного обелина (спектральные характеристики, параметры биолюминесцентной реакции, термоинактивация и условия хранения).

Выявлены закономерности химического модифицирования рекомбинантного обелина действием различных реагентов, направленного на получение его высокоактивных коньюгатов с биоспецифичными молекулами – гаптенами, авидином или стрептавидином, иммуноглобулинами, пригодных для использования в качестве высокочувствительных репортеров (меток) в биолюминесцентном микроанализе. Получен и охарактеризован как высокочувствительный биолюминесцентный репортер химерный белок proZZObe, обладающий биолюминесцентной активностью обелина и аффинностью белка А из Staphylococcus aureus к Fc фрагментам иммуноглобулинов класса G.

Экспериментально обоснована перспективность применения полученных коньюгатов для биолюминесцентного иммуноанализа на примере определения ряда биологически активных веществ – гормонов, онкомаркеров, инфекционных агентов в сыворотках. Показано, что метки на основе рекомбинантного обелина обеспечивают чувствительность микроанализа, равную или близкую чувствительности радиоизотопного анализа, стабильны при хранении в растворе, замороженном или лиофилизированном виде, обладают низким уровнем шума, просты и безопасны. В отличие от иммуноферментного анализа с колориметрической детекцией продукта, анализ на основе обелинового репортера исключает стадии длительного инкубирования с субстратом и остановки ферментативной реакции.

Впервые предложены варианты высокочувствительного двухпараметрического биолюминесцентного микроанализа: одновременного – на основе мутантных вариантов обелина с измененными спектрами биолюминесценции и последовательного – на основе обелина в тандеме с целентеразин-зависимой люциферазой Metridia longa.

Показано, что коньюгаты обелин-авидин (или стрептавидин) являются высокочувствительными и быстрыми репортерами для определения биотинилированных олигонуклеотидов в гибридизационном анализе продуктов ПЦР. Использование биолюминесцентого репортера позволяет определять 10-11М (10-15 моль) матрицы, что на порядок выше чувствительности аналогичного колориметрического репортера на базе щелочной фосфатазы.

Практическая значимость.

На основе разработанной технологии получения рекомбинантого обелина высокой очистки налажено его мелкооптовое производство. Получение белка занимает в среднем 22-24 ч и может осуществляться специалистом технической квалификации. Этим способом получены ряд различных генетических вариантов обелина, а также рекомбинантные акворин и его варианты, клитин и Са2+-регулируемый целентеразин-связывающий белок Renilla muelleri.

Полученные коньюгаты обелина с биоспецифическими молекулами являются основными компонентами для создания отечественных высокочувствительных биолюминесцентных иммунодиагностикумов и наборов для ДНК-гибридизационного анализа, направленных на выявление социальноважных заболеваний и инфекций.

Предложенные варианты двухпараметрического биолюминесцентного микроанализа позволяют создавать двухпараметрические диагностикумы, а в перспективе – многопараметрические диагностикумы, использование которых существенным образом удешевит и интенсифицирует анализ, а также позволит исключить ошибки разнесенного во времени раздельного определения двух или нескольких антигенов в одном образце сыворотки.

В перспективе разработка биолюминесцентных высокочувствительных и простых для рутинного применения молекулярных диагностикумов на основе рекомбинантного обелина может способствовать решению задачи обеспечения отечественного здравоохранения тест-системами нового поколения.

Положения, выносимые на защиту:

1. Разработан эффективный способ получения рекомбинантного Са2+регулируемого фотопротеина обелина и его генетических вариантов, позволяющий за 22-24 ч получать высокоочищенный белок силами специалиста технической квалификации.

2. Выявлены закономерности химического модифицирования обелина и предложены способы получения его высокоактивных химических коньюгатов с гаптенами и биоспецифическими белками, пригодных для использования в качестве биолюминесцентных репортеров в молекулярном микроанализе.

3. Экспериментально обоснована перспективность и конкурентоспособность биолюминесцентных репортеров на базе рекомбинантного обелина в иммуно- и ДНК-гибридизационном микроанализе биологически важных веществ.

4. Предложены варианты высокочувствительного двухпараметрического биолюминесцентного микроанализа: одновременного – на основе мутантных вариантов обелина с измененными спектрами биолюминесценции и последовательного – на основе обелина в тандеме с целентеразин-зависимой люциферазой Metridia longa.

В результате проведенных комплексных исследований разработана биотехнологическая основа для создания отечественных биолюминесцентных диагностикумов социально значимых заболеваний и инфекций.

Вклад автора. Основные результаты работы получены лично автором, под его руководством или при его непосредственном участии в планировании и проведении экспериментов. Имена соавторов указаны в соответствующих публикациях.

Апробация работы и публикации. Основные материалы, изложенные в работе, были представлены на: International Conference on Medical Biotechnology, Immunization and AIDS, (Лениниград, 1991); International Bioluminescence Symposium (Гавайи, США, 1993); VIII–XV International Symposiums on Bioluminescence and Chemiluminescence (Кэмбридж, Великобритания, 1994; Вудсхол, США, 1996; Болонья, Италия, 1998; Асиломар, США, 2000; Кэмбридж, Великобритания, 2002; Йокогама, Япония, 2004;

Парадиз Пойнт, США, 2006; Шанхай, Китай 2008); 2nd International Conference on Clinical Chemiluminescence (Берлин, 1996); 31st European Marine Biology Symposium (Санкт-Петербург, 1996); 5th International Conference on Instrumental Methods of Analysis, Modern Trends and Applications, (Патры, Греция, 2007); на конференциях «Фундаментальная наука – медицине» (Новосибирск, 2007, 2008); на V съезде Российского фотобиологического общества (Пущино, 2008);

на семинарах лаборатории фотобиологии Института биофизики СО РАН.

Публикации. По материалам диссертации опубликовано 57 работ, из которых 18 – статьи в журналах, рекомендуемых ВАК, 10 – статьи в сборниках трудов Международных конференций, 1 заявка на патент, 1 – препринт и 27 – тезисы докладов на конференциях.

Объем и структура диссертации. Диссертационная работа состоит из введения, шести глав, заключения, выводов и списка цитируемой литературы.

Работа изложена на 225 страницах машинописного текста, содержит 73 рисунка и 7 таблиц. Список цитируемой литературы включает 214 источников из них 189 – иностранных.

Работа выполнена при финансовой поддержке: РФФИ (гранты 93-04-21308а, 96-04-48489а, 99-04-48452а, 02-015-49419а, 05-04-48271а, 06-04-08076офи, 0604-89502-ннс_а, 07-04-01248а), ФЦП «Исследования и разработки по приоритетным направлениям развития науки и техники России на 2007-20годы» (ГК № 02.512.11.2008), Программы РАН «Молекулярно-клеточная биология», Гранта CRDF No. RB1-2495-KR-03.

ОСНОВНОЕ СОДЕЖАНИЕ РАБОТЫ 1. Получение и основные физико-химические свойства рекомбинантного обелина.

Биосинтез апообелина в клетках штамма-суперпродуцента E.coli BL21gold (pET19-OL8), экспрессирующих апообелин, (Маркова С.В., ИБФ СО РАН) сопровождается упаковкой этого белка в виде нерастворимых телец включений.

Для получения рекомбинантного апообелина дикого типа (WT), а также других апофотопротеинов, экспрессированных на базе той же конструкции, был разработан способ, основные этапы которого показаны на Рис. 1.

Рекомбинантные клетки разрушали УЗ-дезинтегрированием и осадок телец включений отделяли центрифугированием. Балластные вещества удаляли промыванием осадка различными буферными растворами. Полученный в результате осадок растворяли 6 М мочевиной в 20 мМ Трис HCl pH 7,0, 5 мM CaCl2 и центрифугировали. Показано, что в тельцах включений сосредоточено 75-85% от общего экспрессированного клетками апобелка. Полученный препарат апобелка очищали ионообменной хроматографией на DEAE-Sepharose FF в денатурирующих условиях в градиенте NaOAc 0-0,5 M (буфер А: 6 М мочевина, 20 мМ Трис HCl pH 7,0, 5 mM CaCl2; буфер Б: 1 М NaOAc в буфере А). В среднем выход апофотопротеинов составляет 35-45 мг на грамм сырой клеточной массы. Активацию апообелина синтетическим целентеразином проводили 10-20-кратным разбавлением полученного после хроматографии 6 М мочевинового раствора апобелка активационным буфером. Механизм этого процесса неизвестен и условия его эффективного протекания подбирали эмпирически. Были установлены: оптимальный состав активационного раствора – 20 мМ Трис HCl рН 7, 10 мМ ДТТ, 5 мМ ЭДТА, 1,2-1,5 молярный избыток целентеразина, оптимальная концентрация апобелка – 0,2-0,4 мг/мл, минимальное время активации – 4 ч. Конечная концентрация мочевины – 0,60,3 М, NaOAc – не более 0,02 М. Полученный в результате фотопротеин выделяли из активационного раствора ионообменной хроматографией на колонке MonoQ (GE Healthcare) или QAE-Sepharose FF (при препаративном получении обелина WT) в градиенте NaCl 0-0,35 M. При получении мутантых вариантов обелина эту хроматографию проводили только на колонке MonoQ для отделения активного фотопротеина от исходного апобелка, поскольку Рис. 1. Основные стадии получения рекомбинантного обелина.

эффективность их активации в разработанных условиях зависит от произведенных аминокислотных замен. В среднем, c одного грамма клеточной биомассы выделяется 20-35 мг рекомбинантного обелина WT высокой очистки (Рис. 2). Разработанный способ получения обелина занимает 22-24 ч, начиная Рис. 2. Типичная электрофореграмма белковых препаратов при выделении и очистке рекомбинантного обелина. 1, 2 – клеточные белки до и после индукции, соответственно; 3 – раствор клеточных белков в супернатанте после разрушения клеток и центрифугирования; 4 – раствор телец включений в 6 М мочевине; 5 – апообелин, полученный после хроматографии на DEAESepharose FF; 6 – финальный препарат обелина; 7 – маркерные белки.

Таблица 1. Основные физико-химические свойства рекомбинантного обелина в сравнении с природным белком.

Параметр Рекомбинантный белок Природный Константа спада реакции (сек-1) 6,6 Удельная активность (кв/мг) 6,5х1015 4,95х10Электронный спектр поглощения max1=280нм E1мг/мл=2, max2=460нм Е1мг/мл=0,0Спектр биолюминесценции max = 478нм, плечо при 390нм (18%) Константы термоинактивации (мин-1, х 10-4) при t=30С 16 5,при t=40С 230 при t=50С 1500 15 с дезинтеграции биомассы, и может проводиться специалистом технической квалификации. По основным физико-химическим свойствам рекомбинантный обелин близок природному белку, выделенному из гидроида Obelia longissima (Таблица 1). Обелин непосредственно участвует в реакции светоизлучения, и потому зависимость величины биолюминесцентного сигнала от количества белка линейна во всем диапазоне исследуемых концентраций (Рис. 3).

Определены условия хранения рекомбинантного обелина. Белок не теряет активности в растворе (20 мМ Трис HCl, pH 7, 5 мМ ЭДТА, 0,2 М NaCl) при 48°С в течение 6-8 месяцев. Полное сохранение активности при замораживании препаратов обелина обеспечивается снижением ионной силы раствора, а также добавлением 5-10% трегалозы или 0,1-1% БСА. Для лиофильного высушивания использовали растворы белка в 10 мМ Трис HCl, pH 7, 2,5 мМ ЭДТА, полученные гель-фильтрацией на Биогеле P-6. Высушенный препарат полностью сохраняет активность в течение года при -20°С.

1Рис. 3. Зависимость биолюми1несценции от количества обелина или его генетически модифицированных 1вариантов: WT (--), Y138F (--), W92F;H22E (--). Пределы 1обнаружения (количество белка, при котором биолюминесцентный сигнал 10-в 2 раза превышает фоновый) составляют 1,4, 4,2 и 12 аттомоль, 10-соответственно.

100 101 102 103 104 105 1Белок, аттомоль 2. Получение биоспецифичных коньюгатов обелина, пригодных для использования в качестве меток в молекулярном анализе.

А) Химический синтез.

Коньюгаты обелин-биотин были синтезированы в разработанных нами условиях с использованием 5-кратного молярного избытка Nоксисукцинимидного эфира биотинамидогексановой кислоты (Sigma), в Биолюминесценция, отн.

ед.

растворе 0,1 М NaHCO3, 5 мМ ЭДТА время реакции – 30 мин, при комнатной температуре. Коньюгат выделяли гель-фильтрацией. Было показано, что на поверхности белка иммобилизуется 2-3 молекулы биотина и сохраняется 7075% исходной активности.

Коньюгаты обелин-биоспецифичные белки и гаптены.

Для синтеза коньюгатов разработана универсальная схема с использованием в качестве бифункционального длинноцепочечного кросс- линкера – Рис. 4. Синтез коньюгатов обелина с биоспецифическими молекулами.

сукцинимидного эфира 4-малеимидометил циклогексановой кислоты (SMCC, Pierce, США), Рис. 4. Ранее нами было показано, что, несмотря на присутствие в аминокислотной последовательности обелина 5 цистеиновых остатков, они недоступны для химического модифицирования. В то же время, эксперименты по получению биотинилированных производных показали наличие на поверхности белка доступных для модификации аминогрупп. С помощью реагента Траута – 2-имитониолана, реакция которого протекает по доступным аминогруппам, был получен обелин с тионилированным спейсером на поверхности белка, пригодный для коньюгирования с малеимидактивированными биоспецифическими молекулами. Показано, что использование 5-кратного молярного избытка 2-имитониолана при проведении реакции в 50 мМ BICINE, pH 8,5, 250 мМ NaCl, 5 мМ ЭДТА, 30 мин, приводит к появлению 2-х дополнительных SH-групп и при этом сохраняется около 80% исходной активности белка.

В дальнейшем сайт-направленным мутагенезом Asp12, находящаяся на свободном NH2 конце обелина, была заменена на Cys (мутант D12C) (С.В.

Маркова). При этом биолюминесцентная активность полученного генмодифицированного белка практически не отличалась от активности обелина WT. Было показано, что введенный остаток цистеина обеспечил доступную для модификации SH-группу, и это позволило исключить стадию химического тионилирования белка.

Малеимид-активированные производные биоспецифических молекул (RNH2, Рис. 2) получали с использованием 10-50-кратного молярного избытка SMCC, в 20 мМ PIPES, pH 7,5, 0,25 М NaCl, 5 мМ ЭДТА в течение 1,5-2 ч при комнатной температуре. При этом на модельном примере иммуноглобулина кролика было показано, что в его молекулу вводится 2-7 малеимидных групп.

Избытки реагентов удаляли гель-фильтрацией на колонке, уравновешенной мМ PIPES, pH 7,5, 0,25 М NaCl, 5 мМ ЭДТА. Малеимид-тироксином получали в 0,1 М растворе NaHCO3 с применением 1,2-молярного избытка SMCC и использовали для дальнейшей работы без гель-фильтации.

Коньюгаты (Obe-R, Рис. 2) получали инкубированием SMCCактивированных биоспецифических молекул с тионилированным обелином в молярном соотношении 1:10 при комнатной температуре в течение 2 ч или при 4оС в течение ночи. Коньюгаты выделяли гель-фильтрацией на колонке Superose 12 (GE Healthcare), уравновешенной 20 мМ ТрисHCl pH 7,0, 0,1 M NaCl, 5 мM ЭДТА. После всех модификаций потери активности обелина не превышали 30-35%. Полученные с помощью химических модификаций коньюгаты стабильны при хранении в растворе при 4-8оС в течение, как минимум, 6 месяцев – потери биолюминесцентной активности за этот период не превышали 10%. Коньюгаты стабильны при лиофилизации с добавлением 0.1% БСА – после растворения высушенных белков потерь фотопротеиновой и иммуноглобулиновой активностей не наблюдали.

Б) Получение коньюгата в виде генетической химеры proZZ-Obe.

Для получения химерного белка proZZ-Obe использовали биомассу рекомбинантных клеток С600/pGP1-2, трансформированных плазмидой pTZZO2, в которой к гену апообелина была присоединена двойная нуклеотидная последовательность, кодирующая иммуноглобулинсвязывающий фрагмент белка А – proZZ (Илларионова В.А, ИБФ СО РАН).

Рекомбинантный белок выделяли из телец включений, которые после УЗдезинтегрирования клеток отделяли центрифугированием. Затем белок растворяли в 6 М мочевине, центрифугировали и активировали белок в супернатанте целентеразином (1,2 молярный избыток) при 20-кратном разбавлении активационным буфером. Химерный белок (димер, с мол. массой 41 и 43 кДа) выделяли аффинной хроматографией на IgG-Agarose.

Характеристики его биолюминесценции близки к таковым рекомбинантного обелина WT: удельная активность 8,5 1015 кв/мг, константа спада биолюминесцентного сигнала – 5,9 с-1. Аффинность полученной химеры к иммуноглобулинам была продемонстрирована модельным твердофазным микроанализом иммуноглобулинов кролика, мыши и человека (Рис. 5).

Полученный фьюжин-белок proZZObe использовали в качестве Рис. 5. Твердофазный биолюминесцентный анализ иммобилизованных на поверхности иммуноглобулинов G – кролика (), мыши (), человека ().

биолюминесцентного репортера для определения антител к туберкулезному токсину и для определения альфафетопротеина в стандартных сыворотках. На Рис. 6 приведены схемы и результаты этих анализов. В случае определения антигена (АФП) поверхность активировали Fab2 фрагментами иммуноглобулинов, во избежание связывания proZZObe с иммуноглобулинами Рис. 6. Схемы и результаты иммуноанализа антител к туберкулезному токсину (слева) и АФП (справа) с использованием в качестве репортера химерного белка proZZ-Obe в стандартных сыворотках.

на поверхности. Некоторое сужение линейного диапазона в этом эксперименте может быть связано с насыщением поверхности лунок.

Результаты данных исследований показывают, что при экспрессии апообелина в виде единой полипептидной цепи с другими полипептидами он не теряет способность формировать активный фотопротеиновый комплекс:

полученный химерный белок обладает двумя функциями – биолюминесценцией и аффинностью белка А к Fc фрагментам иммуноглобинов G. Этот результат демонстрирует принципиальную возможность конструирования разнообразных химерных протеинов, обладающих активностью обелина и биоспецифичностью добавленных полипептидов (например, миниантител), которые без дополнительных модификаций представляют собой биолюминесцентные репортерные белки.

3. Биолюминесцентный иммуноанализ с использованием коньюгатов обелина в качестве меток.

Иммуноанализ альфафетопротеина (АФП).

Биотинилированные производные обелина, как и любого другого репортерного белка, в принципе являются универсальными метками, которые можно использовать для выявления любых биотинилированных молекул, используя высокоаффинный авидиновый или стрептавидиновый мостик. Пользуясь таким подходом, мы провели биолюминесцентный иммуноанализ альфафетопротеина в сыворотках. Схема анализа и его результаты приведены на Рис. 7. В лунки планшета вносили по 100 мкл раствора поликлональных АТ к АФП (5 мкг/мл, PBS) и инкубировали 1 ч при 37°С. После промывки PBS, содержащим 0,1% Tween-20, 5 мМ ЭДТА (ПБ), блокировали свободные места на поверхности 1% раствором БСА 1 ч при 37°С и промывали, как описано выше. Затем в лунки вносили по 100 мкл стандартных, тестовых или контрольных сывороток АФП, инкубировали 1 ч 37°С и промывали. Последовательное инкубирование растворов биотинилированных антител (2,5 мкг/мл, PBS) и авидина (2,5 мкг/мл, PBS) и промывки проводили аналогично. Раствор Obe-Bio (1,5 мкг/мл, 20 мМ Трис HCl, рН 7,0, 0,1М NaCl, 5 мМ ЭДТА) инкубировали при комнатной температуре 1-1,5 ч. После промывки биолюминесцентный сигнал Рис. 7. Схема и результаты биолюминесцентного твердофазного иммуноанализа АФП в контрольных сыворотках.

Каждая точка представляет среднее значение от 10-ти независимых определений.

связавшегося обелина измеряли с помощью планшетного люминометра Luminoscan v1.30, сразу после внесения в лунки по 100 мкл 0,1 М раствора CaCl2 в 20 мМ Трис HCl, рН 8,8. Полученная зависимость биолюминесцентного сигнала от концентрации АФП линейна во всем исследуемом диапазоне (5 – 200 нг/мл). Основные аналитические характеристики биолюминесцентного 1микроанализа сравнили с характеристиками пробирочного РИА (метка – I, МПП "ДИАС", г. Красноярск): чувствительность – 2-2,5 нг/мл (0,8-2,2 нг/мл);

процент связывания метки в нулевой сыворотке (фон) – 0,5% (1,5%); тест на определение концентрации в пробе, полученной при смешивании проб с известным содержанием АФП – 98-105% (90-110%). Таким образом, полученные результаты показывают, что биолюминесцентный иммуноанализ даже в таком многостадийном варианте по своим параметрам не уступает традиционному РИА. В отличие от изотопного варианта, биолюминесцентный вариант реализуется в микропланшетах, что обеспечивает более высокую производительность.

Иммуноанализ тиреотропина (ТТГ) и 2-х форм тироксина – общего (TT4) и свободного (FТ4).

Содержание ТТГ в сыворотках определяли одностадийно с помощью сэндвичиммуноанализа (см. схему на Рис. 8). Активацию лунок планшета проводили инкубированием мышиных анти-ТТГ-иммуноглобулинов (клон 10С7, мкг/мл, PBS, по 150 мкл/лунку) при 37oC, 1 ч, затем промывали и блокировали свободную поверхность, как описано ранее. После промывки в лунки вносили по 50 мкл сыворотки (стандартной, контрольной или клинического образца) и по 50 мкл раствора коньюгата Obe-IgG-5E8 (1 мкг/мл, PBS, 0,25% BSA, 5 мМ ЭДТА). Смесь инкубировали при встряхивании (18oC, 45 мин). Затем лунки промывали и измеряли биолюминесценцию обелина, как уже описано. На Рис.

8 приведена полученная зависимость биолюминесценции от концентрации ТТГ в стандартных сыворотках. Эту зависимость использовали для определения содержания гормона в контрольных (Immunotech, lot C104, Чехия) и клинических сыворотках. Чувствительность проведенного анализа составила 0,0097 µIU/мл (среднее значение стандартной нулевой сыворотки + 2SD).

Чувствительность радиоизотопного иммуноанализа ТТГ для наборов фирмы Immunotech – 0,01 µIU/мл. Для сравнения на рисунке приведен результат анализа с использованием раствора предварительно лиофилизированной метки, которую хранили в течение 2-х месяцев при 4-8oC. Видно, что результаты практически совпадают с таковыми для метки, хранившейся в растворе.

Результаты биолюминесцентного определения ТТГ в 34-х сыворотках пациентов сравнили с результатами РИА, полученными с помощью RIA gnost hTSH kit (CIS bio International, Франция) в клинической лаборатории Красноярской краевой больницы. Как видно из Рис. 8 (слева) результаты двух определений близки: полученные точки укладываются на прямую (R2=0,997) с угловым коэффициентом близким 1 и свободным членом близким 0.

Определение двух форм тироксина, общего (ТТ4) и свободного (FТ4), Рис. 8. Справа: Твердофазный биолюминесцентный иммуноанализ ТТГ в стандартных сыворотках с использованием метки до () и после лиофильной сушки (). Каждая точка представляет среднее от 8 независимых определений ± 1SD. µU – международные единицы (IRP80/558WHO).

Слева: Сравнение результатов радиоиммунного анализа (RIA) и биолюминесцентного (BLIA) иммуноанализа ТТГ в клинических сыворотках (n=34). На врезке – сравнение образцов с низким содержанием гормона.

проводили одностадийным конкурентным иммуноанализом по схемам, представленным на Рис. 9. и 10. При анализе общего Т4 поверхность активировали раствором мышиных анти-Т4-IgG (10 мкг/мл, PBS, 14 ч, 4-6°С, 100 мкл /лунку). После промывки и блокировки в лунки вносили по 20 мкл стандартных или контрольных сывороток и по 80 мкл коньюгата Obe-T4 (1 мкг/ мл, PBS, 5мM ЭДТА, 0,05% ANSA) и инкубировали при встряхивании (18oC, мин). Затем после промывки измеряли биолюминесценцию обелина, как описано выше. В процессе инкубирования сывороточный тироксин и тироксин в коньюгате с обелином конкурируют за связывание с иммуноглобулинами к Т4, иммобилизованными на поверхности лунок. Количество связанного коньюгата Obe-T4 обратно пропорционально содержанию ТТ4 в сыворотках.

Рис. 9. Твердофазный конкурентный иммуноанализ общего (ТТ4) тироксина в стандартных сыворотках. Каждая точка – среднее значение от определений ± 1SD.

Результаты представлены в полулогарифмических и прямых (на врезке) координатах. L0 – биолюминесценция от стандартной сыворотки с нулевым содержанием гормона; L – люминесценция от стандартных сывороток с различным содержанием TT4.

Используя полученную зависимость как калибровочную, определили содержание ТТ4 в контрольных сыворотках, (лот 112, Immunotech, Чехия).

Полученный при этом результат хорошо коррелировал с содержанием гормона, указанного производителем (Таблица 2).

При анализе свободного Т4 поверхность активировали раствором коньюгата Рис. 10. Слева: Твердофазный конкурентный иммуноанализ свободного тироксина (FТ4) в стандартных сыворотках. Каждая точка – среднее значение от 8 определений ± 1SD. Результаты представлены в полулогарифмических и прямых (на врезке) координатах. L0 – биолюминесценция от стандартной сыворотки с нулевым содержанием гормона; L – люминесценция от стандартных сывороток с различным содержанием FТ4. Справа: Сравнение результатов радиоиммунного (RIA) и биолюминесцентного иммуноанализа (BLIA) FT4 в клинических сыворотках (n=10).

гемоцианин-Т4 – HC-T4 (20 мкг/мл, PBS, ночь, 4°С, 100 мкл/лунку). После промывки в лунки вносили по 20 мкл стандартных, контрольных или клинических сывороток и по 80 мкл коньюгата мышиных анти-Т4-IgG–Obe (мкг/мл, PBS, 5 мM ЭДТА, 0,25% BSA) и инкубировали при встряхивании (18oC, 45 мин). После промывки измеряли биолюминесценцию иммобилизованного коньюгата анти-Т4-IgG–Obe. В процессе инкубирования сывороточный FT4 и T4 на поверхности конкурируют за связывание с коньюгатом анти-Т4-IgG–Obe.

Количество иммобилизованного анти-Т4-IgG-Obe обратно пропорционально содержанию FТ4 в сыворотках. Используя полученную зависимость как калибровочную кривую, определили содержание FT4 в контрольных (Immunotech, лот 005) и 10 клинических сыворотках. Результаты биолюминесцентного определения клинических образцов близки результатам РИА (Рис. 10).

Полученные нами основные параметры (содержание гормонов в соответствующих контрольных сыворотках и чувствительность) биолюминесцентного иммуноанализа (BLIA) сравнили с таковыми радиоизотопного иммуноанализа (RIA), (Таблица 2). Полученные при этом результаты показывают, что биолюминесцентная метка при иммуноанализе рассмотренных гормонов в сыворотках не уступает радиозотопной по чувствительности и надежности. При этом она лишена недостатков последней – безопасна, стабильна и позволяет проводить анализ в высокопроизводительном планшетном варианте.

Таблица 2. Аналитические параметры биолюминесцентного и радиоизотопного иммуноанализа ТТГ, ТТ4 и FT4.

Гормон Контрольные сыворотки Чувствительность (ед. конц.) BLIA RIA* BLIA** RIA* ТТГ 1,64 ± 0,1 1,41 – 2,(лотC104) 14,6 ± 0,715 11,3 – 16,9 0,01 0,(µU/мл) TT4 139,3 ± 9,9 100 – 1(лот 112) 232,3 ± 10,7 190 – 285 15 (нмол/мл) FT4 (лот 005) 9,41 ± 1,7 10 – 16,(пмол/мл) 42,1 ± 6,5 28 – 42 0,25 0,*www.immunotech.cz; **Чувствительность определяли как среднее значение сигнала от 8-ми определений стандартной нулевой сыворотки +2SD для ТТГ и – 2SD для TT4 и FT4.

Иммуноанализ инфекционных агентов Аналитические возможности фотопротеиновых меток были также исследованы на примере иммуноанализа двух инфекционных агентов – бактерии Shigella sonnei (LPS) и вируса гепатита В (HbsAg) в сыворотках. Для работы были использованы соответствующие коммерческие наборы реактивов, изготовленные НПО Аквапаст (Санкт-Петербург) и ЗАО Вектор-Бест (Новосибирск), основанные на колориметрическом выявлении антигена. В ходе нашего анализа в качестве биолюминесцентных меток использовали синтезированные коньюгаты обелина с соответствующими антителами.

Анализы проводили в сэндвич формате, аналогично описанному выше анализу ТТГ, и их чувствительность без проведения специальной оптимизации составила: для HbsAg 0,37 нг/мл (0,1-0,5 нг/мл, Вектор-Бест), а для S.sonnei LPS, 0,25 нг/мл (1 нг/мл, Аквапаст). Отметим, что чувствительность тестсистем на вирус гепатита В, выпускаемых рядом фирм – лидеров на рынке иммунодиагностикумов (Organon, Labsystems, Sanofi Diagnostics Pasteur, Behring) колеблется в диапазоне 0,5-0,1 нг/мл. Таким образом, даже без оптимизации условий анализа, обелиновая метка обеспечивает чувствительность иммуноанализа на уровне коммерческих диагностикумов.

Одновременный иммуноанализ двух антигенов в одном образце с использованием «цветных» мутантов обелина.

Для диагностирования ряда заболеваний и установления эффективности назначенной терапии часто необходим одновременный скрининг содержания двух и более веществ. Это особенно характерно для эндокринных заболеваний, где важно не только определить содержание того или иного гормона, но и баланса между ними. Раздельное определение таких пар или форм (например, свободной и связанной) гормонов может вносить существенные искажения в результаты анализа. Нами был разработан подход иммуноанализа, позволяющий одновременно определять два антигена в одном образце сыворотки. Для примера использовали два гормона – лютеинизирующий (ЛГ) и фолликулостимулирующий (ФСГ), определение которых всегда производится в паре при диагностике ряда нарушений функций генеративных органов.

Для работы в качестве репортеров были использованы мутантные формы обелина с измененными спектрами биолюминесценции, полученные сайтнаправленным мутагенезом аминокислот активного центра обелина. Спектры «фиолетового» мутанта W92F;H22E с max= 388 нм и «зеленого» мутанта Y138F с max = 492 нм (Рис. 11А) имеют малую область перекрывания, и их сигналы эффективно разделяются с помощью широкополосных оптических фильтров, установленных перед ФЭУ двухканального биолюминометра Рис 11. A: Нормированные биолюминесцентные спектры обелинов W92F;H22E (черный) и Y138F (серый); и спектры пропускания светофильтров: I – ФС6, II – ЖС16. Для сравнения на рисунке приведен спектр биолюминесценции обелина дикого типа (серый, штрих); Б: Пропускание биолюминесцентных сигналов смеси мутантов через светофильтры, встроенные в каналы I и II. Пунктиром показаны сигналы без светофильтров. Данные нормированы на концентрацию белка. Стрелками показан момент запуска реакции.

Таблица 3. Некоторые физико-химические свойства мутантных форм обелина в сравнении с обелином дикого типа.

ICa-free/ белок ICa-free/ Константа Биолюминесценция Активность Белок (отн.ед. ICa спада max/плечо (нм) % от WT мг-1) х10-8 (с-1) WT 482/400 100 210 8,6 6,W92F;H22E 388 10 68,2 30 6,Y138F 493/400 68 461,5 25 0,ICa-free – интенсивность кальций-независимой люминесценции ICa – интенсивность кальций-активируемой биолюминесценции (модель БЛМ 8802М2К, СКБ «Наука», Красноярск) (Рис. 11Б). Как видно из Таблицы 3, эти белки обладают высокой активностью и стабильностью, предел обнаружения этих белков составляет 4,2 и 12 аттомоль для Y138F и W92F;H22E, соответственно (Рис. 3). ЛГ и ФСГ представляют собой двухсубъединичные гликопротеиды, у которых -субъединицы структурно схожи и, таким образом, биологические и иммунологические свойства каждого гормона определяются его уникальной -субъединицей. Антитела к субъединице использовали для активации поверхности, а в качестве «цветных» биолюминесцентных меток использовали коньюгаты: мышиные анти--ФСГ IgG~W92F,H22E и мышиные анти--ЛГ IgG~Y138F. Анализ проводили по схеме, показанной на Рис. 12, слева. На этом же рисунке справа приведены Рис. 12. Схема проведения (слева) и результаты (справа) одновременного твердофазного иммуноанализа содержания ЛГ () и ФСГ () в стандартных сыворотках. Каждая точка представляет среднее значение от трех независимых определений ± SD.

результаты определения гормонов в смешанных стандартных сыворотках.

Чувствительность анализа при одновременном определении составила 0,мМЕ/мл для ФСГ и 1,1 мМЕ/мл для ЛГ (рассчитывали как среднее значение сигнала от нулевой сыворотки + 2SD, n=3). Чувствительность раздельного радиоизотопного иммуноанализа составляет 0,5 мМЕ/мл для каждого гормона (НПО Диас, Россия). Принимая во внимание, что одновременный биолюминесцентный анализ был выполнен без специальной оптимизации условий, полученные значения чувствительности можно считать вполне удовлетворительными и демонстрирующими перспективность предлагаемого подхода.

Последовательный иммуноанализ двух антигенов в одном образце с использованием обелина в тандеме с люциферазой Metridia longa.

Люцифераза Metridia longa представляет собой небольшой одноцепочечный белок (м.м. около 20 кДа), катализирующий реакцию окисления целентеразина молекулярным кислородом, с выделением кванта света (max=482 нм).

Клонирование генов, кодирующих несколько изоформ этого белка, получение бактериальных штаммов-продуцентов рекомбинантных белков проведено в Институте биофизики СО РАН (Markova V.V. et al., 2004). Для наших работ использовали одну из изоформ этой люциферазы – MLuc39. Белок выделяли из телец включений после ультразвуковой дезинтеграции рекомбинантых клеток E.coli. Тельца включения промывали последовательно раствором 20 мМ ТрисHCl, pH 7,0, 0,15 М NaCl, а затем 20 мМ Трис-HCl, pH 7,0, 0,5% Tween (трижды), и растворяли в 6 М растворе гуанидин-HCl и центрифугировали.

Полученный экстракт переводили в 100-кратный объем раствора, содержащего 20 мМ Трис-HCl pH 8,8, 5 мМ цистеина, 0,5 мМ цистина, 1 мМ ЭДТА, инкубировали в течение ночи при 4С, концентрировали и хроматографировали на колонке Superose 12 (GE Healthcare), уравновешенной 0,1 М NaHCO3. Для работы использовали фракцию белка с молекулярной массой 21 кДа.

Нами было обнаружено, что биолюминесцентная реакция люциферазы инициируется не только свободным целентеразином, но и целентеразином, иммобилизованным внутри Са2+-зависимого целентеразин-связывающего белка Renilla muelleri (CBP) (Titushin M.S. et al., 2008) при добавлении Са2+. При этом наблюдается увеличение интегрального биолюминесцентного сигнала в 1,раза (Рис. 13, слева). Предел обнаружения МLuc39 при использовании раствора целентеразина составляет 10 аттомоль, а при использовании в качестве «субстрата» СВР – 1 аттомоль (Рис. 13, справа). Для сравнения на этом же рисунке представлена зависимость биолюминесценции обелина от количества белка. По сравнению с люциферазным, сигнал обелина несколько ниже (в случае с использованием СВР – во всем диапазоне концентрации). Очевидно, наблюдаемая разница сигналов связана с принципиально различным устройством рассматриваемых биолюминесцентных систем: молекулы обелина непосредственно участвуют в реакции, а люцифераза катализирует окисление целентеразина растворенным кислородом, и в условиях избытка субстрата имеет место увеличение биолюминесцентного сигнала за счет большого числа оборотов фермента. Нами было показано, что CBP как «субстрат» обладает еще одним серьезным преимуществом.

Рис. 13. Слева: Биолюминесценция MLuc39 при запуске раствором целентеразина () или CBP (---); Справа: Зависимость биолюминесценции MLuc от количества белка. Реакцию инициировали 6,3 µМ целентеразином (-) или 6,3 µМ CBP+Са2+ (--). Для сравнения приведена зависимость биолюминесценции обелина (--) от количества белка.

Как известно, целентеразин быстро окисляется в растворе, что приводит к появлению фонового хемилюминесцентного сигнала и делает необходимым применение только свежеприготовленных препаратов реагента. В то время как целентеразин, иммобилизованный внутри белка, защищен от автоокисления:

СВР устойчив при длительном (более года) хранении в растворе при 4-8С, а также в замороженном и лиофилизированном виде.

Биотинилированные производные MLuc39 получали с использованием 2кратного молярного избытка N-гидроксисуксинимидного эфира биотинамидогексановой кислоты (Sigma) в 0,1 М NaHCO3, 0,25 M NaCl (мин, 4С). Реакцию останавливали добавлением глицина, который потом вместе с избытком реагента отделяли гель-фильтрацией. При этом люцифераза сохраняет 35-37% исходной биолюминесцентной активности.

Биотинилированные производные люциферазы (MLuc~Bio) и обелина (Obe~Bio) использовали в качестве репортеров для иммуноанализа гонадотропных гормонов ЛГ и ФСГ в смешанных стандартных сыворотках.

Биотинилирование антител к ЛГ и ФСГ (анти-ЛГ и анти-ФСГ) проводили 20-кратным избытком Bio~Su в PBS pH 8,5, 5 мМ ЭДТА, 1,5-2 ч при комнатной температуре, избыток реагента отделяли гель-фильтрацией. Комплексы MLuc– Bio~Stavi~Bio–анти-ФСГ и Оbе–Bio~Stavi~Bio–анти-ЛГ получали инкубированием биотинилированных белков со стрептавидином в течение мин при молярном соотношении MLuc–Bio (или Оbе–Bio): Stavi : Bio– анти-ФСГ (или Bio–антиЛГ), равном 2:1:1, а затем выделяли гель-фильтрацией на колонке Superdex 2(GE Healthcare), уравновешенной PBS, 5 мМ ЭДТА.

Анализ проводили по схеме, представленной на Рис. 14. Лунки планшета активировали антителами к ФСГ (10 мкг/мл, 0,1 М NaHCO3, по 100 мкл/лунку) Рис. 14. Схема проведения и результаты 1 ч при 37С и промывали.

анализа ФСГ () и ЛГ () в смешанных Блокировали свободную стандартных сыворотках с использованием двух биолюминесцентный репортеров.

поверхность 1% БСА в PBS (1 ч, 37С). После промывки вносили по 100 мкл смеси стандартных сывороток ЛГ и ФСГ с концентрациями: 1,25 и 80; 5 и 40; 10 и 20; 20 и 10; 40 и 5; 80 и 1,25 мМЕ/мл, соответственно, инкубировали 1 ч при 37С и снова промывали.

Затем в лунки вносили смесь меток в PBS, 5 мМ ЭДТА, 0,2% БСА, инкубировали при перемешивании 40 мин при 20С. После промывки биолюминесценцию обелина инициировали добавлением 100 мкл 0,1 М раствора CaCl2. Сигнал интегрировали в течение 5 сек, а затем инициировали биолюминесценцию люциферазы добавлением в те же лунки по 50 мкл CBP (мкМ, 20мМ ТрисHCl, 5 мМ ЭДТА) и измеряли сигнал в течение 20 сек.

Результаты анализа представлены на Рис. 14. Во всем диапазоне измерений величина сигналов, полученных от люциферазы, выше, чем от обелина, поскольку фермент работает в условиях избытка по субстрату. Суммарное время измерения сигналов составляет 25 сек, т.е. для измерения стандартного 96-луночного планшета необходимо 40 мин. В предложенном варианте анализа биолюминесцентные реакции обоих репортеров фактически запускаются одним реагентом – СаСl2, измерения проводятся в планшетном биолюминометре и не требуют дополнительных оптических устойств, связанных с многоволновой детекцией сигнала, как в случае одновременного анализа с «цветными» мутантами обелина 4. Гибридизационный биолюминесцентный анализ с использованием фотопротеина обелина.

Чувствительность детекции продуктов полимеразной цепной реакции является важным фактором при диагностике различных заболеваний.

Существующие на сегодняшнем рынке диагностические системы основаны либо на качественном обнаружении ДНК-мишени методом гель-электрофореза, либо на колориметрическом определении с помощью репортерных ферментов (щелочная фосфатаза, пероксидаза хрена и пр.). Эти методы обладают недостаточно высокой чувствительностью и большими временными затратами.

Системы, основанные на анализе продуктов ПЦР в реальном времени (Real time PCR assay), достаточно дороги. В данном разделе приведены результаты исследований применения коньюгатов обелина с авидином или стрептавидином для выявления продуктов гибридизации в твердофазном анализе в сравнении с таким же коньюгатом щелочной фосфатазы. Эксперименты по колориметрическому выявлению проводились И.А. Пышной (ИХБФМ СО РАН, Новосибирск). В качестве твердофазного носителя были исследованы мелкодисперсный отечественный полимер на основе диметакрилового эфира этиленгликоля – ДМЭГ-7 (Институт особо чистых препаратов, СанктПетербург) и ряд коммерческих планшетов разных производителей с различными активированными поверхностями лунок. Модельную ДНКматрицу выявляли методом молекулярной гибридизации с помощью зонда ЗI (5’-TCAGGCAGTACCACAAGGCC), иммобилизованного на поверхность. В качестве ДНК-матрицы использовали олигонуклеотид МI (5’GTTGCGAAAGGCCTTGTGGTACTGCCTGA) или МI*, содержащий на 3’- Рис. 15. Схема проведения гибридизационного анализа.

А) – Выявление биотинилированной ДНК-матрицы MI* с иммобилизованным зондом ЗI; Б) – Выявление немеченой ДНК-матрицы MI путем ферментативного удлинения иммобилизованного зонда ЗI в составе гибридизационного комплекса в присутствии биотин-содержащего нуклеотидтрифосфата dUTP* и Taq-ДНК-полимеразы.

конце остаток биотина (*). Введение биотина в состав гибридизационного комплекса осуществляли гибридизацией иммобилизированного зонда ЗI с матрицей МI* (10-7 10-12 М, 30 мин, 62С) (Рис. 15А) или ферментативным удлинением иммобилизированного зонда ЗI в составе комплекса ЗI/МI с помощью Taq-ДНК-полимеразы в присутствии биотинилированного дезоксиуридинтрифосфата dUTP* (30 мин, 62С) (Рис. 15Б). В последнем случае метка оказывается ковалентно связанной с носителем, что позволяет, без потери специфичного сигнала выявления, применять более жесткие процедуры отмывки для снижения фонового сигнала. На Рис. 16 приведены результаты выявления ДНК-матрицы МI на поверхности ДМЭГ с иммобилизованным Рис. 16. Зависимость сигнала от концентрации выявляемой ДНКматрицы при проведении анализа на поверхности полимерных частиц ДМЭГ: (а) – колориметрическое выявление:

зависимость окраски полимера от концентрации ДНК-матрицы через 10 (1), 30 (2), 120 (3) мин после добавления субстратов BCIP + NBT, (IOD – интенсивность оптической плотности в шкале серых тонов), на врезке – сканированное изображение частиц в лунках через те же промежутки времени, где н/с – неспецифический сигнал; (б) – биолюминесцентное выявление с использованием коньюгата обелин-авидин.

олигонуклеотидным зондом ЗI. Биотиновую метку вводили в последовательность зонда ЗI с помощью Taq-ДНК-полимеразы (по схеме на Рис. 15Б) в течение 30 мин при 62оС. Данная температура проведения реакции обеспечивает условия эффективного комплексообразования ( 0.5), поскольку температура плавления комплекса в условиях проведения реакций составляет 65,9оС и близка к температурному оптимуму Taq-ДНК-полимеразы. В случае колориметрического анализа после 10-минутного инкубирования с хромогенными субстратами для щелочной фосфатазы BCIP+NBT окрашивание полимера наблюдали только в случае концентрации анализируемой ДНКматрицы МI 10-7 и 10-8 М. Через 2 ч достоверный сигнал регистрировали в лунке с концентрацией МI 10-10 М (Рис. 16а). Окраска полимера в последней лунке (концентрация матрицы МI 10-11 М) практически совпадала с неспецифической фоновой окраской полимера (н/с), которая накапливалось за это же время. При использовании обелиновой метки (Рис. 16б), зависимость биолюминесцентного сигнала от концентрации матрицы была линейна (R2 = 0.91) во всем исследуемом диапазоне концентраций. Сканирование сигнала от каждого образца производили в течение 5 сек. Таким образом, информацию о содержании анализируемой матрицы в 5 образцах получали всего через 25 сек.

При этом биолюминесцентная метка позволяет определять наличие матрицы МI в концентрации 10-11 М.

Для проведения твердофазного анализа весьма удобным является микропланшетный формат. В наших экспериментах были использованы три вида планшет NucleoLinkTM Strip, CovaLinkTMNH (Nalge Nunc International, США) и DNA-BINDTM (Costar, США), содержащих на поверхности лунок различные реакционноспособные группы. При этом сравнение меток при проведении анализа в планшетах всех видов выявило одинаковые закономерности. Для примера на Рис. 17 приведены результаты, полученные с использованием планшет DNA-Bind. При биолюминесцентном способе обнаружения модельных матриц МI* (по схеме на Рис. 15.А) и МI (по схеме на Рис. 15.Б) сигналы имеют хорошую воспроизводимость (разброс 5-10%, n=4), и их величина линейно зависит от концентрации матрицы в диапазоне от 10-8 М до 10-12 М (R2 = 0,97). Предел обнаружения матриц МI* и МI составляет 10-11 М.

Этот предел определяли как концентрацию матрицы, при которой сигнал (0,и 0,026 для МI* и МI, соответственно) достоверно отличается от контрольного, плюс 2SD. Полученную линейную зависимость сигнала от концентрации матриц можно использовать как калибровочную кривую для определения содержания данной ДНК-матрицы в исследуемом растворе. Колориметрическое выявление в аналогичном варианте после 4-часового инкубирования достоверно обнаруживает в образце 10–10 М ДНК-матрицы. В области высоких концентраций внесенной матрицы (10-610-8 М) для обеих меток разницы между сигналами практически нет. Очевидно, это связано с насыщением поверхности лунок при данных концентрациях олигонуклеотидов в образцах.

Рис. 17. Результаты выявления ДНК-матриц МI*() и МI () на планшетах DNA-Bind: (а) – биолюминесцентная метка коньюгат обелинстрептавидин, (б) – колориметрическая метка (1 – через 15мин, 2 – через 4 ч после внесения субстрата-NPP).

Особый интерес представляют эксперименты по выявлению ПЦРпродуктов вируса гепатита С (ВГС), выделенных из разных клинических образцов. Амплифицированные фрагменты кДНК вируса гепатита С (ВГС), были любезно предоставлены Пышной И.А. (ИХБФМ СО РАН).

Двухцепочечный ПЦР-фрагмент длиной 230 п.о. был предварительно денатурирован. Биотиновую метку в последовательность зонда ЗI вводили с помощью Taq-ДНК-полимеразы (по схеме на Рис. 15Б). На Рис. 18 приведены результаты определения одного из фрагментов на поверхности планшет DNA Bind. Видно, что, как и в модельных экспериментах, для колориметрического анализа существенным параметром является возможность накопления сигнала, и, если в первые 30-60 мин интенсивность окраски в пробах практически не отличается от контрольной, то через 4 ч можно выявить матрицу в образце с 500-кратным разбавлением (Рис. 18б). Для обелиновой метки ДНК-матрица выявляется непосредственно в момент внесения раствора CaCl2 в лунки и, как Рис. 18. Выявление ПЦР-фрагмента ВГС на планшетах DNA-Bind.

По оси абсцисс указаны разбавления образца ПЦР-фрагмента, «Н2О» – контрольный образец (вода вместо раствора ДНК). (а) – биолюминесцентная метка коньюгат обелин-стрептавидин; (б) – колориметрическая метка через 4 ч после внесения субстрата NPP; на врезке – кинетика накопления колориметрического сигнала при внесении матрицы с разбавлением в 20 (1), 100 (2) и 500 (3) раз.

показано на Рис. 18(а), сигнал от образца с 1000-кратным разведением целевой ДНК достоверно (более чем в 2 раза) отличается от контрольной пробы.

Таким образом, в ходе проведенных экспериментов нами показано, что биолюминесцентная метка, представляющая собой химические коньюгаты Са2+регулируемого фотопротеина обелина с авидином (Рис. 16) или стрептавидином (Рис. 17 и 18) может успешно использоваться для выявления ДНК фрагментов методом молекулярной гибридизации. При этом она обладает рядом преимуществ по сравнению с колориметрической меткой. Это: высокая (более чем на порядок) чувствительность; простота запуска реакции (надо только добавить раствор СaCl2) и регистрации сигнала; возможность получения результата практически сразу после проведения анализа (отсутствуют процедуры длительного инкубирования ферментативной метки с субстратом, а также остановки реакции); величина биолюминесцентного сигнала фотопротеина линейно зависит от его количества, что позволяет строить соответствующие калибровочные кривые и не только определять наличие целевой ДНК-последовательности, но и оценивать ее количество; высокая чувствительность выявления позволяет проводить ПЦР-анализ с меньшим количеством циклов ПЦР, что позволяет повысить его специфичность.

ВЫВОДЫ 1. Разработан эффективный способ получения рекомбинантного Са2+регулируемого апофотопротеина обелина из штамма-суперпродуцента E.coli BL21gold (pET19-OL8). Разработанный подход успешно использован для выделения ряда мутантных вариантов апообелина и других рекомбинантных целентеразин-связывающих Са2+-активируемых белков, полученных на основе аналогичной экспрессирующей конструкции. Выход высокоочищенных апобелков – 30-45 мг на грамм сырой клеточной пасты.

2. Разработаны эффективные условия получения активированного рекомбинантного обелина дикого типа в практически индивидуальном состоянии с выходом 75-80% от исходного апобелка. Выход активированных мутантных вариантов обелина в тех же условиях зависит от произведенных аминокислотных замен.

3. Рекомбинантный обелин дикого типа обладает физико-химическими свойствами, близкими природному обелину: удельная биолюминесцентная активность: 6,3х1015 кв мг-1; константа спада биолюминесцентного сигнала: kd = 6,6 с-1; спектральные характеристики свечения: max=482 нм, плечо при =390 нм; спектр абсорбции содержит две характерные полосы с max1=2нм, Е1мг/мл=2,5 и max2=460 нм, Е2мг/мл=0,022. Предел обнаружения рекомбинантного обелина составляет 1,4 аттомоль. Белок обладает относительной стабильностью к действию протеаз. Определены условия хранения в растворе, замороженном и лиофилизированном виде без потери биолюминесцентной активности.

4. Разработан эффективный способ получения коньюгатов обелина с биоспецифичными молекулами (гаптенами, иммуноглобулинами, авидином или стрептавидином), позволяющий сохранить 75-80% исходной биолюминесцентной активности белка. Полученные производные стабильны в условиях проведения модельного анализа, при хранении в растворе, а также в замороженном и лиофилизированном виде.

5. На примере твердофазного иммуноанализа ряда биологически важных веществ в сыворотках (гормонов, инфекционных агентов и др.) показано, что полученные коньюгаты обладают чувствительностью, равной или близкой радиоизотопной метке, широким линейным диапазоном, низким уровнем шума, безопасны и стабильны в условиях анализа и при хранении.

Биолюминесцентная реакция обелиновых меток отличается простотой (надо только добавить раствор Са2+) и высокой скоростью (на измерение стандартного 96-луночного планшета требуется 8 мин).

6. На примере твердофазного иммуноанализа двух гонадотропных гормонов показано, что репортеры на основе мутантных вариантов обелина с измененными характеристиками свечения позволяют одновременно и с высокой чувствительностью определять две мишени в одном образце сыворотки: сигналы от каждой мишени эффективно разделяются с помощью широкополосных оптических фильтров.

7. Разработан вариант иммуноанализа двух антигенов с использованием двух разных репортеров – обелина и люциферазы Metridia с последовательным запуском биолюминесцентных реакций. Показано, что применение в качестве «субстрата» люциферазы Са2+-зависимого целентеразин-связывающего белка Renilla позволяет инициировать биолюминесценцию обеих меток ионами Са2+.

8. Коньюгаты обелин-авидин (или стрептавидин) являются высокочувствительными и быстрыми репортерами для определения биотинилированных олигонуклеотидов в гибридизационном анализе продуктов ПЦР. Использование биолюминесцентого репортера исключает стадии длительного инкубирования с субстратом и остановки ферментативной реакции и позволяет определять 10–11М (10-15 моль) матрицы, что на порядок выше чувствительности аналогичного колориметрического репортера на базе щелочной фосфатазы.

Список публикаций Статьи в научных журналах.

1. Vysotski E.S., Trofimov C.P., Bondar V.S., Frank L.A., Markova S.V, Illarionov B.A. Mn2+-activated luminescence of photoprotein obelin. // Arch. Biochem.

Biophys.-1995. - Vol.315. - P. 92-99.

2 Frank L.A., Illarionova V.A., Vysotski E.S. Use of proZZ-obelin fusion protein in bioluminescent immunoassay. // Biochem. Biophys. Res. Commun. -1996. –V.

219. - P. 475-479.

3 Франк Л.А., Высоцкий Е.С., Петунин А.И., Навдаев А.В. Са2+активируемый фотопротеин обелин как метка в иммуноферментном анализе. // Иммунология. -1997.– № 1. -C. 59-61.

4 Illarionov B.A., Frank L.A., Illarionova V.A., Bondar V.S., Vysotski E.S., Blinks J.R. Recombinant obelin: cloning and expression of cDNA, purification and characterization as a calcium indicator. // Methods in Enzymology. -2000.- V. 305. - P. 223-249.

5. Бондарь В.С., Пуртов К.В., Маликова Н.П., Франк Л.А., Илларионов Б.А. О роли консервативного Cys158 при образовании активного фотопротеинового комплекса обелина. // Биохимия. - 2001, - Т. 66. - С.1245-1251.

6. Vysotski E.S., Liu Zhi-Jie, Markova S.V., Blinks J.R., Deng Lu, Frank L.A., Herko M., Malikova N.P., Rose J.P., Wang Bi-Cheng, Lee J. Violet bioluminescence and fast kinetics from W92F obelin: Structure-Based proposals for the bioluminescence triggering and the identification of the emitting species. // Biochemistry. - 2003. - V. 42. - P. 6013-6024.

7. Malikova N.P., Stepanyuk G.A., Frank L.A., Markova S.V., Vysotski E.S., Lee J.

Structural tuning of obelin bioluminescence by mutations of Trp92. // FEBS Lett.

- 2003. - V. 554. - P. 184-188.

8. Франк Л.А., Петунин А.И., Высоцкий Е.С. Синтез конъюгатов Са2+регулируемого фотопротеина обелина с иммуноглобулинами и их использование в качестве меток в иммуноанализе. // Биоорган. хим. - 2004. - Т.30. - С. 364-368.

9. Frank L.A., Petunin A.I., Vysotski E.S. Bioluminescent immunoassay of thyrotropin and thyroxine using obelin as a label. // Anal. Biochem. - 2004. - V.

305. - P. 240-246.

10. Markova S.V., Golz S., Frank L.A., Kalthof B., Vysotski E.S. Cloning and expression of cDNA for a luciferase from the marine copepod Metridia longa. // J. Biol. Chem. - 2004. - V. 279. - P. 3212-3217.

11. Stepanyuk G.A., Golz S., Markova S.V., Frank L.A., Lee J., Vysotski E.S.

Interchange of aequorin and obelin bioluminescence color is determined by substitution of one active site residue of each photoprotein. // FEBS Lett. - 2005. - V. 579. - P. 1008–1014.

12. Высоцкий Е.С., Маркова С.В., Франк Л.А. Кальций-регулируемые фотопротеины морских кишечнополостных. Молекуляр. биология. 2006. Т.

40. С. 404-417.

13. Frank L., Markova S., Remmel N., Vysotski E., Gitelson I. Bioluminescent signal system: bioluminescence immunoassay of pathogenic organisms. // Luminescence.- 2007. - V. 22. - P. 215–220.

14. Titushin M.S., Markova S.V., Frank L.A., Malikova N.P., Stepanyuk G.A., Lee J., Vysotski E.S. Coelenterazine-binding protein of Renilla muelleri: cDNA cloning, overexpression, and characterization as a substrate of luciferase. // Photochem. Photobiol. Sci. - 2008. - V. 7. - P. 189-196.

15. Borisova V.V., Frank L.A., Markova S.V., Burakova L.P., Vysotski E.S.

Recombinant Metridia luciferase isoforms: expression, refolding and applicability for in vitro assay. // Photochem. Photobiol. Sci. - 2008. – V. 7. - P. 1025-1031.

16. Frank L.A., Borisova V.V., Markova S.V., Malikova N.P., Stepanyuk G.A., Vysotski E. S. Violet and greenish photoprotein obelin mutants for reporter applications in dual-color assay. // Anal. Bioanal. Chem. - 2008. -V. 391.- P.

2891–2896.

17. Борисова В.В., Пышная И.А, Пышный Д.В., Франк Л.А.

Высокочувствительный и быстрый метод выявления ДНК-фрагментов с использованием фотопротеина обелина как репортера. // Биоорган. химия. - 2008. - Т. 34. - С. 792-798.

18. Франк Л.А., Борисова В.В., Верещагина Т.А., Фоменко Е.В., Аншиц А.Г., Гительзон И. И. Выделение рекомбинантных белков с использованием аффинных магнитных сорбентов на основе микросфер энергетических зол.

// Прикл. биохим. микробиол. - 2009. - Т. 45. - С. 237–242.

Статьи в сборниках научных конференций.

19. Frank L.A., Markova S.V., Illarionova V.A., Illarionov B.A., Vysotski E.S.

Calcium-activated photoprotein obelin derivatives in immunoassay: perspectives.

// In: Bioluminescence and Chemiluminescence. Fundamentals and Applied Aspects. Eds: A.K. Campbell, L.J. Kricka, P.E. Stanley. John Wiley & Sons, Chichester. 1994. P. 249-220. Frank L.A., Vysotski, E.S. Bioluminescent immunoassay of alphafetoprotein with Ca2+-activated photoprotein obelin. // In: Bioluminescence and Chemiluminescence. Molecular Reporting with Photons. Eds: J.W. Hastings, L.J.

Kricka, P.E. Stanley. John Wiley & Sons. Chichester. 1997. P. 439-4 21. Bondar V.S., Frank L.A., Inzhevatkin E.V., Malikova N.P., Illarionova V.A., Vysotski E.S. Bioluminescent activity of the recombinant obelin after chemical modification of histidine and cysteine residues. // In: Bioluminescence and Chemiluminescence. Perspectives for the 21-th Century. Eds: A. Roda, M.

Pazzagli, L.J. Kricka, P.E. Stanley. John Wiley& Sons. Chichester. 1999. P. 400403.

22. Frank L.A., Efimenko S.A., Petunin A.I., Vysotsky E.S. Chimeric protein proZZ-Obe as universal label for bioluminescent immunoassay. // In:

Bioluminescence and Chemiluminescence. Perspectives for the 21-th Century.

Eds: A. Roda, M. Pazzagli, L.J. Kricka, P.E. Stanley. John Wiley& Sons.

Chichester. 1999. P. 111-114.

23. Bondar V.S, Frank L.A., Vysotski E.S. Efficiency of apophotoprotein charging depends strongly on protein concentration. // In: Bioluminescence & Chemiluminescence 2000. Eds: J.F. Case, P.J. Herring, B.H. Robison, S.H.D.

Haddock, L.J. Kricka, P.E. Stanley. World Scientific. Singapore. 2001. P. 139-124. Frank L.A., Bondar V.S., Vysotski E.S. Sensitivity of obelin and apoobelin to digestion by some proteases. // In: Bioluminescence & Chemiluminescence 20Eds: J.F. Case, P.J. Herring, B.H. Robison, S.H.D. Haddock, L.J. Kricka, P.E.

Stanley. World Scientific. Singapore. 2001. P. 55-25. Markova, S.V. Apoobelin biotinylated in vivo: overproduction in Esherichia coli cells. / S.V. Markova, G.A. Stepanyuk, L.A. Frank, E.S. Vysotski. // In:

Bioluminescence and Chemiluminescence. Progress and current application. Eds:

P.E. Stanley, L.J. Kricka. World Scientific. Singapore. 2002. P. 107-110.

26. Frank L.A., Borisova V.V., Vysotski E.S. Calcium-regulated photoprotein obelin as a label in immunoassay: an outlook for applications. // In: Bioluminescence and Chemiluminescence. Progress and Perspectives. Eds: A. Tsuji, M. Matsumoto, M.

Maeda, L.J. Kricka, P.E. Stanley. World Scientific. Singapore. 2005. P. 463-466.

27. Eremeeva E.V., Markova S.V., Frank L.A., Vysotski E.S. The main function of His175, Trp179 and Tyr190 residues of the obelin binding site is to stabilize the hydroperoxycoelenterazine intermediate. // In: Bioluminescence & Сhemiluminescence: chemistry, biology and applications. Eds: A. Szalay P. Hill L. Kricka, P. Stanley. World Scientific. Singapore. 2007. P. 7-10.

28. Borisova V.V., Frank L.A., Markova S.V., Golz S., Vysotski E.S. Refolding of the recombinant luciferases of Metridia longa. // In: Bioluminescence & Сhemiluminescence: chemistry, biology and applications. Eds: A. Szalay P. Hill, L. Kricka, P. Stanley. World Scientific. Singapore. 2007. P.3-6.

29.Франк Л.А., Бондарь В.С., Тюлькова Н.А., Высоцкий Е.С.. Са2+активируемый фотопротеин обелин и бактериальная люцифераза в иммунологическом микроанализе.- Препринт № 113Б, Красноярск: Изд-во ИФ СО РАН, 1992, 22с.

30.Борисова В.В., Франк Л.А., Маркова С.В., Высоцкий Е.С. «Способ одновременного определения двух аналитов биолюминесцентным молекулярным микроанализом». Заявка на патент № 2008122723/15(027309) от 24.06.2008.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.