WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!

 

                                                                       На правах рукописи

ЧЕРНЫШЕВ АЛЕКСЕЙ АНАТОЛЬЕВИЧ        

Усовершенствование метода диагностики

нозематоза медоносных пчел

06.02.05 – Ветеринарная санитария, экология, зоогигиена и

ветеринарно-санитарная экспертиза

АВТОРЕФЕРАТ

диссертации  на соискание ученой степени

кандидата биологических наук

Москва – 2012

Работа выполнена в лаборатории ветеринарной санитарии в пчеловодстве ГНУ «Всероссийский научно-исследовательский институт ветеринарной санитарии, гигиены и экологии» Российской академии сельскохозяйственных наук

Научный руководитель:

кандидат биологических наук, доцент

Сохликов Алексей Борисович,

(ГНУ ВНИИВСГЭ)

Официальные оппоненты:

доктор биологических наук, профессор

Павлова Инна Борисовна,

ГНУ ВНИИВСГЭ, ведущий  научный сотрудник лаборатории санитарной микробиологии

доктор биологических наук

Бондаренко Владимир Олегович,

ФГБУ «ВГНКИ», ведущий научный сотрудник отдела качества и стандартизации фармакологических лекарственных средств для животных

Ведущая организация:

ФГОУ ВПО «Московская Государственная

академия ветеринарной медицины и биотехнологии им. К.И. Скрябина

(ФГОУ ВПО МГАВМиБ)

Защита состоится « 03 » октября 2012 г. в 11:00 часов на заседании диссертационного совета Д 006.008.01 при ГНУ «Всероссийский научно-исследовательский институт ветеринарной санитарии, гигиены и экологии» по адресу: 123022, Москва, Звенигородское шоссе, дом 5.

С диссертацией можно ознакомиться в библиотеке ГНУ «Всероссийский научно-исследовательский институт ветеринарной санитарии, гигиены и экологии» Россельхозакадемии.

Автореферат разослан  « ____ »  ___________ 2012  г.

Ученый секретарь

диссертационного совета,

кандидат биологических наук  Крутько Н.С.

1. Общая характеристика работы

Актуальность темы

  В настоящее время во многих странах мира отмечено нарастание массовой гибели пчелиных семей неустановленной  этиологии. Так называемый молниеносный коллапс (синдром массовой гибели пчел) многие авторы связывают с инфекцией  медоносных пчел, вызываемой микроспоридией  Nosema ceranae (Fries I., Martin R., Higes M. 2006; Garcia P., Martinndez R., 2007; Meana A., 2007; Hornitzky M., 2008; Chen Y., Pettis J. 2008). Этот вид ноземы был впервые выделен в 1996 г (I. Fries et al.,) из горных китайских пчел Apis cerana. Заболевание нозематозом медоносных пчел, вызываемое микроспоридией Nosema apis (Zander, 1909) хорошо изучено и описано в литературе (Fries I., Fen F., 1996; Meloun L., Geythaus H., 2001; Hatjina F., Haristis L., 2005).

Видовая идентификация возбудителей нозематоза затруднена, так как морфологические различия Nozema арis и Nosema ceranae незначительны и не могут быть установлены традиционными методами исследования. С этой целью применяют специальные методы: электронную микроскопию и молекулярно-генетические методы, в частности полимеразную  цепную реакцию (ПЦР) (Blanchard P., Ribieri M., Celle O., 2007; Hornitzky M., 2008; Giersch T., Galey F., 2009). В последние годы нозематоз широко распространяется по всей территории России и  наносит значительный экономический ущерб пчеловодству. Это вызывает необходимость разработки мер по предупреждению распространения нозематоза пчел на пасеках.

Цель и задачи исследований

Цель работы  разработать метод видовой идентификации возбудителей нозематозной инфекции, а также определить меры по предупреждению распространения нозематоза пчел на пасеках.

Для достижения этих целей были поставлены следующие задачи:

1. Изучить эпизоотическую ситуацию по нозематозу пчел на пасеках Московской области в период 2009 – 2011 гг.

2. Разработать метод видовой идентификации возбудителей нозематоза пчел с использованием полимеразной цепной реакции.

3. Изучить влияние микроспоридии Nosema ceranae на жизнедеятельность и продуктивность семей пчел.

4. Разработать меры по предупреждению распространения нозематоза пчел на пасеках.

Научная новизна исследований

Определена эпизоотическая ситуация по нозематозу пчел на пасеках Московской области  в период 2009 – 2011 гг.

Методом ПЦР «в реальном времени» идентифицирован возбудитель Nosema ceranae в семьях пчел, пораженных нозематозом.

Установлено влияние Nosema ceranae на жизнедеятельность и продуктивность пчелиных семей.

Разработан метод лазерной интерференционной микроскопии для контроля качества дезинфекции при нозематозе пчел, который позволяет выявить морфометрические различия (фазовая толщина и диаметр) живых и погибших спор микроспоридий рода Nosema.

Разработаны меры по предупреждению распространения нозематоза пчел на пасеках.

Практическая значимость работы

На основании проведенных исследований разработаны:

1. «Методические рекомендации по определению жизнеспособности спор микроспоридий рода Nosema методом лазерной интерференционной микроскопии» (утв. Отделением ветеринарной медицины РАСХН 15.06.2009 г), п.п. 3, 4;

2. «Методическое пособие по идентификации возбудителей нозематоза медоносных пчел методом ПЦР «в реальном времени» (утв. Отделением ветеринарной медицины РАСХН 09.11.2011 г), п.п. 2, 4;

3. «Методическое пособие о мерах по предупреждению распространения нозематоза пчел на пасеках» (рассмотрено и одобрено на секции «Патология пчел,  рыб и охрана полезных гидробионтов» отделения ветеринарной медицины РАСХН, протокол №2 от 26.04.2012 г), п.п. 3, 4.

Апробация работы

Материалы исследований и основные положения диссертации доложены и обсуждены: на заседаниях Ученого совета ГНУ ВНИИВСГЭ в 2009 – 2011 гг.; на 2-ой Международной научно-практической конференции преподавателей, молодых ученых, аспирантов и студентов «Инновационные процессы в АПК», посвященной 50-летию образования РУДН (Москва, 2010 г.); на секции «Патология пчел,  рыб и охрана полезных гидробионтов» Отделения ветеринарной медицины РАСХН (Москва, 2011, 2012 гг.).

Публикации

По материалам диссертации опубликовано 5 научных работ, 4 из них в научных журналах, рекомендованных ВАК РФ.

Положения выносимые на защиту:

       1. Изучение эпизоотической ситуации по нозематозу пчел на пасеках Московской области в период 2009 – 2011 гг.

       2. Разработка метода полимеразной цепной реакции для видовой идентификации возбудителей нозематоза пчел.

       3. Изучение влияния микроспоридии Nosema ceranae на жизнедеятельность и продуктивность семей пчел.

4. Меры по предупреждению распространения нозематоза пчел на пасеках.

Объем и структура работы

Диссертационная работа состоит из введения, обзора литературы, материалов и методов исследований, результатов собственных исследований и их обсуждения, выводов и практических предложений, списка литературы и приложения. Материал изложен на 106 страницах машинописного текста, включая 7 таблиц, 11 рисунков. Список литературы содержит 351 источник отечественных и зарубежных авторов.

2. Материалы и методы исследований

Экспериментальную часть исследований  проводили в период 2009 – 2011 гг. в лаборатории ветеринарной санитарии в пчеловодстве, на экспериментальной пасеке  ГНУ ВНИИВСГЭ, а также на пасеках Московской области.

Исследования проводили согласно принятым документам:

       - Основные методические требования к постановке экспериментов в пчеловодстве (М., ВАСХНИЛ, 1971 г.);

       - Методические указания по диагностике нозематоза медоносных пчел. (Утв. ГУВ МСХ СССР от 25.04.1985 г.);

       - Инструкция по дезинфекции, дезакаризации, дезинсекции и дератизации на пасеках. (Утв. ГУВ МСХ СССР от 25.06.1982 г.);

       - Инструкция о мероприятиях по предупреждению и ликвидации болезней, отравлений и основных вредителей пчел. (Утв. Департаментом ветеринарии РФ 17.08.1998 г.).

Препараты их живых пчел готовили по методике В.И. Полтева (1936).

Изучение эпизоотической ситуации по нозематозу на территории Московской области в период 2009 – 2011 гг. проводили на пасеках членов Московского общества пчеловодов-любителей, где была зарегистрирована гибель пчелиных семей.

Мертвых пчел (подмор) по 50 – 100 шт. от каждой пчелиной семьи в лаборатории помещали на фильтровальную бумагу, просматривали каждую пчелу с помощью лупы, отмечали  наличие клещей Varroa destructor или других паразитов. Затем проводили диагностику на наличие микроспоридий рода Nosema. Всего исследовано  200  проб.

Для видовой идентификации спор микроспоридий рода Nosema разработан метод ПЦР «в реальном времени».

В качестве стимулятора повышения репродуктивной активности пчелиных маток использовали препарат апистим (изготовитель: ООО «Аписфера 2000», Москва),  в качестве контроля –  цветочную пыльцу.

Степень поражения пчелиных семей спорами микроспоридий рода Nosema определяли  после выставки семей пчел из зимовника, затем формировали опытные и контрольные группы семей пчел. При этом учитывали: породу пчел, возраст пчелиных маток, силу пчелиных семей в улочках, кормообеспеченность, количество открытого и печатного расплода, степень поражения семей нозематозом. Идентификацию двух видов возбудителей нозематоза не проводили.

При определении влияния стимулирующих подкормок на развитие нозематоза в семьях учитывали:

       - среднее число спор микроспоридий рода Nosema в пробах пчел (интенсивность инфекции),  млн.;

- количество пчел, пораженных микроспоридией рода Nosema (экстенсивность инфекции),  %.

После проведения стимулирующих подкормок отмечали репродуктивную активность пчелиных маток, общее состояние семей пчел и их работоспособность.

Изучение выживаемости возбудителя нозематоза пчел и разработку режимов дезинфекции объектов пчеловодства проводили в соответствии с методиками по дезинфекции и санитарии в пчеловодстве.

В качестве дезинфицирующих средств использовали: уксусную кислоту (80%-ной концентрации) и 6%-ный раствор пероксида водорода с добавлением 0,5% уксусной кислоты.

В связи с тем что микроспоридий рода Nosema не культивируются на питательных средах, качество дезинфекции контролировали методом проведения биопробы и согласно Методическим рекомендациям по определению жизнеспособности спор микроспоридий рода Nosema методом лазерной интерференционной микроскопии. (Утв. Отделением ветеринарной медицины РАСХН 15 июня 2009 г. ).

3. Результаты собственных исследований

3.1. Изучение эпизоотической ситуации по нозематозу на пасеках Московской области в период 2009 2011 гг.

Результаты изучения эпизоотической ситуации по нозематозу на пасеках Московской области  представлены в таблице 1.

Таблица 1

Результаты  исследования проб пчел от погибших семей за период  2009– 2011 гг.

Место отбора проб

Обследованно семей пчел, шт

Выявлены возбудители

Всего

Выявлено

погибших

Взято проб

nosema

nosema + varroa

varroa

Невыясненная этиология

Можайский район

210

27

27

6

10

7

4

Одинцовский район

300

30

30

6

12

8

4

Балашихинский район

160

12

12

3

4

3

2

Раменский район

150

15

15

4

5

3

3

Ногинский район 

240

29

29

6

10

9

4

Орехово-Зуевский

110

10

10

2

4

2

2

Коломенский

170

30

30

8

11

8

3

Московская область

1340

153

153

35

56

40

22

Как видно из представленных данных, при обследовании 1340 пчелиных семей из 7 районов Московской области в период  2009–2011 гг. погибло 153 семьи пчел. Из проб пчел от погибших семей выделили микроспоридии рода Nosema в 22,9% и  микроспоридии рода Nosema совместно с клещом Varroa destructor в 36,6%  случаев.

       3.2. Разработка метода полимеразной цепной реакции для видовой идентификации возбудителей нозематоза пчел

Для видовой идентификации спор микроспоридий рода Nosema разработан метод ПЦР «в реальном времени» (ПЦР-РВ), который по сравнению с традиционным методом ПЦР имеет ряд преимуществ: меньше стадий исследований (нет электрофореза); быстрый анализ (результат виден до окончания анализа); более чувствительный и специфический анализ; возможность количественного и качественного определения ДНК возбудителя в биологическом материале.

Наиболее ответственный этап при постановке реакции ПЦР «в реальном времени» - синтез праймера. Необходимая информация о последовательности нуклеотидов у микроспоридий Nosema apis и Nosema ceranae получена из международных банков данных (GenBank, EMBL) через сеть Интернет. Специфические участки  нуклеотидной цепочки (праймер) для  Nosema ceranae и Nosema apis представлен в таблице 2.

  Таблица  2

Последовательность нуклеотидов в праймерах для микроспоридий рода Nosema

Вид

Последовательность праймера (5' – 3')

Величина продукта ПЦР-РВ  (bp)

Расположение

на геноме

Nosema apis GenBank: U97150

Forward:

5'-GCCCTCCATAATAAGAGTGTCCAC– 3'

142

4364 - 4387

Reverse:

5'ATCTCTCATCCCAAGAGCATTGC– 3'

Probe: 5'ACTTACCATGCCAGCAGCCAGAAGA– 3'

Nosema ceranae GenBank: DQ486027

Forward:

5'AAGAGTGAGACCTATCAGCTAGTTG– 3'

104

218 - 242

Reverse:

5'CCGTCTCTCAGGCTCCTTCTC– 3'

Probe: 5'ACCGTTACCCGTCACAGCCTTGTT– 3'

На экспериментальной пасеке ВНИИВСГЭ, используя обычную  световую  микроскопию, было выявлено 4 семьи пчел, пораженных нозематозом, и сформирована опытная группа. В качестве контроля использовали пчел от здоровых семей. От опытных и контрольных семей были отобрано по 50 живых пчел,  из средней кишки которых выделяли ДНК.

Результаты учитывали по анализу кривых накопления ДНК в ходе проведения ПЦР-РВ. На рисунках 1, 2, 3 представлены графики накопления ДНК  и  электрофореграммы продуктов ПЦР–РВ геномной ДНК Nosema apis  и Nosema ceranae.

Рисунок 1

График накопления ДНК Nosema apis для различных концентраций методом ПЦР-РВ.

Электрофореграмма продуктов ПЦР-РВ геномной ДНК Nosema apis.

               

График накопления ДНК Nosema ceranae для различных концентраций методом ПЦР-РВ.

Электрофореграмма продуктов ПЦР-РВ геномной ДНК Nosema ceranae.

               

                                                       

Рисунок 2

График накопления ДНК Nosema apis для различных концентраций методом ПЦР-РВ.

Электрофореграмма продуктов ПЦР-РВ геномной ДНК Nosema apis.

График накопления ДНК Nosema ceranae для различных концентраций методом ПЦР-РВ

Электрофореграмма продуктов ПЦР-РВ геномной ДНК Nosema ceranae.

                                                                                       

Рисунок  3

График накопления ДНК Nosema apis для различных концентраций методом ПЦР-РВ

Электрофореграмма продуктов ПЦР-РВ геномной ДНК Nosema apis.

График накопления ДНК Nosema ceranae для различных концентраций методом ПЦР-РВ

Электрофореграмма продуктов ПЦР-РВ геномной ДНК Nosema ceranae.

При анализе содержания геномной ДНК двух возбудителей нозематоза пчел методом ПЦР «в реальном времени» установили, что содержание ДНК Nosema ceranae в средней кишке пораженных нозематозом пчел существенно выше, чем содержание ДНК Nosema apis. Визуально это видно по выходу ПЦР–продукта (ампликона) (рис. 1, б, г; 2, б, г; 3, б, г), а так же по кривым ПЦР «в реальном времени» (рис. 1, а, в; 2, а, в; 3, а, в). О высоком содержании генома Nosema ceranae свидетельствуют и незначительные изменения концентрации ампликона в экспериментах с разведением ДНК-матрицы. При разведении в 104 раз выход ампликона практически не меняется при визуальном анализе в геле при проведении электрофореза.

3.3. Влияние микроспоридии  Nosema ceranae на жизнедеятельность и продуктивность семей пчел

В результате исследований по выделению ДНК у пораженных нозематозом пчел с применением ПЦР «в реальном времени» было установлено, что основным возбудителем нозематозной инфекции на экспериментальной пасеке ВНИИВСГЭ является микроспоридия вида Nosema ceranae.

В течение пчеловодческого сезона в опытных и контрольных семьях пчел выполняли все необходимые пасечные работы, при этом лекарственные средства, стимуляторы развития не применяли. Результаты наблюдения представлены в таблице 3.

  Таблица 3

Состояние семей пчел пораженных Nosema ceranae

Группы

семей

пчел

Весенний период (апрель - май)

Летнее-осенний период (август - сентябрь)

Число рамок, шт

Сила семьи, число улочек

Количество

меда, кг

Число рамок, шт

Сила семьи, число улочек

Количество

меда, кг

Опытная

5+1

3+0,5

4,3+0,5

8+1*

5,7+0,5*

12,1+1,2*

Контрольная

6+1

4+0,5

5+0,8

11+1*

9+0,5*

18+1,5**

Примечание: * P > 0,95; ** P > 0,99

Как видно из данных, приведенных в таблице, сила семей опытной группы пчел была на 36,6%, а количество собранного ими меда на 32,8% меньше, чем в контроле. При этом массовой гибели и слета пчел не отмечено.

3.4. Разработка мер по предупреждению распространения нозематоза пчел на пасеках

Нами было изучено влияние препарата апистим на развитие нозематозной инфекции в семьях пчел и определена жизнеспособность спор микроспоридий рода Nosema после проведения дезинфекции.

3.4.1. Изучение влияния препарата апистим на развитие нозематозной инфекции в семьях пчел.

Важным профилактическим мероприятием при нозематозе является интенсивное наращивание числа молодых пчел в весенний период, так как для них характерна естественная устойчивость к заражению нозематозом.

Проведен поиск стимуляторов репродуктивной активности пчелиных маток, не содержащих веществ белковой природы, так как белок является стимулятором развития микроспоридий рода Nosema.

С этой целью применяли препарат апистим, содержащий сбалансированный комплекс солей микроэлементов: калия, магния и кобальта, в качестве контроля  использовали  цветочную пыльцу. Результаты, полученные в ходе исследований, представлены в таблицах 4 и 5.                                                                                                                                                       Таблица  4 

Развитие нозематозной инфекции в семьях пчел

Группы семей пчел

Среднее число спор ноземы в пробах пчел, млн

Количество пчел, зараженных спорами ноземы, %

До опыта

После опыта

До опыта

После опыта

1 (пыльца)

4,8 ± 0,5

15,6 + 1,1*

27 ± 5

83 ± 5*

2 (апистим)

5 ± 0,8

8,2 + 0,8*

30 ± 6

42 ± 6*

3 (контроль)

5,2 ± 0,6

12, 7 + 1,2**

25 ± 4

67 ± 4*

Примечание: * P > 0,95; ** P > 0,99

Полученные результаты свидетельствуют, что подкормка, пораженных нозематозом семей пчел, сахарным сиропом с препаратом апистим приводила к снижению степени поражения пчел нозематозом на 37% и к уменьшению количества спор в пробах пчел на 35,4%, тогда как подкормки с пыльцой увеличивали степень поражения пчел нозематозом на 24% и количество спор ноземы в пробах возрастало на 22,8% по сравнению с контролем.

                                                                                       

                                                                                        Таблица 5

Количество печатного расплода в семьях пчел, тыс. ячеек

Группы семей пчел

Период после обработки, сут.

12

14

16

18

21

1 (пыльца)

5,8 + 0,8

9,8 + 1,3

15,7 + 1,5

20,6 + 1,2

25,4 + 1,2**

2 (апистим)

6,7 + 1,2*

11,2 + 1,1

16,8 + 1,3

23,4 + 1,5

28,5 + 1,1*

3 (контроль)

4,2 + 0,5

8,7 + 0,7

14,3 + 0,9

18,2 + 1,1

21,7 + 1*

Примечание: * P > 0,95; ** P > 0,99

Данные, представленные в  таблице, свидетельствуют, что количество печатного расплода возросло после применения подкормок с препаратом апистим  на 31,3% и с пыльцой на 17%  по сравнению с контролем.

В результате проведенных исследований было установлено, что  препарат апистим увеличивает репродуктивную активность пчелиных маток, уменьшает степень поражения пчел нозематозом и может быть рекомендован для профилактики нозематоза пчел.

3.4.2.  Проведение дезинфекции при нозематозе пчел

В качестве дезинфицирующих средств при дезинфекции соторамок, инфицированных спорами микроспоридий рода Nosema, использовали уксусную кислоту (80%-ной концентрации) и 6%-ный раствор пероксида водорода с добавлением 0,5% уксусной кислоты, а в качестве контроля – воду.

Результаты опытов по проведению дезинфекции при нозематозе пчел представлены в таблице 6 .

  Таблица 6

Результаты опытов по дезинфекции сотов при нозематозе пчел

Средство

дезинфекции

Концент-рация, %

Экспози-ция, ч

Расход

л/м3, г

Число

тестов

Обезза- ражено

Необезза-

ражено

Уксусная кислота

80

96

2,0

10

10

-

Пероксид водорода,

+

уксусная кислота

6

0,5

6

0,5

10

10

-

Вода (контроль)

-

6

0,5

10

-

10

Из данных, представленных в  таблице, видно, что пары 80%-ной уксусной кислоты и 6%-ный раствор пероксида водорода с добавлением 0,5%

уксусной кислоты в указанных режимах оказывают обеззараживающее действие при дезинфекции соторамок, инфицированных спорами микроспоридий рода Nosema .

3.4.3.  Определение жизнеспособности спор микроспоридий рода Nosema после проведения дезинфекции методом лазерной интерференционной микроскопии.

Впервые методы интерференционной микроскопии для диагностики функционального состояния биологических объектов были применены В.П. Тычинским  (1983 г).

Определение жизнеспособности спор микроспоридий рода Nosema методом лазерной интерференционнй микроскопии проводили совместно с  ООО «Лаборатории Амфора» (г. Москва). Суть данного метода заключается в установлении фазовых портретов живых и погибших спор микроспоридий рода Nosema.

Для этой цели живые споры микроспоридий рода Nosema выделяли из средней кишки зараженных нозематозом пчел. Суспензию с живыми спорами наносили на поверхности тест-объектов, которые  подвергали дезинфекции:  парами уксусной кислоты 80%-ной концентрации (экспозиция 4 сут); 10%-ным раствором пероксида водорода (экспозиция 3 ч); текучим паром при температуре около 100C (экспозиция 30 мин). Гибель спор микроспоридий рода Nosema устанавливали методом биопробы. Исследование живых и погибших спор микроспоридий рода Nosema проводили на Модуляционном интерференционном микроскопе МИМ 2.1 производства ООО «Лаборатории Амфора». Для достоверной статистической оценки выборка составила 35–40 спор.

Было установлено, что наиболее значимыми параметрами при изучении морфометрических признаков живых и погибших спор являются их фазовая толщина и диаметр. На рисунке 4 приведены гистограммы распределения фазовой толщины спор микроспоридий рода Nosema.

Рисунок 4

Распределение фазовой толщины живых и погибших спор Nosema

На гистограмме видно, что фазовая толщина живых спор составила  100 –200 нм с максимумом в районе 128 нм, т.е. большинство (около 50%) спор в данной популяции имело фазовую толщину 122 – 132 нм. Под воздействием дезинфектантов и высокой температуры фазовая толщина спор резко снижалась до 40–150 нм с максимумом в районе 100 нм.

Изменения, вызванные внешними факторами, выразились  и в изменении поперечного диаметра споры (продольный диаметр споры искажается в зависимости от ее ориентации в пространстве).  На рисунке 5 приведены гистограммы распределения диаметров живых и погибших спор микроспоридий рода Nosema.

Рисунок 5

Распределение диаметра живых и погибших спор Nosema

Из гистограммы  видно, что диаметр живых спор составлял 2,5 – 3,5 мкм с максимумом в районе 2,5 мкм. Под воздействием дезинфектантов и высокой температуры диаметр спор увеличивался, и максимум гистограммы смещался в область 3 – 4 мкм.

Еще одним важным параметром, отражающим состояние спор, является рефрактерность – средняя по объему разница показателя преломления споры и окружающей ее среды, которую вычисляли как отношение фазовой толщины споры к ее диаметру. На рисунке 6 приведены гистограммы распределения рефрактерности живых и погибших спор микроспоридий рода Nosema.

Рисунок 6

Распределение рефрактерности живых и погибших  спор Nosema

Из гистограммы  видно, что средний показатель рефрактерности погибших спор микроспоридий рода Nosema уменьшился на 0,02.

Проведенные исследования показали, что методы лазерной интерференционной микроскопии позволяют объективно оценивать функциональное состояние спор микроспоридий рода Nosema по ряду морфометрических признаков (фазовая толщина и диаметр) и служат объективным критерием оценки качества дезинфекции объектов пчеловодства при нозематозе пчел.

ВЫВОДЫ:

1. Анализ проб пчел от погибших семей на пасеках Московской области за период 2009 – 2011 гг. выявил наличие спор микроспоридий рода Nosema в 59,5%  общего числа погибших семей пчел.

2. Для видовой идентификации спор микроспоридий рода Nosema разработан метод ПЦР «в реальном времени», который в сравнении с традиционным методом имеет ряд преимуществ: меньше стадий исследований; более чувствительный и специфический анализ; возможность количественного и качественного определения ДНК возбудителя в биологическом материале.

3. Методом ПЦР «в реальном времени» идентифицированы возбудители нозематоза пчел на пасеках Московской области и установлено, что микроспоридия вида Nosema ceranae доминирует в  генномной ДНК по сравнению с микроспоридией вида Nosema apis.

4. Установлено, что сила семей пчел, пораженных микроспоридией Nosema ceranae, была на 36,6%, а количество собранного ими меда на 32,8% меньше чем в контроле. При этом массовой гибели и слета пчел не отмечено.

5. Установлено, что в семьях пчел, пораженных нозематозом, применение препарата апистим в весенний-летний период повышает репродуктивную активность пчелиной матки на 31,3%, в результате чего снижается степень поражения пчел нозематозом на 37% по сравнению с контролем.

6. Состав, содержащий  6% пероксида водорода с добавлением 0,5 % уксусной кислоты, оказывает обеззараживающее действие при дезинфекции соторамок, инфицированных спорами микроспоридий рода Nosema, и является экологически безопасным.

7. Метод лазерной интерференционной микроскопии для контроля качества дезинфекции при нозематозе пчел позволяет выявить морфометрические различия (фазовая толщина и диаметр) живых и погибших спор микроспоридий рода Nosema.

Предложения для практики

Разработаны и утверждены для использования в научно-исследовательских учреждениях и ветеринарных лабораториях:

1. «Методические рекомендации по определению жизнеспособности спор микроспоридий рода Nosema методом лазерной интерференционной микроскопии» (утв. Отделением ветеринарной медицины РАСХН 15.06.2009 г), п.п. 3, 4;

2. «Методическое пособие по идентификации возбудителей нозематоза медоносных пчел методом ПЦР «в реальном времени» (утв. Отделением ветеринарной медицины РАСХН 09.11.2011 г), п.п. 2, 4;

3. «Методическое пособие о мерах по предупреждению распространения нозематоза пчел на пасеках» (рассмотрено и одобрено на секции «Патология пчел,  рыб и охрана полезных гидробионтов» Отделения ветеринарной медицины РАСХН, протокол №2 от 26.04.2012 г, г. Москва), п.п. 3, 4.

Список опубликованных работ

1) Чернышев А.А. Определение жизнеспособности спор микроспоридий рода Nosema методом лазерной интерференционной микроскопии. \\ «Проблемы ветеринарной санитарии, гигиены и экологии». – 2010. – №2(4). – С. 78–82.

2) Сохликов А.Б., Игнатьева Г.И., Чернышев А.А. Метод ПЦР–РВ для идентификации возбудителей нозематоза.\\ Пчеловодство. – 2012. – №1. – С. 24 –25.

3) Сохликов А.Б., Чернышев А.А. Препарат Апистим для профилактики нозематоза пчел. \\ Пчеловодство. – 2011. – №2. – С. 26–28.

4) Сохликов А.Б., Чернышев А.А. Методы профилактики нозематоза пчел. \\ «Проблемы ветеринарной санитарии, гигиены и экологии». – 2011. –№1(5). – С. 49–53.

5) Чернышев А.А., Сохликов А.Б., Игнатьев П.С. Определение жизнеспособности спор микроспоридий рода Nosema методом лазерной интерференционной микроскопии. \\Инновационные процессы в АПК. Сборник статей 2-й Международной научно-практической конференции преподавателей, молодых ученых, аспирантов и студентов, посвященной 50–летию образования РУДН. – М., РУДН, 2010, С. 343–346.




© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.