WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

загрузка...
   Добро пожаловать!

Pages:     | 1 || 3 | 4 |

Синтетическая часть продукт ПЦР TXbaI HpaI NdeI Рис. 1. Схема сборки экспрессионной конструкции pTNF5 на базе вектора pET23а под контролем индуцибельного промотора ТСуществуют наблюдения, свидетельствующие о значительном влиянии на эффективность трансляции 5’-концевых кодонов, располагающихся в составе мРНК непосредственно вблизи старта трансляции [Патрушев, 2000]. C учетом этого обстоятельства, восстанавливая участок кодирующей области, недостающий в составе конструкции pTNF-1, за счет клонирования синтетического ДНКдуплекса, мы заменили первые 5 кодонов гена человека на синонимичные им кодоны, предпочтительно использующиеся в E. coli.

Val, следующий за N-концевым остатком Met, в природном человеческом гене в составе полусинтетического гена был заменен на Met. Следующий Arg кодировался бы чрезвычайно редким для E. coli кодоном AGA (Рис. 2). В результате сборки полусинтетического гена TNF- в составе конструкции pTNFкодон AGA был заменен на CGC, что не сказалось на аминокислотном составе продукта, но, потенциально могло привести к повышению уровня синтеза рекомбинантного белка в клетках E. coli. Следующие 3 кодона (Ser, Ser, Ser) также были заменены на синонимичные. Синтетический фрагмент был внесен в состав конструкции pTNF-1, в результате чего получена конструкция pTNF5, кодирующая зрелый вариант TNF- человека. Таким образом, был получен полусинтетический ген TNF- ожидаемого размера 490 п. н.

NdeI 1. agatcatcttctcgaaccccgagtgacaagcctgtagcccatgttgtagca 2.catatggtccgcagcagcagccgcaccccgagtgacaagcctgtagcccatgttgtagcga 3. M M R S S S R T P S D K P V A H V V A Pис. 2. Фрагмент последовательности полусинтетического гена TNF- человека вблизи начала транслируемой области; 1) природный ген человеческого TNF-;

2) полусинтетический ген; 3) аминокислотная последовательность, получаемая при трансляции как природного, так и полусинтетического генов. Цветом отмечены нуклеотиды в природном гене, подвергшиеся замене в составе полусинтетического гена Продукция и очистка рекомбинантного TNF- По результатам анализа телец включения из биомассы соответствующих рекомбинантных штаммов, обе конструкции pTNF-1 и pTNF5 в условиях индукции ИПТГ (изопропил--тиогалактозид) вызывали накопление целевых белковых продуктов в клетках E. coli. Тем не менее, при экспрессии конструкции pTNF-1 в E. coli удалось получить соответствующий белковый продукт. При этом участок, отсутствующий в продукте pTNF-1 по сравнению с полноразмерным зрелым TNF-, не составляет отдельного глобулярного домена. Уровень продукции усеченного белка в нашей системе составлял 70-90 мг/л. Полноразмерный зрелый белок - продукт конструкции pTNF5 - также эффективно синтезировался в использованной системе. При этом уровень его продукции в различных экспериментах можно оценить на уровне 50-100 мг/л (Рис. 3).

pTNF18.pTNF-14.1 2 Рис. 3. Накопление рекомбинантного TNF- в лизатах E. сoli. На дорожки нанесен: 1) суммарный лизат культуры, трансформированной pTNF5;

2) суммарный лизат культуры, трансформированной pTNF-1; 3) стандарты молекулярной массы. Целевые продукты отмечены стрелками В литературе приводится ряд данных об экспериментах по синтезу TNF- человека в E. coli. Так, Шингаровой и соавт. [Шингарова и др.,1997] описана экспрессия TNF- под контролем промотора триптофанового оперона E. coli, причем продукт экспрессии накапливался в цитоплазме в растворимом виде, а не формировал тельца включения. Однако уровень экспрессии при этом оказывался невысоким. При этом выделение и очистка такого белка требовала нескольких стадий, что сказывалось на количественном выходе конечного продукта.

Синтез белка в нашей системе происходила под контролем индуцибельного промотора фага Т7. Поскольку ген ДНК-полимеразы фага Т7 в использованном нами штамме E. coli BL21(DE3) находился под контролем лактозоиндуцибельного промотора lac-tac, для запуска транскрипции в среду культивирования добавляли ИПТГ. При этом TNF- накапливался в виде телец включения с высоким выходом.

Следует отметить, что мы модифицировали протокол экспрессии по сравнению со стандартным [Palmer et al., 1995]. В настоящее время в литературе наиболее часто упоминается схема, при которой индуктор добавляется по достижении культурой оптической плотности A680=0.3-0.4. Мы обнаружили, что в разработанной нами системе ИПТГ может быть внесен одновременно с инокулятом, что это не сказывается на выходе белка, но позволяет сократить время ферментации.

Ренатурация TNF- В литературе описана экспрессия TNF- человека, а также его ренатурация из телец включения в лабораторных и полупромышленных условиях. Однако, конструктивные особенности нового продуцента, в том числе уровень продукции целевого продукта и состав среды культивирования, привели к качественному изменению свойств и химического состава исходного материала (телец включения), используемых для ренатурации. Исходя из этого, при разработке схемы ренатурации не были использованы подходы, ранее положительно зарекомендовавшие себя применительно к TNF-, а была выбрана методология, основанная на скрининге панели буферных растворов для ренатурации, и тех свойствах белка, которые могут быть рассчитаны на основании лишь известной аминокислотной последовательности. Из рассмотрения были исключены методы гель-фильтрации, диализа и другие, ограничивающие возможность широкого варьирования состава буферов или требующие значительных количеств обрабатываемого белка, что нежелательно на начальных этапах отработки методики.

На этапе подбора условий ренатурации применялся экспресс-протокол, включающий одноступенчатое разбавление аликвот телец включения, предварительно солюбилизированного в растворе хаотропного агента (6 М гуанидин-гидрохлорид), панелью из 15 различных буферных растворов. При этом часть панели была исключена из эксперимента путем сопоставления их рН с pI белка, подлежащего ренатурации: предполагается, что вблизи pI белок менее склонен к формированию агрегатов за счет ионных взаимодействий. С помощью пакета программ “DNA STAR” была рассчитана pI денатурированного TNF- человека, составившая 7.28. С учетом этого результата из полной панели были отобраны только буферные растворы cо щелочными значениями pH (табл. 1).

Номер Компоненты и их концентрации буфера Трис- NaCl KCl MgCl2 CaCl2 Сахароза ЭДТА Тритон ПЭГ HCl X-100 мM мM мM мM мM М мM % % 1 50 9.6 0.4 2 2 0.1 0.5 0.2 50 9.6 0.4 2 2 1 0.3 50 9.6 0.4 2 2 0.1 0.4 50 9.6 0.4 2 2 1 0.5 0.5 50 240 10 1 0.6 50 240 10 1 0.7 50 240 10 2 2 0.1 0.5 0.8 50 240 10 2 2 0.Табл. 1. Состав буферных растворов c pH=8.0, использованных для ренатурации рекомбинантного TNF-. Штриховкой отмечен буферный раствор, показывающий лучший результат; серым цветом отмечены буферные растворы с низким содержанием соли Состав буферных растворов, приведенный в Табл. 1, можно разделить на буферные растворы низкой (№1-4) и высокой ионной силы (№5-8). Концентрацию общего белка в суспензии телец включения определяли по модифицированному методу Лоури (нерастворимые в воде агрегаты предварительно растворяли в небольшом объеме 0.7 M NaOH, разбавляя затем стандартным раствором в 10 раз).

В ходе экспериментов было установлено, что ренатурация TNF- человека эффективно идет лишь в буферных растворах с высокой ионной силой, в остальных буферах основная масса белка агрегировала и удалялась из раствора при центрифугировании (Рис. 4). Буферный раствор №6, обеспечивший наилучший результат, содержал 240 мМ NaCl, 10 мМ КСl и 0.5% Triton X-100 (табл. 1). В то же время, высокая ионная сила буфера не является достаточным условием хорошего выхода ренатурации: так, для буфера 7 ионная сила не отличается от буфера 6 (Рис. 4 дорожка 8), в то же время, белок, ренатурированный в буфере 7, нестабилен при хранении в течение 7 дней при 4С, подвергаясь протеолизу (Рис. дорожка 9).

Номера буферов 1 2 3 4 5 6 7 Рис. 4. SDS-PAAG электрофорез в 12.5% геле ренатурированного TNF. На дорожки нанесено (верхний ряд) (1)–стандарты молекулярной массы; (2)-белок TNF- до процедуры рефолдинга; (3-10)-белок, оставшийся в растворе после ренатурации 2.5 мкг (по общему белку) солюбилизированного материала телец включения в присутствии буферов 1-8 (нижний ряд) (табл. 1) Объясняя причину различной эффективности ренатурации TNF- в зависимости от условий среды, необходимо учитывать, что нативный TNF- находится в растворе в форме тримера, что характерно для всех лигандов и рецепторов семейства TNF/TNF-R. Существуют данные о возможности аномального фолдинга TNF-, приводящего к формированию димерных молекул, вместо тримерных. Такой белок стабилен в растворе лишь непродолжительное время и не способен к спонтанному переходу в истинно нативную конформацию.

Экспрессия TNF-R1 в клетках Drosophila melanogaster Для тестирования функциональной активности TNF- человека, полученного экспрессией в E. coli в виде нерастворимого денатурированного белка и подвергнутого далее процедуре ренатурации, была разработана система, при которой предполагалось молекулярное взаимодействие как с моноклональными антителами, так и с нативным экстраклеточным доменом рецептора (ed-TNFR1).

Экстраклеточный домен рецептора I типа было решено получить в секреторном виде экспрессией в эукариотических клетках.

Клетки линии S2 Drosophila melanogaster практически идеально подходят для продукции растворимых форм рецепторов человека и высших млекопитающих, так как естественным образом адаптированы для секреции рекомбинантного белка с большим числом дисульфидных связей во внеклеточную среду, обеспечивая при этом их корректный фолдинг. В клетках насекомых белок продуцируется не только функционально активным, но и гликозилированным, что невозможно в случае экспрессии рекомбинантного продукта в прокариотических микроорганизмах.

Получение кДНК TNF-R1 и создание экспрессионной конструкции pMT-TNFRЭкстраклеточная часть TNF-R1 кодируется в геноме человека 4 экзонами общей длиной 501 п.н., поэтому для создания продуцентов была клонирована кДНК, кодирующая этот белок. Хотя многие клетки организма чувствительны к TNF-, содержание в них рецепторов невелико, что осложняло задачу выделения препарата мРНК, пригодного для извлечения целевого транскрипта. В качестве источника кДНК TNF-R1 была выбрана мРНК из длительно поддерживаемой в культуре линии предшественников нормальных цитотоксических лимфоцитов человека CER43. Для увеличения уровня продукции TNF-R1 клетки CERподвергали стимуляции кокультивированием с облученными периферическими моноцитами крови человека в течение 10 суток. По окончании культивирования окрашивание красителем трипановым синим показало присутствие в культуре большого числа мертвых клеток CER43, что свидетельствовало о запуске апоптоза (клетки-мишени были уничтожены ранее за счет цитотоксической активности CER43).

Фрагмент ДНК длиной 501 п.н., полученный в результате ПЦР первой цепи тотальной кДНК из клеток CER43 после стимуляции, кодировал только экстраклеточный, но не трансмембранный и внутриклеточный домены TNF-R(Рис. 5).

PMT лидер кДНК TNF-R6-His стоп-кодон AgeI KpnI Рис. 5. Схема сборки конструкции pMT-TNFR1 под контролем медьиндуцибельного промотора металлотионеина В литературе имеются кристаллографические данные высокого разрешения, позволяющие судить о структуре экстраклеточного домена TNF-R1 (ed-TNFR1), состоящем из 167 а.о. Следует отметить, что ed-TNFR1 содержит внутримолекулярных дисульфидных связей. По обилию дисульфидных связей этот рецептор сходен со многими другими поверхностными трансмембранными рецепторами эукариот (Fas, KDR, ActRII). В связи с этим растворимые формы лиганд-связывающих доменов рецепторов с трудом поддаются ренатурации in vitro, следовательно, они только с низким выходом могут быть приведены в функционально активное состояние за счет использования стандартной технологии экспрессии в E. coli и рефолдинга продукта, извлеченного из телец включения.

Система экспрессии в клетках Drosophila позволяет получать растворимые формы рецепторов в нативной конформации и естественным гликозилированием, что может иметь значение при изучения взаимодействий рецептора с лигандом.

Учитывая эти соображения, фрагмент ДНК, кодирующий ed-TNFR1, был клонирован в вектор pMT/V5-His, предназначенный для экспрессии в клетках зародышевых линий дрозофилы под контролем индуцибельного медь-зависимого промотора металлотионеина. Данный промотор позволяет обеспечивать высокий уровень транскрипции и широко применяется для продукции рекомбинантных белков.

В результате клонирования была получена конструкция pMT-TNFR1, кодирующая рекомбинантный ed-TNFR1. В составе этого белка на С-конце экстраклеточного домена TNF-R1 вместо трансмембранного домена находился двухаминокислотный спейсер Thr-Gly и последовательность из шести остатков His.

Для обеспечения секреции ed-TNFR1 из клеток дрозофилы был использован собственный лидерный пептид TNF-R1.

Экспрессия конструкции pMT-TNFR1 в клетках Drosophila С целью получения клеточной линии S2, несущей интегрированную в геном копию плазмиды pMT-TNFR1, первичная культура трансфицированных клеток подвергалась селекции на устойчивость к гентицину (G418) в концентрации 500 мкг/мл в течение 6 недель. Параллельно с селекцией был проведен тест на способность частично обогащенной культуры к синтезу целевого продукта. Для этой цели из общего пула отбирали часть клеток, подвергшихся нескольким этапам селекции, и индуцировали их ионами двухвалентного металла (Cu2+). На 3-ий день после индукции отбирали образцы кондиционированной среды и анализировали наличие в них ed-TNFR1 с помощью ELISA.

Клетки Drosophila melanogaster после 6 недель селекции продуцировали edTNF-R1 в культуральную среду в виде 3-х полос близкой молекулярной массы, которые указывают на различную степень гликозилирования (Рис. 6).

Рис. 6. SDS-PAAG` электрофорез в 12.5% акриламидном геле продукции TNF-R1. 1стандарты молекулярной массы; 2-культуральная жидкость клеток Drosophila melanogaster, трансфицированных конструкцией pMT-TNFR1; 3-культуральная жидкость, сконцентрированная в 70 раз; 4-несвязавшаяся белковая фракция после Ni-NTA-сефорозы; 4-проскок; 5-промывка; 6-элюция (стрелками отмечен конечный продукт в разной степени гликозилирования) Экстраклеточный домен рецептора TNF типа 1 был очищен до гомогенного состояния с помощью 2-х стадийной процедуры: металло-хелатной хроматографией на Ni-NTA-сефарозе и гель-фильтрацией на Superdex HR-200.

В результате был получен продукт, двигающийся при денатурирующем электрофорезе в виде 3-х полос близкой молекулярной массы, что свидетельствовало о различной степени гликозилирования полипептидной цепи (Рис. 6).

Pages:     | 1 || 3 | 4 |






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»