WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

   Добро пожаловать!


На правах рукописи

Мухина Жанна Михайловна

ЭФФЕКТИВНОСТЬ МЕТОДОВ МОЛЕКУЛЯРНОГО МАРКИРОВАНИЯ В СЕЛЕКЦИИ, СЕМЕНОВОДСТВЕ СЕЛЬСКОХОЗЯЙСТВЕННЫХ КУЛЬТУР И ДЛЯ ИЗУЧЕНИЯ БИОРАЗНООБРАЗИЯ РАСТИТЕЛЬНЫХ РЕСУРСОВ

Специальность: 06.01.05 – селекция и семеноводство сельскохозяйственных растений

АВТОРЕФЕРАТ

диссертации на соискание ученой степени доктора биологических наук

Краснодар - 2012

Работа выполнена в ГНУ Всероссийский научно-исследовательский институт риса Россельхозакадемии в 2000 -2011 гг.

Официальные оппоненты: Щеглов Николай Иванович, доктор биологических наук, профессор кафедры генетики, микробиологии и биотехнологии ФГБОУ ВПО «Кубанский государственный университет», г. Краснодар;

Казакова Алия Сабировна, доктор биологических наук, профессор, зав. кафедрой физиологии и химии ФГБОУ ВПО «Азово-Черноморская государственная агро-инженерная академия», г. Зерноград;

Димурин Яков Николаевич, доктор биолоических наук, профессор, зав. лабораторией генетики ГНУ Всероссийский научноисследовательский институт масличных культур им. В.С. Пустовойта Россельхозакадемии, г. Краснодар Ведущая организация – ГНУ Краснодарский научно-исследовательский институт сельского хозяйства им. П. П. Лукъяненко Россельхозакадемии, г. Краснодар

Защита состоится « 29 » мая 2012 года в часов на заседании диссертационного совета Д 220.038.03 при ФГБОУ ВПО «Кубанский государственный аграрный университет» по адресу: 350044, г. Краснодар, ул. Калинина, 13, главный корпус, конференц-зал, тел/факс 8 (861) 221-57-

С диссертацией можно ознакомиться в библиотеке ФГБОУ ВПО «Кубанский государственный аграрный университет», с авторефератом – на сайтах http://www.vak.ed.gov.ru и http://www.kubsau.ru/

Автореферат разослан 2012 г.

Учный секретарь диссертационного совета, д. б. н., профессор Цаценко Л. В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ



Актуальность темы. Генетическое разнообразие, природное или созданное человеком, является основой для выведения новых сортов сельскохозяйственных растений.

Современные сорта сельскохозяйственных культур должны удовлетворять основным требованиям:

- обладать высоким урожаем и хорошим качеством продукции;

- быть хорошо адаптированными к зональным агротехнологиям;

- быть устойчивыми к биотическим и абиотическим стрессовым факторам.

Маркерная селекция значительно упрощает процесс создания таких сортов, ускоряя и делая более эффективным отбор растений с интересующими селекционера генами. В случае доказанного факта сонаследования целевого гена и сцепленного с ним молекулярного маркера отпадает необходимость оценки отбираемых растений по фенотипу (например, создание инфекционных фонов, абиотических стрессовых условий и т.д.), которая в ряде случаев связана со значительными трудозатратами и технически трудновыполнима.

Генетические маркеры играют исключительно важную роль в изучении наследственной конституции организма и, в особенности, в оценке исходного селекционного материала, поскольку облегчают контроль за включением желаемых (и нежелаемых) генетических факторов от родительских форм в создаваемые сорта и гибриды.

Для сравнения следует отметить, что средняя продолжительность селекционных схем, основанных на классических методах гибридизации и отбора растений, для однолетних культур около 10, а для двулетних - до 20 лет.

Прогресс молекулярной генетики дал толчок к развитию различных типов ДНК-маркеров, основанных на анализе полиморфизма нуклеотидной последовательности ДНК. Их использование коренным образом изменило методы оценки генетического разнообразия, паспортизации и классификации сортов растений и штаммов грибов, картирования и определения физической природы генов, интрогрессии новых генов и генетического мониторинга в селекции и генетике сельскохозяйственных растений.

Цель и задачи исследований. Основной целью исследований являлась разработка и обоснование эффективности, целесообразности методических схем, использующих молекулярное маркирование в практической селекции и семеноводстве сельскохозяйственных культур, а также при изучении биоразнообразия растительных ресурсов.

Для достижения цели исследований были поставлены следующие задачи:

1. Методом маркерной селекции создать исходный селекционный материал (линии) риса с пирамидированными генами устойчивости к пирикуляриозу для использования его в качестве донорного в селекционных программах, направленных на создание устойчивых к патогену сортов риса.

2. Создать ДНК-маркеры для идентификации аллельного состояния эффективного в зоне краснодарского рисосеяния гена устойчивости риса к пирикуляриозу Pi-ta. Обосновать эффективность схем оценки исходного селекционного материала на наличие целевого гена, а также маркерного контроля гена Pi-ta в селекционных программах на основе ДНК-анализа.

3. Создать аллельспецифичный ДНК-маркер гена красной окраски перикарпа риса Rc для ранней диагностики (до появления метелок) подлежащих элиминации краснозерных форм в питомниках размножения в системе первичного семеноводства риса.

4. Обосновать целесообразность методологии контроля краснозерной примеси в системе первичного семеноводства риса, основанной на молекулярном маркировании локуса Rc.

5. Изучить генетическую основу феномена краснозерных аналогов белозерных сортов в производственных посевах риса на основе молекулярногенетического подхода. Рекомендовать меры борьбы с краснозерностью при производственном выращивании риса.

6. Выполнить генетическую паспортизацию отечественных сортов риса селекции ВНИИ риса и коллекционных сортообразцов института с использованием ПЦР (микросателлитных) маркеров. Создать базу данных, содержащую информацию об аллельном разнообразии изученных микросателлитных локусов у образцов коллекции для использования ее в селекционном процессе и для защиты авторских прав селекционеров.

7. Изучить внутри- и межвидовое биоразнообразие злостного сорняка рисовых полей рода Echinochloa (ежовники) в рисосеющих регионах стран СНГ на основе ДНК (микросателлитного) анализа различных экотипов сорняка.

Дать молекулярно-генетическое обоснование наличию большого количества переходных форм и схожих морфологических признаков у представителей разных таксонов целевого рода, затрудняющих точную идентификацию растений.

8. Создать пополняемую базу данных, содержащую информацию об аллельном разнообразии четырех микросателлитных локусов ДНК растений экотипов рода Echinochloa из различных эколого-географических зон рисосеяния стран СНГ для изучения генетических взаимосвязей таксонов рода.

Обосновать целесообразность ее применения в селекционных схемах на создание сортов риса с высокой энергией роста из-под слоя воды (безгербицидная технология борьбы с сорняками).

9. Создать пополняемую базу данных, содержащую информацию об аллельном разнообразии 21 микросателлитного локуса ДНК рефренсных коллекционных штаммов с известным патотипом из российской государственной коллекции Magnoporthe grisea (Herbert) Barr - возбудителя пирикуляриоза риса. Обосновать целесообразность ее применения в селекционных программах на устойчивость риса к пирикуляриозу при изучении биоразнообразия вновь выделенных полевых изолятов патогена.

10. Оптимизировать систему молекулярного маркирования для оценки генетической однородности партий семян простых гибридов подсолнечника (Helianthus annuus L.). Обосновать целесообразность применения данной методологии в практическом семеноводстве изученных гибридов подсолнечника.

Научная новизна исследований.

Впервые методом маркерной селекции на генетической основе отечественных сортов риса (Боярин, Вираж, Виктория) создан исходный селекционный материал (линии с интродуцированными и, в том числе, с пирамидированными генами Pi1, Pi2, Pi33, придающими длительную устойчивость к пирикуляриозу). При фитопатологическом тестировании на вегетационной площадке ВНИИ риса линии оценены как устойчивые к смеси изолятов патогена, выделенных на территории Краснодарского края.

Созданы внутригенные ДНК-маркеры для идентификации аллельного состояния эффективного в зоне краснодарского рисосеяния гена устойчивости к пирикуляриозу риса Pi-ta, исключающие необходимость фитопатологического теста для выявления донорных генотипов.

Впервые поиск доноров гена Pi-ta среди российских коллекционных образцов риса был осуществлен без применения классической фитопатологической методики: заражения совместимыми расами паразита, а только на основании данных ДНК-анализа.

Создан внутригенный аллельспецифичный ДНК-маркер гена красной окраски перикарпа риса Rc для ранней диагностики (задолго до фенотипического проявления признака) краснозерной примеси, засоряющей посевы риса. Впервые разработана методическая схема контроля краснозерных форм в первичных звеньях семеноводства риса на основе данных ДНКанализа. Определен порог разрешающей способности методики и проведена ее полевая апробация.

Впервые на основе молекулярно-генетического подхода изучена генетическая основа феномена краснозерных аналогов белозерных сортов риса, резко снижающих товарную ценность семян. Обосновано предположение о переопылении сорно-полевыми краснозерными формами риса возделываемых белозерных сортов с последующим самоопылением последних в ряду поколений как наиболее вероятной причине возникновения краснозерных аналогов. Рекомендованы меры борьбы с краснозерностью при производственном выращивании риса Впервые проведена ДНК-паспортизация сортов и сортообразцов риса коллекции ВНИИ риса. Создана база данных, содержащая информацию об аллельном разнообразии микросателлитных локусов изученных генотипов, которая может быть использована в селекционном процессе для подбора родительских форм при гибридизации, а также для защиты авторских прав селекционеров.

Впервые биоразнообразие экотипов злостного сорняка рода Echinochloa (ежовники), собранных из разных зон рисосеяния стран СНГ, изучено методом молекулярного маркирования (микросателлитный анализ). ДНК-анализ подтвердил гипотезу внутри- и межвидового скрещивания, существующего в природных популяциях сорняка, объясняющую наличие большого количества переходных форм и схожих морфологических признаков у представителей разных таксонов.

Впервые проведено генотипирование образцов российской государственной коллекции Magnoporthe grisea (Herbert) Barr - возбудителя пирикуляриоза риса - на основе полиморфизма микросателлитных локусов ДНК патогена. Создана база данных, позволяющая оценивать степень генетического сходства вновь выделенных полевых изолятов и коллекционных образцов с известным патотипом.

Основные положения, выносимые на защиту.

1. Исходный селекционный материал для создания сортов риса, устойчивых к пирикуляриозу, - линии с интродуцированными генами устойчивости к патогену Pi1, Pi2, Pi33, полученные методом маркерной селекции; в их числе - линия с тремя пирамидированными указанными генами.

2. Доминантный ПЦР-маркер для выявления доноров эффективного гена устойчивости к пирикуляриозу Pi-ta. Проведенный автором массовый ПЦРанализ коллекционных образцов риса – эффективный лабораторный и единственный способ идентификации донорных генотипов при отсутствии совместимых рас патогена.

3. Кодоминантный ПЦР-маркер гена Pi-ta, с помощью которого возможен маркерный контроль аллельного состояния целевого гена в расщепляющихся популяциях в селекционных программах, направленных на создание устойчивых к пирикуляриозу сортов риса, 4. Методическая схема контроля краснозерной примеси в питомниках размножения первичных звеньев семеноводства риса на основе созданного ПЦР-маркера, идентифицирующего аллельное состояние гена красной окраски перикарпа риса Rc задолго до фенотипического проявления признака (появление метелки), повышающая качество контроля. Полевая апробация методической схемы показала ее эффективность для контроля чистоты питомников размножения от засорения краснозерными формами.

5. База данных, содержащая данные об аллельном разнообразии микросателлитных локусов ДНК коллекционных сортообразцов и районированных сортов риса селекции ВНИИ риса. Генотипирование сортообразцов риса на основе полиморфизма ДНК (микросателлитных) – локусов целесообразно использовать в селекционном процессе, для более эффективного подбора родительских пар при гибридизации. При этом один из основных критериев подбора – разнокачественность микросателлитных профилей родительских форм планируемой комбинации скрещивания по большинству изученных локусов. В этом случае можно рассчитывать на гетерозисный эффект.

6. Оптимизация системы молекулярного маркирования для оценки генетической чистоты партий семян изученных в рамках исследования простых гибридов подсолнечника отечественной селекции для последующего использования в семеноводстве этих гибридов.

7. База данных, содержащая данные об аллельном разнообразии 21-го микросателлитного локуса ДНК образцов российской государственной коллекции Magnoporthe grisea (Herbert) Barr - возбудителя пирикуляриоза риса.

Сравнивая микросателлитные профили вновь выделенных полевых изолятов и коллекционных образцов патогена с известным патотипом, можно оценивать степень их генетического сходства. Это усовершенствует селекционный процесс при создании устойчивых к пирикуляриозу сортов риса, облегчая генотипирование зональных популяций паразита.

8. База данных, содержащая данные об аллельном разнообразии 4-х микросателлитных локусов ДНК экотипов злостного сорняка рисовых полей рода Echinochloa (ежовники), собранных из разных зон рисосеяния стран СНГ, для использования ее при изучении зависимости отзывчивости разных генотипов сорняка на гербициды, применяемые в системе рисоводства в России, а также в селекционных программах, направленных на создание сортов риса с высокой энергией роста из-под слоя воды при безгербицидной технологии борьбы с сорняками рисовых полей.

Практическая значимость работы.

Созданные линии риса на генетической основе отечественных сортов с интродуцированными генами широкого спектра устойчивости к пирикуляриозу Pi1, Pi2, Pi33, а также линия с тремя пирамидированными указанными генами представляют собой ценный исходный материал, который может быть использован в качестве донорного в селекционных программах, направленных на создание устойчивых к пирикуляриозу сортов риса.

Использование созданного доминантного ДНК-маркера эффективного гена устойчивости к пирикуляриозу Pi-ta для массового скрининга коллекционных образцов риса повышает скорость и эффективность поиска доноров указанного гена, и, кроме того, избавляет от необходимости оценки образцов по фенотипу (фитопатологический тест, требующий наличия совместимых рас патогена).

Маркерный контроль гена Pi-ta на основе созданного кодоминантного маркера в селекционных программах, направленных на создание устойчивых к пирикуляриозу сортов риса, позволяет в значительной степени (в два раза) ускорять селекционный процесс по указанному гену.

Использование методической схемы контроля краснозерной примеси в первичных звеньях семеноводства риса на основе созданного ДНК-маркера гена красной окраски перикарпа риса Rc делает возможной раннюю диагностику краснозерных форм с их последующей элиминацией из питомников размножения, что повышает надежность контроля.

Созданная база данных, содержащая информацию о полиморфизме ДНК (микросателлитных) локусов районированных сортов риса селекции ВНИИ риса, а также коллекционных сортообразцов, может быть использована как в селекционном процессе, для более эффективного подбора родителских пар при гибридизации, так и для защиты авторских прав селекционеров.

Оптимизированная методическая схема контроля гибридности партий семян трех простых гибридов подсолнечника и генетической чистоты их родительских линий на основе ДНК (микросателлитного) анализа повышает эффективность семеноводства изученных гибридов; позволяя оценивать генетическую чистоту семян вне зависимости от сезона вегетации, а при необходимости, и в упредительном режиме, не дожидаясь результатов грунтконтроля.

ДНК-паспортизация рефренсных изолятов возбудителя пирикуляриоза (Magnoporthe grisea (Herbert) Barr) из российской государственной коллекции патогена может использоваться для изучения их генетического сходства с вновь выделенными полевыми изолятами паразита для изучения их генетического сходства. Это повышает эффективность селекционных схем, направленных на создание устойчивых к пирикуляриозу сортов риса.

Реализация результатов исследований.

Созданный в рамках диссертационного исследования исходный селекционный материал риса (сортообразцы на генетической основе сортов Боярин, Вираж, Виктория, в которые методом маркерной селекции автором были интродуцированы гены устойчивости к пирикуляриозу Рi-1, Pi-33, Pi-2) передан в коллекции ВНИИ риса (г. Краснодар); ВНИИ зерновых культур (г.Зерноград, Ростовская область) для использования в качестве донорного в селекционных программах на устойчивость риса к пирикуляриозу.

Генетическая плазма отечественных сортов пополнена эффективными генами устойчивости к этому, самому вредоносному во всех рисосеющих регионах мира, заболеванию риса.

База данных, содержащая данные об аллельном разнообразии 21-го микросателлитного локуса ДНК образцов российской государственной коллекции Magnoporthe grisea (Herbert) Barr - возбудителя пирикуляриоза риса, передана держателю коллекции, отделу микологии и иммунитета ВНИИ фитопатологии (п. Большие Вяземы, Московская область). Она, несомненно, внесла свой вклад в изучение мирового биоразнообразия паразита.

Генетическая паспортизация коллекционных изолятов необходима, кроме того, для защиты авторских прав держателей коллекций.

Разработанная автором методическая схема контроля краснозерной примеси в питомниках размножения (первичные звенья семеноводства) риса на основе созданного ДНК-маркера гена красной окраски перикарпа риса Rc, делающая возможной раннюю диагностику (до появления метелок) краснозерных форм с их последующей элиминацией из питомников размножения, используется отделом семеноводства и семеноведения ВНИИ риса, что повышает надежность контроля.

Оптимизированная методическая схема контроля гибридности партий семян трех простых гибридов подсолнечника на основе ДНК (микросателлитного) анализа, используется компанией «Агроплазма», оригинатором гибридов, для оценки генетической чистоты производимых коммерческих партий гибридных семян вне зависимости от сезона вегетации подсолнечника, а также для целей внутреннего контроля качества используемых для создания простых гибридов родительских линий.

Созданная база данных, содержащая информацию о полиморфизме ДНК (микросателлитных) локусов районированных сортов риса селекции ВНИИ риса, а также коллекционных сортообразцов, передана в лабораторию исходного материала института для использования в селекционном процессе, для более эффективного подбора родителских пар при гибридизации.

Апробация работы и публикация результатов исследований.

Основные результаты исследований ежегодно докладывались на заседаниях методических комиссий и Ученого совета ВНИИ риса, а также были представлены на всероссийских и международных конференциях: Eurorice 20Symposium. – Краснодар, Россия, 2001; Conference of current European Research on Rice.-Turin, Italy, June 6-8, 2002; Международная научная интернетконференция. - Ставрополь, 2002; 3-й съезд Биохимического общества, Тезисы научных докладов. - С.-Петербург, 26.06.2002–01.07.2002; Международная научно-практическая конференция «Трансгенные растения – новое направление в биологической защите растений». - Краснодар, 2002; Научное обеспечение агропромышленного комплекса: материалы 5-й региональной науч.– практ.

конференции молодых ученых 18–19 декабря 2003 г. - КубГАУ. – Краснодар, 2003; Международная научно-практическая конференция «Биологическая защита растений - основа стабилизации агроэкосистем». - Краснодар, 2004;

Всероссийская научная конференция молодых ученых и студентов «Современное состояние и приоритеты развития фундаментальных наук в регионах». - Анапа, 2004; The international conference «Challenges and opportunities for sustainable rice-based production systems». - Turin, Italy, 2004;

6-й Международный симпозиум «Новые и нетрадиционные растения и перспективы их использования». – Москва, Пущино, 2005; Международная научно-практическая конференция «Новации и эффективность производственных процессов в виноградарстве и виноделии». - Краснодар, 2005; Всероссийская научно-практическая конференция «Развитие инновационных процессов в рисоводстве – базовый принцип стабилизации отрасли». – Краснодар, 2005; Международная научная конференция «Устойчивое производство риса настоящее и перспективы». – Краснодар, 2006;

XII International symposium on biological control of weeds. - France, 22–27 April, 2007; Annual Meeting of the Phytopathological Society. - USA, 2007; 5-й Московский международный конгресс «Биотехнология: состояние и перспективы развития», 16–20 марта, 2009; Международная научнопрактическая конференция «Селекция сортов риса, устойчивых к абиотическим и биотическим стрессам, для стран умеренного климата и Центральной Азии».

– Краснодар, 2009; XVII международный симпозиум «Нетрадиционное растениеводство. Селекция. Охрана природы. Эниология. Экология и здоровье». - Алушта, 2008; Международная научно-практическая конференция «Селекция сортов риса, устойчивых к абиотическим и биотическим стрессам, для стран умеренного климата и Центральной Азии». – Краснодар, 2009; Annual Meeting of the Phytopathological Society. – USA, August 7-11, 2010.

По материалам докторской диссертации опубликовано 61 работа, из них:

14 статей в изданиях, рекомендованных ВАК РФ, монография и 5 авторских свидетельств на гибриды подсолнечника.

Структура и объем диссертации.

Диссертация изложена на 260 стр. основного текста, включает 27 таблиц, 66 рисунков; состоит из введения, обзора литературы, материалов и методов исследования, результатов и обсуждения, выводов, рекомендаций для практической селекции и семеноводства, списка литературы, включающего отечественных и 231 зарубежных источников и 3 приложений.

Личный вклад автора.

Экспериментальные результаты получены автором лично и совместно с коллегами из ВНИИ зерновых культур им. И.Г. Калиненко (г. Зерноград, Ростовская область); из ВНИИФ (п. Большие Вяземы, Московская обл.);

из С.-Петербургского госуниверситета (г. С.-Петербург), а также с аспирантами, работавшими в лаборатории биотехнологии и молекулярной биологии ВНИИ риса (г.Краснодар) под руководством диссертанта.

Соискателю принадлежат разработка программ исследований, схемы основных экспериментов, участие в экспериментальной работе и теоретическое обобщение полученных результатов. Доля личного участия в публикациях, выполненных в соавторстве, пропорциональна числу соавторов.

Автор выражает большую благодарность ведущему научному сотруднику отдела микологии и иммунитета ВНИИФ Т.М. Коломиец; сотрудникам лаборатории клеточной и генной инженерии растений биолого-почвенного факультета С.-Петербургского госуниверситета Т.В.Матвеевой и Д.И.

Богомазу; заведующему лабораторией селекции, семеноводства и технологии возделывания риса ВНИИ зерновых культур им. И.Г. Калиненко (г. Зерноград, Ростовская область) П.И. Костылеву за неоценимую методическую помошь в постановке экспериментов и обсуждении их результатов; аспирантам диссертанта, И.И.Супруну, Е.Т.Ильницкой, С.В.Волковой, Ю.А.Мягких, С.В.Токмакову, которые принимали участие в экспериментальных работах.

Особую признательность автор выражает Г.Л. Зеленскому, заведующему кафедрой генетики и селекции Кубанского аграрного госуниверситета;

Н.И. Бенко, директору ООО «Агроплазма», за предоставленный селекционный растительный материал для проведения исследований; а также старшему преподавателю кафедры биологии и экологии Кубанского государственного университета Д. П. Кассанелли за участие в экспедициционных поездках для сбора растительного материала и помощь в идентификации изучаемых видов растений.





СОДЕРЖАНИЕ РАБОТЫ

1 ОБЗОР ЛИТЕРАТУРЫ В главе анализируется современное состояние проблемы, связанной с применением молекулярно-генетических маркеров в практической селекции и семеноводстве сельскохозяйственных растений, а также для изучения биоразнообразия растительных ресурсов. Выполнена подборка и краткое описание результатов отечественных и зарубежных исследований, касающихся указанной тематики.

2 МАТЕРИАЛЫ И МЕТОДЫ Исследования проводились с 2000 по 2011 гг. в ГНУ ВНИИ риса (г. Краснодар); часть полевых экспериментов - во ВНИИ зерновых культур им. И.Г. Калиненко (г. Зерноград, Ростовская область);

работы, связанные с выделением ДНК грибных фитопатогенов - во ВНИИФ (п. Большие Вяземы, Московская обл.).

В программе интрогрессии генов широкого спектра устойчивости риса к пирикуляриозу Рi-1, Рi-2, Рi-33 в отечественные сорта риса в качестве доноров этих генов были использованы линии риса C104-Lac, C101-A-51, C101-Lac (подвид indica), которые несут гены Pi-1, Pi-2, Pi-1+Pi-33, соответственно (рабочая коллекция ВНИИ риса). Российские сорта риса Виктория, Вираж и Боярин (подвид japonica) использовали как реципиентные родительские формы (коллекция лаборатории селекции, семеноводства и технологии возделывания риса ВНИИ зерновых культур им. И.Г. Калиненко, г. Зерноград).

Проверку эффективности созданного в рамках исследования ДНК-маркера гена устойчивости к пирикуляриозу риса Pi-ta проводили на сортах риса К(положительный контроль); Nipponbare (отрицательный контроль); а также – сортах Виктория; IR36; Toride; Ou 244 (рабочая коллекция ВНИИ риса). Поиск доноров указанного гена с применением созданного ДНК-маркера проводили на 103 сортообразцах, отобранных для контрольного питомника ВНИИ риса в 2009 году, а также на растениях 33-х F7-линий от скрещивания сортов IR-58 x Кубань 3 (коллекция лаборатории селекции, семеноводства и технологии возделывания риса ВНИИ зерновых культур им. И.Г. Калиненко).

Проверку эффективности созданного ДНК-маркера гена Rc риса проводили на контрастных по изучаемому признаку сортах риса: краснозрных - Рубин, Карат; белозрных - Хазар, Талисман, Снежинка; а также на белозрных сортах и их краснозрных аналогах – Павловский, Спринт, Виктория, Соната, Привольный, Кубань-3 (рабочая коллекция ВНИИ риса).

Полевую апробацию маркера проводили на сортах риса Атлант, Ренар, Флагман, выращиваемых в питомнике испытания потомств первого года (ПИП1) лаборатории семеноводства и семеноведения ВНИИ риса.

Изучение генетической основы феномена краснозерных аналогов белозерных сортов в системе семеноводства риса проводили молекулярным (микросателлитным) анализом на белозерных сортах Бластоник, Виктория, Изумруд, Краснодарский-86, Кубань-3, Лиман, Павловский, Привольный, Соната, Спринт и их краснозрных аналогах.

Генетическую паспортизацию отечественных сортов и сортообразцов риса проводили ДНК (микросателлитным) анализом; в качестве материала использовали 39 сортов и сортообразцов рабочей коллекции ВНИИ риса.

Оценку генетической однородности гибридных семян подсолнечника (Helianthus annuus L.) методом маркирования микросателлитных локусов ДНК проводили на трех простых гибридах посеменным анализом (оригинатор гибридов – компания «Агроплазма», г. Краснодар). Для анализа использовали по 100 семянок каждой изучаемой партии гибридов.

Изучение биоразнообразия образцов российской государственной коллекции Magnoporthe grisea (Herbert) Barr - возбудителя пирикуляриоза риса - на основе молекулярно-генетического подхода проводили с использованием ДНК 59-ти коллекционных штаммов патогена (Российская государственная коллекция патогена; отдел микологии и иммунитета ВНИИ фитопатологии, п. Большие Вяземы, Московская область).

Изучение меж- и внутривидового разнообразия сорных растений рода Echinochloa на основе изучения полиморфизма микросателлитных локусов ДНК проводили с использованием 80 гербарных образцов, собранных в разных зонах рисосеяния стран СНГ.

Экстракцию ДНК из растительного материала проводили СТАВ-методом (Murray M.G.,Thompson W.F., 1980), а также методом Kang H.W. (1998).

Концентрацию выделенной ДНК определяли спектрофотометрически по стандартной методике (Маниатис T. и др., 1984), а также по интенсивности окрашивания ДНК бромистым этидием в агарозном геле (Остерман Л.А., 1981).

Праймеры, использованные в исследованиях, синтезированы фирмой ЗАО «Синтол» (г. Москва). ДНК-амплификацию проводили на амплификаторе «Терцик» («ДНК-технология», г. Москва). Условия проведения амплификации были индивидуальны для каждого праймера. В большинстве случаев проводили их оптимизацию.

Контроль донорных аллелей генов широкого спектра устойчивости риса к пирикуляриозу Pi-1, Pi-2, Pi-33 в программе насыщающих скрещиваний проводился микросателлитными маркерами, тесно сцепленными с целевыми генами: Rm 527, SSR 140 - для гена Pi-2; Rm 224 - для гена Pi-1; Rm 72, Rm 3- для гена Pi-33. Сиквенс праймерных пар указанных микросателлитных маркеров доступен в открытой базе генетических данных GenBank (http://www.ncbi.nlm.nih.gov).

Генетическую паспортизацию отечественных сортов и сортообразцов риса проводили с использованием 14 ПЦР (микросателлитных) маркеров (http://www.ncbi.nlm.nih.gov).

Для изучения генетического сходства белозерных сортов риса с их краснозерными аналогами попарно сравнивали аллельное разнообразие микросателлитных локусов ДНК (http://www.gramene.org).

Для оценки генетической однородности партий гибридных семян изучаемых гибридов подсолнечника (Helianthus annuus L.) были использованы микросателлитные маркеры: Ha 514-ar; Ha 1287-ar; Ha 1442-ar; Ha 1608-ar; Ha 1796-ar; HA 1327-ar (http://www.ncbi.nlm.nih.gov).

Для проведения ДНК (микросателлитного) анализа растений рода Echinochloa использовали микросателлитные маркеры: ЕС1, ЕС2, ЕС3, ЕС(Danquah E.Y. et al., 2002).

Для генотипирования 59 образцов российской государственной коллекции Magnoporthe grisea (Herbert) Barr (возбудителя пирикуляриоза риса) изучали полиморфизм 21 микросателлитного локуса паразита (http://www.ncbi.nlm.nih.gov).

В большинстве экспериментов ПЦР проводили с 40-50 нг ДНК в конечном объеме 25 мкл. Использовали следующий состав реакционной смеси:

0,1 mM каждого дезоксирибонуклеозидфосфата; 0,23М каждого праймера; 1 х ПЦР буфер (20 mM Трис-HCL, pH 8,4; 50 мМ KCL); 1 единица Taq-полимеразы.

Изначально температуру отжига праймеров рассчитывали по формуле Dieffenbach C.W. et al. (1995):

Т = 4 Со (G + C) + 2Со (А + Т) - 3, где G, C, A, T - количество гуанидиновых, цитозиновых, адениновых и тиминовых оснований, соответственно. В дальнейшем ее корректировали (уменьшали или увеличивали) для каждой праймерной пары в зависимости от качества ПЦР-продукта, получаемого при рассчитанной температуре. Таким образом, экспериментально были подобраны оптимальные условия ПЦР, обеспечивающие высокий выход продукта амплификации наряду с минимальным количеством синтезированных неспецифичных фрагментов ДНК.

Для электрофоретического разделения продуктов ПЦР большинства изученных и созданных в рамках данного исследования маркеров использовали 8% полиакриламидный гель на основе 1Трис-боратного буфера (0,09 М Трис, 0,09 М борной кислоты, 2 мМ ЭДТА, рН=8,2). Визуализацию проводили в ультрафиолете после окрашивания гелей бромистым этидием (EtBr).

Идентификацию и размер аллелей определяли с использованием программы GelPro 32.

Гибридизацию растений риса проводили пневмокастрацией и опылением «твелл» - методом (Лось Г.Д., 1987).

Oценку устойчивости растений риса к пирикуляриозу проводили в условиях вегетационной площадки ВНИИ риса в соответствии с методическими указаниями (Коваленко Е.Д., Горбунова Ю.В., Ковалева А.А. и др., 1988).

Для статистического анализа экспериментальных данных использовали кластерный (Ward J.H., 1963) и дискриминантный анализы (Клекка У.Р., 1989).

3 РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 3.1 Интрогрессия генов широкого спектра устойчивости к пирикуляриозу Рi-1, Pi-2, Pi-33 в отечественные сорта риса с применением методов маркерной селекции Гены широкого спектра устойчивости риса к пирикуляриозу, Рi-1, Рi-2, Рi33, являются важным генетическим ресурсом для селекции. (Deng Y. еt al., 2006). Многочисленные исследования показывают, что наибольший эффект перечисленные гены проявляют при совместном действии (Girish Kumar K. et al., 2000; Correa-Victoria F.J. et al., 2003).

В этой связи для придания длительной устойчивости к заболеванию нами проводилось пирамидирование указанных генов на генетической основе отечественных сортов риса Вираж, Боярин, Виктория.

На рисунке 1 представлена схема переноса каждого из генов Рi-1, Pi-2, Pi-33 в генотипы указанных сортов риса из линий-доноров.

Из рисунка видно, что, уже начиная с первого возвратного скрещивания, все последующие этапы селекционной схемы сопровождались маркерным контролем присутствия переносимых донорных аллелей в гибридном потомстве. Причем, поскольку оценка потомства по фенотипу (фитопатологический тест) не велась, ввиду отсутствия совместимых рас паразита, контроль передачи потомству соответствующего аллеля устойчивости на всех этапах селекционной схемы осуществлялся исключительно молекулярно-генетическим методом (микросателлитный анализ). Это стало возможным ввиду тесного сцепления использованных микросателлитных локусов с целевыми генами устойчивости, обеспечивающим их сонаследование.

Рисунок 1 - Схема интрогрессии каждого из генов устойчивости к пирикуляриозу Рi-1, Pi-2, Pi-33 в отечественные сорта риса После первого самоопыления проводился, кроме того, индивидуальный отбор (рис.1). Отбирали растения, наиболее близкие по морфотипу к реципиентной родительской форме и несущие, кроме того, донорные гены устойчивости к патогену в гомозиготном доминантном состоянии.

Рисунок 2 иллюстрирует маркерный контроль переносимой донорной аллели гена Pi-1 на этапе ВС1 (первое возвратное скрещивание). Комбинация скрещивания - C104-Lac (донор гена Pi-1) Боярин. Для анализа использован микросателлитный маркер Rm 224, сцепленный с геном Pi-1.

На рисунке хорошо видна разнокачественность исследованных образцов по наследованию донорных аллелей целевого гена: образцы на дорожках 1, 2, 4, 6, 7, 8 (в отличии от образцов на дорожках 3 и 5) являются гетерозиготами по локусу Rm 224.

Растения, в генотипе которых ПЦР-анализ не выявил донорных аллелей устойчивости, выбраковывали. ВС3 - растения с наименьшим вегетационным периодом и наибольшей фертильностью метелки и, по данным ДНК-анализа, несущие донорные аллели устойчивости, были отобраны для получения семян ВС3F-поколений. ДНК-анализ полученных популяций выявил образцы, несущие вводимые целевые гены в доминантном гомозиготном состоянии.

Pi-1 1 2 3 4 5 6 7 8 Боярин Рисунок 2 – Маркерный контроль наличия донорной аллели гена Pi-1 у растений ВС1- популяции Примечание - Экспериментальная популяция – ВС1 - растения от комбинации скрещивания C104-Lac (донор гена Pi-1) Боярин (реципиентная родительская форма); Pi-1 – линия C104-Lac; 1–8 – анализируемые ВС1растения Среди них удалось отобрать несколько, совмещавших в себе скороспелость, низкорослость, неосыпаемость и фертильность колосков.

Семена этих растений были высеяны, в потомстве отобраны лучшие экземпляры и скрещены между собой для достижения эффекта пирамидирования целевых генов.

Фитопатологический тест, проведенный лабораторией защиты риса ВНИИ риса в 2010 г. на вегетационной площадке института, выявил устойчивость одной из линий с пирамидированными генами устойчивости к пирикуляриозу (Pi-1+Pi-2+Pi-33) к смеси изолятов патогена, выделенных на территории Краснодарского края.

Таким образом, полученный сортообразец риса - ценный исходный селекционный материал, который может быть использован в качестве донора генов широкого спектра устойчивости к пирикуляриозу Рi-1, Pi-2, Pi-33. В коллекцию ВНИИ риса переданы также линии на генетической основе сорта Боярин с интродуцированными методом маркерной селекции донорными генами устойчивости к патогену:

- два сортообразца с геном Рi-1; номера каталога коллекции ВНИИ риса 04433, 04434, соответственно;

- два сортообразца с геном Рi-2; номера каталога коллекции ВНИИ риса 04435, 04436, соответственно;

- два сортообразца с геном Рi-33; номера каталога коллекции ВНИИ риса 04437, 04438, соответственно.

В коллекцию ВНИИ зерновых культур им. И.Г. Калиненко (г. Зерноград, Ростовская область) переданы также линии на генетической основе сорта Вираж с интродуцированными методом маркерной селекции донорными генами устойчивости к патогену:

- сортообразец с геном Рi-2; номер каталога коллекции ВНИИЗК 5441/08;

- сортообразец с геном Рi-33; номер каталога коллекции ВНИИЗК 5485/08;

- сортообразец с генами Рi-1и Рi-33; номер каталога коллекции ВНИИЗК 54561/08.

В качестве резюме необходимо отметить, что в случаях, когда речь идет об интрогрессии одного или нескольких донорных генов, применение методов молекулярного маркирования является приоритетным способом создания исходного селекционного материала с заданными признаками. Это становится особенно очевидным в тех случаях, когда фенотипически контролировать донорный признак не представляется возможным по тем или иным причинам.

3.2 Использование технологии молекулярного маркирования для идентификации важных для селекции риса генов 3.2.1 Создание внутригенных ДНК-маркеров гена устойчивости к пирикуляриозу риса Pi-ta По результатам более ранних исследований, одним из эффективных генов устойчивости риса к пирикуляриозу в Краснодарской зоне рисосеяния является ген Pi-ta (Коломиец Т.М., 1990). Ген Pi-ta секвенирован. Он расположен в области центромеры 12-й хромосомы (Kiyosawa S., 1981). В селекционных программах на устойчивость риса к пирикуляриозу важно контролировать аллельное состояние переносимого донорного гена в гибридном потомстве, т.е.

идентифицировать как доминантную, так и рецессивную аллели. С другой стороны, при массовом скрининге исходного селекционного материала на наличие изучаемого гена задача несколько иная: выявить донорные генотипы;

при этом нет необходимости контролировать аллельное состояние целевого локуса.

В этой связи нами была поставлена задача создания внутригенных кодоминантного и доминантного молекулярных маркеров гена Pi-ta для осуществления маркерного контроля при выполнении различных селекционных задач. Для дизайна праймеров использовали нуклеотидные последовательности доминантной (источник - сорт Yashiro-mochi) и рецессивной (источник - сорт Tsuyake) аллелей гена Pi-ta. Их номера в базе данных www.ncbi.nih.gov - AF207842 и AY196754, соответственно. Было проведено сравнение полученных нуклеотидных последовательностей доминантной и рецессивной аллелей гена Pi-ta с использованием алгоритма «multiple sequence alignment» в программе CLUSTALW (Hall T.A., 1999 г.). В результате был выявлен участок гена с единичной олигонуклеотидной заменой у контрастных по изучаемому гену сортов. Ниже представлена точка полиморфизма гена Pi-ta у сортов риса, несущих доминантную (внизу) и рецессивную (вверху) аллели гена:

cttctatctttacctgctatgcatcttcaacctgac cttctatctttaccttctatgcatcttcaacctgac При создании кодоминантного маркера целевого гена дизайн двух праймерных пар был выполнен таким образом, чтобы в каждой паре праймеров один из них являлся специфичным для конкретной аллели.

Аллельспецифичные праймеры каждой пары (F1 и R2) имели один общий нуклеотид в зоне SNP (single nucleotide polymorphism, точка единичной олигонуклеотидной замены). Дополнительные праймеры для каждой пары были подобраны произвольно, с точки зрения методического удобства (рис. 3).

Точка R2 RSNP 3' Участок двух- цепо- чечной ДНК 5' гена Pi-ta F2 FТочка SNP Рисунок 3 - Схема работы праймерных пар аллельспецифичного ПЦР-маркера гена Pi-ta Примечания 1 SNP – точка единичного олигонуклеотидного полиморфизма;

2 F1 и R1- прямой и обратный праймеры, соответственно, первой праймерной пары;

3 F2 и R2 - прямой и обратный праймеры, соответственно, второй праймерной пары;

4 Стрелками указано направление синтеза ПЦР-продуктов Нуклеотидная последовательность праймерных пар созданного кодоминантного маркера гена Pi-ta представлена в таблице 1.

Таблица 1 - Нуклеотидная последовательность праймеров для идентификации доминантной и рецессивной аллелей гена Pi-ta Праймеры Нуклеотидная последовательность праймерных пар F1 gccgtggcttctatctttacctg R1 atccaagtgttagggccaacattc F2 ttgacactctcaaaggactgggat R2 tcaagtcaggttgaagatgcataga Рисунок 4 иллюстрирует апробацию маркера на контрастных по изучаемому гену сортах риса. Размер ПЦР-продукта у сортов с доминантной и рецессивной аллелями гена отличается почти на 300 пар олигонуклеотидов, что позволяет выполнять визуализацию продукта ПЦР-реакции как в полиакриламидном, так и в агарозном геле, что немаловажно с точки зрения методического удобства при проведении массовых анализов.

1 2 3 4 5 Рисунок 4 - Проверка эффективности кодоминантного маркера для идентификации аллельного состояния гена Pi-ta ПЦР-методом Примечание: 1 – Сорт К1 (положительный контроль); 2 – сорт Nipponbare (отрицательный контроль); 3 – сорт Виктория; 4 – сорт IR36; 5 – сорт Toride;

6 - сорт Ou 2Таким образом, созданный маркер информативен для целей идентификации аллельного состояния при проведении маркерного контроля изучаемого локуса в селекционных программах.

Для создания доминантного маркера гена Pi-ta была использована аналогичная схема поисковой работы с некоторым отличием. После определения точки полиморфизма были сконструированы два, а не четыре аллельспецифичных праймера, причем прямой праймер, специфичный для доминантной аллели, начинался с полиморфной точки, а обратный выбран с точки зрения методического удобства.

Нуклеотидная последовательность сконструированных праймеров :

F: GCTGCTTGTTCGAACAGCGCCTGC (24 п.о) R: CAAGTCAGGTTGAAGATGCATAGC (24п.о) Для проверки эффективности доминантного маркера была поставлена пробная ПЦР с ДНК контрастных по изучаемому признаку сортов риса: К(положительный контроль) и Nipponbare (отрицательный контроль) (рисунок 5).

Рисунок 5 - Проверка эффективности доминантного маркера гена Pi-ta Примечание: mw - маркер молекулярного веса; сорт: К1 (положительный контроль), Nb – Nipponbare (отрицательный контроль) Из рисунка 5 видно, что аллельная миграция наблюдалась только в случае использования сорта, несущего доминантную аллель гена Pi-ta (положительный контроль); и отсутствовала у сорта с рецессивной аллелью гена (отрицательный контроль), что подтверждает эффективность созданного маркера.

Скрининг селекционного материала созданным маркером не выявил носителей доминантной аллели целевого гена среди 103 проанализированных сортообразцов контрольного питомника ВНИИ риса. Среди 33-х F7-линий (комбинация скрещивания IR-58 x Кубань 3): у 22-х линий доминантная аллель гена Pi-ta оказалась в гомозиготном состоянии; у 3-х – в гетеризиготном; у 8 – отсутствовала вообще.

Таким образом, применение созданных внутригенных маркеров ускоряет селекционный процесс по гену Pi-ta, повышая его эффективность.

3.2.2 Создание внутригенного аллельспецифичного ДНК-маркера гена красной окраски перикарпа риса Rc Во всех зонах рисосеяния краснозерные формы являются злейшими засорителями полей и наносят рисоводству ощутимый вред, резко снижая товарную ценность семян. Данные, полученные лабораторией технологической оценки качества зерна ВНИИ риса, показывают, что каждый процент краснозерной примеси снижает урожай партии семян на 1,5–2,3% (Туманьян Н.Г., 2001). В соответствии с ГОСТ Р 52325-2005, в посевах оригинальных и элитных семян риса не допускаются краснозерные формы. В репродукционных семенах и в семенах, предназначенных для производства товарной продукции, примесь таких форм риса не должна превышать соответственно 0,5% и 1,0%. В этой связи для эффективного контроля сортовой чистоты семян риса особое значение приобретает технология выявления гена краснозерности Rc у растений задолго до непосредственного фенотипического проявления признака (появление метелки), что дает возможность заблаговременно элиминировать нежелательные генотипы из дальнейшего размножения в процессе первичного семеноводства сортов.

В рамках данного исследования был создан внутригенный кодоминантный маркер гена Rc, выявляющий носительство доминантной аллели указанного гена вне зависимости от стадии онтогенеза растения риса. Для разработки и дизайна праймеров были использованы нуклеотидные последовательности аллельной серии гена (www.ncbi.nih.gov; номера в базе данных: DQ204735, DQ204736, DQ204737 и DQ204738). Затем было проведено сравнение полученных нуклеотидных последовательностей с использованием алгоритма «multiple sequence alignment» в программе CLUSTALW (см. выше).

В результате была локализована делеция из 14 пар оснований у аллели rc белозрного риса; и сконструированы четыре праймера, предварительно проверенных в системе поиска BLAST базы данных www.gramene.org, чтобы исключить возможность амплификации неспецифичных зон ДНК с помощью этих праймеров:

F1 – ACAACACTGACACTGAAAGG;

R1 – GCATCCACTTGCGCCTTTCC;

F2 – GCAAGTGGAACGCGAAAAGT;

R2 – TTCCAATGTTCGTTAGAGGC Как показано на рисунке 6, два праймера (F1 и R2) являются аллельспецифичными, а два других – нет.

Рисунок 6 - Схема работы праймерных пар аллельспецифичного ПЦР-маркера гена Rc На рисунке аллельная серия локуса Rc (Rc/Rcs/Rc+) имеет обозначение Red, а аллель rc - White. Цифры, изображнные чрным, показывают размер целевых амплифицируемых фрагментов (п.о.), а цифры, изображенные серым – длину минорных фрагментов, амплифицируемых при постановке ПЦР со смесью обеих пар праймеров в одной пробирке (F1, R1 + F2, R2). Жирным пунктиром показана делеция в 14 п.о., тонким пунктиром – участки, идентичные между аллелями. Стрелками – направление синтеза.

Первоначально температура отжига каждого праймера была рассчитана по формуле (см.выше); окончательная температура была подобрана эмпирическим путм. При проведении ПЦР в реакционной смеси была использована смесь праймеров.

Проверка эффективности созданного молекулярного маркера на отечественных сортообразцах риса, контрастных по изучаемому признаку, представлена на риунке 7.

Рисунок 7 - Аллельные различия в локусе Rc у краснозерных и белозерных сортов риса Примечания 1 Краснозрные сорта: 1 – Карат, 2 – Рубин, 4, 6, 8 – краснозерные аналоги белозерных сортов Павловский, Спринт, Привольный, соответственно;

2 Белозерные сорта: 3 – Хазар, 5 – Павловский; 7 – Спринт;

3 «MW» - маркер молекулярного веса 4 Фрагмент, на который указывает стрелка, соответствует 790 п.о.

Из рисунка видно, что созданный маркер позволяет чтко различать аллельное состояние локуса Rc: доминантное (краснозрность) и рецессивное (белозрность).

Для определения порога чувствительности описанной методики была проведена ПЦР с различным соотношением ДНК образцов красно- и белозрного риса в одной пробирке, с использованием при этом одной пары праймеров, идентифицирующей доминантную аллель гена Rc (краснозерность).

Для экстракции ДНК брали по 0,15 г биомассы зелных листьев образца белозрного сорта Павловский и краснозрного – Карат. После достижения эквивалентности концентраций ДНК указанных образцов (800 мкг/мл в обеих пробах) ДНК сорта Карат разводили деионизированной водой в 50, 100, 200, 500 и 1000 раз.

ПЦР-анализ показал, что маркер способен точно выявить краснозерную аллель при соотношении ДНК краснозрного риса к ДНК белозрного вплоть до 1: 200.

Для полевой апробации созданной методики, проведенной в 2010 г. в ПИП1 ВНИИ риса на сортах Атлант, Ренар и Флагман, выделяли ДНК из общей биомассы листьев (стадия второго-третьего настоящего листа), отобранных от каждого растения каждой исследуемой «семьи» изучаемого сорта с последующей постановкой ПЦР и электрофореза.

В случае обнаружения доминантной аллели гена краснозрности в исследуемой группе («семье») растений эта группа полностью элиминируется из ПИП1. Если же необходимо точно идентифицировать краснозерное растение, проводится ПЦР-анализ каждого растения делянки («семьи»).

В результате ДНК-анализа ни в одной из изученных семей не было обнаружено растений с доминантной аллелью гена Rc.

Применение апробированной таким образом методики целесообразно для ежегодного контроля чистоты ПИП1 размножаемых отделом семеноводства и семеноведения института сортов риса от краснозерной примеси. При этом важно, что контроль можно начинать задолго до фенотипического проявления изучаемого признака (появление метелки), что повышает его надежность.

3.2.3 Изучение генетической природы краснозерных аналогов белозерных сортов в системе производственного выращивания риса Как указывалось выше, краснозрные формы риса являются злейшими засорителями рисовых полей. Особое место здесь занимают так называемые краснозерные аналоги белозерных сортов. Феномен таких аналогов состоит в появлении и прогрессивном нарастании числа краснозерных растений в рисовых чеках с районированными белозерными сортами при производственном выращивании риса. При этом морфотипы белозерных и краснозерных растений очень схожи. Есть две основные обсуждаемые гипотезы о происхождении краснозерных аналогов. Эти формы могли возникнуть как вследствие мутаций в локусе Rc, сдвигающих рамку считывания, так и вследствие переопыления белозерных растений сорно-полевыми краснозерными формами риса.

В первом случае оригинальные сорта и их краснозерные аналоги генетически должны быть идентичными, за исключением локуса, в котором произошла мутация. Подобная ситуация описана в работе S.A. Brooks с соавторами на краснозрной форме сорта Wells (Brooks S.A. et al., 2007).

Во втором случае сравнительный анализ ДНК оригинальных, белозерных сортов риса и их краснозерных аналогов должен выявить полиморфизм не только в мутантном, но и во многих других исследуемых локусах.

Для проверки этих гипотез нами была предпринята попытка попарного сравнения полиморфизма 30 ДНК (микросателлитных) локусов белозрных сортов риса Бластоник, Виктория, Изумруд, Краснодарский-86, Кубань-3, Лиман, Павловский, Привольный, Соната, Спринт и их краснозрных аналогов. Кластеризация изученных образцов (Олдендерфер М.С., Блэшфилд С.К., 1989) на основе проведенного микросателлитного анализа выявила наличие двух кластеров при разрезании иерархического дендрита на расстоянии 1,0 условной единицы: в первый кластер попали все белозерные сорта; во второй – все их краснозерные аналоги (рис. 8).

Рисунок 8 - Кластерный анализ сортов риса и их краснозерных аналогов на основе данных микросателлитного анализа Из данных кластеризации следует, что:

1) изученные краснозерные аналоги не могли произойти от белозерных сортов в результате точковой мутации, так как аллельные различия исследованных 30 микросателлитных локусов ДНК в пределах каждой изученной пары (белозерный сорт и его краснозерный аналог) весьма существенны;

2) выявленное указанное несходство аллельного разнообразия микросателлитных локусов позволяют предположить, что краснозерные аналоги возникли в результате переопыления краснозрными сорно-полевыми формами белозерных растений риса с последующим многократным самоопылением последних в ряду поколений, результатом чего стало сильное сходство морфотипов полученных краснозерных гибридов с оригинальными белозерными сортами, используемыми в производственном выращивании;

3) попадание всех изученных краснозерных аналогов в один кластер может свидетельствовать в пользу того факта, что растения изученных районированных белозерных сортов были когда-то переопылены одной или группой схожих по гентипу сорно-полевых форм риса, преобладающих в краснодарской зоне рисосеяния.

Очевидно, что подобный процесс происходит постоянно в ходе длительного выращивания сортов риса в производственных условиях, являясь основной причиной засорения зерна краснозерной примесью. Прогрессивное нарастание процента краснозерности в процессе возделывания белозерных сортов происходит вследствие погрешностей агротехнических приемов, применяемых для удаления сорняков с рисовых полей, включая краснозерные сорно-полевые формы риса. В этой связи в вопросе контроля краснозерности в производственных посевах риса становится понятной приоритетность агротехнических приемов.

3.3 Изучение биоразнообразия растительных ресурсов на основе молекулярно-генетического подхода В данном разделе исследования изучалось биоразнообразие сельскохозяйственно важных растений, вредоносных сорняков, а также грибных фитопатогенов для решения практических задач селекции и семеноводства.

3.3.1 Генетическая паспортизация отечественных сортов и сортообразцов риса (Oriza sativa L.) с использованием ПЦР-маркеров Генетическая паспортизация создаваемых сортов и гибридов сельскохозяйственных растений в последнее время все более востребована их оригинаторами, прежде всего, для оценки генетической чистоты реализуемых партий семян, а также для защиты авторских прав селекционеров.

Современный рынок семян сельскохозяйственных культур предъявляет жесткие требования к их сортовым качествам. Сортовая идентификация обязательна при сертификации коммерческих партий семян. В последнее время все чаще для этого используются современные методы молекулярного маркирования как наиболее достоверные и надежные.

В этой связи была проведена ДНК-паспортизация 39 сортов и сортообразцов коллекции ВНИИ риса с последующей их кластеризацией на основе сходства микросателлитных локусов ДНК. Для этого было использовано 14 «нейтральных» микросателлитных маркеров. Изученные маркеры проявили различный уровень полиморфизма: от трех до семнадцати аллелей на один микросателлитный локус с максимальным полиморфизмом по локусам RM 70 и RM 164.

В качестве иллюстрации на рисунке 9 представлено алллельное разнообразие у 18 сортов и сортообразцов коллекции ВНИИ риса в микросателлитном локусе RM 164.

Каждый изученный сорт (сортообразец) обладал уникальным набором микросателлитных аллелей. В ходе эксперимента не было найдено ни одной пары сортов с полностью идентичным аллельным разнообразием по изученным локусам. По результатам микросателлитного анализа была выполнена кластеризация сортов и сортообразцов риса по методу Ward (Олдендерфер М.С., Блэшфилд С.К.,1989). В результате было выявлено два кластера (рис.10).

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Рисунок 9 - Аллельная миграция в локусе RM 164 у 18 сортов и сортообразцов коллекции ВНИИ риса Примечание - Стрелками указан маркер молекулярного веса; 1-18 - сорта и сортообразцы Рисунок 10 - Кластерный анализ 39 сортов и сортообразцов риса, по данным микросателлитного анализа Достоверность межкластерных различий была подтверждена одним из многомерных статистических методов – дискриминантным анализом. При разделении двух групп (кластеров) была получена только одна дискриминантная функция. Ее анализ показал, что кластеры различаются статистически достоверно, о чем свидетельствует нулевое значение вероятности нуль-гипотезы.

В результате проведенного генотипирования создана база данных, содержащая информацию об аллельном разнообразии 14-ти микросателлитных локусов ДНК изученных сортов и сортообразцов из коллекции ВНИИ риса, которая в случае необходимости может быть использована оригинатором сортов (ВНИИ риса) для защиты авторских прав селекционеров. Для практической селекции риса кластеризация генотипов на основе ДНК-анализа, отражающая степень генетического сходства между ними, может быть с успехом использована при подборе родительских пар для гибридизации с целью получения максимального спектра изменчивости в гибридном потомстве.

3.3.2 Использование технологии молекулярного маркирования для оценки генетической однородности семян простых гибридов Fподсолнечника (Helianthus annuus L.) для применения в практическом семеноводстве культуры Для гетерозисных сельскохозяйственных культур – гибридный подсолнечник, кукуруза, болгарский (сладкий) перец – чистосортность семян (гибридность) особенно важна, так как в данном случае урожай напрямую зависит от процента гибридных зерновок (семянок) в реализуемой партии семян. В условиях жесткой конкуренции на современном рынке семян требования к их качеству сильно возросли. Например, согласно ГОСТ Р 523252005, сортовая типичность семян подсолнечника у родительских форм простых гибридов (линий) в реализуемой партии должна быть не менее 99,8%.

В случае необходимости быстрой проверки семян на сортовую принадлежность и сортовую чистоту, например, при торговых операциях, традиционные методы (апробация и грунтовой контроль) не могут быть использованы, так как из-за их сезонности и длительности они дают информацию скорее констатирующую, чем упреждающую. В такой ситуации лабораторный контроль – единственный действенный инструмент оценки генетической однородности реализуемой партии семян.

Целью данного раздела была оптимизация системы молекулярного маркирования для оценки генетической однородности партий семян трех простых гибридов подсолнечника F1 отечественной селекции на основе ДНКанализа (путем маркирования микросателлитных локусов ДНК) для последующего применения в практическом семеноводстве изученных гибридов.

Схема эксперимента состояла из следующих этапов:

- проведен поиск ДНК-маркеров в базе данных (www.ncbi.nih.gov), в результате которого отобраны микросателлитные маркеры, выявившие, по литературным данным, максимальное аллельное разнообразие при скрининге различных коллекций подсолнечника;

- оценен полиморфизм шести отобранных микросателлитных локусов между инбредными линиями подсолнечника – родительскими формами изучаемых простых гибридов;

- отобраны четыре проявившие полиморфизм маркера, информативные для работы с изучаемыми простыми гибридами подсолнечника;

- выполнена оптимизация условий ПЦР для использованных в работе микросателлитных маркеров;

- проведена оценка генетической чистоты (гибридность) партий семян простых гибридов подсолнечника Махаон 40, Махаон, Светлана (оригинатор – компания «Агроплазма», г. Краснодар) на основе ДНК (микросателлитного) анализа.

Исследования велись с использованием отобранных маркеров (Hа1327-ar, Ha1442-ar, Ha1608-ar, Ha1796-ar). Рисунок 11, например, иллюстрирует оценку полиморфизма микросателлитных локусов НА 1796- ar и НА 1442-ar между восемью инбреднными линиями подсолнечника.

Рисунок 11 – Оценка полиморфизм микросателлитных локусов НА 1796- ar и НА 1442-ar между инбредными линиями – родительскими формами простых гибридов подслнечника (оригинатор линий – компания «Агроплазма», г. Краснодар) Примечание - Номерами обозначены инбредные линии:

а) при скрининге маркером Ha 1796 ar:

1- BС 42; 2- AM 08; 3- АМ 40; 4- AC 42; 5- RM 02; 6- BM 42; 7- RB; 8- AM б) при скрининге маркером Ha 1442 ar:

1- BС 42; 2- AM 08; 3- АМ 40; 4- RM 02; 5- BM 42; 6- AC 42; 7- AM 32; 8- RB Маркеры, оказавшиеся полиморфными между родительскими линиями каждой анализируемой гибридной комбинации, были использованы для оценки гибридности реализуемых партий семян этой комбинации (рис.12).

Рисунок 12 – Аллельное разнообразие в локусе НА 1327-ar у семянок простого гибрида подсолнечника Махаон Примечание - № 9, 10 – материнская и отцовская инбредные линии данного гибрида, соответственно Из рисунка видно, что из 18 представленных на данной электрофореграмме семянок как «отцовская», так и «материнская» аллели в данном локусе присутствует у 8 (№№ 2, 3, 6, 7, 14, 17, 18, 20), которые, таким образом, являются гибридными. Остальные семянки несут только «материнскую» аллель и, следовательно, не являются гибридными.

По результатам посеменного микросателлитного анализа (изучаются микросателлитные профили ДНК-локусов каждой из 100 исследуемых семянок) была проведена оценка генетической однородности (процент гибридных семянок на 100 исследуемых) коммерческих партий семян указанных гибридов, подлежащих реализации. Кроме того, данный анализ был использован для проверки генетической однородности родительских линий этих гибридов.

Гибридные семянки проверенных лабораторным методом партий подсолнечника были высеяны в поле для проведения так называемого грунтконтроля (оценка генетической однородности по данным морфотипа) (табл. 2).

Несколько заниженный процент генетической однородности исследуемых гибридов подсолнечника, полученный нами по результатам лабораторного теста (отсутствие разнокачественности микросателлитных профилей между анализируемыми семянками), по сравнению с данными полевого тестирования (оценка однородности растений по морфотипу) может быть, в числе прочих причин, обусловлен также и тем, что при созревании гибридов на участках гибридизации нельзя полностью исключить переопыление материнской линии гибрида другой формой, генетически близкой к отцовской. В таком случае выявить указанные генетические различия при грунтконтроле, основываясь на данных морфотипа, может быть затруднительно, а чувствительность ДНКметода позволяет это сделать.

Таблица 2 - Результаты анализа генетической однородности семян реализуемых партий простых гибридов подсолнечника (данные 2009 г.) Сортовая чистота (процент Сортовая чистота гибридных семянок) по № (процент гибридных Гибрид результатам лабораторного партии растений) по данным ДНК(микросателлитного) грунт-контроля анализа Махаон 615 97,9 Махаон 40 641 97,5 Для получения более сопоставимых результатов в дальнейшем предложенная методическая схема должна быть усовершенствована по следующим направлениям:

- строгое соблюдение технологического регламента при выращивании гибридов на участках гибридизации (соблюдение пространственной изоляции посевов, выкашивание отцовской линии гибрида сразу после опыления, до созревания семянок);

- увеличение количества исследуемых микросателлитных локусов, полиморфных между родительскими инбредными линиями, при ДНК-анализе гибридных семянок.

Резюмируя сказанное, необходимо отметить, что генетическое разнообразие микросателлитных локусов ДНК можно с успехом использовать как надежный признак для оценки сортовых качеств семян гибридного подсолнечника (как и ряда других гетерозисных культур) и получать достоверные данные о чистосортности семян в упредительном режиме, не дожидаясь результатов грунт-контроля. Тем более что последние, в подавляющем большинстве случаев, возможны только на следующий после получения гибридных семян вегетационный сезон. Иными словами, реализовывать партии семян зачастую приходится «вслепую», не имея полной уверенности в их гибридности или гибридности, полученной в результате опыления отцовской формой гибрида.

3.3.3 Изучение меж- и внутривидового разнообразия злостного сорняка рода Echinochloa методом молекулярного маркирования Ежовник куриное просо (просянка), Echinochloa crussgalli – наиболее распространенный сорняк в рисоводстве на территории стран СНГ. Увеличение числа побегов этого сорняка до 200 и более на 1 м2 снижает продуктивность риса до 50% и более. Это однолетние растения с огромным коэффициентом кущения. Отдельные растения формируют до 58 побегов, высота 90–170 см, иногда достигает 200 см. (Агарков В.Д., Касьянов А.И., 2000).

Целью данного раздела исследования было изучение внутри- и межвидового биоразнообразия злостного сорняка рисовых полей рода Echinochloa (ежовники) в рисосеющих регионах стран СНГ на основе ДНК (микросателлитного) анализа различных экотипов сорняка, а также молекулярно-генетическое обоснование наличия огромного количества переходных форм и схожих морфологических признаков у представителей разных таксонов целевого рода, затрудняющих точную идентификацию растений.

Кроме того, точная идентификация и характеристика генетических взаимосвязей этого проблемного сорняка поможет разработать подробные рекомендации по применению гербицидов, целенаправленно поражать отдельные экотипы меньшим количеством химикатов. С другой стороны, зональная ДНК-паспортизация экотипов сорняка, преобладающих в том или ином рисосеющем регионе, может использоваться в селекционных схемах, направленных на создание сортов риса с высокой энергией роста из-под слоя воды при использовании безгербицидной технологии борьбы с сорняками рисовых полей.

В ходе экспедиционных поездок, проводившихся в течение семи вегетационных сезонов (2005-2011 гг.), были обследованы 37 районов Краснодарского края, а также часть территории Ростовской области (побережье Таганрогского залива, берега лиманов за г. Таганрог), где собран гербарный материал целевого сорняка. В результате выполнено картирование указанных территорий по распространенности сорняка.

Собранные в ходе экспедиций растения описаны по морфотипу и идентифицированы в соответсвии с таксономическими ключами, принятыми в России, (Косенко И.С., 1970).

Далее был проведен ДНК- анализ 80 идентифицированных по морфотипу растений для выявления генетического сходства растений как на меж-, так и внутривидовом уровне. Сформирована пополняемая база данных, содержащая информацию об аллельном разнообразии микросателлитных локусов ДНК изученных образцов целевого сорняка. В эксперимент были также включены образцы из коллекции ВНИИ риса, собранные ранее на рисосеющих территориях Украины и Астраханской области России.

Были использованы 4 микросателлитных маркера - ЕС1, ЕС2, ЕС3, ЕС5, созданные для изучения биоразнообразия рода Echinochloa (Danquah E.Y. et al., 2002). ДНК-анализ показал, что выявленное аллельное разнообразие исследованных локусов оказалось невелико (рис. 13). В локусе Ech 1, например, среди всех исследованных образцов обнаружено три аллели, в локусе Ech 5 – всего две аллели.

Последующий статистический анализ экспериментальных данных, выполненный методом Ward (Олдендерфер М.С., Блэшфилд С.К., 1989) преследовал целью классификацию образцов по общности генотипов (рис. 14).

В результате разрезания иерархического кластерного дендрита на уровне усл. ед. было выявлено три кластера. При этом не было выявлено очевидной зависимости между таксономической принадлежностью растений, местом произрастания и их кластерной принадлежностью. Так, образцы растений разных видов изучаемого рода, например, Echinochloa crussgalli (образец № 03 - 5-21, собран в Херсонской области Украины) и Echinochloa orizoides (образец № 03-12-4, собран в г. Пролетарск, Ростовской области), произраставшие, кроме того, в отдаленных друг от друга эколого-географических зонах, попали в один кластер.

Сходство микросателлитных профилей изученных образцов может свидетельствовать в пользу существующего в природе процесса естественного переопыления растений, принадлежащих к разным таксонам исследуемого рода и, вследствие этого, наличия огромного количества переходных форм, описанных ботаниками и затрудняющих точную идентификацию растений целевого рода. Это, в свою очередь, привело к сходству локусов ДНК, что проиллюстрировал микросателлитный анализ. Таким образом, экспериментальные данные ДНК-анализа подтвердили гипотезу внутри- и межвидового скрещивания, существующего в природных популяциях сорняка (Danquah E.Y. et al., 2002).

Рисунок 13 - Аллельное разнообразие в локусе Еch1 у 16 исследованных гербарных образцов растений рода Echinochloa, собранных в различных эколого-географических районах рисосеяния Примечания 1 Крайняя левая дорожка – маркер молекулярного веса;

2 Последующие 16 дорожек слева направо – изученные гербарные образцы растений рода Echinochloa Рисунок 14 - Результаты кластерного анализа 55 образцов растений рода Echinochloa (ежовники), (по данным микросателлитного анализа) Примечание - По оси абцисс - номера изученных образцов ежовников 3.3.4 Изучение биоразнообразия образцов российской государственной коллекции Magnoporthe grisea (Herbert) Barr (возбудителя пирикуляриоза риса) методом молекулярного маркирования.

Мониторинг расового состава возбудителя пирикуляриоза (наиболее вредоносного заболевания риса во всех рисосеющих регионах мира) необходим для разработки правильной селекционной стратегии в создании устойчивых сортов этой важнейшей сельскохозяйственной культуры.

В этой связи целью данного раздела работы было изучение генетического разнообразия возбудителя пирикуляриоза риса на основе молекулярногенетического подхода, исследуя полимрфизм 21-го ДНК (микросателлитного) локуса патогена.

Сравнение «ДНК-паспортов» рефренсных изолятов с известным патотипом с таковыми у вновь выделенных полевых изолятов может дать информацию о степени их генетического сходства. Значительное сходство в данном случае позволяет предположить также и сходство их патотипов. Такая информация чрезвычайно важна для селекционеров.

При экспериментальном подтверждении данного предположения эта стратегия могла бы стать неплохой альтернативой классическому фитопатологическому способу генотипирования полевых изолятов паразита (использующему сорта-дифференциаторы растения-хозяина с известными генами устойчивости к паразиту). Молекулярно-генетический подход значительно облегчает и ускоряет выполнение указанной задачи.

В этой связи в рамках данного исследования проведена генетическая паспортизация изолятов государственной коллекции Magnoporthe grisea, держателем которой является Всероссийский научно-исследовательский институт фитопатологии (ВНИИФ, п. Большие Вяземы, Московская область).

ДНК 59 изолятов коллекции с известным патотипом, охарактеризованных, кроме того, по комплексу культурально-морфологических свойств, была любезно предоставлена для проведения молекулярного (микросателлитного) анализа сотрудниками лаборатории микологии и иммунитета ВНИИФ.

Таблица 3 иллюстрирует выявленный нами полиморфизм микросателлитных локусов ДНК коллекционных изолятов.

Таблица 3 - Полиморфизм микросателлитных локусов ДНК изолятов российской государственной коллекции Magnoporthe grisea (Herbert) Barr Число аллелей, Размер № п/п Микросателлитный локус выявленных амплифицирован- в ходе исследования ных аллелей (п.о.) 1 Pyrms 7–8 7 99-12 Pyrms 15–16 6 133-13 Pyrms 37–38 4 190-24 Pyrms 39–40 7 430-55 Pyrms 43–44 9 166-36 Pyrms 45–46 7 200-27 Pyrms 47–48 4 175-18 Pyrms 59–60 9 168-39 Pyrms 61–62 4 220-210 Pyrms 63–64 5 176-111 Pyrms 67–68 6 194-712 Pyrms 77–78 7 106-213 Pyrms 81–82 7 184-214 Pyrms 83–84 8 160-615 Pyrms 87–88 7 174-216 Pyrms 93–94 6 206-217 Pyrms 99–100 10 173-218 Pyrms 101–102 2 419 Pyrms 107–108 5 290-320 Pyrms 115–116 5 369-421 Pyrms 125–126 12 120-3Из таблицы 3 видно, что у изученных образцов микросателлитные маркеры проявили различный уровень полиморфизма: от двух до двенадцати аллелей на один локус с максимальным полиморфизмом по маркерам Pyrms 43 – 44, Pyrms 59 – 60, Pyrms 99 – 100 и Pyrms 125 – 126.

На рисунке 15 проиллюстрировано аллельное разнообразие исследованных изолятов патогена в микросателлитном локусе Pyrms 99 - 100.

Рисунок 15 - Аллельное разнообразие, выявленное у коллекционных изолятов возбудителя пирикуляриоза риса в локусе Pyrms 99-1Примечания 1 Крайние дорожки электрофореграммы – маркер молекулярного веса;

2 Изоляты: 1 – КП-10.83, 2 – ОК-28sem, 3 – ХС-21 R1122.84, 4 – ОК-23met, 5 – КП-74usl.85, 6 – ОК-19 R7.86, 7 – ОК-26 R1122-11221118, 8 – F-67-57п.95-85 R1117, 9 – КК-96usl2, 10 – КК-96usl.3, 11 – КП-57мет R1114, 12 – 138 AR1119, 13 – ХК-40 R335п42-90R1119, 14 – КК-97-24, 15 – КК-97-4 3, 16 – КК-97-По результатам эксперимента была составлена матрица и выполнена кластеризация изолятов фитопатогена по степени сходства их ДНК-локусов.

Для этой цели использовали кластерный анализ по методу Ward (Олдендерфер М.С., Блэшфилд С.К., 1989). Результаты кластеризации представлены на рисунке 16.

Рисунок 16 - Кластерный анализ изученных изолятов Magnoporthe grisea (Herbert) Barr, по данным микросателлитного анализа В результате разрезания иерархического кластерного дендрита на уровне 0,6 усл.ед. были выделены четыре кластера. «Емкость» кластеров была различной и варьировала от 10 до 20 изолятов. Очевидно, что в первом кластере преобладают изоляты японского происхождения; туда же относятся оба французских изолята, во втором – изоляты, собранные на территории Краснодарского края. Третий кластер целиком состоит из изолятов украинского происхождения. К четвертому относятся украинские и российские, а также японские изоляты (табл. 4).

Таблица 4 - Доля изолятов патогена разного географического происхождения в кластерах (%) Происхождение Емкость № кластера Краснодарский Франция Япония Средняя кластера Украина (шт.) край Aзия 1 20 20 10 10 60 2 12 8 59 0 25 3 17 100 0 0 0 4 10 60 30 0 10 Окончательное решение вопроса о различиях между кластерами было получено с использованием дискриминантного анализа, который подтвердил, что кластеры изолятов действительно различаются друг от друга (таблица расстояний Махаланобиса, традиционно подтверждающая результат дискриминации групп), (табл. 5).

Таблица 5 - Расстояния Махаланобиса для кластеров коллекционных изолятов возбудителя пирикуляриоза риса Кластер 1 2 3 1 - 3,13 2,41 1,2 0,00 - 1,61 2,3 0,00 0,00 - 0,4 0,00 0,00 0,00 - Примечание - Выше главной диагонали приведены расстояния Махаланобиса;

ниже - вероятность ноль-гипотезы об отсутствии различий Проведенное в рамках данной работы генотипирование изолятов возбудителя пирикуляриоза риса с известным патотипом из государственной коллекции патогена позволило создать генетические «отпечатки» каждого изолята, на основе чего сформирована база данных. Это позволит в дальнейшем проводить сравнительную характеристику микросателлитного профиля каждого вновь выделенного полевого изолята паразита из различных зон рисосеяния с таковыми из базы данных, оценивая, таким образом, степень их генетического сходства.

Как указывалось выше, при значительном сходстве микросателлитных профилей рефренсных (с известным патотипом) и новых полевых изолятов высоковероятно также и сходство их патотипов. Это, в свою очередь, дает селекционером ценную информацию об эффективных в данной зоне рисосеяния генах устойчивости риса к возбудителю пирикуляриоза.

Такой подход особенно эффективен в ситуациях, когда корректно провести классический фитопатологический тест с привлечением сортовдифференциаторов для выяснения патотипа изучаемой популяции паразита не представляется возможным.

Среди всех изученных изолятов не было обнаружено двух с идентичным набором микросателлитных аллелей. Таким образом, результат эксперимента показал эффективность использования полиморфизма микросателлитных локусов для изучения генетического разнообразия возбудителя пирикуляриоза риса.

ЗАКЛЮЧЕНИЕ В рамках данного исследования обоснована эффективность и целесообразность молекулярно-генетического подхода при решении практических задач селекции и семеноводства важных сельскохозяйственных культур. Показаны возможности молекулярного маркирования при создании селекционного материала с заданными свойствами ускоренными темпами. По мере улучшения экономического состояния сельскохозяйственного производства будет происходить все более активное внедрение современных биотехнологических методов в процессы создания сортов и сертификации семян. При этом описанные в проведенном исследовании селекционносеменоводческие схемы вполне могут стать типовыми.

ВЫВОДЫ 1. Разработанные методические схемы ДНК-паспортизации, а также выявления хозяйственно ценных признаков в исходном селекционном материале с помощью молекулярного маркирования усовершенствуют селекционно-семеноводческий процесс сельскохозяйственно важных растений (рис, подсолнечник).

2. Селекционный материал риса на генетической основе отечественных сортов Виктория, Боярин, Вираж с интродуцированными (в том числе - с тремя пирамидированными) генами Pi-1, Pi-2, Pi-33, придающими длительную устойчивость к пирикуляриозу, созданный методом маркерной селекции, может использоваться в качестве донорного в селекции устойчивых к патогену сортов риса.

3. Созданные внутригенные молекулярные маркеры эффективного в Краснодарском крае гена устойчивости риса к пирикуляриозу Pi-ta позволяют проводить массовый скрининг селекционного материала для выявления доноров указанного гена, а также осуществлять маркерный контроль целевого гена в селекционных программах без оценки по фенотипу (фитопатологический тест с использованием совместимых рас паразита). Это дает возможность ускоренными темпами создавать перспективные, устойчивые к патогену, формы риса.

4. Контроль чистоты питомников размножения (первичные звенья семеноводства) сортов риса от краснозерного засорения с применением созданного ПЦР-маркера гена красной окраски перикарпа риса Rc повышает надежность и эффективность семеноводческого процесса риса, позволяя проводить раннюю (задолго до появления метелок) диагностику краснозерной примеси.

5. На основе молекулярно-генетического подхода изучена генетическая основа феномена краснозерных аналогов, резко снижающих качество зерна при производственном выращивании белозерных сортов риса.

Обосновано, что переопыление сорно-полевыми краснозерными формами, а не мутации в локусе Rc – наиболее вероятная причина возникновения таких аналогов. В этой связи в вопросе контроля краснозерности в производственных посевах риса становится понятной приоритетность агротехнических приемов.

6. ДНК-паспортизация 39 сортов и сортообразцов коллекции ВНИИ риса, выполненная на основе микросателлитного анализа, может быть использована в селекционном процессе для подбора родительских форм при гибридизации, а также для защиты авторских прав селекционеров.

7. Оптимизирована методическая схема оценки генетической однородности семян простых гибридов F1 подсолнечника, (Helianthus annuus L.) на основе молекулярного маркирования. Ее применение в практическом семеноводстве изученных гибридов повышает надежность контроля генетической чистоты производимых коммерческих партий гибридных семян вне зависимости от сезона вегетации, а также внутреннего контроля (компанией - оригинатором) качества родительских линий гибридов.

8. Биоразнообразие злостного сорняка рисовых полей рода Echinochloa (ежовники) из рисосеющих регионов стран СНГ впервые изучено методом молекулярного маркирования. ДНК-анализ подтвердил гипотезу внутри- и межвидового скрещивания, существующего в природных популяциях сорняка (Danquah E.Y. et al., 2002), объясняющую наличие большого количества переходных форм, и схожих морфологических признаков у представителей разных таксонов рода.

9. Созданная база данных, содержащая информацию об аллельном разнообразии микросателлитных локусов ДНК различных экотипов ежовников, может быть использована для изучения генетических взаимосвязей таксонов рода Echinochloa. Это поможет разработать рекомендации по применению гербицидов, целенаправленно поражать отдельные формы сорняка меньшим их количеством.

10. ДНК-паспортизация экотипов сорняка, преобладающих в конкретных зонах рисосеяния, может использоваться в селекционных схемах, направленных на создание сортов риса с высокой энергией роста из-под слоя воды при использовании безгербицидной технологии борьбы с сорняками рисовых полей.

11.Молекулярно-генетическими методами (ПЦР-анализ) изучено биоразнообразие 59 образцов российской государственной коллекции Magnoporthe grisea (Herbert) Barr – возбудителя пирикуляриоза риса.

Коллекционные изоляты генотипированы на основе полиморфизма микросателлитных локусов ДНК. Сравнение микросателлитных профилей рефренсных штаммов (с известным патотипом) патогена с таковым вновь выделенных полевых изолятов гриба дает информацию о степени их генетического сходства.

РЕКОМЕНДАЦИИ ДЛЯ ПРАКТИЧЕСКОЙ СЕЛЕКЦИИ И СЕМЕНОВОДСТВА 1. Использовать полученные линии риса с интродуцированными и, в том числе, с тремя пирамидированными генами Pi-1, Pi-2, Pi-33, в качестве донорных в селекционных программах, направленных на создание устойчивых к пирикуляриозу сортов.

2. Для массового скрининга коллекционных образцов риса с целью поиска доноров эффективного гена устойчивости к пирикуляриозу Pi-ta, а также для маркерного контроля доминантной аллели указанного гена в селекционных программах использовать созданные ДНК-маркеры гена Pita, не прибегая к оценке образцов по фенотипу (фитопатологический тест).

3. Для повышения качества контроля краснозерной примеси в системе первичного семеноводства риса использовать разработанную методическую схему, основанную на ДНК-маркировании гена красной окраски перикарпа риса Rc, что обеспечивает раннюю диагностику краснозерных форм с их последующей элиминацией из питомников размножения задолго до фенотипического проявления признака (появление метелки).

4. Для защиты авторских прав селекционеров использовать созданную базу данных, содержащую информацию об аллельном разнообразии микросателлитных локусов районированных сортов риса селекции ВНИИ риса.

5. В селекции риса, для более эффективного подбора родительских форм при гибридизации, использовать данные кластеризации сортов и сортообразцов, полученные на основе аллельного сходства ДНК (микросателлитных) - локусов изученных образцов.

6. В практическом семеноводстве гибридного подсолнечника для повышения качества контроля гибридности партий семян простых гибридов и генетической чистоты их родительских линий использовать ДНК (микросателлитный) анализ, каждый раз подбирая информативные для конкретных генотипов ДНК-маркеры.

7. В селекционных программах на устойчивость риса к пирикуляриозу при изучении биоразнообразия вновь выделенных полевых изолятов возбудителя пирикуляриоза (Magnoporthe grisea (Herbert) Barr) использовать созданную на основе ДНК-анализа базу данных, основанную на полиморфизме микросателлитных локусов ДНК рефренсных штамов патогена с известным патотипом.

Основное содержание диссертационной работы опубликовано в следующих печатных работах:

I. Статьи в изданиях, рекомендуемых ВАК 1. Мухина, Ж.М. Комплексный подход к селекции риса на устойчивость к пирикуляриозу с применением молекулярных маркеров / В.С. Ковалев, Ж.М. Мухина, Е.Т. Ильницкая [и др.] // Доклады Российской академии с.-х.

наук, 2006. - №4. - С.10–12.

2. Мухина, Ж.М. Создание внутригенного ДНК-маркера гена устойчивости к пирикуляриозу риса Pi-b и его использование в практической селекцию / И.И. Супрун, Е.Т. Ильницкая, Ж.М. Мухина // С.-х. биология, 2007. - № 5. - С.63-67.

3. Мухина, Ж.М. Поиск доноров гена расоспецифической устойчивости риса к пирикуляриозу Pi-b с помощью методов молекулярного маркирования / Ж.М. Мухина, Е.М. Харитонов, Е.Т. Ильницкая [и др.] // Доклады Российской Академии с.-х. наук, 2008. - № 5. - С.13-14.

4. Мухина, Ж.М. Создание исходного селекционного материала риса, устойчивого к пирикуляриозу, с применением методов маркерной селекции / Ж.М. Мухина, Е.М. Харитонов, Е.Т. Ильницкая [и др.] // Вестник РАСХН, 2008. - № 4. – С.34.

5. Мухина, Ж.М. Изучение биоразноразнообразия возбудителя пирикуляриоза риса молекулярно-генетическими методами / Ж.М. Мухина, С.В.

Волкова, Т.М. Коломиец [и др.] // Труды КубГАУ, 2008. - 5 (14). - С.112114.

6. Мухина, Ж.М. Изучение биоразнообразия сорных растений рода Echinochloa на территории Краснодарского края на основе морфологического и молекулярно-генетического подходов / Ж.М. Мухина, Г.Л. Зеленский, Д.П. Кассанелли [и др.] // Труды КубГАУ, 2008.- 2 (11). - С.110-114.

7. Мухина, Ж.М. Применение методов молекулярного маркирования для оценки сортовых качеств семян простых гибридов подсолнечника / Ж.М. Мухина, Ю.А. Мягких, С.В. Токмаков // Масличные культуры.

Науч.-техн. бюлл. ВНИИМК. – Краснодар, 2009. – Вып.2 (141). - С.13–17.

8. Мухина, Ж.М. Создание молекулярного маркера для оценки внутривидового полиморфизма по гену Rc, обуславливающему красную окраску перикарпа риса oryza sativa / С.В. Токмаков, Ж.М. Мухина, Д.И.

Богомаз [и др.] // Экологическая генетика, 2011. - 11(3).- С.57 – 67.

9. Мухина, Ж.М. Картирование территорий Краснодарского края и Ростовской области по видовому составу и распространенности сорных растений.

Создание коллекции видов грибных патогенов и штаммов, перспективных для создания микогербицидов / Ж.М. Мухина, Д.П. Кассанелли, Т.М.

Коломиец [и др.] // Труды КубГАУ, 2011. - 1(28). - С.60 - 65.

10. Мухина, Ж.М. Молекулярное маркирование в селекции риса на устойчивость к пирикуляриозу / С.В. Токмаков, Е.В. Дубина, Ж.М. Мухина // Труды КубГАУ, 2011. - № 2(29). - С.132–134.

11. Мухина, Ж.М. Изучение феномена возникновения «краснозерных фенокопий» белозерных сортов риса на основе молекулярно-генетического подхода / С.В. Токмаков, Ж.М. Мухина, Е.В. Дубина // Труды КубГАУ, 2011. - № 2 (29). - С.97–99.

12. Мухина, Ж.М. Создание внутригенных молекулярных маркеров риса для повышения эффективности селекционного и семеноводческого процессов / Ж.М. Мухина, С.В. Токмаков, Ю.А. Мягких [и др.] // Политематический сетевой электронный научный журнал Кубанского государственного аграрного университета. Режим доступа:

http//ej.kubagro.ru/2011/03/pdf/19.pdf. № 67(03). - 2011.

13. Мухина, Ж.М. Интрогрессия генов Pi-ta, Pi-b, Pi-z в отечественный сорт риса Снежинка с применением методов маркерной селекции / Е.В. Дубина, Ж.М. Мухина // Политематический сетевой электронный научный журнал Кубанского государственного аграрного университета. Режим доступа:

http//ej.kubagro.ru/2011/03/pdf/19.pdf. № 66(02). - 2011.

14. Мухина, Ж.М. Молекулярные маркеры и их использование в селекционногенетических исследованиях / Ж.М. Мухина, Е.В. Дубина // Политематический сетевой электронный научный журнал Кубанского государственного аграрного университета. Режим доступа:

http//ej.kubagro.ru/2011/03/pdf/19.pdf. № 66(02). – 2011.

II. Монография 15. Мухина, Ж.М. Использование ДНК-маркеров для изучения генетического разнообразия растительных ресурсов // Краснодар: Просвещение-Юг, 2008. – 99 с.

III. Научные статьи в аналитических сборниках и материалах конференций 16. Мухина, Ж.М. Генотипирование российских сортов риса микросателлитными маркерами / Ж.М. Мухина, В.С. Ковалев, И.И. Супрун [и др.] // Рисоводство, 2002. - №2. - С.32-35.

17. Мухина, Ж.М. Сортовая идентификация риса с использованием белковых маркеров / Е.В. Кругликова, Ж.М. Мухина // Материалы междунар. науч.

интернет-конф. – Ставрополь, 2002. - С.122-127.

18. Мухина, Ж.М. Апробация метода изоэлектрофокусирования применительно к отечественным сортам риса / Е.В. Кругликова, Ж.М. Мухина, В.С.

Ковалев // Рисоводство, 2002. - №1. - С.21-22.

19. Мухина, Ж.М. Молекулярное маркирование генетической плазмы риса на основе полиморфизма проламинов / Ж.М. Мухина, И.И. Супрун, Е.В. Кругликова // Междунар. науч.-практ. конф.: Трансгенные растения – новое направление в биологической защите растений. – Краснодар, 2002. – С.238–241.

20. Мухина, Ж.М. Проламин зерновки риса и его использование в селекции и семеноводстве / Е.В. Кругликова, Ж.М. Мухина, В.С. Ковалев // Рисоводство, 2002. - №2. - С.44- 49.

21. Мухина, Ж.М. Сортовая идентификация риса с использованием белковых маркеров / Е.В. Кругликова, Ж.М. Мухина // Материалы междунар. науч.

интернет-конф. – Ставрополь, 2002. - С.122-127.

22. Мухина, Ж.М. Системы молекулярного ДНК-маркирования и их использование в селекционно-генетических исследованиях риса / И.И. Супрун, Ж.М. Мухина, Е.Т. Ильницкая // Рисоводство, 2003. - №3. - С.25-30.

23. Мухина, Ж.М. Селекция устойчивых к пирикуляриозу сортов риса с использованием методов молекулярной биологии / Е.Т. Ильницкая, Ж.М. Мухина // Научное обеспечение агропромышленного комплекса:

материалы 5-й региональной науч.–практ. конф. молодых ученых. - 18–декабря 2003 г. / КубГАУ. – Краснодар, 2003. – С.315-317.

24. Мухина, Ж.М. Идентификация количественных локусов полевой устойчивости риса к пирикуляриозу / И.И. Супрун, Ж.М. Мухина, Е.М. Харитонов // Рисоводство, 2004. - №4. - С.33-37.

25. Мухина, Ж.М. Молекулярный полиморфизм Waxy-гена у сортов риса российской селекции с различным содержанием амилозы / И.И. Супрун, Ж.М. Мухина, Е.М. Харитонов // Рисоводство, 2004. - №5. - С.18.

26. Мухина, Ж.М. Создание сорта риса с длительной полевой устойчивостью к пирикуляриозу/ И.И. Супрун, Ж.М. Мухина, Е.Т. Ильницкая // Материалы докладов междунар. науч.-практ. конф.: «Биологическая защита растений - основа стабилизации агроэкосистем». – Краснодар, 2004. – Вып.3. - С.149151.

27. Мухина, Ж.М. Селекция риса на устойчивость к пирикуляриозу с применением молекулярного маркирования / И.И. Супрун, Ж.М. Мухина, Е.М. Харитонов // Сб. науч. трудов, посвященный 90-летию КНИИСХ им. П.П. Лукьяненко. – Краснодар, 2004. - Т.3. - С.279-284.

28. Mukhina, Zh.M. Marker assisted selection on rice blast resistance / E.M.

Kharitonov, Zh.M. Mukhina, E.T. Ilnitskaya, I.I. Suprun // Proceeding of the conference «Challenges and opportunities for sustainable rice-based production systems». – Turin, 2004. - P.410-411.

29. Мухина, Ж.М. Пирамидирование генов устойчивости к пирикуляриозу риса Pi-1, Pi-2, Pi-33 с помощью молекулярных маркеров / Е.Т. Ильницкая, Ж.М. Мухина // Рисоводство, 2004. - №5. - С.32-33.

30. Мухина, Ж.М. Создание устойчивых к пирикуляриозу сортов риса с привлечением методики маркерной селекции / Е.Т. Ильницкая, Ж.М. Мухина // Эволюция научных технологий в растениеводстве: сб.

науч. трудов, посвященных 90-летию КНИИСХ им. П.П.Лукьяненко. – Краснодар, 2004. – Т.3. - С.284-286.

31. Мухина, Ж.М. Изучение биоразнообразия возбудителя пирикуляриоза риса фитопатологическими и молекулярными методами / С.А. Волкова, Ж.М. Мухина // Рисоводство, 2004. - №4. – С.101-104.

32. Мухина, Ж.М. Апробация метода электрофореза в кислом (pH 3,2) буфере для целей сортовой идентификации и контроля сортовой чистоты риса. – Эволюция научных технологий в растениеводстве / Е.В. Дубина, Ж.М. Мухина // Сб. научных трудов в честь 90-летия со дня образования Краснодарского НИИСХ им. П.П. Лукъяненко. – Краснодар, 2004. - С.273.

33. Мухина, Ж.М. Биотехнологические подходы к изучению пирикуляриоза риса / С.А. Волкова, Ж.М. Мухина // Рисоводство, 2004. - №4. – С.44-46.

34. Мухина, Ж.М. Фило-географическое изучение Magnaporthe grisea (Herbert) Barr фитопатологическими и молекулярными методами / С.А. Волкова, Ж.М. Мухина // Материалы докладов междунар. науч.-практ. конф.:

«Биологическая защита растений - основа стабилизации агроэкосистем». – Краснодар, 2004. - №3. - С.47-48.

35. Мухина, Ж.М. Фило-географическое изучение популяций Magnaporthe grisea (Herbert) Barr / С.А. Волкова, Ж.М. Мухина // Материалы всероссийской науч. конф. молодых ученых и студентов: «Современное состояние и приоритеты развития фундаментальных исследований в регионах». – Анапа, 2004. –С.52-53.

36. Мухина, Ж.М. Адаптация методики микросателлитного анализа для изучения генетического разнообразия сортов винограда пино белый, рислинг и их клонов / А.С. Звягин, Л.П. Трошин, Ж.М. Мухина [и др.] // «Новации и эффективность производственных процессов в виноградарстве и виноделии». – Т.II. - Виноградарство. – Краснодар, 2005. – С.113-117.

37. Мухина, Ж.М. Селекция риса на устойчивость к пирикуляриозу с применением методов молекулярного (микросателлитного) маркирования / Е.Т. Ильницкая, С.А. Волкова, Ж.М. Мухина // Новые и нетрадиционные растения и перспективы их использования: материалы 6-го междунар.

симпозиума. – Москва–Пущино, 2005. – Т.II. – С.288-290.

38. Мухина, Ж.М. Филогеографическое изучение популяции возбудителя пирикуляриоза / С.А. Волкова, Ж.М. Мухина // Материалы всероссийской науч.-практ. конф.: «Развитие инновационных процессов в рисоводстве – базовый принцип стабилизации отрасли». – Краснодар, 2005. – С.51-52.

39. Мухина, Ж.М. Использование метода молекулярного маркирования для решения проблемы пирикуляриоза / С.А. Волкова, Ж.М. Мухина // Материалы международной научной конференции «Устойчивое производство риса: настоящее и перспективы»: материалы междунар.

науч.-практ. конф. - Краснодар, Россия, 5-9 сентября 2006. – С.199-201.

40. Мухина, Ж.М. Перенос генов устойчивочти к пирикуляриозу в сорта риса с помощью маркерного контроля / П.И. Костылев, Н.Н. Вожжова, Е.Т.

Ильницкая, Ж.М. Мухина // Устойчивое производство риса: настоящее и перспективы: материалы междунар. науч.-практ. конф. - Краснодар, Россия, 5-9 сентября 2006. - С.98-107.

41. Мухина, Ж.М. Идентификация фитопатогенных грибов для биологического контроля тростника обыкновенного – Phragmitis australis / Т.М. Коломиец, Л.Ф. Панкратова, Ж.М. Мухина [и др.] // Устойчивое производство риса:

настоящее и перспективы: материалы междунар. науч.-практ. конф. - Краснодар, Россия, 5-9 сентября 2006.- С.266.

42. Мухина, Ж.М. Изучение биоразнообразия растений рода Echinochloa на территории Краснодарского края / Ж.М. Мухина, С.А. Волкова, Д.П. Кассанелли [и др.] // Устойчивое производство риса: настоящее и перспективы: материалы междунар. науч.-практ. конф. - Краснодар, Россия, 5-9 сентября 2006. - С.278.

43. Мухина, Ж.М. Маркерная селекция как ресурсосберегающая технология в селекции важных сельскохозяйственных культур / Ж.М. Мухина, Т.Е. Соловьева, Д.А. Соловьев // Российское предпринимательство:

современное состояние и приоритеты развития. Коллективная монография.

- Краснодарский Центр науч.-техн. информации. Кубанский государственный университет, 2008. - С.152–160.

44. Мухина, Ж.М. Создание кодоминантного молекулярного ПЦР-маркера для идентификации гена расоспецифической устойчивости к пирикуляриозу риса Pi-ta / Ж.М. Мухина, Ю.А. Мягких, Д.И. Богомаз [и др.] // Рисоводство, 2008. - №12. – С.3–6.

45. Мухина, Ж.М. Использование молекулярно-генетических подходов для идентификации гена расоспецифической устойчивости к пирикуляриозу риса Pi-tа / Ж.М. Мухина, Ю.А. Мягких, С.В. Токмаков // Материалы XVII междунар. Симпозиум: «Нетрадиционное растениеводство. Селекция.

Охрана природы. Эниология. Экология и здоровье». – Алушта, 2008. - С.472-473.

46. Мухина, Ж.М. Поиск грибов – потенциальных агентов биологического контроля сорного растения Echinichloa crus-galli (L.) Beauv. / Т.М. Коломиец, О.О. Скатенок, Ж.М. Мухина [и др.] // «50 лет на страже продовольственной безопасности страны»: юбилейный сб. трудов. - Большие Вяземы, 2008. - С.453–460.

47. Мухина, Ж.М. Отбор грибных фитопатогенов на территории Краснодарского края России для биологического контроля наиболее значимых сорняков / Т.М. Коломиец, Е.Д. Коваленко, Ж.М. Мухина [и др.] // «50 лет на страже продовольственной безопасности страны»: юбилейный сб. трудов. - Большие Вяземы, 2008. - С.461–471.

48. Мухина, Ж.М. Создание внутригенных ДНК-маркеров и их использование в практической селекции риса / Ж.М. Мухина, И.И. Супрун, Е.Т.

Ильницкая [и др.] // 5-й Московский междунар. конгресс: «Биотехнология:

состояние и перспективы развития», 16–20 марта 2009.

49. Мухина, Ж.М. Молекулярно-генетический подход к созданию исходного материала в программах селекции риса / Ю.А. Мягких, Ж.М. Мухина, С.В. Токмаков // Материалы: междунар. науч.-практ. конф.: «Селекция сортов риса, устойчивых к абиотическим и биотическим стрессам, для стран умеренного климата и Центральной Азии». – Краснодар, 2009. - С.60-63.

50. Мухина, Ж.М. Создание внутригенного маркера к гену RC окраски перикарпа краснозерного риса / С.В. Токмаков, Ж.М. Мухина, Ю.А. Мягких // Материалы: междунар. науч.-практ. конф.: «Селекция сортов риса, устойчивых к абиотическим и биотическим стрессам, для стран умеренного климата и Центральной Азии». – Краснодар, 2009. - С.75-78.

51. Мухина, Ж.М. Изучение генетической однородности сортов риса в системе первичного семеноводства на основе прмененя молекулярно-генетических методов / Дубина Е.В., Мухина Ж.М., Солонина Т.В., Трофимова И.А., Коркина Н.Н., Науменко В.П., Токмаков С.В. // Материалы междунар.

науч.-практ. конф.: Основные направления селекции и современные технологии повышения адаптационного потенциала культуры риса в странах умеренного климата. – Краснодар, 2011.- С.128-135.

52. Mukhina, Zh.M. The usage of prolamin storige proteins polimorphism for identification and estimation of rice cultivars purity / E.V. Kruglikova, Zh. Mukhina, V.G. Vlasov // Proceedings of Eurorice 2001 Symposium. - Krasnodar, Russia, 2001.

53. Mukhina, Zh.M. Polymorphism of prolamines of rice variety kernels, widely used in seed production and storage of proteins formula / E.V. Kruglikova, Zh.

Mukhina, V.G. Vlasov, V.S. Kovalyov // Proceedings of Eurorice 20Symposium. - Krasnodar, Russia, 2001.

54. Mukhina, Zh.M. Genotyping of russian rice cultivars by microsatellite markers / J. Chantereau, Zh. Mukhina // Dissemination Conference of current European Research on Rice. - June 6-8, 2002. - Р.61.

55. Mukhina, Zh.M. Mutual benefits through formalized international collaboration on biological control of weeds with plant pathogens / D. Berner, T. Souissi, E.Smallwood, C. Cavin, F. Eskandari, B. Tunali, O. Buyuk, A. Yildirim, Z.

Mukhina [et al.] // Tunisian Journal of Plant Protection, 2011. - №6. – Р.74.

III. Методические разработки 56. Мухина, Ж.М. Изучение биоразнообразия фитопатогенного гриба Magnaporthe grisea (Herbert) Barr с использованием методов молекулярного маркирования / Ж.М. Мухина, С.А. Волкова, Е.В. Дубина [и др.] // Методические рекомендации. – Краснодар, 2007. – 19 с.

IV. Авторские свидетельства на гибриды подсолнечника 57. А.с. № 44648. Подсолнечник МАХАОН 40 / Мухина Жанна Михайловна, Бенко Н.И., Бенко И.Н. - № 9464416; Заявл. 27.12.2005. - (Зарег. Гос. ком.

РФ по исп. и охране селекц. достиж.).

58. А.с. № 40606. Подсолнечник АНЮТА / Мухина Жанна Михайловна, Бенко Н.И. - № 9610331; Заявл. 09.12.2003. - (Зарег. Гос. ком. РФ по исп. и охране селекц. достиж.).

59. А.с. № 46072. Подсолнечник ДАЯ / Бенко Илья Николаевич, Бенко Н.И., Мухина Ж. М. - № 9359455; Заявл. 28.11.2006. - (Зарег. Гос. ком. РФ по исп.

и охране селекц. достиж.).

60. А.с. № 38165. Подсолнечник ВУЛКАН / Мухина Жанна Михайловна, Васильев А.В. - № 9705075; Заявл. 13.02.2002. - (Зарег. Гос. ком. РФ по исп.

и охране селекц. достиж.).

61. А.с. № 54209. Подсолнечник ЛЮБО / Мухина Жанна Михайловна, Бенко И.Н., Бенко Н.И. - № 9252993; Заявл. 14.11.2007. - (Зарег. Гос. ком. РФ по исп. и охране селекц. достиж.).






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.