WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

загрузка...
   Добро пожаловать!

Pages:     | 1 || 3 | 4 |

и др., 1999]. Для индикации суммарной ДНК M. tuberculosis и M. bovis используют внешние праймеры Т2/Т2А в ПЦР-1 и внутренние Т4/Т4А в ПЦР-2. Для определения ДНК M. tuberculosis используют внешние праймеры Т1/Т1А в ПЦР-1 и внутренние Т3/Т3А в ПЦР-2. Тест-система «Нарвак Nested-PCR» предназначена для выявления и дифференциации ДНК M. tuberculosis и M. bovis. «Нарвак RT-PCR» («Н-РВ») – это модификация тест-системы «Нарвак Nested-PCR», адаптированная для проведения ПЦР в реальном времени. ПЦР проводили в амплификаторе «Терцик» (ДНКТехнология, Россия), согласно программе амплификации, указанной фирмойпроизводителем.

Тест-система «ТУБ-ДИФ» – это двухстадийная ПЦР, основанная на амплификации межгенного региона senX3-regX3 и позволяющая по разнице длин специфических амплифицированных фрагментов дифференцировать ДНК M.

tuberculosis, M. bovis, M. bovis BCG [Корнева И.Н. и др., 2002]. ПЦР проводили в амплификаторе «Терцик» (ДНК-Технология, Россия) согласно программе амплификации, указанной фирмой-производителем.

Рестрикционный анализ продуктов «ТУБ-ДИФ» В МНПЦБТ разработана система рестрикционного анализа с использованием двух рестриктаз RsaI, TaaI для продуктов ПЦР, полученных после применения тестсистемы «ТУБ-ДИФ» в случаях затрудненной интерпретации результатов.

ПЦР проводили согласно требованиям фирмы-производителя (ИМГ РАН).

Реакционную смесь для каждой рестриктазы готовили отдельно, с учетом числа положительных проб после проведения ПЦР с помощью тест-системы «ТУБДИФ» (Х) и трех дополнительных проб, необходимых для постановки положительного контроля. Реакционные смеси для рестриктаз готовили с использованием необходимых буферов.

Полученную реакционную смесь тщательно перемешивали и разносили по мкл в пробирку. В каждую пробирку вносили по 15 мкл ампликонов, полученных после проведения ПЦР с помощью тест-системы «ТУБ-ДИФ», и помещали в водяную баню, с температурой воды 37С для рестриктазы RsaI и 65С для рестриктазы TaaI.

Пробирки инкубировали в термостате при температуре 37С для рестриктазы RsaI и 65С для рестриктазы TaaI, в течение 60 минут, после чего для прекращения рестрикции охлаждали, поместив на лёд в течение 3-5 минут.

Детекцию продуктов рестрикции проводили, используя горизонтальный электрофорез с этидиумом бромидом в 3% агарозном геле, при напряжении 10-В/см. Длины рестрикционных фрагментов определяли визуально при помощи маркера длин Gene Ruler 50 bp DNA Ladder (Fermentas Inc, США).

Определение вида нетуберкулезных микобактерий с помощью тестсистемы «MAIS-диф» (МНПЦБТ, Россия) Созданная в МНПЦБТ тест-система «MAIS-диф» (приоритетная справка №2004137089 от 2005 года) основана на ПДРФ гена hsp65 и состоит из двух последовательных этапов. На первом этапе проводится ПЦР фрагмента гена hsp65, второй этап представлен рестрикционным анализом ампликонов, полученных после проведения ПЦР. «MAIS-диф» предназначена для идентификации вида микобактерий комплекса MAIS, некоторых других видов нетуберкулезных микобактерий и их дифференциации от комплекса M. tuberculosis.

Проведение ПЦР гена hspРеакционную смесь готовили из компонентов набора реагентов для проведения ПЦР с учетом числа пробирок, поступивших для тестирования содержащихся в них проб (Х) и дополнительных пробирок, необходимых для постановки положительного и отрицательного контроля.

Для амплификации фрагмента гена hsp65 использовали праймеры:

HSP-1 5GCCAAGAAGACCGATGACGTHSP-2 5GGTGATGACGCCCTCGTTGCВода дистиллированная (для ПЦР) ПЦР – смесь (5х): 10 мМ трис-HCl pH 8,0; 50 мМ KCl; 0,5% твин 20; 5% формамид Раствор 1,5 мМ MgCldNTP по 200 мкМ Праймеры по 5 мкМ ДНК-полимераза (BIOTAQ ДНК-полимераза) 3,75U Общий объем (47 х N) мкл Полученную реакционную смесь тщательно перемешивали и разносили по пробиркам, подготовленным для постановки ПЦР, из расчета 47 мкл на пробирку.

Обработанный биологический материал вносили в амплификационную смесь по мкл. Пробирки помещали в автоматический температурный циклер «Терцик» (ДНКТехнология, Россия) и проводили амплификацию методом ПЦР. Профиль амплификации состоял из следующих этапов:

№ шага Время Количество Температура, С° программы выдержки циклов 1 94 (предварительная денатурация ДНК) 2 мин 94 (денатурация ДНК) 30с 2 62 (отжиг праймеров) 30с 72 (удлинение праймеров) 1 мин 3 72 (завершающая инкубация) 6 мин Детекцию продуктов амплификации проводили, используя горизонтальный электрофорез в TBE-буфере (0,089мМ трис-бората; 0,089М борной кислоты; 2мМ EDTA, рН 8,0) с этидиумом бромидом в 1,5% агарозном геле при напряжении 10-В/см.

Проведение ПДРФ гена hspРеакционную смесь готовили с учетом числа проб, с положительной реакцией на содержание ДНК после проведения ПЦР гена hsp65 (Х) и дополнительных проб, необходимых для постановки положительного контроля. В пробирку объемом 0,5 мл вносили, отдельной для каждого компонента пипеткой, следующие реагенты набора для рестрикционного анализа в указанной ниже последовательности и количестве:

Буфер Y+/Tango (Fermentas Inc, США) 5 мкл Рестриктаза Hin6I (Fermentas Inc, США) 1,9U – 9,6 мкл Общий объем (14,6 х N) мкл Полученную реакционную смесь тщательно перемешивали и разносили по пробиркам, подготовленным для постановки рестрикционного анализа, из расчета 14,6 мкл на пробу. Затем в каждую пробирку вносили по 17 мкл ампликонов, полученных после проведения ПЦР гена hsp65, и помещали в водяную баню, с температурой воды 37С. Пробирки инкубировали в термостате при температуре 37С в течение 70 минут, после чего для прекращения рестрикции охлаждали, поместив на лёд в течение 3-5 минут.

Детекцию продуктов рестрикции проводили, используя горизонтальный электрофорез с этидиумом бромидом в 3% агарозном геле, при напряжении 10-В/см. Длины рестрикционных фрагментов определяли визуально при помощи маркера длин Gene Ruler 50 bp DNA Ladder (Fermentas Inc, США).

Статистическая обработка данных Для оценки статистической значимости различий между сопоставляемыми величинами (количество исследуемых вариантов) использовали критерий Стьюдента.

Различия считались достоверными при р<0,05, высоко достоверными при р<0,01, недостоверными при р>0,05 (программа Matlab, версия 6,5).

Чувствительность и специфичность метода определяли по S. Rusch-Geroles et.

al. (1999).

Результаты собственных исследований Для определения ДНК туберкулезного комплекса применяли тест-системы «Сobas Аmplicor» (Roche, Швейцария) и «Нестед-ПЦР» (МНПЦБТ, Россия). Для дифференциации представителей туберкулезного комплекса апробировали две тестсистемы фирмы «НАРВАК» (Россия), специфичные в отношении туберкулезного комплекса и M. bovis и ПЦР-систему «ТУБ-ДИФ» (ИМГ РАН), позволяющую идентифицировать некоторые виды, входящие в туберкулезный комплекс. Поскольку тест-системы «НАРВАК» специфичны в определении вида M. bovis, мы изучали двухэтапную «Н-ПЦР» и одноэтапную ПЦР, в режиме реального времени «Н-РВ» на штаммах с заведомо известным видом. Из 7 исследуемых штаммов M. bovis только в 3 случаях с помощью двухэтапной ПЦР и в 1 случае с помощью одноэтапной ПЦР в реальном времени получен положительный результат определения вида микобактерий, что малоэффективно. Несомненным преимуществом тест-системы «ТУБ-ДИФ» является простота исполнения и возможность дифференцировать ДНК M. bovis, M. tuberculosis и M. bovis BCG.

Для сравнения эффективности двух тест-систем «Cobas Amplicor MTB» («СА») и «ТУБ-ДИФ» исследовали 128 образцов ДНК, полученных из мокроты больных с различными формами туберкулеза или с подозрением на туберкулез. Наличие в указанных пробах ДНК МБТ ранее определено с помощью тест-системы «СА».

Результаты представлены в таблице 1.

Необходимо отметить, что для 108 образцов получены положительные результаты выявления ДНК M. tuberculosis complex с помощью тест-системы «ТУБДИФ». Распределение этих результатов в зависимости от вида микобактерий было следующим: ДНК M. tuberculosis обнаружена в 105 случаях, M. bovis в двух и M. bovis BCG в одном. Анализ полученных данных показал совпадение результатов определения наличия и отсутствия микобактерий туберкулезного комплекса в образцах двумя тест-системами.

Таблица 1.

Результаты выявления Mycobacterium tuberculosis complex с помощью тест-систем «СА» и «ТУБ-ДИФ» (n=128) Тест-системы, применяемые для определения микобактерий Результаты p туберкулезного комплекса «СА»1 «ТУБ-ДИФ» Положительные 102 (79,8%) 108 (84,4%) p>0,Отрицательные 16 (12,5%) 20 (15,6%) р>0,1) – в таблицу не включены результаты «СА» с отрицательным внутренним контролем (n=10) По всей вероятности незначительное различие в частоте выявления микобактерий двумя тест-системами связано с тем, что в тест-системе «ТУБ-ДИФ» отсутствует система внутреннего контроля, вследствие чего характеристика результата может быть только положительная или отрицательная. Расхождение данных для отрицательных образцов может быть объяснено тем, что отрицательные результаты по «CA» включает в себя данные с отрицательным внутренним контролем, что означает, что реакция не прошла, а это может быть связано с наличием в образце ингибиторов амплификации. Известно, что применение двухэтапной ПЦР позволяет ослабить воздействие примесей на выявление ДНК МБТ из биологического материала.

Хотя разница в частоте выявления ДНК МБТ между двумя тест-системами не достоверна, преимуществом «ТУБ-ДИФ» является возможность определения не только МБТ, но и дифференциации M. bovis и M. bovis BCG.

Тест-система, созданная в ИМГ РАН, «ТУБ-ДИФ» более проста в исполнении.

На электрофореграмме (рис.1) видно четкое отличие M. tuberculosis (350 п.н.) от M.

bovis (370 п.н.) и M. bovis BCG (270 п.н.) (рис. 1).

1 2 3 4 5 6 Рис. 1. Электрофореграмма разделения M. tuberculosis, M. bovis, M. bovis BCG с помощью тест-системы «ТУБ-ДИФ» 1-4 – ДНК, выделенная из диагностического материала больных туберкулезом; 5 – M.

bovis BCG, СПбНИИФ; 6 – M. tuberculosis H37Rv, АТСС25618; 7 – M. bovis Ravenel, СПбНИИФ В ряде случаев при разделении образцов ДНК с помощью электрофореза четкого разделения сигналов не получалось и возникали трудности определения вида микобактерий (рис. 2).

1 2 3 Рис. 2. Электрофореграммы разделения ампликонов ДНК МБТ, полученных с помощью «ТУБ-ДИФ» 1 – M. bovis BCG; 2 – неинтерпретируемый результат; 3 – M. tuberculosis; 4 – M. bovis В связи с этим в МНПЦБТ отработаны условия рестрикционного анализа, с помощью которого ДНК неинтерпретируемых полос можно дифференцировать.

Подбор рестриктаз проводили с помощью компьютерных программ Primer Primier 5 и BioEdit v.7.0.1. Были отобраны рестриктазы RsaI и TaaI с сайтами рестрикции GT^AC и AC_N^GT соответственно. Длины рестрикционных фрагментов в парах нуклеотидов для рестриктазы RsaI составили: M. bovis – 357 п.н., M.

tuberculosis – 221 п.н., 82 п.н., M. bovis BCG – 237 п.н.; для рестриктазы TaaI: M. bovis – 328 п.н., 23 п.н., M. tuberculosis – 303 п.н., M. bovis BCG – 237 п.н. Результаты представлены на рисунке 3.

1 2 3 4 5 Рис. 3. Рестрикционные профили M. tuberculosis, M. bovis, M. bovis BCG после обработки ампликонов рестриктазами RsaI и TaaI 1 – M. bovis 2 – M. tuberculosis RsaI 3 – M. bovis BCG 4 – M. bovis 5 – M. tuberculosis TaaI 6 – M. bovis BCG Применение дополнительного рестрикционного анализа, позволило отличить плохо дифференцируемые сигналы, полученные после проведения ПЦР.

Апробацию тест-системы «ТУБ-ДИФ» проводили на ДНК МБТ, выделенной от больных различными заболеваниями.

Известно, что 30% населения являются инфицированнными МБТ [Cole T., 2005]. Вполне возможно, что при иммунодефиците связанном с каким-то заболеванием, активизируется размножение МБТ и увеличивается вероятность их выявления. По сравнению с МБТ, M. bovis выявляют значительно реже. По данным литературы частота выделения этого вида микобактерий зависит от заболеваемости туберкулезом домашних животных, в первую очередь крупного рогатого скота и географического региона в котором проводилось исследование [Vordermeier H. et al., 2000; Grange J., 2001]. Надо отметить, что генодиагностикой этой инфекции никто специально не занимался, и эти литературные данные могут быть весьма приблизительными. Выявление M. bovis BCG можно объяснить высокой чувствительностью методов на основе ПЦР, вследствие чего возможно выявления ДНК не только непосредственно микобактерий, но и их фильтрующихся L-форм. По крайней мере, ДНК M. bovis, M. bovis BCG были выявлены у больных лимфоаденитом, хронической гранулематозной болезнью, мезентеральной лимфоаденопатией и т.д.

При помощи тест-системы «ТУБ-ДИФ» проанализировано 254 образца различного биологического материала (кровь, мокрота, бронхоальвеолярный лаваж, ликвор), полученного от больных с различными заболеваниями и подозрением на микобактериальную инфекцию.

Распределение полученных результатов по двум группам (взрослые пациенты стационара МНПЦБТ и дети, находившиеся на лечении в РДКБ) представлено в таблице 2.

Таблица 2.

Выявление микобактерий туберкулезного комплекса в диагностическом материале больных, находившихся на лечении в МНПЦБТ и РДКБ (n=245) № МНПЦБТ (n=133) РДКБ (n=112) Варианты результатов п/п кол-во % кол-во % 1. M. tuberculosis 104 78,20% 26 23,21% 2. M. bovis 4 3,01% 5 4,46% 3. M. bovis BCG 2 1,50% 11 9,82% 4. Отрицательный 23 17,29% 70 62,50% Из данных, представленных в таблице 2, видно, что у взрослых больных с подозрением на туберкулез M. tuberculosis выявляли в три раза чаще (78,2%), чем у больных детей с подозрением на микобактериальную инфекцию (23,21%), что составляло 94,5% и 62% от выявления M. tuberculosis complex. Результаты определения M. bovis примерно совпадали для двух групп больных и составили 3,01% и 4,46% (3,6% и 12% от выявления M. tuberculosis complex). Частота определения M.

bovis BCG составили 1,50% у больных из МНПЦБТ и 9,82% для пациентов детского стационара РДКБ (1,8% и 26% от выявления M. tuberculosis complex). Значительные отличия распределения по группам пациентов этого вида микобактерий можно объяснить тем, что вакцинный штамм M. bovis BCG вводят детям до 16 лет в соответствии с календарем профилактической вакцинации РФ, вследствие чего ДНК этого вида микобактерий определяли в основном у пациентов детской больницы.

Особый интерес представляли больные с признаками первичного иммунодефицита и онкогематологическими заболеваниями с подозрением на наличие микобактерий туберкулезного комплекса, среди которых присутствовали и M. bovis и M. bovis BCG.

Исследование диагностического материала, полученного от больных с признаками первичного иммунодефицита, показал, что в 21,1% случаях у них были выявлены микобактерии туберкулезного комплекса, из которых 42,8% – M.

Pages:     | 1 || 3 | 4 |






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»