WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

загрузка...
   Добро пожаловать!

Pages:     | 1 || 3 | 4 |

Arabidopsis thaliana ПЦР в режиме реального времени прямой gacgtttagcgatggttgga 20 ELIP1 AT3G22840 обратный taccgaggaaccatgagacg 20 прямой gtggtgtcgggtggtttcta 20 ELIP2 AT4G14690 обратный cctctgcccttattcccttg 20 прямой cgtcttcgtggtggtttctaa 21 UBQ10 AT4G05320.2 обратный tacaaggccccaaaacacaa 20 Стандартная ПЦР прямой tatccggtgggagtgagatg 20 ELIP1 AT3G22840 обратный gagtgtcccacctttgacga 20 прямой ctgctccttccggtgtattg 20 ELIP2 AT4G14690 обратный cctctgcccttattcccttg 20 прямой gacccattgaacttggctga 20 Lhcb2 AT2G05070 обратный caagacgaccgttcttgagc 20 прямой attcgcatcctacgaagtgg 20 ChlH AT5G13630 обратный ttaatcgccaattcctcgac 20 прямой tattgcttctggtgcggttt 20 HEMA1 AT1G58290 обратный ttttccagcgccaattacac 20 прямой ggttgtgaatcgaagcgaag 20 HEMA2 AT1G09940 обратный ctgcagcacaagacagcatc 20 прямой cgtctcatcttcgctggaa 19 UBQ10 AT4G05320.2 обратный agccatccttagaacccaaca 21 прямой cggagtaatgattaacagggac 22 18S рРНК X16077 обратный ccgcgatccgaacacttca 20 Ячмень Стандартная ПЦР ELIP прямой ccgtccgaacaactagcagc клон X15691 54 обратный ttatccggtcgacagcaaagc HVLPELIP прямой cttagcaaggagcaccttc клон X15693 54 обратный cgagcatagcgaagcggcc HVLPпрямой caaggaaggcagcaggcgc 18S рРНК AY552749 54 обратный cctggtaagtttccccgtgtt Получение комплементарной ДНК (кДНК) с помощью реакции обратной транскрипции (ОТ).

кДНК синтезировали, используя набор «Синтез первой цепи кДНК (базовый)» («СилексМ», Россия) или «Omniscript RT kit» («QIAGEN», Германия), согласно рекомендациям производителей. Для проведения реакции использовали Олиго-дТ или специфические праймеры. Реакцию ОТ проводили на амплификаторе «ДНК ТП-4ПЦР-Терцик» («ДНК-Технология», Россия) или «T3 THERMOCYCLER» («Biometra», Германия).

Полимеразная цепная реакция в режиме реального времени («Real-time» ПЦР).

«Real-time» ПЦР проводили на роторном анализаторе «Rotor-Gene (RG) 3000» («Corbett Research», Англия) с реакционной смесью, которая содержала: 2х «ImmoMix» (с 1.мМ MgCl2) («BIOLINE», Германия) – 10 µл; 35 мМ MgCl2 («BIOLINE», Германия) – 2 µл;

50xSYBR Green («QIAGEN», Германия) – 0.4 µл; 10 мМ прямого и обратного праймеров – по 1 µл; кДНК – 2 µл; стерильная вода – 2.6 µл. Реакцию проводили по следующей схеме:

1. Начальная денатурация - 94°С, 3 мин – 1 цикл. 2. Амплификационный цикл (повторов): денатурация - 94°С, 30 с; отжиг праймеров - 61° С, 30 с; элонгация - 72° С, 15 с.

3. Достраивание цепей ДНК - 72° С, 3 мин – 1 цикл.

Кривую плавления строили, устанавливая базовую линию и порог амплификации в соответствии с рекомендациями производителя роторного анализатора. Полученные данные анализировали с помощью программного обеспечения LinRegPCR (Pfaff, 2001; Ramakers, 2003). Относительное содержание транскриптов нормализировали по UBQ10. Для подтверждения отсутствия примесей проводили реакции «негативного контроля» без добавления кДНК со всеми используемыми праймерами.

Стандартная ПЦР.

Для ПЦР использовали наборы «ОТ-ПЦР базовый» («СилексМ», Россия) и «BIOTAG PCR Kit» («BIOLINE», Германия). Реакционные смеси (25 µл) готовили согласно рекомендациям производителей. Реакцию амплификации проводили по следующей схеме:

1. Начальная денатурация - 94°С, 3 мин – 1 цикл. 2. Амплификационный цикл (повторов): денатурация - 94°С, 30 с; отжиг праймеров - 54 (61)° С (в зависимости от используемых праймеров), 30 с; элонгация - 72° С, 15 с. 3. Достраивание цепей ДНК - 72° С, 5 мин – 1 цикл. 4. Хранение – 4°С.

Было выбрано оптимальное число циклов ПЦР. Контролем, подтверждающим нанесение равных количеств суммарной кДНК, служили 18S рРНК и UBQ10. Параллельно проводили реакции без добавления полимеразы для доказательства отсутствия примесей.

Электрофорез ПЦР-продуктов.

Амплифицированные фрагменты разделяли с помощью электрофореза в 1.5% (для фрагментов > 300 п.н.) и 2% (для фрагментов < 300 п.н.) агарозном геле, содержащем 1хТАЕ буфер (0.04 М Трис-ацетат, 2 мМ ЭДТА) в присутствии 0.5 µг/мл EthBr при напряжении 120В в течение 25 мин. Размер продукта амплификации определяли сравнением с маркерами длин фрагментов. Гель фотографировали и анализировали, как описано выше. Рестрикция амплифицированного фрагмента ДНК ферментами HindIII и BamHI являлась доказательством, что амплификация прошла корректно.

Определение содержания интермедиатов биосинтеза тетрапирролов.

Содержание протопорфирина IX (Proto), Mg-Proto и Mg-ProtoМе определяли по методу, описанному в литературе (Alawady and Grimm, 2005).

Измерение фотохимической активности ФС2.

Флуоресценцию хлорофилла a измеряли на импульсном флуориметре РАМ (РАМ 101/PDA, Heinz Walz, Effeltrich, Германия).

Результаты и их обсуждение 1. Участие интермедиатов биосинтеза тетрапирролов в ретроградной регуляции экспрессии ядерных генов пластидных белков ELIP1 и ELIP2 у Arabidopsis.

1.1. Экспрессия генов ELIP и содержание хлорофилла у hy и gun мутантов на разных стадиях развития растений.

Для того чтобы выяснить, участвуют ли интермедиаты биосинтеза тетрапирролов в экспрессии ядерных генов белков фотосинтеза, мы исследовали экспрессию генов ELIP1 и ELIP2 у четырех мутантов с нарушениями в ферментах биосинтеза тетрапирролов: hy мутанты (аллельные gun) с нарушениями в биосинтезе гема (где HY1 гены кодируют гемоксигеназу; HY2 – фитохромобилинсинтазу) и gun мутанты с нарушениями в биосинтезе хлорофилла (где GUN4 гены кодируют белок, Рис. 1. Уровень экспрессии ELIP1 и ELIP2 у 10- и 30-дневных hy и gun участвующий в регуляции активности Mgмутантов Arabidopsis. Содержание хелатазы; GUN5 ген - H-субъединицу этого транскриптов определяли относительно уровня экспрессии генов ELIP1 у ДТ фермента).

растений, который принимали за 100%.

Анализ ОТ-ПЦР показал, что уровень экспрессии генов ELIP1 и ELIP2 у 10-дневных gun5 и gun5-1 мутантов (полиморфизм в экзоне 3) сходны с уровнем экспрессии этих генов у растений дикого типа. Однако уровень экспрессии генов ELIP у hy1, hy2 мутантов увеличивался на 30-40%, а у gun4 мутантов на 50-60% по сравнению с растениями дикого типа. Уровень экспрессии ELIP2 был ниже, чем ELIP1, как у мутантов, так и у растений дикого типа (рис. 1).

Для того чтобы исследовать экспрессию генов ELIP1 и ELIP2 в процессе развития растений, был проведен эксперимент со взрослыми растениями hy и gun мутантов Arabidopsis. ОТ-ПЦР анализ содержания транскриптов генов ELIP у 30-дневных растений показал, что различия в уровнях экспрессии этих генов у мутантов и растений дикого типа сходны с различиями, наблюдающимися у 10-дневных растений (рис. 1).

Исследование содержания хлорофилла в хлоропластах hy и gun мутантов и ДТ растений Arabidopsis показало, что растения с мутациями, повреждающими пластидные ферменты биосинтеза тетрапирролов, характеризуются пониженным содержанием хлорофилла (у gun4, hy1 и hy2 мутантов накапливалось ~ 50% хлорофилла; у gun5-1 (gun5) ~ 80%, по сравнению с растениями дикого типа). Различия по содержанию хлорофилла между мутантами и диким типом не зависят от возраста растений. В то же время у взрослых растений хлорофилла накапливалось больше (~ в 2 раза), чем у 10-дневных проростков (рис. 2).

Рис. 2. Содержание хлорофилла у 10- и 30- дневных gun мутантов Arabidopsis. (А) Растения gun5-1, gun4, hy1, hy2 мутантов и ДТ Arabidopsis, выращенные в течение 10 и 30 дней. (Б) Диаграмма накопления хлорофилла у мутантов и растений дикого типа. СВ –сырой вес. Приведенные на рисунке данные являются средними не менее трех независимых экспериментов. ± стандартное отклонение.

Таким образом, было показано, что HY1, HY2 и GUN4 пластидные сигналы позитивно регулируют экспрессию генов ELIP независимо от возраста растений. Эти факты свидетельствуют о том, что экспрессия генов ELIP находится под влиянием пластидных сигналов, генерируемых биосинтезом тетрапирролов. Обнаруженная обратная корреляция между накоплением транскриптов ELIP и содержанием хлорофилла у gun мутантов с нарушениями биосинтеза тетрапирролов, по-видимому, указывает на то, что белки ELIP модулируют синтез хлорофилла, предотвращая накопление свободного пигмента и, таким образом, защищая клетки от фотоокисления.

1.2. Действие норфлуразона на экспрессию генов ELIP у hy и gun мутантов и растений дикого типа Arabidopsis.

Для того чтобы изучить участие интермедиатов биосинтеза тетрапирролов, как пластидных сигналов, в регуляции экспрессии генов ELIP, были проведены опыты с gun мутантами и ДТ растениями Arabidopsis в присутствии НФ. Как известно, обработка растений НФ - ингибитором биосинтеза каротиноидов, приводит к нарушению функционирования хлоропластов (Mayfield and Taylor, 1987) и подавлению пластидного сигнала (Woodson and Chory, 2008).

Анализ пигментного состава пластид растений, обработанных НФ, показало полное отсутствие хлорофилла и каротиноидов у 10-дневных проростков. Исследование содержания транскриптов ELIP1 и ELIP2 с помощью ОТ-ПЦР и ПЦР в режиме реального времени у растений дикого типа показало, что полная дисфункция пластид (при обработке НФ) приводит к значительному ингибированию (на 80-90%) экспрессии ELIP (рис. 3). Однако у НФ-обработанных hy и gun мутантов Arabidopsis наблюдалось только частичное ингибирование экспрессии этих генов (на 40-50%).

Рис. 3. Содержание транскриптов ELIP1 и ELIP2 у 10-дневных растений hy и gun мутантов и ДТ Arabidopsis, выросших в присутствии 5 µM НФ (+) и без добавления ингибитора (-). (A) ОТ-ПЦР анализ накопления ELIP. (Б, В) ПЦР анализ в режиме реального времени. UBQиспользовали для стандартизации ОТ-ПЦР. Содержание транскриптов ELIP1 и ELIPопределяли относительно уровня экспрессии генов ELIP1 у контрольных растений, который принимали за 100%.

Для того чтобы изучить изменяется ли действие ретроградного сигнала на экспрессию ELIP в процессе развития растений, было изучено действие НФ на 30-дневные растения Arabidopsis. Результаты, полученные с помощью ОТ-ПЦР, показали, что экспрессия ядерных генов стрессовых белков ELIP1 и ELIP2 у НФ-обработанных растений дикого типа была подавлена (на 80-90%), а у hy и gun мутантов практически не изменялась (рис. 4).

Рис. 4. Содержание транскриптов ELIP1 и ELIP2 у НФ-обработанных (+) и контрольных (-) 30-дневных hy и gun мутантов и ДТ растений Arabidopsis. UBQ10 использовали для стандартизации ОТ-ПЦР.

Таким образом, результаты, полученные при исследовании мутантов с нарушениями в передаче пластидного сигнала, и с помощью ингибиторного анализа, показали, что пластидные сигналы, индуцируемые интермедиатами биосинтеза тетрапирролов, участвуют в регуляции экспрессии ядерных генов хлоропластных белков ELIP в зависимости от возраста растений.

1.3. Влияние экзогенного и эндогенного Mg-Proto на экспрессию генов ELIP1 и ELIP2 у gun5 мутантов и растений дикого типа Arabidopsis.

Ранее было высказано предположение, что Mg-Proto и Mg-ProtoМе – интермедиаты биосинтеза тетрапирролов могут выступать в роли молекул, передающих сигнал от пластид к ядру. Мы проверили, существует ли зависимость между накоплением этих молекул и содержанием транскриптов ядерных генов ELIP с помощью увеличения их содержания эндогенно (добавлением гербицида ДП) и экзогенно (добавлением Mg-Proto). Как известно, ДП ингибирует биосинтез тетрапирролов на стадии превращения Mg-ProtoМе в протохлорофиллид, в результате чего происходит избыточное накопление Mg-ProtoМе.

ДП в условиях фотодеструкции, вызванной НФ, приводил к значительному подавлению экспресии генов ELIP, как у растений дикого типа, так и у gun5 мутантов (рис. 5А). Как было сказано выше, экспрессия этих же генов у растений, которые были обработаны одним НФ, была только частично подавлена у мутантов (рис. 5Б). Следовательно, повышение содержания Mg-Proto в хлоропластах коррелирует с экспрессией генов ELIP. Кроме того, дополнительным доказательством было значительное снижение экспрессии генов ELIP у растений дикого типа и gun5 мутантов при действии самого Mg-Proto на клетки растений (рис. 5В).

Рис. 5. Содержание транскриптов ELIP1 и ELIP2 после обработки НФ, ДП и Mg-Proto (+) у gun5 (gun5-1) мутантов и ДТ растений Arabidopsis и контрольных растений (-). (А) 10дневные растения инкубировали с раствором 5мM ДП. (Б) Растения росли на НФ-среде. (В) Листья 30-дневных растений инкубировали с 50 µM Mg-Proto. UBQ10 и 18S рРНК использовали для стандартизации ОТ-ПЦР.

Эти данные и данные литературы позволяли предполагать, что Mg-Proto может выступать в роли сигнальной молекулы, которая участвует в передаче сигналов от хлоропластов к ядру, регулируя экспрессию ядерных генов белков хлоропластов ELIP1 и ELIP2.

1.4. Содержание интермедиатов биосинтеза тетрапирролов у gun мутантов и растений дикого типа Arabidopsis, выращенных в присутствии или без НФ.

Для того чтобы выяснить, коррелирует ли содержание интермедиатов биосинтеза тетрапирролов с уровнем экспрессии ядерных генов белков пластид ELIP, было изучено содержание предшественников хлорофилла (Proto, Mg-Proto и Mg-ProtoMe) в присутствии НФ у проростков Arabidopsis в условиях светового стресса.

Результаты высокоэффективной жидкостной хроматографии (HPLC) показали, что в отсутствие ингибитора уровень Proto был выше у gun5-1 и gun4 мутантов по сравнению с ДТ (рис. 6А). В присутствии НФ накопление Proto было подавлено ~ на 100% у gun4 мутантов и ДТ растений, и у gun5-1 мутантов ~ на 50%. Содержание Mg-Proto и Mg-ProtoMe у необработанных gun5-1, gun4 мутантов не отличалось от их уровня у растений дикого типа.

Видимо, gun мутации не влияют на накопление этих интермедиатов у растений. В присутствии НФ содержание Mg-Proto и Mg-ProtoMe снижалось как у ДТ растений, так и у gun мутантов. Как следует из рис. 6Б, в присутствии НФ экспрессия генов ELIP была подавлена у растений дикого типа и частично восстановлена у gun5-1 и gun4 мутантов.

Таким образом, прямое определение содержания Mg-Proto и Mg-ProtoMe с помощью HPLC не выявило корреляции между уровнем накопления Mg-Proto и Mg-ProtoМе в условиях фотодеструкции, вызванной НФ, и экспрессией генов ELIP. Следовательно, эти интермедиаты биосинтеза тетрапирролов не являются сигнальными молекулами при передаче ретроградного пластидного сигнала в ядро.

Рис. 6. Содержание тетрапирролов (А) и транскриптов ELIP1 и ELIP2 (Б) у 10-дневных gun4, gun5-1 мутантов и ДТ растений Arabidopsis, выросших на НФ-среде (+) или на среде без ингибитора (-). СВ - сырой вес. UBQ10 использовали для стандартизации ОТ-ПЦР.

Содержание транскриптов ELIP1 и ELIP2 определяли относительно уровня экспрессии генов ELIP1 у ДТ растений, который принимали за 100%.

Pages:     | 1 || 3 | 4 |






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»