WWW.DISSERS.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

загрузка...
   Добро пожаловать!

Pages:     || 2 | 3 | 4 |

На правах рукописи

ПОГУЛЬСКАЯ Елена Николаевна РОЛЬ ПЛАСТИДНЫХ СИГНАЛОВ В РЕГУЛЯЦИИ ЭКСПРЕССИИ ЯДЕРНЫХ ГЕНОВ СТРЕССОВЫХ БЕЛКОВ ELIP И HSP32 У ПРОРОСТКОВ ЯЧМЕНЯ 03.00.04 – биохимия

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Москва 2006

Работа выполнена в лаборатории биохимии хлоропластов Института биохимии им. А.Н. Баха РАН

Научный консультант: доктор биологических наук Н.П. ЮРИНА

Официальные оппоненты: доктор биологических наук, профессор Н.П. КОРАБЛЕВА доктор биологических наук В.В. КУЗНЕЦОВ

Ведущая организация: Научно-исследовательский институт физико-химической биологии им. А.Н. Белозерского МГУ им. М.В. Ломоносова

Защита состоится 30 мая 2006 г. в 15.00 ч на заседании диссертационного совета К 002.247.01 по защите диссертаций на соискание ученой степени кандидата наук в Институте биохимии имени А.Н. Баха РАН по адресу: 119071, Москва, Ленинский проспект, 33, корп. 2.

С диссертационной работой можно ознакомиться в Библиотеке биологической литературы РАН по адресу: 119071, г. Москва, Ленинский проспект, 33, корп.1.

Автореферат разослан 28 апреля 2006 г.

Ученый секретарь диссертационного совета, кандидат биологических наук А.Ф. Орловский 2

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы. Хлоропласты содержат около 3500 различных белков, только небольшая часть которых кодируется пластидным геномом. Большинство белков пластид кодируется ядром. Координация экспрессии генов хлоропластных белков, кодируемых двумя клеточными геномами, достигается путем обмена информацией между ними, в котором участвуют специфические регуляторные сигналы, идущие как от ядра к пластидам, так и от пластид к ядру. Ключевая роль в этих процессах принадлежит клеточному ядру.

Сигналы, посылаемые ядром в различные компартменты клетки (ядерные или антероградные сигналы) изучены значительно лучше, чем сигналы, генерируемые хлоропластами (пластидные или ретроградные сигналы).

Предположение о существовании «пластидного сигнала», который регулирует экспрессию ядерных генов хлоропластных белков, было высказано впервые в середине 80-х годов (Brner, 1986; Oelmller, Mohr, 1986). В последние годы интерес к исследованию пластидных сигналов сильно возрос. Было установлено, что пластидными сигналами, «запускающими» синтез кодируемых ядром пластидных белков, могут являться продукты синтеза белка в пластидах, активные формы кислорода (синглетный кислород и перекись водорода), редокс-состояние электрон-транспортной цепи фотосинтеза, а также интермедиаты биосинтеза тетрапирролов. Было доказано, что пластидные сигналы регулируют экспрессию ряда генов фотосинтеза (Pfannschmidt, 2003). Однако данные о передаче сигналов от хлоропластов к ядру по-прежнему немногочисленны. Молекулярная характеристика индивидуальных компонентов, участвующих в передаче сигналов, только начинается. Не идентифицированы ни механизмы, позволяющие пластидному сигналу проходить через оболочку органелл, ни молекулы-мессенджеры, локализованные в цитоплазме/ядре.

В связи с изложенным, большой интерес представляет исследование роли пластидных сигналов в экспрессии ядерных генов стрессовых белков хлоропластов, поскольку эти белки играют важную роль в защите растений от стрессовых факторов окружающей среды (интенсивный свет, экстремальные температуры, засуха и др). В хлоропластах высших растений идентифицированы мультигенное семейство стрессовых белков Elip, локализованных в тилакоидах, и стрессовый белок теплового шока Hsp32, локализованный в строме хлоропластов. Действие пластидного сигнала на транскрипцию ядерных генов стрессовых белков хлоропластов практически не изучено. Белки семейства Elip (ранние индуцируемые светом белки) синтезируются в растениях на ранних этапах зеленения этиолированных проростков, а также в условиях светового стресса, засухи и действия низких температур (Adamska et al., 2001). У высших растений белки, относящиеся к мультигенному семейству Elip, кодируются ядром, синтезируются на цитоплазматических рибосомах и в форме предшественников пост-трансляционно транспортируются в хлоропласты (Montane, Kloppstech, 2000).

Белки теплового стресса образуются у растений в условиях повышенной температуры окружающей среды. Низкомолекулярный белок Hsp32 играет существенную роль в устойчивости к тепловому стрессу и в процессах развития растений (Kruse et al., 1993).

Цель и задачи работы. Целью данной работы было исследование роли пластидных сигналов в регуляции экспрессии ядерных генов стрессовых белков пластид – гена низкомолекулярного белка светового стресса Elip и гена белка теплового шока Hsp32 с использованием ингибиторного анализа. В соответствии с указанной целью были поставлены следующие задачи:

1. Изучить экспрессию ядерных генов стрессовых белков пластид Elip, Hsp32 и маркерных генов белков фотосинтеза Lhcb1, RbcS на уровне мРНК и на уровне белков в условиях, позволяющих выявить пластидный сигнал.

2. Изучить импорт белков в хлоропласты в условиях окислительного стресса, вызванного недостатком каротиноидов у стрессовых белков пластид Elip и Hsp32 и белков фотосинтеза Lhcb1 и RbcS.

3. Изучить участие интермедиатов биосинтеза тетрапирролов (Mg-протопорфирина IX и монометилового эфира Mg-протопорфирина IX), продуктов синтеза пластидных белков и редокс-состояния электрон-транспортной цепи фотосинтеза в регуляции транскрипции гена Elip.

Научная новизна. Выявлены различия в регуляции экспрессии генов стрессовых белков пластид и генов белков фотосинтеза. Показано, что в изученных условиях пластидные сигналы ингибируют экспрессию генов белков фотосинтеза, частично подавляют экспрессию гена Elip и не влияют на экспрессию гена белка теплового шока Hsp32. Регуляция гена Elip отличается от регуляции экспрессии гена близкородственного белка Lhcb1. Показано, что в регуляции транскрипции гена Elip участвуют интермедиаты биосинтеза тетрапирролов и редокс-состояние компонентов электрон-транспортной цепи (пула пластохинонов). Впервые установлено, что экспрессия одного и того же гена Elip может кооперативно регулироваться несколькими (по крайней мере, двумя) хлоропластными сигналами. Впервые обнаружено накопление в оболочке хлоропластов предшественников пластидных стрессовых белков в условиях фотодеструкции, что обусловлено нарушениями импорта белков-предшественников в пластиды.

Научно-практическая ценность. Полученные данные позволяют существенно расширить представления о механизмах внутриклеточной передачи сигналов, обусловливающих координированную экспрессию генов в различных структурах растительной клетки. Настоящая работа является фундаментальным исследованием.

Полученные данные могут быть использованы при проведении генно-инженерных работ по созданию продуктивных сортов сельскохозяйственных растений.

Апробация работы. Основные результаты работы были представлены на V-м Съезде Общества Физиологов растений России (г. Пенза, 2003), Международной конференции «Молекулярная генетика, геномика и биотехнология» (г. Минск, 2004), XVIIой молодежной школе «Перспективные направления физико-химической биологии и биотехнологии» (г. Москва, 2005) и на 11-ом Конгрессе Общества фотобиологов (г. Э-лебен, Франция, 2005).

Публикации. По материалам диссертации опубликовано 10 печатных работ.

Структура и объем работы. Диссертация состоит из введения, обзора литературы (главы), описания материалов и методов исследования, изложения результатов и их обсуждения, выводов и списка цитируемой литературы (175 источников). Диссертация изложена на 114 страницах, содержит 19 рисунков и 3 таблицы.

СОДЕРЖАНИЕ РАБОТЫ

Обзор литературы В обзоре литературы рассмотрены современные представления о регуляции экспрессии ядерных генов белков пластид с помощью сигналов, генерируемых хлоропластами, и о медиаторах, участвующих в этом процессе. Основное внимание уделено рассмотрению классов пластидных сигналов, структуры и функций белков Elip и Hsp32.

Материалы и методы исследования Растения и условия выращивания. Проростки ячменя (Hordeum vulgare L.) выращивали при 20°С в водной культуре в темноте в течение 7 сут. Для ингибирования биосинтеза тетрапирролов использовали 2,2’-дипиридил («Sigma», США). Этиолированные проростки обрабатывали 2,2’-дипиридилом в конечной концентрации 5 мМ и освещали светом 30 мкмоль квантов м–2 сек-– 1 в течение 8 ч. Для выявления роли пластидного сигнала в опытах использовали растения, обработанные норфлуразоном (SAN 9789, 4-хлор -5-(метиламино)-2- (,,-три-фтор-м-толил-3-(2Н)пиридазинон; NF), что приводило к фотодеструкции хлоропластов. Cемена замачивали в дистиллированной воде, содержащей 0,5 мМ NF, и выращивали в водной культуре в темноте в присутствии той же концентрации ингибитора. В опытах с ингибитором синтеза белка в пластидах использовали линкомицин в конечной концентрации 0,5 мМ. Затем проростки освещали светом 300 мкмоль квантов м-– с– 1 в течение суток. Условия теплового стресса: контрольные и обработанные NF интактные растения инкубировали в течение 2 ч при 42°С в термостате в темноте. Для создания условий светового стресса этиолированные проростки в течение 24 ч освещали светом 300 мкмоль квантов м-– с-– 1. Для того чтобы выяснить, может ли редокс-состояние хлоропластов являться пластидным сигналом при экспрессии гена Elip, мы использовали 3-(3’, 4’- дихлорфенил)- 1,1’ –диметилмочевину (DCMU; диурон; 120 мМ) – специфический ингибитор, блокирующий транспорт электронов от фотосистемы 2 к пулу пластохинонов (PQ), что предотвращает восстановление последнего. Проростки ячменя (Hordeum vulgare L.) выращивали при 20°С в водной культуре в темноте в течение 6 сут, затем переносили на раствор ингибитора - 120 мМ, опрыснув раствором DCMU той же концентрации. Затем проростки освещали светом 300 мкмоль квантов м-– 2 с– 1 в течение суток.

Содержание Mg-протопорфирина IX и его монометилового эфира определяли с помощью спектрофлуориметра RF-5301PC («Shimadzu», Япония). Длины волн возбуждения (Ex) и испускания (Em) флуоресценции составляли 420 и 598 нм, соответственно (Rebeiz et al., 1966; Rebeiz et al., 1975).

Геномную ДНК выделяли из контрольных проростков ячменя с помощью СТАВ-буфера и депротеинизации хлороформом.

Выделение РНК и нозерн-гибридизация. Суммарную РНК выделяли из контрольных и обработанных ингибиторами проростков ячменя с помощью фенольной депротеинизации.

Препараты тотальной РНК, фракционированные методом электрофореза в 1,5%-ном агарозном геле и окрашенные EthBr, переносили на нитроцеллюлозный фильтр с помощью капиллярного блоттинга и проводили нозерн-гибридизацию. Фильтр помещали в раствор для предварительной гибридизации, которую проводили в течение 2 ч в термостате при 42°С в присутствии 50%-ного формамида, 5 х раствора Денхарда (1 x Денхард : 0,02%-ный Фиколл, 0,02%-ный поливинилпирролидон, 0,02%-ный БСА), 5 x SSC (1 x SSC : 0,15 M NaCl, 0,015 M цитрат Na, pH 7,0), 1%-ного Ds-Na и 100 мкг/мл ДНК спермы лосося. Для обнаружения мРНК, кодируемой геном Elip, использовали пробы, полученные с помощью амплификации геномной ДНК ячменя. РНК-блоты гибридизовали с меченными [-32P]dATP ДНК-зондами. ДНК-зонды метили [-32P]dATP с помощью набора для случайного мечения праймеров («Random Primer», «СилексМ»; Россия). рРНК, окрашенные бромистым этидием, служили контролем, подтверждающим нанесение равных количеств суммарной РНК и эффективность последующего переноса РНК на мембрану. Для тестирования линейности ответа использовали несколько разных по времени экспозиций с пленкой. Радиоавтограммы фотографировали и анализировали с помощью видеосистемы “DNA Analyzer” и специализированного программного обеспечения “Gel Explorer” («Хеликон», Россия).

Амплификацию гена Elip проводили с помощью Tag-полимеразы («СилексМ», Россия) в соответствии с рекомендациями производителя. 30 мкл стандартной реакционной смеси содержали: 10 мМ Трис-HCl, рН 8,3; 50 мМ KCl; 2,5 мМ MgCl2; 1,5 мМ каждого из дезоксирибонуклеозидтрифосфатов («СилексМ», Россия); по 10 мкМ праймеров: 5'– TTGATTAATGGCGACCATGATG – 3' (прямой) и 5'– CACAACCTGTACTTAGCTAGTA – 3' (обратный); 10 нг ДНК-матрицы; 5 единиц Tag-полимеразы. Полимеразную реакцию проводили на многоканальном амплификаторе ДНК ТП-4ПЦР-01 «Терцик» (АО «ДНКТехнология»). Реакция протекала при следующих условиях: 1-ый цикл – 94°, 10 мин; циклов: 94°, 30 сек; 56°, 30 сек; 72°, 45 сек; последний цикл 72°, 5 мин. Продукты амплификации (ампликоны) разделяли с помощью электрофореза в 1,5%-ном агарозном геле, содержащем 1 х буфер ТАЕ (0,04 М трис-ацетат, 2 мМ ЭДТА) в присутствии EthBr при 100 В.

Фрагмент геля, содержащий необходимый ПЦР-продукт, вырезали, и ДНК экстрагировали с помощью набора «Выделение ДНК из агарозных гелей» («СилексМ», Россия). Путем секвенирования подтверждали идентичность ПЦР-продуктов.

В реакции обратной транскрипции, сопряженной с ПЦР (ОТ-ПЦР), матрицей служила суммарная РНК, выделенная из листьев ячменя, как описано выше. Обратную транскрипцию проводили согласно рекомендациям фирмы-изготовителя фермента, используя 100 ед.

обратной транскриптазы («СибЭнзим», Россия). Для подтверждения отсутствия примесей геномной ДНК в препаратах РНК проводили реакции без добавления обратной транскриптазы.

Проводили также обработку выделенной РНК ДНКазой. кДНК амплифицировали с помощью ПЦР с использованием специфических праймеров: 5'– CGAGCGCGACGAGTCCGA – 3' (обратный для кДНК), 5'– GCGGCTCGGCCCGGTCTCT – 3' (прямой для ПЦР-продукта), 5'– AGAGCTCCGCGTTGGCGTTCATG – 3' (обратный для ПЦР-продукта). В качестве гена для нормирования данных была исследована 18S рРНК с использованием специфических праймеров: 5'– AAGAAGCTAGCTGCGGAGGGATGG – 3' (обратный для кДНК), 5'– GACAGTCGGGGGCATTCGTATTTC – 3' (прямой для ПЦР-продукта), 5'– CCTGGTAAGTTTCCCCGTGTTGAG – 3' (обратный для ПЦР-продукта). ПЦР-продукты фракционировали с помощью электрофореза в 1,5%-ной агарозе.

Выделение пластид из проростков ячменя. Интактные пластиды выделяли из 200-400 г проростков ячменя и очищали с помощью центрифугирования в градиенте Перколла (Юрина и др.).

Выделение суммарных белков клетки. Для выделения суммарных белков 100 мг листьев гомогенизировали в жидком азоте, переносили в 1мл буфера, содержащего 12,5 мМ Tрис-HCl, pH 6,8, 2%-ный Ds-Na, 1 мМ ЭДТА, 6 мМ DTT и 10%-ный глицерин. Экстракт прогревали при 65°С в течение 15 мин и затем центрифугировали 15 мин при 18 000 g.

Концентрацию белка определяли по Лоури, и белки анализировали с помощью Ds-Na-ПААГ.

Pages:     || 2 | 3 | 4 |






© 2011 www.dissers.ru - «Бесплатная электронная библиотека»