WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

загрузка...
   Добро пожаловать!

Pages:     | 1 || 3 | 4 |   ...   | 5 |

Клетки промывали раствором PBS, снимали с чашек раствором PBS, содержащим 0.03 % эмбриональной сыворотки, пермеабилизовали в растворе 0.01 % сапонина 30 мин при 20 С, затем добавляли РНКазу А (100 мкг/мл), иодид пропидия (40 мкг/мл), инкубировали 15 мин при 37 С и анализировали на проточном цитофлуориметре ATC300 (Brucker, Франция). Полученные результаты обрабатывали с помощью программы Modfit.

Оценку активности каспаз in vitro проводили с использованием флуорогенного субстрата AcDEVD-AMC (Sigma, США). Клетки лизировали в буфере, содержащем 50 мМ HEPES (ICN, США) pH 7.4, 0.1 % CHAPS (Sigma, США), 0.5 % IGEPAL-100 (ICN, США), 5 мМ DTT (Sigma, США) 30 мин при 4 С. Затем лизат центрифугировали 20 мин при 14000 g, отбирали супернатант и брали по 40 мкг белка на реакцию. Пробы собирали в луночной плате, реакционная смесь состояла из лизата, реакционного буфера (40 мМ HEPES pH 7.4, 0.1 % CHAPS, 1 мМ DTT), 40 мкМ субстрата AcDEVD-AMC. Для подтверждения специфической активации каспаз применялся ингибитор каспаз ZVAD в концентрации 50 мкМ. Реакцию проводили 1 ч при 37 С. Флюоресценцию измеряли при длине волны 460 нм, используя энергию возбуждающего излучения при длине волны нм. Из полученных значений флюоресценции вычитали флюоресценцию пустого раствора AcDEVD-AMC в реакционном буфере. В эксперименте проводили измерение 3-х независимых проб и делали подсчет стандартного отклонения от среднего значения.

Измерения проведены с использованием флюориметра (Туроверов и др., 1998) в лаборатории структурной динамики, стабильности и фолдинга белков Института цитологии РАН.

Выявление активности SAGal проводили под световым микроскопом. Клетки фиксировали в 4 % формалине и окрашивали в буфере, содержащем Х-Gal рН 6.0 (Dimri et al., 1995) при 37 С в течение 1 сут.

Иммунофлюоресценция. Клетки промывали раствором PBS, фиксировали в 4 % формальдегидом 10 мин, обрабатывали 0.5 % раствором Triton-X-100 на PBS 20 мин, затем добавляли раствор, блокирующий неспецифическое связывание, 5 % бычий сывороточный альбумин (БСА) на PBS. Далее клетки инкубировали при 20 С 1 ч с моноклональными антителами мыши к -катенину (Santa Cruz, sc-7963), E-кадгерину (Transduction Laboratories, 610182), N-кадгерину (Transduction Laboratories, 610921) в разведении 1:300, а затем при 20 С 1 ч с антителами против иммуноглобулинов мыши, конъюгированными с флюорохромами GAM-TRITC (Santa Cruz, sc-3796) или GAMAlexa488 (Molecular Probes). Первые и вторые антитела разводили в растворе PBS, содержащем 5 % БСА и 0.05 % Tween-20. Окраску ядер проводили с помощью ДНКсвязывающего красителя Topro-3 (Molecular Probes), а окраску актина с помощью родамин-фаллоидина (Molecular Probes). Анализ изображений проводили на конфокальном микроскопе (Leica, Германия).

Для выявления олигонуклеосомной фрагментации проводили выделение экстрахромосомной ДНК. Собирали все (плавающие + прикрепленные) или отдельно плавающие и прикрепленные клетки, промывали PBS, лизировали 20 мин при 4 С в буфере, содержащем 5 мМ Трис-HCl, 0.5 % Тритона Х-100 и 100 мМ ЭДТА рН 8.0. Лизат центрифугировали 20 мин при 14000 g. Супернатант отбирали в отдельные пробирки, в которые добавляли NaCl и РНКазу А (конечная концентрация 0.15 М и 100 мкг/мл соответственно), а затем инкубировали 1 ч при 37 С. В пробы добавляли SDS и протеиназу К (конечная концентрация 0.5 % и 200 мкг/мл соответственно), инкубировали ч при 37 С. Депротеинизацию проводили смесью фенола с хлороформом. Затем проводили переосаждение и промывку ДНК. ДНК растворяли в буфере TE и проводили вертикальный электрофорез в 2 % агарозном геле. Гель окрашивали бромистым этидием и фотографировали.

Для исследования содержания белков Oct-4, циклина D1, циклина A, p27Кip1, p21Wafметодом вестерн-блоттинга клеточные экстракты получали путем лизиса клеток в буфере PBS, содержащем 1 % NP-40, 0.5 % дезоксихолата натрия, 0.1 % SDS, ингибиторы протеаз (1 мМ PMSF, по 10 мкг/мл пепстатина А, леупептина и апротинина), ингибиторы фосфатаз (1 мМ ортованадата натрия, 5 мМ EGTA, 10 мМ NaF) с последующим центрифугированием. Количество белка в пробах измеряли по методу Брэдфорд (Bradford, 1976) и уравнивали пробы для электрофореза между собой по количеству белка. После диск-электрофореза в ПААГ в денатурирующих условиях белки из геля переносили на нитроцеллюлозную мембрану (Amersham, Великобритания). В качестве первых использовали антитела к Oct-4 (sc-5279), p27kip1 (sc-1641), циклину D1 (sc717), циклину A (sc-751) (Santa Cruz), p21Waf1 (Ab-3, Calbiochem). В качестве вторых антител использовали козьи антитела против иммуноглобулинов кролика и мыши, коньюгированные с пероксидазой хрена. Белки выявляли методом усиленной хемилюминесценции (ECL, Amersham).

Анализ ДНК-связывающей активности методом ретардации в ПААГ.

Ядерные экстракты получали согласно протоколу Шрайбера с соавторами (Schreiber et al., 1989). Для получения ядерных экстрактов клетки отмывали от среды раствором Версена, 107 клеток суспендировали в 0.4 мл буфера А (10 мМ HEPES, pH 7.9, 0.1 мМ ЭДТА, 10 мМ KCI, 0.1 мМ EGТА, 1 мМ ортованадата натрия, 1 мМ PMSF, 1 мМ DTT и по 10 мкг/мл леупептина и апротинина), инкубировали 15 мин на льду, затем добавляли NP-40 до 0.06 % и инкубировали 3 мин. Далее центрифугировали при 12000g 2 мин, отделяя цитоплазматическую фракцию (супернатант) и ядра. Осадок ядер помещали в буфер Б (мМ HEPES, pH 7.9, 1 мМ ЭДТА, 0.4 М NaCI, 1 мМ EGTA, 1 мМ ортованадата натрия, мМ PMSF, 1 мМ DTT и по 10 мкг/мл леупептина и апротинина), 15 мин интенсивно встряхивали на шейкере, центрифугировали 30 мин 12000 g при 4 С, экстракты хранили при –70 С. Количество белка в пробах измеряли методом Брэдфорд (Bradford, 1976).

Экстракты ядер инкубировали 30 мин при 20 С в буфере для реакции, содержащем 5 мМ HEPES-КОН pH 7.9, 2.5 мМ DTT, 2.5 мМ ЭДТА, 15 % глицерина, 2.5 мМ DTT, 5 мМ MgCl2. В реакцию добавляли 1 мкг неспецифического конкурента polydI/polydC (Pharmacia) и 2 мкг экстрактов ядер так, чтобы конечная концентрация NaCl была в пределах 75-100 мМ. Объем реакции был 10-20 мкл. Затем добавляли 1 нг меченых [-32Р]АТФ олигонуклеотидов и инкубировали дополнительно 20 мин при 20 С. В качестве меченых олигонуклеотидов использовали последовательности из регуляторных областей гена коллагеназы (Col-AP-1: 5’-AGCATGAGTCAGCC-3’) и c-jun, jun2-TRE (Jun2-AP-1: 5’AGCTAGCATTACCTCATCCC-3’) (Pospelova et al., 1999). При исследовании специфичности выявляемых комплексов использовали немеченный олигонуклеотид в 10- и 50-кратном избытке (10 и 50 нг соответственно). В качестве неспецифического конкурента использовали сайт связывания SRF из промотора c-fos DSE 5’CACAGGATGTCCATATTAGGAC-3’. Электрофорез проводили в 5 % ПААГ в буфере TBE, гель фиксировали (10 % этанол 10 % уксусная кислота), сушили и экспонировали с рентгеновской пленкой Kodak X-OMAT K 1-2 сут. Для выяснения белкового состава выявляемых комплексов использовали поликлональные антитела Santa Cruz к с-Fos (sc52x), c-Jun (sc-45x), ATF-2 (sc-19) (Santa Cruz, США), пробы в буфере для реакции инкубировали 2 ч 4 0С в присутствии антител, затем добавляли меченую пробу на 20 мин 20 С.

Тотальную клеточную РНК выделяли с помощью Trizol® (Gibco BRL). Реакции обратной транскрипции (ОТ) и амплификации (ПЦР) проводили по протоколу, описанному ранее (Kukushkin et al., 2002). Праймеры для генов oct-4, циклин E, циклин D1, c-myc, cdc25A, p27kip1, p21Waf1 были описаны ранее (Kukushkin et al., 2002; Абрамова и др., 2003; Лянгузова и др., 2004). Последовательности использованных праймеров к генам:

p57kip2 - 5’-CCCGGACGCGAACCCGGACG -3’/5’-CGAGAGAGGCTGGTCCTTCA-3’ (расчетная длина продукта 312 п. о.; циклин A2 - 5’- GCATGAGGGCGATCCTTGTG 3’/5’-ACAGTTTGCAGGCTGCAGGTG -3’ (расчетная длина продукта 355 п. о.); p16ink4a - 5’-CCGAACTCTTTCGGTCGTAC-3’/5’-GGGTCGCAGGTTCTTGGTCA-3’(расчетная длина продукта 280 п. о.); tcf4 - ; -катенин - ; dab2 - ; E-кадгерин - ; N-кадгерин - ; snail - ;.

Температура отжига приведенных праймеров составляла 58 С. Электрофорез ПЦРпродуктов с маркером молекулярного веса ДНК 100 bp-ladder (Gibco BRL) проводили в % агарозном геле на буфере ТВЕ. Денатурирующий электрофорез рибосомных РНК приведен в качестве контроля нагрузки.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 1. Влияние ингибиторов деацетилаз гистонов на скорость прироста популяции и клеточный цикл мЭСК. Высокая скорость роста и деления является характерным признаком недифференцированных эмбриональных стволовых клеток мыши (мЭСК), причем, в отличие от большинства соматических нетрансформированных клеток, скорость деления мЭСК не зависит от присутствия факторов роста сыворотки (Schratt et al., 2001).

Мы предположили, что конститутивная пролиферация и подавление апоптотической программы мЭСК связаны с наличием эпигенетических механизмов регуляции транскрипции. Ацетилирование и деацетилирование гистонов, осуществляемое ферментами ацетилазами и деацетилазами, вносит существенный вклад в регуляцию транскрипции генов, среди которых есть регуляторы клеточного цикла и дифференцировки. На других клеточных системах показано, что ингибиторы деацетилаз гистонов (HDAC) обладают антипролиферативным действием, вызывая как длительные, так и кратковременные остановки клеточного цикла, старение или апоптоз в зависимости от происхождения клеточной линии и от ее функционального статуса (Ogryzko et al., 1996;

Peart et al., 2003; Dokmanovic, Marks, 2005). Специфический ответ клетки на действие ингибитора HDAC зависит от функциональной настройки системы регуляции клеточного цикла, возможности реализовать длительный блок клеточного цикла. Чтобы оценить эффект ингибиторов HDAC на пролиферацию мЭСК, мы сравнивали динамику роста популяции клеток в контроле и в присутствии различных концентраций трихостатина А (TSA) и бутирата натрия (NaBut). Оказалось, что даже небольшие концентрации ингибиторов оказывают сильный эффект на прирост популяции мЭСК. Количество клеток на 4 сут после рассева (8х106 в контроле) уменьшается более чем в два раза в чашках, обработанных 12.5 нМ TSA и 2.5 мМ NaBut (3.8х106 и 1.76х106 клеток соответственно) (рис.1, а, Чуйкин и др., 2006). Поскольку замедление прохождения по клеточному циклу – один из возможных механизмов антипролиферативного действия ингибиторов HDAC на мЭСК, методом проточной цитометрии исследовали распределение клеток по фазам клеточного цикла. Было установлено, что при действии TSA доля клеток в фазе S снижается с 71 % до 31 %, а доля клеток, находящихся в фазе G2 увеличивается c 9 % до %. Эффект TSA на клетки является обратимым, и после отмывки средой, не содержащей TSA, доля клеток в фазе S возрастает до 50 %, в то время как в фазе G2 остается около 24 % клеток (рис. 1, б).

G0-G1: 20 % G0-G1 : 15 % G0-G1: 20 % G0-G1 : 15 % б б а а G2-M: 9 % G2-M : 54 % G2-M: 9 % G2-M : 54 % S: 71 % S: 31 % S: 71 % S: 31 % 0 50 100 150 200 0 50 100 150 200 Channels Channels 0 50 100 150 200 0 50 100 150 200 Channels Channels Контроль TSA 1 сут Контроль TSA 1 сут G0-G1 : 26 % G0-G1 : 26 % G0-G1 : 19 % G0-G1 : 19 % G2-M : 24 % G2-M : 24 % G2-M : 47 % G2-M : 47 % S: 50 % S: 50 % S: 34 % S: 34 % 0 50 100 150 200 0 50 100 150 200 Channels 0 50 100 150 200 Channels 0 50 100 150 200 Channels Channels 246 246 TSA 2 сут TSA 1 сут TSA 2 сут TSA 1 сут Время, сут Время, сут отмывка 1 сут отмывка 1 сут Рис. 1. Воздействие ингибиторов HDAC TSA и NaBut приводит к подавлению Рис. 1. Воздействие ингибиторов HDAC TSA и NaBut приводит к подавлению пролиферации мЭСК; а - динамика роста популяции в контроле кривая 1, при действии пролиферации мЭСК; а - динамика роста популяции в контроле кривая 1, при действии 0.5 или 2.5 мМ NaBut (кривые 2, 4 соответственно) и при действии 12.5 или 25 нМ TSA 0.5 или 2.5 мМ NaBut (кривые 2, 4 соответственно) и при действии 12.5 или 25 нМ TSA (кривые 3, 5 соответственно); б – гистограммы распределения клеток по фазам (кривые 3, 5 соответственно); б – гистограммы распределения клеток по фазам клеточного цикла в контроле и после обработки 150 нМ TSA; по оси абсцисс – клеточного цикла в контроле и после обработки 150 нМ TSA; по оси абсцисс – количество ДНК, усл. ед, по оси ординат – число клеток.

количество ДНК, усл. ед, по оси ординат – число клеток.

2. Изучение эффекта ингибиторов деацетилаз гистонов на жизнеспособность мЭСК.

Индукция клеточной гибели может быть причиной снижения числа клеток при действии ингибиторов HDAC на мЭСК. Влияние TSA на клеточный цикл мЭСК наблюдается и на сут воздействия (рис. 1, б), кроме того, визуально наблюдается увеличение количества мертвых и открепившихся клеток. Чтобы подтвердить индукцию апоптотической гибели был сделан анализ олигонуклеосомной фрагментации ДНК. Показано, что TSA и NaBut вызывают дозо-зависимое увеличение доли фрагментированной ДНК, причем характерная для апоптотирующих клеток «лесенка» на электрофореграммах отмечается именно в открепленных клетках (рис. 2, а), а это значит, что гибель и открепление клеток происходят практически одновременно. Чтобы оценить долю живых (метаболически активных) клеток был использован MTT-тест, в результате чего показано, что существенное снижение числа метаболически активных клеток происходит после 2суточного действия TSA, причем эффект прямо зависит от концентрации TSA (рис. 2, б). В первые сутки действия TSA эффект незначителен. Поскольку апоптоз – процесс, происходящий с участием цистеиновых протеаз (каспаз), было проверено изменение активности каспаз после воздействия TSА. Для этого применялся флюоресцентный метод оценки активности каспаз с использованием искусственного субстрата AcDEVD-AMC. На рис. 2, в видно, что активность каспаз увеличивается на 1 и 2 сут обработки TSA. На 2 сут воздействия 150 нМ TSA отмечается увеличение активности каспаз более чем в 5 раз, причем увеличение активности каспаз наблюдалось, когда в опыт брали прикрепленные и открепившиеся клетки. Экстракты для анализа активности каспаз получали из прикрепленных + открепившихся клеток, за исключением дорожки 4. В прикрепленных клетках после 2 сут воздействия TSA активность каспаз практически не отличается от Number Number Number Number.

.

Число клеток Число клеток Number Number Number Number контроля (рис. 2, в, дорожки 1, 4 соответственно). Присутствие в реакции ингибитора каспаз широкого спектра действия, ZVAD в концентрации 50 мкМ, приводило к снижению активности каспаз (рис. 2, в, дорожка 5). Таким образом, можно сделать вывод о том, ингибитор HDAC TSA вызывает блок клеточного цикла и последующую апоптотическую гибель клеток.

Pages:     | 1 || 3 | 4 |   ...   | 5 |






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»